Home

NativePure pcDNA Gateway Vector Kit

1. detailed below Box Component Catalog no Shipping Storage BN3002 BN3006 1 NativePure pcDNA Gateway Vector Kit v v Room 20 C temperature 2 NativePure Binding and Purification Module Blue ice 4 C 3 NativePure AcTEV Protease Module v Dry ice 20 C Continued on next page Kit Contents and Storage continued NativePure Each NativePure pcDNA Gateway Vector Kit contains the following vectors pcDNA Gateway Store the vectors at 20 C Vectors Item Amount pceDNA 3 2 capTEV NT V5 DEST 6 ug lyophilized in TE pH 8 0 pceDNA 3 2 capTEV CT V5 DEST 6 ug lyophilized in TE pH 8 0 pceDNA 3 2 capTEV NT V5 GW ARPC2 10 ug lyophilized in TE pH 8 0 TM NativePure The following reagents are included in the NativePure Binding and Purification Binding and Module supplied with cat no BN3006 only Store at 4 C Purification ae Reagent Composition Amount Module p Streptavidin Agarose 10 ml of a 50 slurry containing 5 ml packed 5 ml of packed Streptavidin resin Agarose beads in 0 1 M sodium phosphate pH 7 5 0 1 M NaCl and 2 mM sodium azide 10 NP40 10 v v NP40 in deionized 8 ml water NativePure 5X 0 5 M Tris HCI pH 8 0 100 ml Lysis Binding Buffer 0 5M KCl 1mM EDTA 7 5 mM MgCl NativePure 10X TEV Buffer 0 1 M Tris HCl pH 8 0 40 ml 1 5 M NaCl 5mM EDTA NativePure Columns Pol
2. Felgner P L a and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biology 115 887 903 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Landy A 1989 Dynamic Structural and Regulatory Aspects of Lambda Site specific Recombination Ann Rev Biochem 58 913 949 41 References continued Nayak S Li L and Lee J 2003 Enhanced TEV Protease Extends Enzyme Stability for Long Term Activity Focus 25 3 12 14 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 Puig O Caspary F Rigaut G Rutz B Bouveret E Brigado Nilsson E Wilm M and Seraphin B 2001 The tandem affinity purification method a general procedure of protein complex purification Methods 24 218 229 Rigaut G Shevchenko A Rutz B Wilm M Mann M and Seraphin B 1999 A generic protein purification method for protein complex characterization and proteome exploratio
3. Non shaded and light shaded regions are derived from the pcCDNA 3 2 capTEV NT V5 DEST vector e The overlined nucleotides flanking the shaded region correspond to bases 1212 and 3457 of the pcDNA 3 2 capTEV NT V5 DEST vector sequence CMV Forward Priming Site CAAT F e l 733 TCGTAACAAC TCCGCCCCAT TGACGCAAAT GGGCGGTAGG CGTGTACGGT GGGAGGTCTA TATAAGCAGA TATA En Met Gly Ala 803 GCTCTCTGGC TAACTAGAGA ACCCACTGCT TACTGGCTTA TCGAAATTAG CTTCACC ATG GGC GCC mE CEG Ce BioEase Tag Gly Thr Pro Val The Ala Fro Len Ala Gly Thr rle Trp Lys Val Leu Ala Ser Glu 869 EEC ACC CCG Gre ACC GCC CCE CIE GCG CEC ACT ATC TGG AAG EIE CTG GCC ATE GAA CCG TEE GGC CAC TGG CEG GEC GAC CEC CCG TGA TAG ACC TTC CAC GAC Cec TCe CIT Gly Gln Thr Val Ala Ala Gly Glu Val Leu Leu Ile Leu Glu Ala Met Lys Met Glu 926 GGC CAG ACG GTG GCC GCA GGC GAG EIG CIE CIE ATT CIE GAA GCC ATG AAG ATG GAA CCG GTr TGC CAC CoG CGP CCG CIC CAC GAC GAC TAA GAC CTT EEE TAC TTC TAC CTT In vivo biotinylation site Thr Giu Ile Arg Ala Ala Gln Ala Gly Thr Val Arg Gly Ile Ala Val Lys Ala Gly 983 ACC GAA ATC CGC GCE GEG CAG CEC GEG ACE GIG CGE CGT ATC GCG GIG AAA GCE GGC NEGESEWENACHE CCRC CENCE CECHCREC CECCERTCCRCACHC CCRC CARTACECCONCACEUULECCEREEE Asp Ala Val Ala Val Gly Asp Thr Leu Met Thr Leu Ala Gly Ser Gly Ser Glu Asn 1040 GAC GCG EIG GCE GIC EST GAC ACC CIG Ae ACC LIE GCe Cec TCT GGA TCC GAG AAT EIG Cee CAC CGC CAG CCG UTe TEE CAC TAC TEE GAC CGC CCG AGA CCT AGG CIC T
4. bound protein complexes from the streptavidin agarose is achieved by cleavage with a protease The TEV Tobacco Etch Virus Protease is a site specific protease that allows efficient release of bound materials under native conditions Rigaut et al 1999 The NativePure pcDNA Gateway Vectors are designed with two tandem TEV cleavage sites that promote gt 90 cleavage of the biotinylated recombinant protein and associated protein complexes from the streptavidin agarose during purification under native conditions TM AcTEV Protease an enhanced form of TEV protease that is highly active and specific Nayak et al 2003 is supplied with cat no BN3006 and also available separately from Invitrogen page vii Note Upon TEV cleavage the biotin tag is lost and protein detection can be performed using the V5 tag see below The capTEV Tag includes a polyhistidine region 6XHis for potential removal of the bait protein under denaturing conditions using a nickel charged affinity resin after purifying the protein complex using streptavidin agarose The NativePure pcDNA Gateway Vectors contain a N or C terminal V5 epitope derived from the P and V proteins of the paramyxovirus SV5 Southern et al 1991 Fusion proteins containing the 14 amino acid V5 epitope GKPIPNPLLGLDST can be identified using an anti V5 antibody See page vii for recommended antibodies and ordering information Continued on next page Overvie
5. Selective Antibiotic liquid 20 ml 10131 035 Quant iT Protein Assay Kit 1000 assays Q33210 Streptavidin AP Conjugate 125 ul SA100 04 Streptavidin HRP Conjugate 2 5 mg 43 4323 WesternBreeze Chromogenic Kit Anti Rabbit 20 reactions WB7105 WesternBreeze Chemiluminescent Kit Anti Rabbit 20 reactions WB7104 NuPAGE MOPS SDS Running Buffer 20X 500 ml NP0001 NuPAGE MES SDS Running Buffer 20X 500 ml NP0002 NuPAGE LDS Sample Buffer 4X 10 ml NP0007 NuPAGE Sample Reducing Agent 10X 250 ul NP0004 NuPAGE Transfer Buffer 20X IL NP0006 1 HiMark Pre Stained Protein Standard 250 pl LC5699 Tris Glycine SDS Running Buffer 10X 500 ml LC2675 Tris Glycine SDS Sample Buffer 2X 20 ml LC2676 Nitrocellulose 0 45 um Membrane Filter Paper Sandwiches 20 sandwiches LC2001 Invitrolon PVDF 0 45 pm Membrane Filter Paper Sandwiches 20 sandwiches LC2005 Phosphate Buffered Saline PBS 1X 500 ml 10010 023 Anti V5 Antibody 50 pl R960 25 Anti V5 AP Antibody 125 ul R961 25 Anti V5 HRP Antibody 50 pl R962 25 Continued on next page vii Additional Products continued Products for A complete range of products for purification of native protein complexes and Native Protein analysis using native gel electrophoresis is available from Invitrogen For more Analysis information go to www invitrogen com or contact Technical Service see page 36 Item Amount Catalog no NativePure Affinity Puri
6. TK polyA bases 3542 3813 f1 origin bases 3839 4267 SV40 early promoter bases 4294 4602 Neomycin resistance gene bases 4677 5471 SV40 polyA bases 5647 5777 pUC origin bases 6160 6833 c Ampicillin b a resistance gene bases 6978 7838 c bla promoter bases 7833 7937 c c complementary strand Continued on next page 33 Map and Features of pcDNA 3 2 capTEV CT V5 DEST Features The pcDNA 3 2 capTEV CT V5 DEST vector contains the following elements Features have been functionally tested and the vector has been fully sequenced Feature Benefit Human cytomegalovirus CMV immediate early promoter enhancer Allows efficient high level expression of your recombinant protein Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 attR1 and attR2 sites Allows recombinatorial cloning of the gene of interest from an entry clone ccdB gene Allows negative selection of plasmid Chloramphenicol resistance gene Allows counterscreening of plasmid V5 epitope Allows detection of recombinant fusion protein with Anti V5 antibodies Southern et al 1991 capTEV Tag Allows in vivo biotinylation and affinity purification of BioEase tag recombinant proteins and associated complexes TEV cleavage sites 6XHis tag V5 C term reverse primer binding site Allows sequencing of the insert TK polyA reverse primer binding site Allows sequencing of the insert Her
7. Transfer the post nuclear supernatant to a sterile tube Aliquot the supernatant and perform protein estimation on an aliquot of the lysate using TM the Quant iT Protein Kit page vii or Bradford protein assay Store aliquots at 80 C until use Dy OTe G8 Guidelines are provided to prepare samples for native electrophoresis and SDS PAGE For details refer to the manuals supplied with the gels NativePAGE Electrophoresis For samples with high DNA content such as tissue or cell samples we recommend a benzonase endonuclease treatment to reduce protein streaking as follows To the sample from Step 6 add MgCl to a final concentration of 2 mM and 1 2 units benzonase per pl of sample Mix well and incubate at room temperature for 30 60 minutes Centrifuge the lysate at 20 000 x g for 30 minutes at 4 C For NativePAGE electrophoresis add NativeP AGE Sample Buffer 4X to obtain a final concentration of 1X in the sample Do not heat the samples Load the samples onto the NativePAGE Gel and load NativeMark Unstained Protein Standard page vii Perform electrophoresis using the conditions listed in the NativePAGE manual SDS PAGE To the sample from Step 6 above add NuPAGE LDS Sample Buffer 4X or Tris Glycine SDS Sample Buffer 2X to obtain a final concentration of 1X in the sample Add reducing agent DTT to a final concentration of 50 mM Heat the samples at 85 C for 2 5 minutes Load the samples onto the SD
8. components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Notwithstanding the preceding any buyer who is employed in an academic or govern ment institution may transfer materials made with this product to a third party who has a license from Life Technologies under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights to practice any methods claimed in the foregoing patents or patent applications Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Life Technologies Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use
9. of biotinylation for your protein and complex formation choose the appropriate N or C terminal construct for further purification or analysis experiments You should select the construct that provides better biotinylation signal and demonstrates complex formation Expected Results Introduction Protein Biotinylation Results Examples of results obtained by SDS PAGE and native gel electrophoresis followed by Western blot detection to confirm biotinylation and native complex formation of a number of N and C terminally tagged proteins of interest are shown in this section N and C terminal NT and CT tagged expression clones for the following genes were constructed as described in this manual actin related protein complex component p34 ARPC2 Golgi associated protein Bet 3 B galactosidase LacZ and human proteosome subunit beta 2 PSMB2 Freestyle 293 cells were transiently transfected using Lipofectamine 2000 At 24 hours post transfection cells were harvested and lysed using the protocol on page 21 Ten micrograms of post nuclear supernatant was loaded per well on a 4 12 NuPAGE Novex Bis Tris gel and electrophoresed Proteins were transferred to a nitrocellulose membrane 0 45 um and subjected to Western detection using streptavidin alkaline phosphatse conjugate 1 4000 and the WesternBreeze Chemiluminescent Kit 1 2 3 4 5 6 7 8 Lane 1 ARPC2 NT 47 4 kDa ee Lane 2 ARPC2 CT 49 4 kDa ua s Lane 3 Bet 3
10. or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of the foregoing patents was used in the manufacture of such product Continued on next page 37 Purchaser Notification continued Limited Use Label License No 19 Gateway Cloning Products continued Gateway Clone Distribution Policy Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer Limited Use Label License No 135 Recombinant TEV Protease Limited Use Label License No 163 Enhanced TEV Protease 38 Life Technologies Corporation will not assert a claim against the buyer of infringement of the above patents based upon the use of this product to manufacture a protein for sale provided that no meth od claim in the above patents was used in the manufacture of such protein If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information on purchasing a license to use this product for purposes other than those permitted above contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 For additional information about Invitrogen s policy for
11. origin bases 6107 6780 c Ampicillin b a resistance gene bases 6925 7785 c bla promoter bases 7780 7884 c c complementary strand Continued on next page 31 Map and Features of pcDNA 3 2 capTEV NT V5 DEST Features The pcDNA 3 2 capTEV NT V5 DEST vector contains the following elements Features have been functionally tested and the vector has been fully sequenced Feature Benefit Human cytomegalovirus CMV immediate early promoter enhancer Allows efficient high level expression of your recombinant protein Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 CMV forward primer binding site Allows sequencing of the insert capTEV Tag BioEase tag TEV cleavage sites 6XHis tag Allows in vivo biotinylation and affinity purification of recombinant proteins and associated complexes attR1 and attR2 sites Allows recombinatorial cloning of the gene of interest from an entry clone ccdB gene Allows negative selection of plasmid Chloramphenicol resistance gene Allows counterscreening of plasmid V5 epitope Allows detection of recombinant fusion protein with Anti V5 antibodies Southern et al 1991 Herpes Simplex Virus Thymidine Kinase TK polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA Cole and Stacy 1985 fl origin Allows rescue of single stranded DNA SV40 early promot
12. solutions for troubleshooting Biotinylation and biotinylation and complex formation from your pcDNA 3 2 capTEV Complex expression construct Formation Problem Possible Cause Solution No biotinylation of Incorrect detection method Use streptavidin conjugated to alkaline recombinant protein observed phosphatase or horseradish peroxidase followed by Western detection as described page 19 Protein not expressed Use antibodies to the V5 epitope page vii followed by western detection to ensure that protein is expressed Gene of interest not in frame with TM capTEV Tag Make sure that the gene of interest is in frame with the capTEV Tag as shown on pages 11 12 Recombinant protein recovered but not as a complex N or C terminal tag interfering with complex formation Test both N and C terminal tagged constructs to determine optimal complex formation page 18 Complexes dissociated during lysate preparation To avoid dissociation of protein complexes e Perform cell lysis using freeze thaw cycles Avoid trypsinizing the cells or scraping the cells e Perform cell lysis in the absence of NP40 as some protein complexes maybe unstable in the presence of NP40 e Avoid vortexing the lysate during lysate preparation Perform all purification steps at 4 C and use chilled buffers Complexes unable to form in mammalian cell line of choice Optimize using another mammalian cell line
13. 0 2 EE E E ee ead er er Re een ea ee oa Bar er N a 29 Creating Stable Celli Lines irur i e ea a ea ae oaa TE Henna 29 Map and Features of ppDNA 3 2 capTEV NT V5 DEST unenensnnenennenseen 31 Map and Features of PCDNA732 0aPTEV CT V5 DEST sa 33 Map of PEDNA 8 2 capTEV NT GW ARFC un sense 35 Technical Servicers n nenep 22ER ses ae E a Aedes ee des HERR EIER sec R a 36 P rchaserNotification nennen nenn ar an ea OE Rs Soest babe ety 37 Product Qualification esien a ri aan lei 41 References Renee een tits sense a engen tte 42 iii Experienced Users Procedure Introduction This quick reference procedure is provided for experienced users to create expression clones If you are performing the LR recombination reactions for the first time we recommend that you follow the detailed protocols provided in the manual Step Action Generate entry clones Clone your gene of interest with and without a stop codon into Gateway entry vectors to create two entry clones for recombination into pcDNA 3 2 capTEV NT V5 DEST and pcDNA 3 2 capTEV CT V5 DEST Perform LR recombination reactions 1 Add the following components to 1 5 ml microcentrifuge tubes at room temperature and mix Component NT tag CT tag Positive Entry Clone Entry Clone Control Entry clone without stop 1 7 ul 50 150 ng rxn Entry clone with stop 1 7 ul 50 150 ng rxn pcDNA 3 2 capTEV NT V5 1ul 7 1 ul DEST 150 ng l
14. 141 814 6117 E mail tech_service invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com Material Data Safety Sheets MSDSs Limited Warranty 36 MSDs are available on our Web site at www invitrogen com On the home page click on Technical Resources and follow instructions on the page to download the MSDS for your product Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is in
15. 600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
16. CDNA 3 2 capTEV V5 DEST vectors Refer to pages 11 12 to see the recombination regions of the vectors When recombining into the pcDNA 3 2 capTEV CT V5 DEST vector the design for your entry clone must contain a Kozak translation initiation sequence with an ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1991 Kozak 1990 An example of a Kozak consensus sequence is provided below The ATG initiation codon is shown underlined G A NNATGG Other sequences are possible but the G or A at position 3 and the G at position 4 are the most critical for function shown in bold Creating N and C Terminal Tagged Expression Clones Introduction Resuspending the Vectors Propagating the Vectors Experimental Outline 10 After you have generated both entry clones perform LR recombination reactions to transfer the gene of interest into the pcCDNA 3 2 capTEV V5 DEST vectors to create your expression clones To ensure that you obtain the best results we recommend that you read this section and the next section entitled Performing the LR Recombination Reactions pages 13 15 before beginning The pcDNA 3 2 capTEV V5 DEST vectors are supplied as 6 ug of plasmid lyophilized in TE pH 8 0 To use resuspend the plasmid in 40 ul sterile water to a final concentration of 150 ng ul If you wish to propagate and maintain the pcDNA 3 2 capTEV V5 DEST vectors we recommend using One Shot ccdB Surviva
17. GTTAGC 3 V5 C term reverse 5 ACCGAGGAGAGGGTTAGGGAT 3 Long Term Storage For your convenience Invitrogen offers a custom primer synthesis service For more information go to www invitrogen com or contact Technical Service page 36 Once you have identified the correct clone be sure to purify the DNA and make a glycerol stock for long term storage We also recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony out for single colonies on an LB plate containing 100 ug ml ampicillin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 100 ug ml ampicillin 3 Grow at 37 C with shaking until culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol 5 Transfer to a cryovial and store at 80 C 15 Transient Transfection of Cells Introduction Plasmid Preparation Positive Control Plasmid 16 After generating your expression clones we recommend performing transient transfection of your cell line of choice followed by Western detection of biotinylated protein to determine which expression clone is optimal This section provides general information for transiently transfecting your expression clones into the mammalian cell line of choice We recommend that you include the positive control vector pcDNA 3 2 capTEV NT GW ARPC2 see below and a mock transfection negative control in your experiments to evaluate
18. NT 32 8 kDa Lane 4 Bet 3 CT 35 5 kDa Lane 5 LacZ NT 129 kDa Lane 6 LacZ CT 131 6 kDa Lane 7 PSMB2 NT 35 3 kDa E Lane 8 PSMB2 CT 37 9 kDa gt MultiMark multicolored protein standard not shown see page vii was used to determine the molecular weights of the N and C terminally tagged proteins The faint band detected in all lanes is endogenous biotinylation from the lysate The presence of multiple bands in lane 5 represents slight protein degradation These results show that the proteins of interest are biotinylated For some proteins there is a difference in the level of biotinylation in the N and C terminally tagged versions e g lane 1 vs lane 2 lane 3 vs lane 4 and lane 7 vs lane 8 However for LacZ lane 5 vs lane 6 both N and C terminally tagged constructs have similar levels of biotinylation Continued on next page 23 Expected Results continued Native Complex Formation Results 24 N and C terminal NT and CT tagged expression clones for the following genes were constructed as described in this manual actin related protein complex component p34 ARPC2 human proteosome subunit beta 2 PSMB2 GripTite 293 cells were transiently transfected using Lipofectamine 2000 At 24 hours post transfection cells were harvested and lysed using the native protocol on page 21 Ten micrograms of post nuclear supernatant was loaded per well on a 3 12 NativePAGE Nov
19. Protein complexes not observed Protein degraded e Perform all purification steps at 4 C e Check to make sure that the BioEase tag is not cleaved during processing or purification e Include protease inhibitors during cell lysis 28 Appendix Creating Stable Cell Lines Introduction Important Linearizing the Plasmid Geneticin Determining Geneticin Sensitivity The pcDNA 3 2 capTEV V5 DEST vectors contain the neomycin resistance gene to allow selection of stable cell lines If you wish to create stable cell lines transfect your expression construct into the mammalian cell line of choice and select for stable transfectants using Geneticin General information and guidelines are provided below It is not necessary to create stable cell lines for purification or analysis of complexes If you wish to create stable cell lines make sure to assay clones for expression of biotinylated protein and complex formation page 18 and expand those clones To obtain stable transfectants we recommend that you linearize your pcDNA 3 2 capTEV N or CT expression construct before transfection While linearizing the vector may not improve the efficiency of transfection it increases the chances that the vector does not integrate in a way that disrupts elements necessary for expression in mammalian cells Cut at a unique site that is not located within a critical element or within your gene of intere
20. S gel and load appropriate molecular weight standard page vii Perform electrophoresis using the conditions listed in the manual supplied with the gel Western Analysis Perform Western blotting with nitrocellulose or PVDF membranes page vii After blocking probe the blot with a suitable dilution of streptavidin AP or HRP conjugate and develop the blot using the WesternBreeze Chromogenic or Chemiluminescent Kits Continued on next page 21 Detecting Native Protein Expression and Biotinylation continued What You Should See The Next Step 22 After SDS PAGE and Western blotting with streptavidin conjugate the protein of interest should exhibit biotinylation of the protein Note that you will see background bands due to endogenous biotinylated proteins The level of biotinylation may vary between the N and C terminally tagged protein or may be similar If you do not observe any biotinylation on your protein of interest see Troubleshooting page 27 After native electrophoresis and Western blotting with streptavidin conjugate the protein of interest should migrate as a complex on the native gel indicating the ability to interact with endogenous binding partners The ability for complex formation may vary between the N and C terminally tagged proteins or may be similar The next page shows results of a SDS PAGE and native electrophoresis experiment and provides guidelines on interpreting your results Based on the level
21. TA TEV Recognition Site TEV Recognition Site 6X His Tag rn m Leu Tyr Phe Gln Gly Gln Leu Glu Asn Leu Tyr Phe Gln Gly Gln Leu His His His 1097 CTT TAT TTT CAG GGT CAA TTG GAG AAT CTT TAT TTT CAG GGT CAA TTG CAT CAT CAT GAA ATA AAA GTC CCA GTT AAC CTC TTA GAA ATA AAA GTC CCA GTT AAC GTA GTA GTA TEV Cleavage Site TEV Cleavage Site V5 Epitope r 7 j His His His Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Thr Ser 1154 CAT CAT CAT GGT AAG CCT ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT ACG ACA AGT GTA GTA GTA CCA TTC GGA TAG GGA TTG GGA GAG GAG CCA GAG CTA AGA TGC TGT TCA 1212 attB1 attB2 3457 1211 AA AGTGGTGATA AAC ATG TIT TT TCACCACTAT Continued on next page 11 Creating N and C Terminal Tagged Expression Clones continued Recombination The recombination region of the expression clone resulting from Region of pcDNA 3 2 capTEV CT V5 DEST x entry clone is shown below peDNA 3 2 Features of the Recombination Region capTEV CT V5 e Light shaded regions correspond to the capTEV tag DEST e Dark shaded regions between the attB sites correspond to DNA sequences transferred from the entry clone into pcDNA 3 2 capTEV CT V5 DEST by recombination Non shaded and light shaded regions are derived from the pcCDNA 3 2 capTEV CT V5 DEST vector e The overlined nucleotides flanking the shaded region correspond to bases 882 and 3127 of the pePDNA 3 2 capTEV CT V5 DEST vector sequence CAAT TATA 710
22. TCGTAACAAC TCCGCCCCAT TGACGCAAAT GGGCGGTAGG CGTGTACGGT GGGAGGTCTA TATAAGCAGA 780 GCTCTCIGGC TAACTAGAGA ACCCACTGCT TACTGGCTTA TCGAAATTAA TACGACTCAC TATAGGGAGA 882 attB1 Pro Ala 850 CCCAAGCTGG CTAGTTAAGC TATCAACAAG TTT ATAGTTGTTC AAACATGTTT 3127 attB2 1 I Phel Leu Tyr Lys Val Val Asp Leu Glu Gly Pro Arg Phe Glu Gly Lys Pro Ile Pro 3125 C TTG TAC AAA GTG GTT GAT CTA GAG GGC CCG CGG TTC GAA GGT AAG CCT ATC CCT TTT CAC CAA CTA GAT CTC CCG GGC GCC AAG CTT CCA TTC GGA TAG GGA V5 C term reverse priming site V5 Epitope 6X His Tag Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg Thr Gly His His elie His His AES 3182 AAC CCT CTC CTC GGT CTC GAT TCT ACG CGT ACC GGG CAT CAT CAT CAT CAT CAT TTG GGA GAG GAG CCA GAG CTA AGA TGC GCA TGG CCC GTA GTA GTA GTA GTA GTA TEV Recognition Site TEV Recognition Site SSS EEE Gly Glu Asn Leu Tyr Phe Gln Gly Gln Leu Glu Asn Leu Tyr Phe Gln Gly Gly Ala 3236 GGT GAG AAT CTT TAT TTT CAG GGT CAA TTG GAG AAT CTT TAT TIT CAG GGT GGC GCC CCA CIC TTA GAA ATA AAA GTC CCA GIT AAC CTC TTA GAA ATA AAA GTC CCA CCG CGG TEV Cleavage Site Er TEV Cleavage Site A BioEase Tag Gly Thr Pro Val Thr Ala Pro Leu Ala Gly Thr Ile Trp Lys Val Eeu Ala Sem Glu 3293 GGC ACC CCG GTG ACC GCC CCG CTG GCG GGC ACT ATC TGG AAG GTG CTG GCC AGC GAA CCG TGG GGC CAC TGG CGG GGC GAC CGC CCG TGA TAG ACC TIC CAC GAC CGG TCG CTI Gly Gln Thr Val Ala Ala Gly G 3350 GGC CAG ACG GTG GCC GCA GGC GA CCG GTC TGC CAC CGG CGT CCG CI Val L
23. This should allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technology including Gateway clones for purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 39 Product Qualification Vectors NativePure Affinity Purification Reagents 40 The pcDNA 3 2 capTEV Gateway destination vectors as well as the corresponding control plasmid are qualified by restriction endonuclease digestion pPDNA 3 2 capTEV NT V5 DEST and pcDNA 3 2 capTEV CT V5 DEST are further qualified in a recombination assay using Gateway LR Clonase II enzyme mix The ccdB gene is assayed by transformation using an appropriate E coli strain For details on the qualification of NativePure Affinity Purification reagents refer to the NativePure Affinity Purification Kit manual References Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publi
24. allow removal of the bound biotinylated proteins complexes of interest while endogenous biotinylated proteins remain bound to the streptavidin agarose column After TEV cleavage a 6xHis tag is present for potential removal of the bait protein under denaturing conditions after protein complex purification These features are described in detail in the following sections Continued on next page Overview continued BioEase Tag TEV Protease Recognition Site 6XHis Tag V5 epitope The BioEase Tag is a 72 amino acid peptide derived from the C terminus amino acids 524 595 of Klebsiella pneumoniae oxalacetate decarboxylase a subunit that contains a single covalent biotinylation site at lysine 561 of the protein Schwarz et al 1988 When fused to a heterologous protein the 72 amino acid BioEase domain is both necessary and sufficient to facilitate recognition and in vivo biotinylation of the recombinant protein of interest by cellular biotinylation enzymes The high affinity and selectivity of the streptavidin biotin interaction is utilized to efficiently purify the biotinylated protein and associated complexes by streptavidin agarose affinity chromatography supplied with cat no BN3006 also available separately from Invitrogen For ore information about cellular biotinylation processes refer to published reviews Chapman Smith and J E Cronan 1999 Since the streptavidin biotin interaction is extremely strong removal of the
25. at such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing
26. ation supplied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading frames created using Invitrogen s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing attL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by non profit organizations and by for profit organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by academic and government organizations without royalty payment to Invitrogen Organizations other than academia and government may also distribute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction
27. bases 1118 1138 6XHis tag bases 1145 1162 V5 epitope bases 1163 1204 attB1 bases 1205 1229 ARPC2 gene bases 1250 2152 attB2 bases 2169 2193 TK polyA bases 2201 2472 f1 origin bases 2508 2936 SV40 early promoter bases 2963 3271 Neomycin resistance gene bases 3346 4140 SV40 polyA bases 4316 4446 pUC origin bases 4829 5502 c Ampicillin b a resistance gene bases 5647 6507 c bla promoter bases 6502 6606 c c complementary strand 35 Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical service contact information Access to the Invitrogen Online Catalog Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0
28. cell lysate using freeze thaw cycles no SDS buffers 2 Analyze lysate by e SDS PAGE e Native gel electrophoresis using NativePAGE gels 3 Perform two Western blots one using the SDS PAGE gel and other using the NativePAGE gel 4 Develop the blots with streptavidin conjugate using the WesternBreeze Kits Important 18 The cell lysate is prepared using mild conditions for lysis to enable analysis of protein complexes The cell lysis protocol included in this section allows you to use the same lysate for analysis using native non denaturing electrophoresis and denaturing SDS PAGE We recommend using freeze thaw cycles for cell lysis to obtain intact protein complexes Trypsin treatment or scraping the cells is not recommended as these methods cause cell damage and dissociation of protein complexes If you have already performed trypsin treatment inactivate trypsin using medium with 10 FBS Wash cells three times with 1X PBS before lysing the cells Perform cell lysis in the absence of NP40 as some protein complexes maybe unstable in the presence of NP40 During lysate preparation avoid vortexing the lysate as it can dissociate the protein complexes If your sample is in a SDS PAGE sample buffer prepare a fresh lysate without SDS using the protocol on page 21 for native electrophoresis Do not use SDS PAGE samples for native gel electrophoresis Continued on next page Detecting Native Protein Expression and Biotiny
29. combination reaction into a suitable E coli host follow the manufacturer s instructions and select for expression clones Note You may store the LR reaction at 20 C for up to 1 week before transformation if desired Continued on next page Performing the LR Recombination Reactions continued What You Should See Confirming the Expression Clone If you use E coli cells with a transformation efficiency of 2 1 x 10 cfu ug the LR reaction should give gt 5 000 colonies if the entire reaction is transformed and plated The ccdB gene mutates at a very low frequency resulting in a very low number of false positives True expression clones will be ampicillin resistant and chloramphenicol sensitive Transformants containing a plasmid with a mutated ccdB gene will be both ampicillin and chloramphenicol resistant To check your putative expression clone test for growth on LB plates containing 30 ug ml chloramphenicol A true expression clone will not grow in the presence of chloramphenicol Sequencing To confirm that your gene of interest is in frame with the N and C terminal capTEV Tag you may sequence your expression construct We suggest using the following primer sequences Refer to the diagrams on pages 11 12 for the location of the primer binding sites Vector Primer Sequence pceDNA 3 2 capTEV NT V5 DEST CMV forward 5 CGCAAATGGGCGGTAGGCGTG 3 pcDNA 3 2 capTEV CT V5 DEST TK polyA 5 CTTCCGTGTTTCA
30. containing Geneticin at the predetermined concentration required for your cell line Feed the cells with selective media every 3 4 days until Geneticin resistant colonies can be identified 7 Pick at least 3 4 Geneticin resistant colonies and expand them in culture 8 Analyze clones as described on page 18 for biotinylation of recombinant 30 protein and complex formation Select clones that exhibit biotinylation and complex formation for further experiments Map and Features of pcDNA 3 2 capTEV NT V5 DEST Map The map below shows the elements of the pcDNA 3 2 capTEV NT V5 DEST vector 7921 bp DNA from the entry clone replaces the region between bases 1212 and 3457 after performing the LR reaction The complete sequence of this vector is available for downloading from www invitrogen com or by contacting Technical Service page 36 att Reade Cm att Comments for pcDNA 3 2 capTEV NT V5 DEST 7921 nucleotides CMV promoter bases 219 806 capTEV tag bases 863 1162 BioEase tag bases 863 1078 TEV cleavage bases 1091 1111 TEV cleavage bases 1118 1138 6XHis tag bases 1145 1162 V5 epitope bases 1163 1204 attR1 bases 1205 1329 ccdB gene bases 1758 2063 Chloramphenicol resistance gene CmR bases 2408 3066 attR2 bases 3347 3471 TK polyA bases 3479 3750 f1 origin bases 3786 4214 SV40 early promoter bases 4241 4549 Neomycin resistance gene bases 4624 5418 SV40 polyA bases 5594 5724 pUC
31. e and negative controls You will need to make 2 4 ml of 1X Lysis Buffer per sample depending on the volume of your samples i e 30 ml flask 10 cm dish T 175 flask see next section Prepare 1X Lysis Buffer to obtain the following 1X final concentration For cat no BN3006 refer to the manual supplied with the NativePure Affinity Purification Kit for details 100 mM Tris HCl pH 8 0 100 mM KCl 200 uM EDTA 1 5 mM MgCl 1X 700 ng ml Pepstatin Roche cat no 1359053 or equivalent Complete protease inhibitor Roche cat no 1697498 or equivalent Store the buffer on ice until use You may aliquot the buffer and store the aliquots at 20 C if needed Continued on next page Detecting Native Protein Expression and Biotinylation continued Preparing Cell Lysate Under Native Conditions Electrophoresis and Blotting 1 Harvest suspension cells by centrifugation We generally use cells from a 30 ml flask Wash the cells twice in phosphate buffered saline PBS Resuspend the cell pellet in 4 ml 1X Lysis Buffer see previous page for a recipe Proceed to Step 4 2 Wash adherent cells with PBS Remove the PBS and add 0 5 1 ml 1X Lysis Buffer 10 cm culture dish containing adherent cells For a T 175 flask use 2 ml 1X Lysis Buffer Harvest cells by pipetting up and down Transfer the cells to a sterile tube Perform 3 freeze thaw cycles to lyse the cells Centrifuge the lysate at 10 000 x g for 10 minutes at 4 C
32. echnical Service see page 36 After transfecting your cells with the ppDNA 3 2 capTEV N and C terminal expression constructs we strongly recommend that you confirm the biotinylation of your protein of interest and the ability of the tagged protein to form complexes prior to proceeding with purification or analysis experiments It is not necessary to create stable cell lines for purification or analysis experiments However you may transiently transfect your cells confirm biotinylation of your protein of interest and the ability of the tagged protein to form complexes see next section then transfect your mammalian cells with the optimal expression construct and select for stable transfectants using Geneticin selective antibiotic See the protocol in the Appendix page 29 17 Detecting Protein Biotinylation and Complex Formation Introduction After transfecting your cells with the ppDNA 3 2 capTEV N and C terminal expression constructs we strongly recommend that you confirm the biotinylation of your protein of interest and the ability of the tagged protein to form complexes prior to proceeding with purification or analysis experiments This section includes instructions to verify biotinylation using SDS PAGE and to verify complex formation using native electrophoresis followed by Western detection with streptavidin conjugate Experimental To detect protein biotinylation and complex formation you will Outline 1 Prepare
33. ectors for expression and purification of N and C terminal biotinylated fusion proteins in mammalian cells using Gateway Technology see page 6 for details on Gateway Technology After transfection into your mammalian cell line of choice the NativePure pcDNA Gateway Vectors allow in vivo biotinylation and expression of the biotin tagged protein of interest bait The biotin tagged recombinant protein bait can be used to identify novel proteins that specifically interact with the protein of interest or to test complex formation between proteins or protein domains for which there is a prior reason to expect an interaction The NativePure Mammalian Affinity Purification System is based on the TAP Tandem Affinity Purification method used to purify native protein complexes Puig et al 2001 The purification of native protein complexes requires the use of a high affinity tag that allows rapid affinity purification of the tagged protein and associated protein complexes when present in low concentrations from cells without any prior information on the protein complex The purified protein complexes are released from the affinity resin using a highly specific protease under native conditions The NativePure pcDNA Gateway Vectors allow expression and in vivo biotinylation of your bait protein of interest Rapid and efficient purification of the bait protein and associated complexes even when present at low concentra
34. er and origin Allows efficient high level expression of the neomycin resistance gene and episomal replication in cells expressing the SV40 large T antigen Neomycin resistance gene Allows selection of stable transfectants in mammalian cells Southern and Berg 1982 SV40 early polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin Allows high copy number replication and growth in E coli Ampicillin bla resistance gene B lactamase Allows selection of transformants in E coli 32 Map and Features of pcDNA 3 2 capTEV CT V5 DEST Map The map below shows the elements of the pePDNA 3 2 capTEV CT V5 DEST vector 8010 bp DNA from the entry clone replaces the region between bases 882 and 3127 after performing the LR reaction The complete sequence of this vector is available for downloading from www invitrogen com or by contacting Technical Service page 36 7 att ccd 8 Cm attR2 V5 capTEV tag Comments for pcDNA 3 2 capTEV CT V5 DEST 8010 nucleotides CMV promoter bases 199 786 T7 promoter priming site bases 827 846 attR1 bases 875 999 ccaB gene bases 1428 1733 c Chloramphenicol resistance gene Cm bases 2078 2736 c attR2 bases 3017 3141 V5 epitope bases 3167 3208 capTEV tag bases 3218 3502 6XHis tag bases 3218 3235 TEV cleavage bases 3239 3259 TEV cleavage bases 3266 3286 BioEase tag bases 3287 3502
35. eu Leu Ile Leu Glu Ala Met Lys Met Glu GTG CTG CTG ATT CTG GAA GCC ATG AAG ATG GAA CAC GAC GAC TAA GAC CTT CGG TAC TTC TAC CTT Sole In vivo biotinylation site Thr Glu Ile Arg Ala Ala Gln Ala Gly Thr Val Arg Gly Ile Ala Val Lys Ala Gly 3407 ACC GAA ATC CGC GCC GCG CAG GCC GGG ACC GTG CGC GGT ATC GCG GTG AAA GCC GGC TGG CTT TAG GCG CGG CGC GTC CGG CCC TGG CAC GCG CCA TAG CGC CAC TTI CGG CCG Asp Ala Val Ala Val Gly Asp Thr Leu Met Thr Leu Ala Gly Ser Gly Ser 3464 GAC GCG GTG GCG GTC GGC GAC ACC CTG ATG ACC CTG GCG GGC TCT GGA TCC TAG TAA CTG CGC CAC CGC CAG CCG CTG TGG GAC TAC TGG GAC CGC CCG AGA CCT AGG ATC ATT TK polyA reverse primer KKK 1 3521 TGA GTTTAAACGG GGGAGGCTAA CTGAAACACG GAAGGAGACA TCT 12 Performing the LR Recombination Reactions Introduction Once you have obtained the entry clones containing your gene of interest you may perform LR recombination reactions between the entry clones and pcDNA 3 2 capTEV V5 DEST vectors and transform the reaction mixture into a suitable E coli host see below to select for expression clones We recommend including a negative control no LR Clonase II in your experiment to help evaluate your results TM E coli Host You may use any recA endA E coli strain including TOP10 DH5a or equivalent for transformation page vii Do not transform the LR reaction mixture into E coli strains that contain the F episome e g TOP10F These stra
36. evitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 19 Gateway Cloning Products Use of the pcDNA 3 2 capTEV NT and CT V5 DEST vectors are covered under the licenses detailed below The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided th
37. ex Bis Tris gel and electrophoresed Proteins were transferred to Invitrolon PVDF membrane and subjected to Western detection using streptavidin alkaline phosphatse conjugate 1 4000 and the WesternBreeze Chromogenic Kit Apparent molecular weights kDa are listed on the left which correspond to NativeMark Unstained Protein Standard Lane 1 5 ul of 1 20 diluted NativeMark Egg Unstained Protein Standard Lane 2 Untransfected cell lysate 1236 eos negative control 1048 Lane 3 APRC2 CT Lane 4 PSMB CT tagged s Lane 5 PSMB NT tagged N o A a 720 ja 480 242 coe mah Biia ei 146 gt 66 These results show that in the case of the human proteasome subunit beta 2 protein PSMB the C terminally tagged protein forms a complex while the N terminally tagged protein does not The 20S proteosome complex shown by arrow above is detected only in lane 4 and not in lane 5 of the streptavidin Western blot These data also show the size of the protein complex formed Background bands detected in all lanes may be protein present in the cell lysate with endogenous phosphatase activity endogenous biotinylation or nonspecific binding Native Protein Analysis Introduction NativePure Affinity Purification Kit Important NativePAGE Gels You may analyze protein complexes as follows e Analyze the protein complexes directly from cell lysates using SDS PAGE or native gel electrop
38. fication Kit 1 kit BN3003 NativeMark Unstained Protein Standard 5 x50 ul LC0725 NativeP AGE Novex 3 12 Bis Tris Gels 10 well 10 gels BN1001BOX NativeP AGE Novex 3 12 Bis Tris Gels 15 well 10 gels BN1003BOX NativeP AGE Novex 4 16 Bis Tris Gels 10 well 10 gels BN1002BOX NativeP AGE Novex 4 16 Bis Tris Gels 15 well 10 gels BN1004BOX NativePAGE Running Buffer 20X 1L BN2001 NativePAGE Cathode Buffer Additive 20X 250 ml BN2002 NativePAGE Sample Buffer 4X 10 ml BN2003 NativePAGE 5 G 250 Sample Buffer Additive 0 5 ml BN2004 NativePAGE Running Buffer Kit 1 kit BN2007 NativeP AGE Sample Prep Kit 1 kit BN2008 10 DDM n dodecyl D maltoside 1 ml BN2005 5 Digitonin 1ml BN2006 Streptavidin Agarose sedimented bead suspension 5 ml S 951 AcTEV Protease 1000 units 12575 015 10 000 units 12575 023 Pre Cast Gels A large variety of pre cast gels for SDS PAGE native PAGE and pre made buffers are available from Invitrogen Use NuPAGE and Novex Tris Glycine pre cast gels for SDS PAGE and Western analysis Use NativePAGE pre cast gels for native gel electrophoresis and Western analysis For details visit www invitrogen com or contact Technical Service page 36 viii Overview Introduction NativePure Mammalian Affinity Purification System Introduction The NativePure Mammalian Affinity Purification Kit and NativePure pcDNA Gateway Vector Kit contains Gateway adapted v
39. he Ultimate ORF collection go to www invitrogen com or contact Technical Service page 36 Generating Entry Clones continued N and C Terminal Expression Clones Kozak Consensus Sequence Individual expression and in vivo biotinylation of the protein of interest in your mammalian cell line may vary depending on whether your protein of interest is fused to an N terminal or C terminal tag We strongly recommend that you recombine your gene of interest into both pcDNA 3 2 capTEV V5 DEST vectors to create both N and C terminally tagged expression clones and determine which clone gives optimal protein biotinylation and complex formation after transfection into mammalian cells Therefore you will need to create two entry vectors containing your gene of interest with either a stop codon N terminal tagged recombine with pcDNA 3 2 capTEV NT V5 DEST or a Kozak translation initiation sequence and no stop codon C terminal tagged recombine with pcDNA 3 2 capTEV CT V5 DEST These required elements are summarized below To make an entry clone to Then your gene of interest must recombine with contain pcDNA 3 2 capTEV NT V5 DEST e Stop codon pcDNA 3 2 capTEV CT V5 DEST e Kozak consensus sequence see below e No stop codon Make sure that your gene of interest is in frame with the N or C terminal capTEV tag and other vector elements after performing the LR recombination reaction with the pc
40. horesis and Western immunodetection e Purify protein complexes from cell lysates under native conditions using the NativePure Affinity Purification kit supplied with cat no BN3006 and analyze purified protein complexes by SDS PAGE native gel electrophoresis or mass spectrometry The NativePure Affinity Purification Kit is included with catalog no BN3006 and is also available separately from Invitrogen see page vii for ordering information The NativePure Affinity Purification system is based on the selective binding of Streptavidin Agarose to biotinylated proteins and protein complexes The lysate is prepared from mammalian cells in Lysis Buffer using a freeze thaw method The lysate is centrifuged and NP 40 is added to the post nuclear supernatant for subsequent protein binding The biotinylated proteins and protein complexes bind to the Streptavidin Agarose column and impurities are removed by thorough washing with buffers The bound biotinylated proteins and protein complexes are released from the column by AcTEV Protease treatment The AcTEV Protease is removed from the eluted fractions and protein complexes are concentrated using NativePure Concentrators The resulting purified protein complexes are analyzed by native electrophoresis Western analysis or mass spectrometry For more information about the NativePure Affinity Purification Kit refer to the manual also supplied with cat no BN3006 Manuals are also a
41. ins contain the ccdA gene and will prevent negative selection with the ccdB gene LR Clonase II LR Clonase II enzyme mix is available separately from Invitrogen page vii to Enzyme Mix catalyze the LR recombination reactions The LR Clonase II enzyme mix TM combines the proprietary enzyme formulation and 5X LR Clonase Reaction Buffer previously supplied as separate components in LR Clonase enzyme mix into an optimized single tube format for easier set up of the LR recombination reaction Use the protocol provided on the next page to perform the LR recombination reaction using LR Clonase II enzyme mix Materials Needed You will need the following materials before beginning e Purified plasmid DNA of your entry clone with stop codon 50 150 ng ul in TE pH 8 0 e Purified plasmid DNA of your entry clone without stop codon 50 150 ng ul in TE pH 8 0 e pcDNA 3 2 capTEV NT V5 DEST 150 ng ul in TE pH 8 0 e pcDNA 3 2 capTEV CT V5 DEST 150 ng ul in TE pH 8 0 e LR Clonase II enzyme mix keep at 20 C until immediately before use e TE Buffer pH 8 0 10 mM Tris HCL pH 8 0 1 mM EDTA e 2 ug l Proteinase K solution supplied with LR Clonase II enzyme mix thaw and keep on ice until use e pENTR gus supplied with LR Clonase II enzyme mix use as a control for the LR reaction 50 ng ul e Appropriate competent E coli host and growth media for expression e 0 C Medium e Selective LB agar
42. invitrogen NativePure pcDNA Gateway Vector Kit For expression and purification of N and C terminal biotinylated fusion proteins and associated complexes in mammalian cells Catalog nos BN3002 BN3006 Version B 28 October 2010 25 0892 ii Table of Contents Experienced Users Procedure cscccccsssscscscccesssetetesesesssnsnsesescsescsceeeeeesesesesesnsnenssesesesesnaanesessseessesesesnananes iv K it Cofitentssand Stora ges asics sans aan an seh EAA E v Additonal Productsys sc teccc5 c6i ccs abasscssessiesecoseteshse esse canescesjaniavss cuputecteaMinccscoasheradaidusaeshgeieslsiseateneteesSeatas vii Introduction anna sCaleatc duets cea nedetaaluacedeetantcavstansdaevGiaetdoavadens Guctabedatedueuawtbausdeevaedauatauiuamcscdtentedinvess 1 OVERVIEW EN ea o aaa Br een radius nee ee ee thy ans 1 Experimental Outines aoni e 2222ER baat odes E ana E sea RET 7 Methods anne 8 Generating Entry CL lines ann nie tele oae ETE E a ETRE a a ida re Up EDE e IE E 8 Performing the LR Recombination Reactions eennnensesnsssesenenenenenennnnnenenn 13 Transient Transfection of Cells rsisi onia tina niesianiois meine misao 16 Detecting Protein Biotinylation and Complex Formation eeennenennnnennnnn 18 Expected Results un hrs nn ake Sa ada ats secre oases aan eames ats teak antes catty 23 Native Protein Analysis ann aRian en ge Lig tain cu DN E R AN 25 Troubleshooting as nn minus enkenlnp Coeds aebete en 26 ADPENIX 2
43. ion For established cell lines consult the original references or the supplier of your cell line for the optimal method of transfection We recommend that you exactly follow the protocol for your cell line Pay particular attention to medium requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen and Okayama 1987 Wigler et al 1977 lipid mediated Felgner et al 1987 Felgner et al 1989 Felgner and Ringold 1989 and electroporation Chu et al 1987 Shigekawa and Dower 1988 For high efficiency transfection in a broad range of mammalian cell lines we recommend using the cationic lipid based Lipofectamine 2000 Reagent Ciccarone et al 1999 available from Invitrogen Using Lipofectamine 2000 see page vii to transfect plasmid DNA into eukaryotic cells offers the following advantages e Provides the highest transfection efficiency in many mammalian cell types TM e DNA Lipofectamine 2000 complexes can be added directly to cells in culture medium in the presence of serum e Removal of complexes medium change or medium addition following transfection are not required although complexes can be removed after 4 6 hours without loss of activity For more information on Lipofectamine 2000 Reagent go to www invitrogen com or contact T
44. l T1 Chemically Competent E coli from Invitrogen for transformation see page vii for ordering information The ccdB Survival T1 E coli strain is resistant to ccdB effects and can support the propagation of plasmids containing the ccdB gene To maintain the integrity of the vectors select for transformants in media containing 50 100 ug ml ampicillin and 15 30 ug ml chloramphenicol Note Do not use general E coli cloning strains including TOP10 or DH5a for propagation and maintenance as these strains are sensitive to ccdB effects To generate an expression clone you will 1 Perform an LR recombination reaction using each attL containing entry clone and the appropriate atfR containing pcDNA 3 2 capTEV V5 DEST vector 2 Transform the reaction mixtures into a suitable E coli host 3 Select for expression clones refer to the next pages for diagrams of the recombination regions of the resulting expression clones Continued on next page Creating N and C Terminal Tagged Expression Clones continued Recombination The recombination region of the expression clone resulting from Region of pcDNA 3 2 capTEV NT V5 DEST x entry clone is shown below peDNA 3 2 Features of the Recombination Region capTEV NT V5 e Light shaded regions correspond to the capTEV tag DEST e Dark shaded regions between the attB sites correspond to DNA sequences transferred from the entry clone into peDNA 3 2 capTEV NT V5 DEST by recombination
45. lation continued Streptavidin Conjugates NativePAGE Gel Electrophoresis SDS PAGE Note Use the strong interaction between biotin and streptavidin to easily detect your recombinant biotinylated protein with one of the following streptavidin conjugates Conjugate Catalog Number Streptavidin AP SA100 01 Streptavidin HRP SA100 03 Ready to use WesternBreeze Chromogenic and Chemiluminescent Kits are available from Invitrogen to facilitate detection of streptavidin conjugates see page vii for ordering information The NativePAGE Novex Bis Tris Gel system is a near neutral pH pre cast polyacrylamide mini gel system to perform native non denaturing electrophoresis The near neutral pH 7 5 environment during electrophoresis results in maximum stability of both proteins and gel matrix providing better band resolution than other gel systems including the traditional Tris glycine native electrophoresis Laemmli system The NativePAGE Novex Bis Tris Gel system provides a sensitive and high resolution method for analysis of native membrane protein complexes native soluble proteins molecular mass estimations and assessing the purity of native proteins A variety of NativePAGE gels and pre made buffers for native electrophoresis are available from Invitrogen page viii You may use NuPAGE Novex Bis Tris Gel page vii Novex Tris Glycine Gel page vii or any other SDS PAGE gel of choice for perf
46. llin bla resistance gene for selection in E coli For maps and features of the pcDNA 3 2 capTEV NT V5 DEST and pcDNA 3 2 capTEV CT V5 DEST vectors see pages 29 35 Continued on next page Overview continued The Gateway Technology The Gateway Technology is a universal cloning method that takes advantage of the site specific recombination properties of bacteriophage lambda Landy 1989 Gateway Technology enables rapid and highly efficient transfer of DNA sequences into multiple vector systems for protein expression and functional analysis while maintaining orientation and reading frame To express your gene of interest using Gateway Technology simply 1 Clone your gene of interest with and without a stop codon into Gateway entry vectors to create two entry clones 2 Generate two expression clones by performing LR recombination reactions between the appropriate entry clones and pcDNA 3 2 capTEV V5 DEST vectors 3 Transfect each expression clone separately into the cell line of choice for transient or stable expression of your gene of interest For more information on the Gateway Technology refer to the Gateway Technology with Clonase II manual This manual is available for downloading www invitrogen com or by contacting Technical Service page 36 Experimental Outline Experimental Outline Outlined below are steps to clone your gene of interest into the pcDNA 3 2 capTEV V5 DEST vectors t
47. n Nat Biotechnol 17 1030 1032 Robinson R Turbedsky K Kaiser D Marchand J B Higgs H N Choe S and Pollard T D 2001 Crystal Structure of ARP2 3 Comples Science 294 1679 1684 Schwarz E Oesterhelt D Reinke H Beyreuther K and Dimroth P 1988 The Sodium Ion Translocating Oxalacetate Decarboxylase of Klebsiella pneumoniae J Biol Chem 263 9640 9645 Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Southern P J and Berg P 1982 Transformation of Mammalian Cells to Antibiotic Resistance with a Bacterial Gene Under Control of the SV40 Early Region Promoter J Molec Appl Gen 1 327 339 Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 2006 2010 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 42 invitrogen Corporate Headquarters Invitrogen Corporation 1
48. nerating entry clones Many entry vectors are available from Invitrogen to facilitate generation of entry clones We recommend pENTR D TOPO or pCR8 GW TOPO for rapid cloning of your gene of interest using TOPO technology see page vii for ordering information You may also perform a BP recombination reaction using a PCR product containing attB sites and an attP containing PDONR vector to create your entry clone A large selection of pDONR vectors is available from Invitrogen For more information go to www invitrogen com or contact Technical Service page 36 Refer to the manual for the specific vector you are using for detailed instructions to construct entry clones If you are using an Ultimate ORF open reading frame clone from Invitrogen as the source of your gene of interest you may do the following For N terminal tagged protein Use Ultimate ORF clones directly as an entry vector for LR recombination with pcDNA 3 2 capTEV NT V5 DEST to generate your entry clone For C terminal tagged protein e Do NOT use Ultimate ORF clones directly as an entry clone for LR recombination with pcDNA 3 2 capTEV CT V5 DEST to generate your entry clone due to the presence of the TAG stop codon e Use Ultimate ORF clone as a template to amplify the gene of interest using primers that modify the stop codon and clone the template without the stop codon into the entry vector of choice page 8 For more information about t
49. o express and analyze your recombinant biotinylated proteins of interest Step Action 1 Clone your gene of interest with and without a stop codon into a Gateway entry vector to create two entry clones 2 Generate two expression clones N and C terminally tagged by performing LR recombination reactions between the appropriate entry clones and the pcDNA 3 2 capTEV NT V5 DEST and pcDNA 3 2 capTEV CT V5 DEST vectors 3 Transfect each of the expression clones separately into the cell line of choice for expression of your biotinylated protein of interest 4 Confirm in vivo biotinylation of recombinant protein by SDS PAGE and detection on a Western blot using a streptavidin conjugate 5 Confirm complex formation with biotinylated recombinant protein by native gel electrophoresis and detection on a Western blot using a streptavidin conjugate 6 Purify the biotinylated protein and associated protein complexes using NativePure Affinity Purification Kit 7 Analyze protein complexes using native electrophoresis SDS PAGE immunodetection or mass spectrometry Methods Generating Entry Clones Introduction Choosing an Entry Vector Note To recombine your gene of interest into both pcDNA 3 2 capTEV NT V5 DEST and pcDNA 3 2 capTEV CT V5 DEST vectors you will generate two entry clones containing your gene of interest with and without a stop codon This section provides guidelines for ge
50. on selection you can generate a stable cell line expressing your construct Geneticin Guidelines is available separately from Invitrogen see page vii Use as follows 1 Prepare Geneticin in a buffered solution e g 100 mM HEPES pH 7 3 2 Use the predetermined concentration of Geneticin in complete medium 3 Calculate concentration based on the amount of active drug 4 Cells will divide once or twice in the presence of lethal doses of Geneticin so the effects of the drug take several days to become apparent Complete selection can take from 2 to 3 weeks of growth in selective medium Generating Stable Once you have determined the appropriate Geneticin concentration to use for Cell Lines selection you can generate a stable cell line expressing your expression construct 1 Transfect the mammalian cell line of interest with the pcDNA 3 2 capTEV expression construct using your transfection method of choice 24 hours after transfection wash the cells and add fresh growth medium without Geneticin 48 hours after transfection split the cells into fresh growth medium without Geneticin such that they are no more than 25 confluent If the cells are too dense the antibiotic will not kill the cells Antibiotics work best on actively dividing cells Incubate the cells at 37 C for 2 3 hours until they have attached to the culture dish Remove the growth medium and replace with fresh growth medium
51. orming SDS PAGE Use an appropriate percentage of acrylamide gel that will best resolve your proteins of interest The N terminal fusion tag including capTEV and V5 epitope tag adds approximately 12 5 kDa to the size of your protein The C terminal fusion tag including capTEV and V5 epitope tag adds approximately 15 1 kDa to the size of your protein Continued on next page 19 Detecting Native Protein Expression and Biotinylation continued Materials Needed 1X Lysis Buffer 20 You will need the following materials and equipment e Transiently transfected cells i e 24 hours after transfection e 1X phosphate buffered saline PBS see page vii e Complete protease inhibitor Roche cat no 1697498 or equivalent e Pepstatin Roche cat no 1359053 or equivalent e Deionized water e NativePure 5X Lysis Binding Buffer supplied with BN3006 or see below for buffer composition e Protein quantification kit such as Quant iT Protein Assay Kit page vii e Protein standards page viii e Optional Benzonase nuclease e NativePAGE gels page viii or equivalent for native electrophoresis e NuPAGE Novex Bis Tris Gels or Tris Glycine gels page vii for SDS PAGE e Appropriate units for electrophoresis and blotting e Streptavidin conjugate page vii e WesternBreeze Detection Kits page vii or equivalent For each experiment you will have 4 transiently transfected cell samples N and C terminal positiv
52. pcDNA 3 2 capTEV CT V5 1ul DEST 150 ng ul pENTR gus 50 ng ul a 2 ul TE Buffer pH 8 0 to 8 ul to 8 ul 5 ul 2 Remove the LR Clonase II enzyme mix from 20 C and thaw on ice 2 minutes 3 Briefly vortex the LR Clonase II enzyme mix twice 2 seconds each time To each sample add 2 1 of LR Clonase II enzyme mix Mix well by pipetting up and down 5 Incubate reactions at 25 C for 1 hour Add 1 lof Proteinase K solution to each reaction Incubate for 10 minutes at 37 C 7 Transform 1 lof the LR recombination reaction into a suitable E coli host follow the manufacturer s instructions and select for expression clones Perform transient transfection Transfect your NT and CT capTEV tagged expression clones into the mammalian cell line of choice page 16 Analyze proteins Confirm biotinylation of your protein and complex formation by Western detection page 18 Kit Contents and Storage Types of Kits Kit Components This manual is supplied with the kits listed below Product Catalog no NativePure pcDNA Gateway Vector Kit BN3002 NativePure Mammalian Affinity Purification Kit BN3006 The following table shows the components associated with the NativePure pcDNA Gateway Vector and Affinity Purification Kits listed above The NativePure Kits are shipped as described below Upon receipt store each item as
53. pes Simplex Virus Thymidine Kinase TK polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA Cole and Stacy 1985 fl origin Allows rescue of single stranded DNA SV40 early promoter and origin Allows efficient high level expression of the neomycin resistance gene and episomal replication in cells expressing the SV40 large T antigen Neomycin resistance gene Allows selection of stable transfectants in mammalian cells Southern and Berg 1982 SV40 early polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin Allows high copy number replication and growth in E coli Ampicillin bla resistance gene B lactamase Allows selection of transformants in E coli 34 Map of pcDNA 3 2 capTEV NT GW ARPC2 Map The map below shows the elements of the pcDNA 3 2 capTEV NT GW ARPC2 vector 6643 bp The plasmid was generated by performing an LR recombination reaction between an entry vector containing the ARPC2 gene and the pcDNA 3 2 capTEV NT V5 DEST vector The complete sequence of this vector is available for downloading from www invitrogen com or by contacting Technical Service page 36 Comments for pcDNA 3 2 capTEV NT V5GW ARPC2 6643 nucleotides CMV promoter bases 219 806 capTEV tag bases 863 1162 BioEase tag bases 863 1078 TEV cleavage bases 1091 1111 TEV cleavage
54. plates containing 100 ug ml ampicillin Continued on next page 13 Performing the LR Recombination Reactions continued LR Reaction 14 Follow this procedure to perform both LR reactions between each of your entry clones and pcDNA 3 2 capTEV V5 DEST vectors To include a negative control set up a second sample reaction but omit the LR Clonase II enzyme mix 1 Add the following components to 1 5 ml microcentrifuge tubes at room temperature and mix Component NT tag CT tag Positive Entry Clone Entry Clone Control Entry clone without stop 1 7 pl 50 150 ng rxn Entry clone with stop 1 7 ul 50 150 ng rxn pcDNA 3 2 capTEV NT V5 1 ul 1 ul DEST 150 ng l pceDNA 3 2 capTEV CT V5 1 pl DEST 150 ng ul pENTR gus 50 ng l 2 ul TE Buffer pH 8 0 to 8 ul to 8 ul 5 pl 2 Remove the LR Clonase II enzyme mix from 20 C and thaw on ice 2 minutes 3 Briefly vortex the LR Clonase II enzyme mix twice 2 seconds each time TM To each sample above add 2 ul of LR Clonase II enzyme mix Mix well by pipetting up and down Reminder Return LR Clonase II enzyme mix to 20 C immediately after use 5 Incubate reactions at 25 C for 1 hour Note Extending the incubation time to 18 hours typically yields more colonies 6 Add1 ul of the Proteinase K solution to each reaction Incubate for 10 minutes at 37 C 7 Transform 1 ul of the LR re
55. r more information on troubleshooting within the Gateway system refer to the Gateway Technology with Clonase II manual which is available from www invitrogen com or by contacting Technical Service Problem Possible Cause Solution Few or no colonies obtained from sample reaction Incorrect antibiotic used to select for transformants Recombinant reactions were not treated with Proteinase K Use ampicillin 100 ug ml to select for clones Treat reactions with Proteinase K before transformation High background in the absence of entry clone LR reaction transformed into an E coli strain containing the P episome and the ccdA gene Use an E coli strain that does not contain the F episome for transformation Deletion of the ccdB gene from the destination vector To maintain the integrity of the vector propagate in media containing ampicillin and 15 30 ug chloramphenicol Prepare plasmid DNA from one or more colonies and verify the integrity of the vector before use 26 Contamination of solution s with another plasmid with amp resistance or by bacteria carrying a resistance plasmid Test for plasmid contamination by transforming E coli with aliquots of each of the separate solutions used in the LR reaction Test for bacterial contamination by plating an aliquot of each solution directly onto LB amp plates Continued on next page Troubleshooting con
56. roteins and associated protein complexes expressed from vectors containing the capTEV tag e Streptavidin Agarose TM e NativePure Columns e Pre made ready to dilute lysis binding and cleavage buffers e AcTEV Protease TM e NativePure Concentrators For more information about each component and its use see the NativePure Affinity Purification Kit manual This manual is supplied with the NativePure Affinity Purification Kit but is also available for downloading at www invitrogen com The NativePure pcDNA Gateway Vector Kit is appropriate for use with established cell lines or cells that can be easily transfected The user must optimize transfection conditions and results may vary among cell types Continued on next page Overview continued How the System Works capTEV Tag To express your biotinylated protein of interest in mammalian cells construct N and C terminally tagged expression clones by performing LR recombination reactions between Gateway entry vectors containing the gene of interest and both pcDNA 3 2 capTEV V5 DEST vectors The resulting expression clones allow expression of N and C terminally biotinylated proteins bait protein in mammalian cells Since individual protein expression and biotinylation may vary with an N or C terminal fusion tag in your cell line it is necessary to construct both versions and determine which expression clone is best for your applica
57. shing Associates and Wiley Interscience Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Chapman Smith A and J E Cronan J 1999 Molecular Biology of Biotin Attachment to Proteins J Nutr 129 477S 484S Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Mol Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic Acids Res 15 1311 1326 Ciccarone V Chu Y Schifferli K Pichet J P Hawley Nelson P Evans K Roy L and Bennett S 1999 Lipofectamine 2000 Reagent for Rapid Efficient Transfection of Eukaryotic Cells Focus 21 54 55 Cole C N and Stacy T P 1985 Identification of Sequences in the Herpes Simplex Virus Thymidine Kinase Gene Required for Efficient Processing and Polyadenylation Mol Cell Biol 5 2104 2113 Felgner P L Gadek T R Holm M Roman R Chan H W Wenz M Northrop J P Ringold G M and Danielsen M 1987 Lipofectin A Highly Efficient Lipid mediated DNA transfection Procedure Proc Natl Acad Sci USA 84 7413 7417 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121
58. st Restriction site information for plasmid vectors is available at www invitrogen com Geneticin blocks protein synthesis in mammalian cells by interfering with ribosomal function It is an aminoglycoside similar in structure to neomycin gentamycin and kanamycin Expression in mammalian cells of the bacterial aminoglycoside phosphotransferase gene APH derived from Tn5 results in detoxification of Geneticin Southern and Berg 1982 To successfully generate a stable cell line expressing your protein of interest you need to determine the minimum concentration of Geneticin required to kill your untransfected host cell line Test a range of concentrations see protocol below to ensure that you determine the minimum concentration necessary for your cell line 1 Plate or split a confluent plate so the cells will be approximately 25 confluent Prepare a set of 6 7 plates Add the following concentrations of antibiotic to each plate 0 50 125 250 500 750 and 1000 ug ml Geneticin 2 Replenish the selective media every 3 4 days and observe the percentage of surviving cells 3 Count the number of viable cells at regular intervals to determine the appropriate concentration of antibiotic that prevents growth within 1 3 weeks after addition of the antibiotic Continued on next page 29 Creating Stable Cell Lines continued Geneticin Once you have determined the appropriate Geneticin concentration to use for Selecti
59. the use and distribution of Gateway clones see the section entitled Gateway Clone Distribution Policy on page 40 This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany This product is licensed under U S Patent No 5 532 142 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any acti
60. tinued Protein The table below lists some potential problems and solutions for troubleshooting Expression protein expression from your pCDNA 3 2 capTEV expression construct Problem Possible Cause Solution Recombinant protein not Poor transfection efficiency e Make sure your cells are healthy expressed from either prior to transfection pcDNA 3 2 capTEV e Optimize transfection conditions expression clone for the method you are using e Use Lipofectamine 2000 for transfecting your cells see page 17 Incorrect detection method Use streptavidin conjugated to alkaline phosphatase or horseradish peroxidase page vii followed by Western detection method of choice Gene of interest not in frame with Make sure that the gene of interest is in capTEV Tag frame with the capTEV Tag as shown on pages 11 12 Recombinant protein not No Kozak consensus sequence Make sure a Kozak consensus sequence expressed from added to C terminal fusion is present in your entry clone design pcDNA 3 2 capTEV CT see page 9 expression clone Stop codon inserted Make sure no stop codon is at the end of your gene see page 9 Gene of interest not in frame with Make sure that the gene of interest is in TM capTEV Tag frame with the capTEV Tag as shown on pages 11 12 Continued on next page 27 Troubleshooting continued Protein The table below lists some potential problems and
61. tion Perform transfection of the ppDNA 3 2 capTEV N and C terminally tagged expression clones into mammalian cells to allow expression of biotinylated proteins and complex formation Cells are lysed and the lysates are analyzed using Western analysis with a streptavidin conjugate to verify biotinylation of the protein of interest The lysates are also analyzed using native gel electrophoresis to verify complex formation with the protein of interest After optimizing the expression and biotinylation of the bait protein of interest the biotinylated protein and associated protein complexes are purified under native conditions using the NativePure Affinity Purification Kit supplied with cat no BN3006 only also available separately from Invitrogen The associated complexes are analyzed by Western detection or mass spectrometry The NativePure pcDNA Gateway Vectors allow N and C terminal fusion of your recombinant protein of interest to the capTEV Tag The capTEV Tag consists of a BioEase in vivo biotinylation peptide two Tobacco Etch Virus TEV protease recognition sites and a 6XHis tag recombinant protein biotin 6XHis TEV TEV BioEase TEV cleavage sites The capTEV tag facilitates in vivo biotinylation of the recombinant bait protein of interest The biotin tagged protein of interest forms complexes in your cell line of choice which can be purified by binding to streptavidin agarose The TEV sites
62. tions is achieved using the streptavidin agarose included with the NativePure Affinity Purification Kit The biotin tagged protein and associated protein complexes may be analyzed by native gel electrophoresis or other techniques such as mass spectrometry The NativePure Mammalian Affinity Purification System when combined with mass spectrometry provides a novel experimental approach to identify interacting proteins for proteome analysis or examine protein complexes that are part of specific cellular pathways differentiation stages or cell types Continued on next page Overview continued System Components Note The NativePure Mammalian Affinity Purification System consists of two kits the NativePure pcDNA Gateway Vector Kit and NativePure Affinity Purification Kit The NativePure pcDNA Gateway Vector Kit includes e Gateway adapted vectors that allow you to clone your gene of interest in frame with an N terminal or C terminal capTEV tag that allows in vivo biotinylation of your protein See next page for a description of the capTEV tag e Acontrol vector expressing the ARPC2 actin related protein complex component p34 Robinson et al 2001 gene fused to the capTEV tag at the N terminal end is included for use as a positive control for expression in the mammalian cell line of choice The NativePure Affinity Purification Kit contains the following components to allow purification of biotinylated p
63. to accept return of the product with a full refund For information about purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail outlicensing lifetech com The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The purchase of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchased from Life Technologies Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of ClonaseTM purchased from Life Technologies Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c materials made by the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its
64. vailable from www invitrogen com or by contacting Technical Service page 36 For affinity purification of native protein complexes expressed using the NativePure Gateway Vector Kits use the Streptavidin Agarose included in the NativePure Affinity Purification Kit or Streptavidin Agarose cat no S 951 page vii Use of other commercially available streptavidin agarose may not provide optimal binding and recovery of protein complexes TM The NativePAGE Novex Bis Tris Gel system is a near neutral pH pre cast polyacrylamide mini gel system to perform native non denaturing electrophoresis The NativePAGE Novex Bis Tris Gel system provides a sensitive and high resolution method for analysis of native membrane protein complexes native soluble proteins molecular mass estimations and determining the purityof native proteins For more information about the NativePAGE Gels see page vii or go to www invitrogen com 25 Troubleshooting Introduction The following sections list potential problems and solutions for problems you may encounter in your experiments For more information to troubleshoot affinity purification refer to the NativePure Affinity Purification manual supplied with cat no BN3006 or available at www invitrogen com or by contacting Technical Service LR Recombination Reaction The table below lists some potential problems and solutions for troubleshooting your LR recombination reactions Fo
65. vity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 re sale of the product or its components whether or not such product or its components are resold for use in research Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned by Life Technologies Corporation and claiming this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions The inform
66. w continued Features of the Vectors The pcDNA 3 2 capTEV V5 DEST vectors contain the following elements Human cytomegalovirus immediate early CMV promoter enhancer to control expression of your gene of interest in a wide range of mammalian cells N or C terminal capTEV Tag for in vivo biotinylation and affinity purification of recombinant proteins and associated complexes The capTEV tag consists of e BioEase Tag for in vivo protein biotinylation e 2 Tobacco Etch Virus TEV protease recognition sites to remove bound biotinylated protein complexes after affinity purification with streptavidin agarose e 6XHis tag for potential purification of protein complexes after TEV cleavage N or C terminal V5 epitope tag for detection of recombinant protein using anti V5 antibodies Two recombination sites attR1 and attR2 for recombinational cloning of the gene of interest from an entry clone The ccdB gene located between the two attR sites for negative selection Chloramphenicol resistance gene located between the two attR sites for counterscreen The Herpes Simplex Virus HSV thymidine kinase polyadenylation signal TKpA for proper termination and processing of the recombinant transcript fl intergenic region for production of single strand DNA in F plasmid containing E coli Neomycin resistance gene for selection of stable cell lines with Geneticin pUC origin for high copy replication and maintenance of plasmid in E coli Ampici
67. your results Once you have generated your expression vectors isolate plasmid DNA for transfection Plasmid DNA for transfection into eukaryotic cells must be clean and free of contamination from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the PureLink HQ Mini Plasmid Purification Kit page vii Other methods of obtaining high quality plasmid DNA may be suitable The NativePure pcDNA Gateway Vector Kits contain a positive control plasmid pcDNA 3 2 capTEV NT GW ARPC2 expressing the ARPC2 actin related protein complex component p34 Robinson et al 2001 with an N terminal capTEV tag The control vector is supplied lyophilized Resuspend the vector in 10 ul TE or sterile water to a final concentration of 1 ug ul You can transfect mammalian cells with this stock or propagate and maintain the plasmid as described below 1 Use 1 ul of the control vector to transform a recA endA E coli strain like TOP10 DH5a or equivalent 2 Select transformants on LB agar plates containing 100 pg ml ampicillin 3 Prepare a glycerol stock of a transformant containing plasmid for long term storage see previous page for a protocol for preparing glycerol stocks Continued on next page Transient Transfection continued Methods of Transfection Transient vs Stable Transfect
68. ypropylene columns 10 NativePure Concentrator Includes a concentrator fitted 10 with a membrane and a filtration chamber NativePure The following reagents are included in the NativePure AcTEV Protease Module AcTEV Protease supplied with cat no BN3006 only Store at 20 C Module Reagent Composition Amount AcTEV Protease 10 U pl AcTEV Protease in 400 ul 50 mM Tris HCI pH 7 5 1mM EDTA 5 mM DTT 50 v v glycerol 0 1 w v Triton X 100 100 mM DTT 100 mM DTT in deionized water 500 ul vi Additional Products Accessory Products Some of the reagents supplied in the NativePure pcDNA Gateway Vector Kit as well as other products suitable for use are available separately from Invitrogen For more information go to www invitrogen com or contact Technical Service see page 36 Product Amount Catalog no pENTR D TOPO Cloning Kit 20 reactions K2400 20 pCR8 GW TOPO TA Cloning Kit 20 reactions K2500 20 Gateway LR Clonase II Enzyme Mix 20 reactions 11791 020 100 reactions 11791 100 One Shot TOP10 Chemically Competent Cells 10 reactions C4040 10 One Shot TOP10 Electrocompetent Cells 10 reactions C4040 50 One Shot ccdB Survival T1 Chemically Competent Cells 10 reactions C7510 03 LB Media 500 ml 10855 021 Ampicillin 200 mg 11593 027 PureLink HQ Plasmid Miniprep Kit 100 reactions K2100 01 Lipofectamine 2000 0 75 ml 11668 027 Geneticin

NativePure pcDNA Gateway Vector Kit

Contents

Download Pdf Manuals

Related Search

Related Contents