SMARTer® Ultra Low RNA Kit for Illumina® Sequencing
Contents
1. 19 Table of Figures Figure B Protocol Overview E 5 Figure 2 Flowchart of SMARTer cDNA Synthesis esee enne tnnt enr etnn ennt testen nennen nne 6 Figure 3 Optional setup to ensure proper and steady positioning of tubes containing first strand cDNA 11 Figure 4 Electropherogram example results from Agilent 2100 Bioanalyzer eese rennen 14 Table of Tables Table 1 Sample Preparation Guidelines eese nennen eene nennen nene A SER E erinnerte nennen 9 Table 2 Cycling Guidelines Based on Amount of Starting Material eese ren enne 12 Table 3 Process Configuration Panel Set Up eee nennen tenete nnne nnne tnt ette entren en rennen enne 15 Table Validated Media isi T ENEE 17 Table 5 Troubleshooting Guide for SMARTer cDNA Synthesis amp Amplification eene 18 051013 www clontech com Page 2 of 19 Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Low RNA Kit for Illumina amp Sequencing User Manual l List of Components The following components have been specifically designed to work together and are optimized for this particular protocol Please do not make any substitutions The substitution of reagents in the kit and or a modification of the2. eese enne nne tnter rennen eren nnne 12 V Amplified cDNA Purification amp Validation cescesecsseceseeesseeeseeeseeeseecsaecaecsaeceaecesecsseeeseeseeeseaeeeaeeeneeeaaeenaees 13 A Protocol Purification of ds cDNA using SPRI Ampure Beads 0 00 ceeccescceeeeeseeeeeeeeeeeeaeeeaeecaaecaaecaeenaeceaeenaeeees 13 B Validation Using the Agilent 2100 BioAnalyzer eese nennen entren en rennen nennen 14 VI Coyaris SHANI G ERE 15 A Protocol Covaris Shearing of Full length cDNA 000 eec ce eeceessesssecsseceseceseceseesseeeseceseeseeeeeaeeeaeecaeecaaecsaecaeseaeseaeenseeees 15 VIL Appendix A PCR Clean Work Station Guidelines eese ener rennen eren 15 A Equipment Needed in the PCR Clean Work Station sees een een rennen rennen 15 B PCR Clean Work Station Operation Instructions isses enr enne 16 VIL Appendix B Working with Cells ene Geek repe tice erae a CEPR RR EDU EEYAEL eDe E ELCHE Rn PE ERE Red 17 A Protocol Screen for Cell Culture Media eeeceesscecsseeeeeeecoeecoeecseesseessecesecessecssseesscesacecaseecesecateceesoeesseesseetsoeteas 17 B Cell Preparation for First Strand cDNA Synthesis sessi ennt rennen rennen rennen 17 IX Appendix C PCR Optimization cinta Hee e e aiii Loa o eC LEUR e eu Euge 17 X Appendix D Troubleshooting Guide eene eme E EEEE eder det Ica Pn rona sa PE obe a tb ee ise nag 18 XI Dare e e
3. protocol may lead to unexpected results Box 1 634935 e 20 ul e Sul Box 2 634935 e 20 ul e 25 ul e 40 ul e 40 ul e 10 ul e 20 ul e imli e 55yl e imli e imli 634936 10 x 20 ul 5 ul 634936 200 ul 250 ul 400 ul 400 ul 100 ul 200 ul 10 ml 550 ul 10 ml 10 ml Storage Conditions SMARTer II A Oligonucleotide 12 uM 5 AAGCAGT GGTATCAACGCAGAGTACXXXXX 3 X undisclosed base in the proprietary SMARTer oligo sequence Control Total RNA 1 yg ul 3 SMART CDS Primer II A 12 uM S AAGCAGTGGTATCAACGCAGAGTACT g9 N_ N 3 N A C G or T N A G or C IS PCR Primer 12 uM 5 AAGCAGTGGTATCAACGCAGAGT 3 Please do not substitute The oligo has been modified 5X First Strand Buffer RNase Free 250 mM Tris HCI pH 8 3 375 mM KCI 30 mM MgCl dNTP Mix dATP dCTP dGTP and dTTP each at 10 mM Dithiothreitol DTT 100 mM SMARTScribe Reverse Transcriptase 100 U ul Nuclease Free Water RNase Inhibitor 40 U ul Dilution Buffer Purification Buffer 10 mM Tris Cl pH 8 5 e Store Control Total RNA and SMARTer IIA Oligonucleotide at 70 C e Store Dilution Buffer at 20 C Once thawed the buffer can be stored at 4 C e Store Purification Buffer at 20 C Once thawed the buffer can be stored at Room Temperature e Store all other reagents at 20 C 051013 www clontech com Page 3 of 19 Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Lo
4. Dilution Buffer with the RNase Inhibitor as indicated below scale up as needed 19 ul Dilution Buffer 1 ul RNase Inhibitor 20 ul Total Volume 2 See Table 1 for guidelines on setting up your control amp test samples Transfer each whole volume of 3 5 ul to individual 0 2 ml RNase free PCR tubes in an 8 well strip Table 1 Sample Preparation Guidelines Components Negative Control Positive Control Test Sample Reaction Buffer 2 5 ul 2 5 ul 2 5 ul Nuclease free water 1 ul Diluted Control RNA 1 ul Sample 1 ul Total Volume 3 5 ul 3 5 ul 3 5 ul The Control RNA is supplied at a concentration of 1 ug ul The Control RNA should be diluted in nuclease free water to match the concentration of your test sample Perform serial dilutions on the Control RNA until you obtain the appropriate concentration 3 Place the samples on a 20 C prechilled IsoFreeze PCR rack in a PCR clean station and add 1 ul of 3 SMART CDS Primer II A 12 uM Mix the contents and spin the tube s briefly in a microcentrifuge 3 5 ul Cell Total RNA in Reaction Buffer from Table 1 1ul 3 SMART CDS Primer II A 12 uM 4 5 ul Total Volume 4 Incubate the tube s at 72 C in a hot lid thermal cycler for 3 min and then put the samples on the IsoFreeze PCR rack NOTE The initial reaction steps Step 5 7 are critical for first strand synthesis and should not be delayed after Step 4 You can prepare your master mix for Step 5 while your tube
5. Kit 5 ml Beckman Coulter Part No A63880 60 ml Beckman Coulter Part No A63881 Use this kit for the SPRI Purifications Sections IV F amp V A MagnaBot II Magnetic Separation Device Promega Part No V8351 Use this stand for the first purification Section IV F Magnetic Stand 96 Ambion Part No AM10027 Use this stand for the second purification Section V A 96 well V bottom Plate 500 ul VWR Cat No 47743 996 MicroAmp Clean Adhesive Seal AB Part No 4306311 8096 Ethanol For Sequencing Library Generation Illumina Paired End DNA Sample Prep Kit Illumina Cat Nos PE 102 1001 amp PE 102 1002 Covaris Instrument and Related Materials for DNA Shearing 051013 www clontech com Page 4 of 19 Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Low RNA Kit for Illumina amp Sequencing User Manual lll Introduction SMARTer cDNA Synthesis for the lumina Sequencing Platform The SMARTer Ultra Low RNA Kit allows high quality cDNA synthesis starting from as little as 10 pg of total RNA or cells The kit has been designed and validated to prepare cDNA samples for sequencing and quantitation with the Illumina HiSeq amp and Genome Analyzer sequencing instruments The entire library construction protocol can be completed within two days see Figure 1 for an overview of the protocol SMART technology offers unparalleled sensitivity and unbiased amplification of cDNA transcripts enabling a direct start from yo
6. degraded or has impurities that inhibit the cDNA synthesis reaction If possible check RNA quality prior to cDNA synthesis Make sure RNA is good quality Certain tissues such as plants have a high level of polysaccharides that interfere with first strand synthesis Make sure to use appropriate RNA isolation kits for each given tissue species Low cDNA yield with the control RNA Control RNA is too diluted Make sure to use recently calibrated pipettes to accurately perform serial dilutions of the control RNA Prepare fresh dilutions of the Control RNA and try again Diluted RNA is less stable therefore avoid using previously diluted low concentration RNA samples CDNA was not efficiently bound to the SPRI beads during purification steps Make sure the SPRI beads are collected correctly on the magnetic stand and given enough time to completely separate the liquid phase Make sure not to disturb beads while removing the supernatant Repeat cDNA synthesis with the freshly diluted control RNA SPRI beads were overdried during purification of amplified cDNA Don t allow the post wash bead pellet to be overdried It s important to allow any residual ethanol to dry but overdrying too long or drying at a temperature higher than room temperature will make it difficult to elute the DNA from the beads Low cDNA yield with the experimental RNA but control is OK Insufficient amount of starting material or
7. resulting full length single stranded ss cDNA contains the complete 5 end of the mRNA as well as sequences that are complementary to the SMARTer Oligonucleotide In cases where the RT pauses before the end of the template the addition of non template nucleotides is much less efficient than with full length cDNA RNA hybrids thus the overhang needed for base pairing with the SMARTer Oligonucleotide is absent The SMARTer anchor sequence and the poly A sequence serve as universal priming sites for end to end cDNA amplification In contrast cDNA without these sequences such as prematurely terminated cDNAs contaminating genomic DNA or cDNA transcribed from poly A RNA will not be exponentially amplified However truncated RNAs with poly A tails that are present in poor quality RNA starting material will be amplified yielding shorter cDNA fragments Poly A RNA XXX 5 VP PSPSPS SP PPS poly A 3 g SMART CDS primer SMARTer II A Oligonucleotide First strand synthesis and tailing by RT DDD IIIS IVI IIIS L gt ponia 5 york YK Template switching and extension by RT 5 blocked primer Amplify cDNA by LD PCR with IS PCR primer Double stranded cDNA Figure 2 Flowchart of SMARTer cDNA synthesis The SMARTer II A Oligonucleotide 3 SMART CDS Primer II A and IS PCR Primer all contain a stretch of identical sequence see Section I for sequence information 051013 www clontech com Page 6 of 19 Clontech Laboratories Inc A
8. Clontech Laboratories Inc SMARTer Ultra Low RNA Kit for Illumina sequencing User Manual Cat Nos 634935 amp 634936 PT5163 1 051013 Clontech Laboratories Inc A Takara Bio Company 1290 Terra Bella Avenue Mountain View CA 94043 USA U S Technical Support tech clontech com United States Canada Asia Pacific Europe Japan 800 662 2566 1 650 919 7300 33 0 1 3904 6880 amp 81 0 77 543 6116 Page 1 of 19 SMARTer Ultra Low RNA Kit for Illumina amp Sequencing User Manual Table of Contents I Last of COMpPOne Dt EE 3 II Additional Materials Required i tiet ree te Feet iet EXER e rc Re e DOE egdassondyduersenddvedagehigesteesuisenee 4 III MACRO DUC ELON Cc 5 IV SMAR Ter CDNA Symth sis e 7 A Requirements for Preventing Contamination eese eene eene nnne enren retener sn trennen nenne 7 B G SITO EB rans ncc ETC 7 C Sample Recomrmiendations sodisce eenias I tea rt ure pepe ta eps rebut ente ives De pepe eeti dug aee ipa rus aut ase Do epa re va espe gebe 8 IEEE Eiern A 8 E Protocol First Strand cDNA Synthesis eese esee eene nnne enne enr en eret nr en tese sn tenete nne 9 F Protocol Purification of First Strand cDNA using SPRI Ampure Beads eere 11 G Protocol ds cDNA Amplification by LD PCR
9. RNA is degraded or has impurities that inhibit the cDNA synthesis reaction If more RNA sample is available quantitate RNA prior to cDNA synthesis Follow PCR cycle guidelines appropriate for the starting amount of sample you are using Xl References Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Chenchik A Zhu Y Diatchenko L Li R Hill J amp Siebert P 1998 Generation and use of high quality cDNA from small amounts of total RNA by SMART PCR In RT PCR Methods for Gene Cloning and Analysis Eds Siebert P amp Larrick J BioTechniques Books MA pp 305 319 Kellogg D E Rybalkin L Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TaqStart Antibody Hot start PCR facilitated by a neutralizing monoclonal antibody directed against Tag DNA polymerase BioTechniques 16 1134 1137 Contact Us Customer Service Ordering Technical Support tel 800 662 2566 toll free tel 800 662 2566 toll free fax 800 424 1350 toll free fax 650 424 1064 web www clontech com web www clontech com e mail orders 9 clontech com e mail tech clontech com Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in
10. Takara Bio Company SMARTer Ultra Low RNA Kit for IIlumina Sequencing User Manual SMARTer cDNA Synthesis NOTE Please read the entire protocol before starting This protocol is optimized for the generation of cDNA starting from ultra low amounts of total RNA using Clontech s SMART technology The protocol also works starting from cells Due to the sensitivity of the protocol the input material total RNA or cells needs to be collected and purified under clean room conditions to avoid contamination The whole process of SMARTer cDNA Synthesis should be carried out in a PCR Clean Work Station under clean room conditions see Appendix A PCR Clean Work Station Guidelines A Requirements for Preventing Contamination Before you set up the experiment make sure you have two physically separated work stations The first should be the PCR Clean Work Station see Appendix A for all Pre PCR experiments that require clean room conditions such as first strand cDNA synthesis Section IV E and purification of first strand cDNA Section IV F The second work station can be in the general laboratory where you will perform PCR measure cDNA concentration and work on any other experiments involving the PCR amplified cDNA It is absolutely required to have a PCR work station in a clean room with positive air flow as contamination may occur very easily Once contamination occurs it can be difficult to remove You need to strictly follow the clean
11. at No 9036 PCR Clean Work Station Operation Instructions IMPORTANT At the beginning of each section of the protocol listed below be sure to put on a clean pair of gloves and sleeve covers then turn on the light and blower on the PCR clean station and lift the cover window Bring a clean trash bag into the PCR clean station as well as two pieces of kimwipes to cover the work area When done using the PCR Clean Work Station after Section IV G wipe the working area dry with Kimwipes and clean with 70 EtOH Once a week clean the working area with DNA OFF Solution Clean Work Station Instructions for First Strand cDNA Synthesis Section IV E 1 Bring the IsoFreeze PCR Rack and the Flipper Rack containing the SMARTer cDNA synthesis reagents from the 20 C freezer to the PCR clean work station and put them on top of the kimwipes Take the cell or RNA samples from 80 C and put them on the IsoFreeze PCR Rack in the PCR clean work station Set up the cDNA synthesis reaction s and put the sample s in the PCR thermal cycler for cDNA synthesis Place all the used tips and tubes in a trash bag remove from the PCR clean work station and dispose Put the IsoFreeze PCR Rack and the Flipper Rack containing the SMARTer cDNA synthesis reagents back in the 20 C freezer Close the cover window of the PCR clean work station leave the blower on and dispose of gloves and sleeve covers Clean Work Station Instructions for Purifi
12. cation of fs cDNA amp LD PCR Sections IV F amp IV G 1 Bring the Ampure XP beads from 4 C to the PCR clean work station Aliquot the beads into 2 tubes one for the first strand cDNA purification Section IV F and one for the PCR product purification Section V A prior to the experiment to avoid a cross contamination Bring the IsoFreeze Flipper Rack containing the SMARTer PCR reagents from the 20 C freezer to the PCR clean work station and put it on top of the kimwipes Set up the PCR reactions Take the PCR reaction tubes out of the PCR clean work station and perform PCR in a thermal cycler in the general lab Place used tips and tubes in a trash bag remove from the PCR clean work station and dispose Put the IsoFreeze Flipper Rack containing the SMARTer PCR reagents back in the 20 C freezer and put the Ampure XP beads back in the 4 C refrigerator Close the cover window of the PCR clean work station Turn off the light and blower and turn on the UV light 051013 www clontech com Page 16 of 19 Clontech Laboratories Inc A Takara Bio Company VIII SMARTer Ultra Low RNA Kit for IIlumina Sequencing User Manual Appendix B Working with Cells A X Protocol Screen for Cell Culture Media Important When working with cultured cells you need to ensure that the cell culture medium does not inhibit first strand cDNA synthesis Therefore it is important to select a medium with the least inhibitory effect We r
13. col First Strand cDNA Synthesis If you will not be performing cDNA synthesis immediately store the tube on dry ice or at 80 C until use Appendix C PCR Optimization If you have a sufficient amount of starting material 21 ng total RNA we recommend optimizing the PCR cycling parameters for your experiment If you have a very limited amount of material or your sample is unique use a similar source of RNA or cells to perform PCR cycle optimization prior to using the actual sample Choosing the optimal number of PCR cycles ensures that the ds cDNA will remain in the exponential phase of amplification When the yield of PCR products stops increasing with more cycles the reaction has reached its plateau Overcycled cDNA can result in a less representative sample Undercycling on the other hand results in a lower yield of cDNA The optimal number of cycles for your experiment is one cycle fewer than is needed to reach the plateau Be conservative when in doubt it is better to use fewer cycles than too many 051013 www clontech com Page 17 of 19 Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Low RNA Kit for IIlumina Sequencing User Manual To perform PCR cycle optimization prepare several tubes containing an amount of RNA equal to your sample amount Subject each tube to a different range of cycles For example if you have 1 ng of RNA subject one tube to the recommended a number of cycles Subject the other two tube
14. directly used for PCR amplification NOTES e Before use beads should be brought to room temperature and mixed well to disperse e Jn order to ensure proper and steady positioning of the tubes containing first strand cDNA from Protocol E you may place the tubes in the top part of an inverted P20 or P200 Rainin Tip Holder which is taped to the MagnaBlot II Magnetic Separator Figure 3 Optional setup to ensure proper and steady positioning of tubes containing first strand cDNA To purify the SMART cDNA from unincorporated nucleotides and small 0 1 kb cDNA fragments follow this procedure for each reaction tube 1 Add 25 ul of SPRI Ampure XP beads to each sample using a 200 ul pipetter Adjust the pipetter to 35 ul and pipette the entire volume up and down 10 times to mix thoroughly The beads are viscous suck the entire volume up and push it out slowly Incubate at room temperature for 8 minutes to let DNA bind to the beads Briefly spin the sample tubes to collect the liquid from the side of the wall Place the sample tubes on the Promega MagnaBot II Magnetic Separation Device for 5 min or longer until the solution is completely clear While samples are still on the Magnetic Separation Device pipette out the solution and discard Briefly spin the tubes to collect the liquid at the bottom Place the tubes back in the Promega MagnaBot II Magnetic Separation Device for 2 min or longer to let beads separate from the liquid comple
15. drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without prior written approval of Clontech Laboratories Inc Your use of this product is also subject to compliance with any applicable licensing requirements described on the product s web page at http www clontech com It is your responsibility to review understand and adhere to any restrictions imposed by such statements Illumina Genome Analyzer HiSeq HiScan and HiScanSQ are registered trademarks or trademarks of Illumina Inc Takara the Takara logo and DNA OFF are trademarks of TAKARA HOLDINGS INC Kyoto Japan Clontech the Clontech logo Advantage SMART SMARTer and SMARTScribe are trademarks of Clontech Laboratories Inc All other marks are the property of their respective owners Certain trademarks may not be registered in all jurisdictions Clontech is a Takara Bio Company 2013 Clontech Laboratories Inc This document has been reviewed and approved by the Clontech Quality Assurance Department 051013 www clontech com Clontech Laboratories Inc A Takara Bio Company Page 19 of 19
16. e plate at room temperature for 3 5 min until the pellet appears dry You may see a tiny crack in the pellet NOTE If you over dried the beads you will see many cracks in the pellet If it is under dried the DNA recovery rate will be lower because of the remaining Ethanol Once the beads are dried add 12 ul of Purification Buffer to cover the beads Remove the plate from the magnetic stand and incubate at room temperature for 2 min to rehydrate Mix the pellet by pipetting up and down 10 times to elute DNA from the beads then put the plate back on the magnetic stand for 1 minute or longer until the solution is completely clear Transfer clear supernatant containing purified cDNA from each well to a nuclease free nonsticky tube Label each tube with sample information and store at 20 C 051013 www clontech com Page 13 of 19 Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Low RNA Kit for Illumina amp Sequencing User Manual B Validation Using the Agilent 2100 BioAnalyzer 1 Aliquot 1 ul of the amplified cDNA for validation using the Agilent 2100 BioAnalyzer and the High Sensitivity DNA Chip from Agilent s High Sensitivity DNA Kit Cat No 5067 4626 See the user manual for the Agilent High Sensitivity DNA Kit for instructions 2 Compare the results for your samples amp controls see Figure 4 to verify whether the sample is suitable for further processing Successful cDNA synthesis and amplification shou
17. ecommend testing your cells compatibility with the media listed in Table 4 These media have been tested with this protocol Table 4 Validated Media Superblock Pierce Cat No 37515 0 1 ml of DMEM F12 Glutamax Invitrogen Cat No 10565 3 6 ul of 25 BSA Invitrogen Cat No A10008 01 For 1 L of PBS Buffer 0 2 micron filtered 0 2 g of KCI 0 24 g of KH PO anhydrous 8 00 g of NaCl 1 44 g of NasHPO anhydrous add dH O to 1 L B Cell Preparation for First Strand cDNA Synthesis Important The cDNA synthesis protocol has been tested with suspension cells without internal labeling Any cell that has gone through fixation won t work the RNA won t release efficiently 1 Pick cell s in 1 ul of validated media see Section A Screen for Cell Culture Media and then transfer to a 0 2 mL RNase free PCR tube containing 2 5 ul of Reaction Buffer Put the tube s on dry ice immediately NOTES e The total volume of suspended cells should not exceed 1 2 tl If necessary you can spin down your cells and resuspend them in Reaction Buffer e Ifyou choose to transfer your cell s in 2 ul of media you need to use double the amount of Reaction Buffer 5 ul You must also double the volumes for all of the components in the first strand synthesis reaction Section IV E Steps 1 6 as well as double the volume of beads for the first SPRI purification Section IV F Step 1 2 Proceed with Section IV E Proto
18. ells 13 100 pg 10 cells 15 10 pg 1 cell 18 1 Prepare a PCR Master Mix for all reactions plus one additional reaction Combine the following reagents in the order shown then mix well by vortexing and spin the tube briefly in a microcentrifuge 5byl 10X Advantage 2 PCR Buffer 2ul dNTP Mix 10 mM 2ul IS PCR Primer 12 uM 2ul 50X Advantage 2 Polymerase Mix Nuclease Free Water Total Volume per reaction 2 Add 50 ul of PCR Master Mix to each tube containing DNA bound to the beads from Section IV F Step 4 Mix well and briefly spin down Important Transfer the samples from the PCR Clean Work Station to the general lab All downstream processes will be performed in the general lab 3 Place the tube in a preheated thermal cycler with a heated lid Commence thermal cycling using 3 the following program 95 C 1 min X cycles uH 95 15sec 65 30sec 68 C 6min 72 C 10 min 4 C forever Consult Table 2 for guidelines Determine the optimal number of PCR cycles using the protocol in Appendix C PCR Optimization Page 12 of 19 051013 www clontech com Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Low RNA Kit for Illumina amp Sequencing User Manual V Amplified cDNA Purification amp Validation A Protocol Purification of ds cDNA using SPRI Ampure Beads PCR amplified cDNA is purified by immobilizing it onto SPRI beads The beads are then washed with 80 Ethanol and eluted in Pur
19. he resulting DNA will be in the 200 500 bp size range 1 CO n oO Wu Turn power ON for the Covaris system and the main cooler Add about 1 9 L of distilled or deionized water to the water bath The water level in the cooler should be within 3 mm of the FULL waterline when the transducer is submerged If needed add distilled or deionized water to the water bath until the FULL line is reached Important Never run a process without the water bath This will permanently damage the transducer Close the door and open the Sonolab software Click ON for the degassed button and degas the water bath for 2 hour 30 minutes Add 65 ul of Purification Buffer to the DNA from Section V A Step 12 Transfer 75 ul of the Purification Buffer DNA mixture into the 100 ul Covaris tube Put the sample tubes into the appropriate location on the Sample holder Set up the process configuration panel based on the following table Table 3 Process Configuration Panel Set Up Duty Intensity Burst Cycle Time min Mode 10 5 200 5 min Frequency Sweeping Save the file and click return to go back to the main page Open the door Place the tube holder with sample tubes on the transducer positioning system Close the door Click START on the main page to run the process After shearing is complete transfer 75 ul of sheared DNA to 1 5 ml tubes Proceed to generate an Illumina Sequencing Library w
20. ification Buffer 1 10 11 12 Take out a 96 well Axygen V bottom plate and cover all the wells with a MicroAmp Clean Adhesive Seal Uncover only the wells that you want to use Vortex SPRI beads till even and then add 90 ul of SPRI Ampure XP Beads to the wells of the 96 well plate Transfer the entire PCR product including the SPRI beads from Section IV G Step 3 to the wells of the plate containing the SPRI beads from Step 1 above Pipette the entire volume up and down 10 times to mix thoroughly Incubate at room temperature for 8 min to let the DNA bind to the beads NOTE The beads are viscous suck the entire volume up and push it out slowly Place the 96 well plate on the Ambion Magnetic Stand 96 for 5 min or longer until the liquid appears completely clear and there are no beads left in the supernatant While the plate is sitting on the magnetic stand pipette out the supernatant Keep the plate on the magnetic stand Add 200 ul of freshly made 80 Ethanol to each sample without disturbing the beads to wash away contaminants Wait for 30 seconds and carefully pipette out the supernatant DNA will remain bound to the beads during the washing process Repeat Step 5 one more time Seal the sample wells on the plate and briefly spin down for 10 seconds at 1 000 rpm to collect the liquid at the bottom of the well Place the 96 well plate on the magnetic stand for 30 seconds then remove all the remaining Ethanol Place th
21. ith the Illumina Paired End DNA Sample Prep Kit Illumina Cat Nos PE 102 1001 amp PE 102 1002 Dispose all tubes and pipettes that have been exposed to amplicons in a sealed trash bag Appendix A PCR Clean Work Station Guidelines A Equipment Needed in the PCR Clean Work Station IMPORTANT The following equipment must be kept in the PCR Clean Work Station only Don t share any equipment reagents between the clean room and the general lab You can only move materials supplies from the clean room to the general lab NOT the other way around Do not use equipment from the general lab for the portions of the protocol that require a PCR Clean Work Station e Single channel pipette 10 ul 20 ul and 200 yl one each e Eight channel pipette 20 ul and 200 ul one each e Filter pipette tips 10 ul 20 ul and 200 ul one box each e One dedicated PCR thermal cycler used only for first strand synthesis e One QuickSpin minicentrifuge for 1 5 ml tube amp one QuickSpin minicentrifuge for 0 2 ml tube e MagnaBot II Magnetic Separation Device Promega Part No V8351 e One marker pen 051013 www clontech com Page 15 of 19 Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Low RNA Kit for IIlumina Sequencing User Manual Small 1 5 ml tube rack Small bottle of nuclease free water One bag of 1 5 ml nuclease free tubes One bag of 8 strip nuclease free 0 2 ml thin wall PCR tubes with caps DNA OFF Solution Takara C
22. ld yield no product in the negative control Figure 4 Panel B and a distinct peak spanning 400 bp to 9000 bp peaked at 2000 bp for the control RNA sample Figure 4 Panel A yielding approximately 2 7 ng of cDNA depending on the input Contaminated samples will have a broader peak and abnormally high yield Figure 4 Panel C 3 Proceed to Section VI Covaris Shearing Positive Control RNA Negative Control 100pg 15cyc nc 18 Sloe hia eve ei EE EEEEEECIT 35 100 200 300 400 500 700 2000 10380 bp 35 100 300 400 600 1000 3000 10380 bp Contaminated Sample FU 4 sample 3 35 100 200 300 400 600 1000 3000 10380 bp Figure 4 Electropherogram example results from Agilent 2100 Bioanalyzer All samples were subjected to SMARTer cDNA synthesis and amplification as described in the protocol FU fluorescence absorption units Panel A top left Clean SMARTer Amplification Product 15 PCR cycles Panel B top right Clean SMART Negative Control 18 PCR cycles Panel C bottom Example of Contaminated SMARTer Amplification Product 051013 www clontech com Page 14 of 19 Clontech Laboratories Inc A Takara Bio Company VI VII SMARTer Ultra Low RNA Kit for Illumina amp Sequencing User Manual Covaris Shearing A Protocol Covaris Shearing of Full length cDNA Prior to generating the final library for Ilumina sequencing the Covaris AFA system is used for controlled DNA shearing T
23. nd protocol If you are using this protocol for the first time we strongly recommend that you perform negative and positive control reactions to verify that kit components are working properly 051013 www clontech com Page 7 of 19 Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Low RNA Kit for Illumina amp Sequencing User Manual Sample Recommendations The sequence complexity and the average length of SMARTer cDNA is noticeably dependent on the quality of starting RNA material Due to the limiting sample size most traditional RNA isolation methods may not be applicable There are several commercially available products that enable purification of total RNA preparations from extremely small samples e g Clontech offers the NucleoSpin RNA XS Kit Cat No 740902 10 for purification of RNA from 10 cells When choosing a purification method kit ensure that it is appropriate for your sample amount Though SMART Technology is sensitive enough to generate cDNA from as little as 10 pg of total RNA the use of a higher amount of starting material 100 pg to 10 ng is recommended for reproducible amplification of low abundance mRNA transcripts After RNA extraction if your sample size is not limiting we recommend evaluating total RNA quality using the Agilent RNA 6000 Pico Kit Cat No 5067 1513 Sample Requirements Total RNA This protocol has been optimized for cDNA synthesis starting from 10 pg of total RNA Ho
24. re avoid using previously diluted low concentration RNA samples cDNA synthesis reaction failed Carefully check the protocol and make sure all components are added in a right order Failure of any components of the reaction will result in a failed cDNA synthesis Make sure to prepare all the necessary items prior cDNA synthesis and to spin down tubes prior opening them Do not delay cDNA synthesis reaction after RNA is denatured to jump start cDNA synthesis PCR failed Make sure to use the recommended PCR enzyme Before using the PCR enzyme check it with previously tested primers and template cDNA was not efficiently bound to the SPRI beads during purification steps Make sure beads are mixed correctly after adding them to DNA samples Vortexing the beads once they are added to samples can shear the DNA or break it free from the beads Make sure the SPRI beads are collected correctly on the magnetic stand and given enough time to completely separate the liquid phase Make sure not to disturb the beads while removing the supernatant Supernatant that is not completely removed from SPHI beads may inhibit downstream reactions 051013 www clontech com Clontech Laboratories Inc A Takara Bio Company Page 18 of 19 SMARTer Ultra Low RNA Kit for IIlumina Sequencing User Manual Problem Cause Solution No cDNA yield with the experimental RNA but control is OK RNA is low quality
25. room operation rules i e you can only move materials supplies from the clean room to the general lab NOT the other way around Don t share any equipment reagents between the clean room and the general lab You need a separate PCR machine inside the PCR workstation for cDNA synthesis Wear gloves and sleeve covers throughout the procedure to protect your RNA samples from degradation by contaminants and nucleases Be sure to change gloves and sleeve covers between each section of the protocol B General Requirements The success of your experiment depends on the quality of your starting sample of RNA Prior to cDNA synthesis please make sure that your RNA is intact and free of contaminants The assay is very sensitive to variations in pipette volume etc Please make sure all your pipettes are calibrated for reliable delivery and make sure nothing is attached to the outside of the tips All lab supplies related to SMARTer cDNA synthesis need to be stored in a DNA free closed cabinet Reagents for SMARTer cDNA synthesis need to be stored in a freezer refrigerator that has not previously been used to store PCR amplicons Add enzymes to reaction mixtures last and thoroughly incorporate them by gently pipetting the reaction mixture up and down Do not increase or decrease the amount of enzyme added or the concentration of DNA in the reactions The amounts and concentrations have been carefully optimized for the SMARTer amplification reagents a
26. s are incubating Step 4 in order to jump start the cDNA synthesis 051013 www clontech com Page 9 of 19 Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Low RNA Kit for Illumina amp Sequencing User Manual Meanwhile prepare a Master Mix for all reactions plus one by combining the following reagents in the order shown at room temperature 2ul 5X First Strand Buffer 0 25 ul DTT 100 mM 1 ul dNTP Mix 10 mM 1 ul SMARTer IIA Oligonucleotide 12 uM 0 25 ul RNase Inhibitor 1 ul SMARTScribe Reverse Transcriptase 100 U 5 5 ul Total Volume added per reaction Add the reverse transcriptase to the master mix just prior to use Mix well by gently vortexing and spin the tube s briefly in a microcentrifuge Add 5 5 ul of the Master Mix to each reaction tube from Step 4 Mix the contents of the tube s by gently pipetting and spin the tube s briefly to collect the contents at the bottom Incubate the tubes at 42 C for 90 min Terminate the reaction by heating the tube s at 70 C for 10 min 051013 www clontech com Page 10 of 19 Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Low RNA Kit for Illumina amp Sequencing User Manual F Protocol Purification of First Strand cDNA using SPRI Ampure Beads Perform in PCR Clean Work Station The first strand cDNA selectively binds to SPRI beads leaving contaminants in solution which is removed by a magnetic separation The beads are then
27. s to 2 3 cycles fewer or more than the first tube i e 15 12 recommended for 1 ng and 10 cycles 1 Use the following program for thermal cycling 95 C 1 min X cycles uu 95 15sec 65 30sec 68 C 6min 72 C 10 min 4 C forever 2 Perform Purification of ds cDNA using SPRI Ampure Beads Section V A 3 Run samples on an Agilent High Sensitivity DNA Chip using the Agilent 2100 Bioanalyzer to evaluate DNA output See the user manual for the Agilent High Sensitivity DNA Kit for instructions 4 Determine the optimal number of cycles required for each experimental and control sample We recommend using the lowest PCR cycle number that generates enough material for Illumina library construction 5 Apply the optimal number of PCR cycles to your sample material X Appendix D Troubleshooting Guide Table 5 Troubleshooting Guide for SMARTer cDNA Synthesis amp Amplification Problem Cause Solution No cDNA yield with the control RNA Control RNA is degraded The control RNA is vigorously tested for RNase contaminations and provided in high concentrations 1 ug ul to reserve its integrity It is essential that any item that could contact the control RNA is RNase free Control RNA is too diluted Make sure to use recently calibrated pipettes to accurately perform serial dilutions of the control RNA Prepare fresh dilutions of the Control RNA and try again The diluted RNA is less stable Therefo
28. tely Pipette out the residual liquid from the beads using a 10 ul pipetter and discard Make sure that there is no supernatant remaining in the tube Be careful not to take out any beads with the supernatant 051013 www clontech com Page 11 of 19 Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Low RNA Kit for Illumina amp Sequencing User Manual G Protocol ds cDNA Amplification by LD PCR Perform steps 1 amp 2 in PCR Clean Work Station We strongly recommend use of the Advantage 2 PCR Kit Cat Nos 639206 amp 639207 for PCR amplification The Advantage 2 Polymerase Mix has been specially formulated for efficient and accurate amplification of cDNA templates by long distance PCR LD PCR Barnes 1994 Table 2 provides guidelines for optimizing your PCR depending on the amount of total RNA used in the first strand synthesis IMPORTANT Optimal parameters may vary with different templates and thermal cyclers To determine the optimal number of cycles for your sample and conditions we strongly recommend that you perform a range of cycles Do not exceed the recommended cycle numbers in the table below for different starting amounts of material Refer to Appendix C for PCR optimization guidelines Table 2 Cycling Guidelines Based on Amount of Starting Material Input Amount Input Amount Typical No of Total RNA Cells PCR Cycles 10 ng 1 000 cells 12 1 ng 100 cells 12 500 pg 50 c
29. ur sample Most importantly SMART technology enriches for full length transcripts and maintains the true representation of the original mRNA transcripts these factors are critical for transcriptome sequencing and gene expression analysis Start with Total RNA or Cells Section IV C SMARTer First strand cDNA Synthesis amp Purification Sections IV E amp IV F Full Length ds cDNA Amplification by LD PCR Section IV G Amplified cDNA Purification amp Valdation Sections V A amp V B Covaris Shearing of Full Length cDNA Section VI ouo Aeg Library preparation using an Illumina Platform Specific Kit om eq Cluster Generation Figure 1 Protocol Overview 051013 www clontech com Page 5 of 19 Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Low RNA Kit for Illumina amp Sequencing User Manual SMARTer cDNA synthesis starts with picogram amounts of total RNA A modified oligo dT primer the SMART CDS Primer primes the first strand synthesis reaction Figure 2 When SMARTScribe Reverse Transcriptase reaches the 5 end of the mRNA the enzyme s terminal transferase activity adds a few additional nucleotides to the 3 end of the cDNA The carefully designed SMARTer Oligonucleotide base pairs with the non template nucleotide stretch creating an extended template to enable SMARTScribe RT continue replicating to the end of the oligonucleotide Chenchik et al 1998 The
30. w RNA Kit for IIlumina Sequencing User Manual Il A Additional Materials Required The following reagents are required but not supplied These materials have been validated to work with this protocol Please do not make any substitutions because you may not obtain the expected results Single channel pipette 10 ul 20 ul and 200 ul one each Eight channel pipette 20 ul and 200 ul one each Filter pipette tips 10 ul 20 ul and 200 ul one box each One QuickSpin minicentrifuge for 1 5 ml tubes One QuickSpin minicentrifuge for 0 2 ml tubes One marker pen Small 1 5 ml tube rack One bag of 8 strip nuclease free 0 2 ml thin wall PCR tubes with caps DNA OFF Solution Takara Cat No 9036 For PCR Amplification amp Validation One dedicated PCR thermal cycler used only for first strand synthesis Advantage 2 PCR Kit Cat Nos 639206 amp 639207 This kit has been specially formulated to provide automatic hot start PCR Kellogg et al 1994 and can efficiently amplify full length cDNAs with a significantly lower error rate than that of conventional PCR Barnes 1994 High Sensitivity DNA Kit Agilent Cat No 5067 4626 IsoFreeze Flipper Rack MIDSCI Cat No TFL 20 IsoFreeze PCR Rack MIDSCI Cat No 5640 T4 Nuclease free thin wall PCR tubes 0 2 ml USA Scientific Cat No 1402 4700 Nuclease free nonsticky 1 5 ml tubes USA Scientific Cat No 1415 2600 For SPRI Bead Purification Agencourt AMPure PCR Purification
31. wever if your RNA sample is not limiting we recommend that you start with more total RNA up to 10 ng Purified total RNA should be in nuclease free water If the total RNA volume is larger than 1 ul perform ethanol precipitation and resuspend the pellet in 1 ul of nuclease free water Cells Although this protocol was optimized for cDNA synthesis starting from total RNA the protocol has also been validated to work starting from cells See Appendix B Working with Cells for instructions on selecting the appropriate media and preparing your cells for first strand cDNA synthesis 051013 www clontech com Page 8 of 19 Clontech Laboratories Inc A Takara Bio Company SMARTer Ultra Low RNA Kit for IIlumina Sequencing User Manual E Protocol First Strand cDNA Synthesis Perform in PCR Clean Work Station IMPORTANT To avoid introducing contaminants to your RNA sample the first part of the cDNA synthesis protocol Sections E G requires use of a PCR work station in a clean room Standard clean room procedure should be followed If no clean room is available you may work with just a PCR Clean Work Station on a temporary basis We strongly recommend putting the PCR work station in a clean room to avoid contamination It is critical to have an air blower in the PCR work station turned on during the whole process Refer to Appendix A for PCR Clean Work Station Guidelines 1 Prepare a stock solution of Reaction Buffer by mixing the
Download Pdf Manuals
Related Search