User Manual
Contents
1. E a n a a a A n A ma A mae A s BA m A n AA ma A ma A ma B e AA a A mn D O D A A A A A A A A AA GAAGA GA GAA A D O D A A A A GA A A AAA GA AAGA GA AA A E a e n a a a A a A a A ma A mae A e BA ma A n AA ma A ma A m AA a AA a A mn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 a2 FPRoOUOCOOOOOGOG OOOO Ooo oot D O D A A A A GA A A A AA GAAGA GA AA AA D O D A A AA A GG A A GAA GA GA A AA D O D A A A A GA AA A GGA A GA GAA A AA H Z Relationship lines format each line indicates one relationship and its value between one pair of sequences For instance if sequence SID and sequence S D2 has a relationship value V the corresponding line should be SIDI SID2 V The separator can either be a Tab or any number of spaces SID1 and SID2 must be consistent with the ones in the Sequence Information script file Figure 5H A sample of Sequence Links script file Relationship lines format 1c 2 0 1687 jo J 0 173 lO 5 0 1887 yl T O 1956 10 id 0 1936 IO 15 0 1678 10 17 0 1701 j 18 0 2004 10 19 0 1784 i 2 0 2046 3 0 2209 i 4 0 2158 I 6 0 2076 1 2 0 1675 1 10 0 221 1 12 0 1673 1 13 O 2096 1 14 0 2159 1 LT 0 2201 1 19 0 219 2 z 0 2121 2 g 0 2146 2 11 0 2023 2 12 0 2262 2 16 0 225d The script file is text based and can be created and edited using any text processing tools or by simply pasting from some other software tools such as Excel Orgin Pro or Matlab It can be2. displays synchronously with the current sequence list window When a sequence is selected in the graph the corresponding item in the list window is highlighted and brought into view automatically which is useful for a user to check the detail information about the selected sequence Conversely sequence items in the list window are also clickable and selectable when an item is selected the corresponding vertex in the graph will be highlighted automatically and the drawing window will be scrolled if necessary to make a view of putting the vertex circle in the center This is very useful for a user to find out the vertex of a specific sequence in the graph from the detail list Figure 10H Details of sequences within the current category are list in the current sequence list window S ieee Vie eo Crore raul Jiliri 5691 7614 TAGTACAGCTGAATGAATCTGTAG 155 Jilin 5692 7615 No cr TAGTACAGCTGAATGAATCTGOTAA cd 156 Jilin 5693 7616 Ao 1998 TAGTACAGCTGAATGAATCTGOTAG ee 157 Jilin FBO4 7617 Mo 1998 TAGTACAGCTEAATGAATCTGOTAG 2159 Jilin 5695 7618 No 1995 TAGTACAGCTGAATGAATCTGTAG kd Category Category graph drawing The intra category graph shows sequences and their relationships within one category Another undirected graph is provided in SRD in the inter category drawing window with each category as a vertex to depict category category relationships The category category graph is somewhat different from the intra c
3. user steered object location Figure 7H A Categories Map and the categoriy hot spots on it 7 A af Guizhou 5 sequences lay ae a eal pr i T i 4 ETN eet Hongkong APE E DE ly Mi The Nansha Islands ly Categories are displayed graphically as a user defined beautiful picture Categories Map in the inter category drawing window The picture has a hot spot for each category which is also user defined When a user clicks one of these hot spots the corresponding category becomes the current category and SRD displays all the sequences of the category and their connections simultaneously in the intra category drawing window In intra category graphs each sequence is represented by an open circle except for the virtual ones which are displayed as black solid circles The number marked in the middle of the circle denotes the SID of each sequence For clarity only SID is printed in graphs other properties such as SeqID Caption sequence strings etc are not printed However full details are available in the current sequence list window On the other hand SRD provides a hot spot for each sequence vertex When a user s mouse moves onto a vertex circle the mouse pointer changes to the pointing finger shape and the cursor returns the SID SeqID and caption of the corresponding sequence in a ToolTip text box Figure 8H An intra category graph generated by SRD Guizhou DestI
4. CEGACCCAGAGATTETAATECACAGITTTTAATTETGCCACGEECAATTTTTETACTETAATACATCACARACTETTTAATAGT KLT ACTTECAATCATACTAGTACTTEGRATCATACTACAGCGAAATAGCAATATCACECTCCECTTECAGAATANAACAAAT TET ELi AAACATCTCCCACCAALTACCOCAAAGCAATETATOCCCOTCOCATICOACCACAAAT TAGATETTCATCARATAT TACAG sq GET TECTAT TAACAAGAGATEGTEGTAATARTGAGAACAAGACCACCGAGACCTTCAGACCTOGAGGAGL Si 155 5892 7615 Wir Ho 1998 sq TALTACARCTEAATC AATEC TC TARAAAT TAATTC TACAAGACCCAACAACAATACARCARACALTATACCTCTAGCACEA ELI DECCGARACCATGGTATACARAACACCACAAATAATACCACATATAACGACAACCACATTETAACETTAGTACAACAGAATDEAA ETI TAACALCTTTAGA AGATAACTGARAA TT ACAGAACAATTTEACAACAARACAATAATETTT ATCAATCITCADGAG sq CECACE TACAGAT TOCARATCCACAGTTT TART TET CEAGGEEAATITTTCTACTETAATACATCACAACTOCOITAATAGT Si AETTIEGAATEATACTALTACTICOCAATOATAATACALLAAATOACAATATECACGET ECCT TG CALRAATARALCAAAT Tis T ag AAACATETGECAGEAAGTAGEGARAGCAATETATECCCCTCCOCAT TGAAGEACAAAT TAGATGET TCATCARATATTACAG sq CET TGCTAT TAACAAGAGATERTGGCAT TART GAGA CGAGACCACCGAGACCTICATACCARGCAGEACE ZH 156 5603 7610 VireMo 1998 ELI TAGTACACCTGAATCAATCETETAGTAATTAATTETACAAGACCCAACAACAATACAACAARAAANGIATACTECTAGCACCAG sq CEARAACATEGTATGCCARCAGGACARAT AAT AGGARAT AT AAGACRAGCACATTGTAACAT TAG TAGAARAGCTIGOAAT sq AAAACTT TACAACACAT AAC TAAAAAAT TARGACRACAAT TI CCCAACARAACAATAATETT TARE CAACC TET ICOAGG ELI ACCGCACCCAGAGATTETAATCCACACGETTTAAT TET GCGACGOCEAATTTTTETACTETAATACATCACAACTGIT TAATA ETI GTACTTIGGAATFATACTAGTECT TGGAATGATACTACAGGAAATGACACTATCACGCTCCCTIGCAGAATARGACAARATT ELI G
5. CTAAACACCTEECADCAACTACCCRAACCAATETATECCECTECCATTACACCACTAHATTACATETECATCAAATAT TAC Sf ACEETTECTATTARDARDAGATOGIGGTOT TAA TOAARCCART AAT ACC ACCEACALL TT ICAGACC TGCALLAGG SH 157 5694 7617 Uir Ho 1998 3g TAG TACAGCT GAATGCARATCTETAGAAAT TAATTICTACAAGACCCAGCAACAATACAARGAAAARETATATCTCTAGEACCA Si aah aaa a as a Lal ees A text file generated by SRD is composed of different types of lines Types of lines Description DD Current dataset ID DstID CM Comments DT Date and time when generate this file CG Current category SH Sequence header a sequence description followed by lines of sequence data SQ Lines of sequence data LS The links is related to all sequence or to the selected sequence LH Link header a link description followed link information LK Link Information including the pair of two sequences with their relationship value End of file Splitting sub windows in different views The main GUI of SRD composed of several sub windows Users are enabled to drag the 16 common border of each two adjacent windows to resize each other If the dragging horizontal border up and down or dragging vertical border left and right the border s orientation can be Figure 21H Drag border to resize sub windows and re arrange windows layout Sequence relationship drawing File Edt Wew Help BBS BBO SS 123 ie ithe Category Figure 22H The border can be draged from vertical to horizontal to re arran
6. D total Mumdeqs 5 165 4626 6517 1998 The reticulate relationships between each pair of sequences are displayed as connection lines labeled with the relationship values at the middle of the line The minimum and the maximum relationship values are calculated and the corresponding connection line is drawn as red color and blue color respectively This is useful for the user to find out the minimum and the maximum relationship and acquire the value range at a glance Figure 9H Select a sequence and display edges separately in an intra category graph The sequence with SID 197 is selected in this example Jim DstID total Mumoeqs 5 197 S692 T615 1998 When there are a large number of sequences and a large number of relationship links connection lines will mix up together To overcome this problem separate edges displaying is supported in the system Any sequence can be selected by clicking on the corresponding vertex When a sequence is selected the corresponding vertex is highlighted with a particular color and edges only linked to the selected sequence are drawn other edges are omitted The minimum and the maximum relationship values are re calculated and colored lines are also re marked according to the current lines drawn When users click anywhere else of the graph all connection lines will display together again Which part of the edges to be displayed depends on the user s selection Furthermore sequence selection
7. Description 1 Dataset selector A drop down menu to select dataset to visualize 2 Zoom selector A drop down menu to set or return the zoom factor used for displaying all graphs 3 Inter category drawing Used for drawing category category relationships which window depicts Chinese province province relationships in this example since sequences in the dataset come from several different provinces in China 4 Current sequence list Lists all sequence within the current category window 5 Foreign sequence list Gives a list of all related sequences linked to the current window category or to the selected sequence 6 Intra category drawing The visualization graph for the current category window 7 Information window Dynamically displays the corresponding text information of all generated graphs at a time 8 Extra category A floating window to visualize another category related to drawing window the current category First use of SRD When the program is first started users will find a Start Wizard to quickly access general functions in the system Novice users should follow the steps and click the commands in the wizard window to perform their visualization To begin the visualization 1 In the first step partition your sequences dataset to several categories Input the CategoryID and the name of each category into the system Both the CategoryID and the name are strings no more than 50 characters However CategoryID
8. GGGGAATTTTIC TACTSTAATACATCAcKaC TG TTTaatagtacttggaatggtac tagt acttggaat jwatactacaggasatagcACtATcaAc G CTCCCTIGCAG AAT AAA ACA C ATTGTAAAcCATG TGGCAG GAAGT 4 GGG AAAGCCA ATG TATGCCCCTICCCATT aGacG4 cA saTTAcs TGOTTcATCA AATATT ACA GGOGTTG CT ATT AAC A AG AG ATG Tots T Ait Aa GAe AG cat T A cA ot Ar ACCT TIC AA4 CCT GG AGG A GG gt 156 TL 5693 talala 1998 TAG TAC Ag TTGAAtGAATCTG TAG TAAT TAAt TG TAC SAG A CCOCAACAACAATAC AAG A AAA AGC TATAC CTC TAGG AC CAGGGCAA GCATGOTATACAAT a CT ATG TAT AAS AC AAG CAC AT TO Taal T TAG Tag a0 ad AA TGGGATAACACTTTIA a c GATAAcTG add aaTT Ades s FAaldalTTagg aac AA dar AAT Aa tCT TI sa tCadTCT TCAGGAGGGGACCCAGAGATTO TAATGCACAGTGTTAATTIGNS GAGGGGAATTTTIC TACTGO TAATACATCAcKal TG TTaatagtacttggaatgataa tagt actt gzaat jaatactacaggagatagcAdtaATcac G CTICCCTTIGOAG AAT Aaa ae aa ATT Tad ac ATG TGC AGG AAG T 4 GGG AAAG CA ATG TATGCCCCICCCATTI aGAGGA c adTTAgA TGITICATCA AATATT ACA GGGTIG TAT TASC AAG AG ATGG TGGT JadGa AT s AG adr el eG AC CAC cG 4G ACC TTC AAd CC T 2G AGG AG SI57 TL 5694 761710 1998 TAG TAC Ag TTC AATGAATC TG TAG AMAT Tat To ae a a oe eae A BAA TAT AC ATCT AG AC The sequence ends if another line starting with a gt or end of file EOF appears The script file is text based and can be created and edited using any text processing tools or by simply pasting from some other software tools such as Excel Orgin Pro or Matla
9. ID can be the name or the database ID of the sequence e g a gi number of NCBI a PDBID of PDB database etc Is Virtual indicates it is a virtual sequence 1 or not O Caption is a text string that describe the sequence could also be none Other corresponding information can be included in the field Memo Figure 3H A sample of Sequence Information Script File gt 154 IL 5691 7614 0 1998 TAG TAC As TTC AAT GAA C TG TAG AA T Tut To a aie ee eT a A TAT AC ATCT AGG AC ICAGGGCAA GCATGGTATACAACAGGACAAATAATACGAGA TATAAGACHACCACATTGT Adc ATT AAT Ag s aC aa y TOS AAT AAcACTTTA aba cA GATAAcTG adds ATTA fA FAaCdalTTzeg aac AAA ar AATAL tI TT s4tCadTCT TCsAGGAGGGGACCCAGAGATTG TASTGCACAGTITTAATIGONG GAGGGGAATTTITIC TACTICI TACAT C ca Ts TT Tastagtacttgzgaataatac tagt acttggaat lgatactacaggagatagcAataTcaC G CTICCCTIGCAGAATAAAACAA ATTATAAACATG TGGCAG GAAGT 4 AGG ACAGCA ATG TATGCCCCTCCCAT T aGacGd cAsaTTaAgsa ToTTcATCA AATATT ACA GOGTTG pC TAT TAA A As ats 8 Tits Tots T T t AAt GA Wak aG Ar Ar ots AN ACC TCANA CCT GHAGGA GG r155 7L 5692 7615 0 1998 TAG TAC AgC TG AAtGAATC TG TAG AAT Tait TS TAC aA A CCC AAC AAC AAT AC A AAO TAT AC TCT AGG AC ICAGGGCAS GCATGG TATAC AAC AGG AC AA ATAATAGG AGA TATAAG AC AAGCACATTG Taact TT AGT Ag a AC aad a TGOGGATAScACTTT ada cA GATAAcTC ads AAT TAAA GAaldalTT ggg aac AS A AAT AA MCT TT AatCadTCT TCAGGAGGGGACCCAG AG ATTGTAATGCACAGTTTTAATIGTG GA
10. SRD User Manual Table of contents 1 Overview 2 First use of SRD 3 The Sequence Information Script File format 4 The Sequence Links Script File format 5 Import new data to visualize 6 Intra category graph drawing 7 Category Category graph drawing 8 Extra category graph drawing 9 Recursion extra intra categories 10 Fully customizable interface 11 Results Export 12 Splitting sub windows in different views Overview SRD Sequence Relationship Drawing program was developed in order to dynamically draw plane undirected graphs for a wide range of sequence relationship visualization analysis either for Figure 1H Overview of SRD main GUI window Sequence relationship drawing Ele Edt yew Hep et2 BEaUlis dD 1008 i z Ankeei H Includes 126 sequence ls All sequence Links Links in the Category Y 2S links in the Category nucleic acid sequences or for peptide sequences Categories analysis is also supported which allows visualizing intra category sequence relationships extra category sequence relationships and category category relationships in several specific windows respectively The following picture is the overview of SRD main GUI window The sample dataset used here is a dataset of China envelope glycoprotein env gene of HIV sequences derived from Chinese center for disease control and prevention The main GUI contains several sub windows Number Window
11. agged to anywhere in the main GUI of SRD It can be closed at any time by clicking the close button at the top right of the window Animation is used again when the window disappears as it returns to its corresponding category Recursion extra intra categories As mentioned above it is easy to view category category relationships and to generate an extra category graph However although clicking a sequence in an extra category graph can control edges displaying separately there is no effect on category category relationships and 12 foreign sequences which is different from selecting a sequence in an intra category graph This is because there can be only one current category at a time and category category relationships and foreign sequences are relative to the current category But sometimes one may concern about the category category relationships and foreign sequences relative to the extra category rather than current category when he is looking at an extra category graph The proposed software adopts an extra intra category transferring technique which have combined these three perspectives to create a highly integrated multi window visualization in the SRD environment This can be simply done by another mouse action double click A double click on one vertex in the extra category graph leads to a current category transferring The extra category drawing window is animated from big to sm
12. agging in this graph Click save button to save all the changes to the database To re arrange categories 1 e set categories hot spots click the Set Categories Coordinates button in the dialog Select a category in the list Then click mouse at somewhere in the picture map to set the center of the hot spot drag mouse to draw a proper circle to set the hot spot range for the category SRD allows importing a user defined available RTF Rich Text Format file into the system as a help document in which information appears as color coded text The RTF file can be generated by most word processing software such as Microsoft Word Windows WordPad Open Office etc and saved as a RTF file The RTF format help file can then be further imported using the Import help document function in the help menu The help document can be displayed in another window by clicking the help function in the help menu or press Ctrl F 1 Figure 20H A Help document displaying as RTF format Help document E loj x Sequence relationship drawing Help Document The Help Document is meant to be a very basic guide to help Flease edit your ow help document by a word processing software save as RIF format and click help import help document to import it to the system Results Export Finally for the purpose of input to other applications or the purpose of further analysis the capacity to output results is
13. all again but to disappear at the middle of the intra category drawing window which indicates that the current category now has become the one previously in the extra category window The double clicked sequence is then automatically selected in the now intra category graph All other windows are changed according to the new current category and the new selected sequence One may right click a related category again to open the extra category drawing window and double click a sequence in this window to make a second extra intra transferring Then right click another category and transfer again This recursion is helpful to trace a sequence relationship path between different categories especially in investigating a revolutionary path between different organisms or investigating a disease transmission path between different places Fully customizable interface To cater to the broadest array of biological scientists users the program is fully customizable for categories definition category category map picture all vertices locations and even help document Users can alter all these things using the update database dialog To open the Update database dialog click Update data command in the File menu 13 1 To edit categories definition click the Set Categories Coordinates button in the dialog A category list will be shown at the right bottom Click the Add or Delete button
14. ategory one although both of them are undirected graphs Firstly the fact that a category linked to another only denotes that there exists some relationships between the sequences within the two categories so we needn t define a category category relationship value and therefore no value will be labeled on the connection lines in the category category graph Moreover when drawing an intra category graph to illustrate sequence relationships within the current category at a larger scale the user will want Figure 11H A category category graph z Heilongjiang ks The Nansha Islands i i to see whether and how her current category are related to someone else At this scale in the category category graph it should be straightforward to display edges that only linked to the current category while other edges should be omitted at the moment for clarity In SRD when the current category is selected by clicking the corresponding hot spot in the Categories Map an intra category graph is generated and simultaneously edges linked to the current category are displayed as several red lines in the inter category drawing window At the same time the foreign sequence list window is also filled with some sequences which are called Foreign sequences since these sequences listed here denote that each of them is related at least to one of the sequences within the Current Category It is useful to get a detail list of
15. b It can be imported directly into the system by an interactive Import New data dialog provided by SRD which is activated by mouse clicks throughout the entire importing process An input module of the software will automatically detect the file formats and an internal syntax analyzer will give back any error information When the input process completes the parser recognizes the text and stores all the information into the computerized database along with the application The Sequence Links Script File format Users must create a Sequence Links script file that contains relationships between each two sequences Both the script files are text based and can be generated and edited using any text processing tools Sequence Links script file can adopt one of the following format Matrix format a nxn matrix separated by spaces in each line The separator can be one Space or several spaces or even Tab which is useful to load a table style text file Figure 4H A sample of Sequence Links script file Matrix format O 1667 0 173 O 0 2046 0 2208 _ a cr j mo cn Oy 2158 Pa m r oy 1675 el2l 0 2146 2261 2023 1T35 1686 1883 l dl 2203 2242 TT 2004 1655 0 194 1873 1899 1758 E a a n an a A a A n AA ma A mae AA ms BA m A n AA m AA ma A ma AA o AA a A mn E m a s A an a A a A n A ma A ma A os G ma A an AA me AA ma A m AA e A a AA mn
16. ei ks The Manaha Islands An extra category graph has most the same characteristics as an intra category one such as circular vertices connection lines hot spots etc Sequence vertices are also clickable to draw connection lines separately A special characteristic of an extra category graph is that vertices of all foreign sequences in this graph are filled with a particular color which denotes that there are some relationships between them and the current selected one Furthermore SIDs of related sequences and relationship values can be displayed in the prompt ToolTip text when mouse moving onto the foreign sequences vertices which allows a user to quickly get the information about which a colored sequence is linked to and how about the relationship values 11 Figure 15H An extra category graph Guizhou DetID total Mumseqs 5 Alternatively another way to open the extra category drawing window is to click one of the Figure 16H Cursor gives the linking information when mouse moves onto a foreign sequence vertex Guizhou Det D total Hurmsegs 5 166 48285 6517 1998 Links to the sequence 137 value 2045 in cluster Henan Mouble click to show outer cluster links items list in the foreign sequence list window In this way the drawing window will scroll automatically to make the selected sequence into view Moreover this window is a floating window which is always placed above and can be dr
17. essential The output layer is able to directly write contents in all list windows to files copy any graphs into the clipboard and save pictures as BMP bitmap image format files These can be done by a simple mouse right click in most windows of the main GUI and choosing the corresponding functions in the pop up menu To efficiently view the results generated by SRD text output is also supported as complementary to the graphical drawings A text file can be generated to describe current graphs 15 by clicking the Output Text Information function in the edit menu The text file is structured so as to be usable by human readers as well as by computer programs It is composed of different types of lines each with its own format which are used to record the various types of data Some files will not contain all of the line types and some line types may occur many times in another file this depends on the user s selection in graph drawing window A terminator line designates the end of the file Figure 21H An output text file generated by SRD oo HIY CH fy SRD Wer 3 7 DT 2010 3 31 13241 p2 CG all SH 15h 5691 7614 VYir Ho 1998 sg TAGTACAGCTGAATGARTCTGTAGAAAT TAATTEGTGCAAGACCCAARCAACARTACAARGAAAAARGTATACATCTAGGACCA sq CECCAAECATEGTATACARCALCACAARATAATAGCCACAT AT ARG ACAACCACATICTARCET TACT AGARCAAARAT OCA ELI TARCAC TT TRRRACACATAACTLEARRAAT T AACACAACAATT TCELAACAAAACAATAGTCIT TART CAR TET TEADEAG ETI
18. ge windows layout Sequence relationship drawing Fie Edt view Help abe BBL se Anhwei DetID HIY MumSeqs 126 Tues n the Cetageey 123 inks m the Category 17 changed from horizontal to be vertical or vice versa This can be used to re arrange the sub windows layout of SRD Figure 23H A new re arranged sub windows layout Sequence relationshep drawing aHee BG SO 18
19. imported directly into the system by an interactive Import New data dialog provided by SRD which is activated by mouse clicks throughout the entire importing process An input module of the software will automatically detect the file formats and an internal syntax analyzer will give back any error information When the input process completes the parser recognizes the text and stores all the information into the computerized database along with the application Import new data to visualize To start a sequence relationship visualization sequences and the relationship values between them must be imported into the system Users must create a Sequence Information script file that contains all sequences in the dataset and a Sequence Links script file that contains relationships between each two sequences Import both the script files using the Import New data dialog To open the Import New data dialog click Import New data command in the File menu Figure 6H The Import New Data dialog Import New Data eS x Import a new set of sequence relationships New DstlD Fiert import sequences Information noat include sequence coordinates Then import sequence links Sequence information file format SID must be range from zero to ni gt SID CategomlD SeglD leVirtual Caption Mera SSS EgUENTCES HMMA SMM DEgUENCES HMMM gt NextS equencel 2 Inport links seque
20. nce links file can be a matris file or adopt the Format below SID1 SIDS Relationship alue e g 1 27 0 0545 1 32 U 4r Close Click Import sequences command to import a Sequence Information script file Then click Import Links to import a Sequence Links script file Data set ID DstID will be asked when click the commands Please Input a string no more than 50 characters as your dataset ID The dataset ID you input must be consistent the same with the two askings when you click the two commands separately When the Sequence Links script file importing is complete graphs layout for all categories will be performed automatically automatically set vertices coordinates of all sequences Note 1 Before importing one must define all categories CategoryID and CategoryName And the CategoryID in a Sequence Information script file must be consistent with that defined before 2 When importing new data if a Data set ID DstID a user inputs already exists in the system the previous dataset will be overwritten And the system will ask the user if he want to do so Intra category graph drawing An intra category graph is used to depict all sequences and their connections within a category the current category Unlike some regular graph drawing software in which the location of an object is fixed SRD provides an interactive dynamic drawing by using a hot spot technique jointly with a
21. related sequences in other categories while visualizing an intra category relationship Figure 12H Foreign sequences are list in the foreign sequence list window arr distance Anhwel 305 1098 No Se eo Se aaa ae ee TEE 1385 1098 TAGTAC 234 Anhwei 1385 1098 Mo 2005 TAGTAL 157 8 295 Anhwei 1706 1254 No 2005 TAGTAL 158 28 2134 Guizhou 4827 6516 No 1998 TAGTAL 155 29 2141 Henan 5016 6663 No z002 TAGTAL 155 G4 Figure 13H The foreign sequence list is altered automatically when a sequence with SID 155 is selected by clicking the corresponding vertex in the intra category drawing window or clicking the corresponding item in the current sequence list window Sida distance 2134 Guizhou 452 6516 Nao 1955 TAGTAL 155 2141 Henan 5016 6663 No 2002 TAGTAL 155 7 There is also a mechanism to get extra connections separately i e to get extra connections only linked to the selected one sequence in the current category rather than all of them This can be simply done by selecting one sequence by clicking on the corresponding vertex in the intra category drawing window or clicking the corresponding item in the current sequence list window As mentioned in previous section this will lead to the selected sequence vertex to be highlighted and connection lines displayed separately in the intra category graph At the same time this will also affect extra connections Catego
22. ry category edges and foreign sequence list will also be altered automatically according to this selection Once again how extra connections are displayed depends on a user s selection Combining this feature with intra category graph provides a macroscopic understanding of sequence relationships Extra category graph drawing 10 Continue with the previous section when a user sees several red lines in the inter category drawing window hot spots of all linked categories are assigned a new functional property With mouse moving onto the hot spots users will find that the ToolTip has been changed by being added a new line of text Right click to depict sequences in related category which can not be found on normal category hot spots If a user right clicks one of them the extra category drawing window will be animated from small to big to become visible in the main GUI The animation indicates the opening of the right clicked category An extra category graph has been generated in this window in which sequences and the relationships between them in the right clicked category are illustrated just similar as that in an intra category one This is a particularly important point for interactive graphic displays which is useful for a user to visualize the detail foreign sequences and relationships in another related category Figure 14H Hot spots of all linked categories are assigned a new functional property f Heilongjiang b
23. should be unique If one would like to visualize all sequences as a whole 1 e not perform the partition into several categories he must also input one category 1 e partition all sequences into one group 2 Assign a unique zero based number to each of the sequence which is called SID number Then create a Sequence Information Script File to contain all sequences information and a Sequence Links Script File to contain the relationship values between each two sequences Import the two script files into the system using the Import New data dialog Figure 2H Start Wizard in SRD Start Wizard pin Pen mme mal melen m e e a la eee a a ao melee a a aama ee ala eea m a la ee ee es J Panien y your Sequences into several goupil Categories you don t want to do so please add only one category syelem to visualize Sel sequence vertex coordinates in each calegory To open the Import New data dialog click Import New data command in the File menu 3 This step is optional Manually rearranged the graph for each category by mouse dragging the sequence vertices to make the graphs more beautiful using the Update database dialog To open the Update database dialog click Update data command in the File menu 4 This step is optional To vividly depict different categories create a picture called Categorys Map using any image crea
24. tion and editing tools such as MS Paint Photoshop Fireworks etc in which each category has an icon on it Import the picture using the Update database dialog 5 This step is optional Using the Update database dialog again set hot spots for each category on the Categorys Map imported in the previous step Sample datasets are available on the website The Sequence Information Script File format Users must create a Sequence Information script file that contains all sequences in the dataset Sequence Information script file adopts a format as a FASTA file that begins with a single line description followed by lines of sequence data The description line is distinguished from the sequence data by a greater than gt symbol in the first column There should be no space between the gt and the first letter of the identifier The description line must exist for each sequence while the rest sequence data lines are optional The description line must adopt a specific format with several fields separated by a I character The format of the description line is as follows gt SID CategoryID SeqID Is Virtual Caption Memo Where fields in brackets are optional and can be omitted Each sequence must be assigned a unique zero based identifier number called SID And each category must also be given a string identifier a string not more than 50 characters which is called CategoryID The field Seq
25. to add a new category or delete the selected category in the list 2 To customize a category category map click Set Categories Map button in the dialog Choose a picture as the map Any picture with bmp jpg gif format is supported In the example we choose a China map as the category category map because we partition all the sequences to several Chinese provinces 3 To re arrange objects in each intra category graph or extra category graph click the Set Sequences Coordinates button in the dialog Then choose the dataset DstID and the category in the two drop down menus bellow The dialog presents the sequence list in the selected category and illustrates the undirected graph to users graphically All objects Figure 18H Re arrange objects in each intra category graph by mouse dragging Update database i 0 x Set Categories Map Set Categories Coordinates T E Y l 113 1799 1298 2005 2 links in the category Set Sequences Coordinates Drag to change DstlD HI Category AH Figure 19H Set hot spots for categories It is setting a hot spot for category Guangxi in this figure Set Categories Map Set Categones Coordinates Set Sequences Coordinates Cate X vy Anhwe 373 244 Guan 349 337 Gansu 193 152 Guag 298 336 Guz 280 302 Henan Saf Ze Hubei 333 258 Hebei 344 160 Hainan 312 a F Autos et Add Delete coordinates can then be adjusted by users mouse dr
Download Pdf Manuals
Related Search