pEco™-suCMV-nHis-(Neo)
Contents
1. 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com pEco suCMV nHis Neo PCR cloning Kit User Manual Patent pending Cloning PCR products for mammalian expression of N term His tagged protein Cat Contents Amounts Application pEco suCMV nHis Neo 10 tubes x 50ul ea vector built in Eco Cloning for 10 rxn Mammalian expression IC 1002 cells of N term His tag Positive PCR insert 1 x 10ul ea protein Sequencing primer pair Forward and reverse 15ul each 25ng ul Storage Eco Cloning Kit is shipped on dry ice Upon received stored at 80 C Once thawed must be used do not re freeze Product should be stable for 6 months Product Description 1 Introduction The revolutionary Eco Fusion in vivo cloning method is the easiest PCR cloning method available 1 Simply amplify your gene of interest with a primer pair that is flanked with short arms homologous to the expression vector 2 Add iul of purified PCR into the engineered vector build in cloning cells 3 Immediately proceed to transformation 2 How it works The engineered E Coli strain in GenTarget s Eco PCR Cloning Kit has an enhanced E Coli competent cells enabling an in vivo joining reaction for cloning with no tube reactions Let the E Coli do the job for you In Vivo GenTarget provides E Coli cloning cells with a selection of built2. Following lysis run a gel protein analysis Purification use your favorite protocol and reagent to purify the expressed His tagged protein by affinity chromatography 6 Vector maps The figure below summarizes the vector map of pEco suCMV nHis neo The complete nucleotide sequence is available for downloading from our Website at Support page www gentarget com To make your clone map simply paste your gene sequence not including the flanking sequences of both ends in the Red highlighted position showed below replacing the NNNN NN In most case the pasted sequence is ATG to last codon Cloning site for pEco suCMV nHis Neo vector GCAAAGGGCA ATTCTGCAGA AAGCTTACCG AATTCACCATG GcG CAT CAC CGTTTCCCGT TAAGACGTCT TTCGAATGGC TTAAGTGGTAC ccc GTA GTG His ag PCR Insert CAT CAT CAT CATNNNNNNNN NTAGACGCGT GTTAACCTGC TAACAAGTGG GTA GTA GTA GTANNNNNNNN NATCTGCGCA CAATTGGACG ATTGTTCACC pEco suCMV nHis Neo PCR manual Page 6 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Map of pEco suCMV nHis Neo vector GOI cloning ends BGH Poly pEco suCMV nHis Neo 5495 bp pUC19 ori suCMV 117 953 GOI cloning ends 1012 1013 BGH polyA 1088 1315 SV40 promoter F1 ori 1361 1789 SV40 promoter 1843 2125 Neo 2200 2994 SV40 polyA 3168 3298 pUC19
3. ces must be in frame and set between the homologous leader and the 20bp gene specific sequence An example of PCR primer design To design the primer pair for the following gene sequence atggcctctgtgaaggaaaatccactctagtccctacctgcatttctcagccttgct tacctgttgccaacattgggccaacccgaattcttcccaatctttatcttggctgcca gcgagatgtcctcaacaaggagctgatgcagcagaatgggattggttatgtgtta aatgccagcaatacctgtccaaagcctgacttttta The PCR primer for vector pEco suCMV nHis will be pEco suCMV nHis Neo PCR manual Page 3 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 ell arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Fwd 5 tttgtacaaaaaagcaggcaccatggcctctgtgaaggaaaatcc Rev 5 tttgtacaagaaagctgggttaaagtcaggctttggacagg If inserting a protein cleavage site the Forward primer will be Fwd 5 catgcatcatcaccatcatcatcaINNNNNN atggcctctgtgaaggaaaatcc where the NNNNNN is the in framed codon sequence of cleavage site Notes 1 GenTarget s cloning kits with the same terminal tags share PCR insert sites The three Eco cloning kits with N terminal tags Cat IC 1001 IC 1002 and IC 1003 can share the same PCR insert and the two cloning kits with C terminal tags Cat IC 1006 and IC 1007 can share the same PCR insert 2 A stop codon does not need to be included in the PCR reverse primer since a stop codon is already built in immediately after the PCR inser
4. e Res 4 172 177 3 Kaluz et al Nucl Acids Res 1992 20 4369 4370 Related Products Cat Product Name Amount Application PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression IC 1001 PCRcloningkit kit f Nterm His tagged protein PCR cloning kit with a built in vector non T7 promoter based in provided cloning cells for E Coli expression of N term His tagged protein specially designed for toxic proteins IC 1003 PCRcloningkit kit PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression IC 1004 PCReloning kit kit f N term GST tagged protein PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression IC 1006 PCReloningkit kit 0f Cterm His tagged protein PCR cloning kit with a built in mammalian expression vector with Neomycin selection marker in provided cloning cells for mammalian expression of C term His tagged protein IC 1007 PCR cloning kit kit pEco suCMV nHis Neo PCR manual Page 8 of 8 www gentarget com GenTarget Inc Copyrights 2015
5. hang the extra A overhang if it exists will be removed in the cloning step e Can be used with PCR products of varying sizes from 200 bp to 10 kb The same PCR product can be used to construct multiple different expression vectors e Engineered E Coli and mammalian expression vectors for high protein yields e Great for high throughput cloning pEco suCMV nHis Neo PCR manual Page 2 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com 4 Protocol Outline Produce and clean PCR products Vv Add 1 2 ul of PCR product into the cloning cells provided briefly mix and immediately proceed to transformation Y Pick colonies save glycerol stocks and isolate plasmids by miniprep to verify the positive clones Yv Express protein from the saved glycerol stock 5 Detailed Protocol 1 PCR primer design PCR primers used for generating inserts for Eco Cloning must contain a 20 25bp homologous sequence corresponding to the built in vector Design your primer pair as follows Fwd 5 catggcgcatcaccatcatcatcat 20bp of 5 end gene specific forward sequence Rev 5 ttgttagcaggttaacacgcgtcta 20bp of 3 end gene specific reverse sequence A protein cleavage site may be included in the forward primer to allow excision of the N term tag if desired Its codon sequen
6. in vectors for mammalian or E Coli expression systems A proprietary process for making ready to use E Coli cells with built in vectors ensures low background and a positive cloning rate of greater than 90 pEco suCMV nHis Neo PCR manual Page 1 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Or i 5 1 Target PCR Add PCR to cells K e a ap _ Transformation Q c gt peer In vivo cloning 8 pEco suCMV nHis Neo cloning cells was built in with a proprietary suCMV promoter for maximum expression yield PCR insert will be cloned in framed with a N terminal His tag Vector contains a SV40 promoter driven neomycin selection maker allowing select stable cells for long term expression 3 Key Features e The easiest and most cost effective PCR cloning method available Simply add iul of PCR insert into provided cells for transformation regardless of the insert s size and concentration e No need to buy vectors and no tedious bench work preparing a vector backbone e No need to buy cloning competent cells e No need for any enzymes or any tube reactions e Precisely directional cloning of PCR products without any extra amino acids except the affinity tag N term 6His e Compatibility with any PCR product with or without a 3 A over
7. ining 100 ug ml ampicillin Grow colonies at 37 C overnight Note In the absence of a PCR insert cells usually form background colonies the no insert negative control also generates a few colonies In the presence of PCR insert however gt 90 colonies are positive Colony number varies depending on the quality and quantity of the PCR products The concentration of purified PCR product can be from 20 ng ul to 150 ng ul with sizes ranging from 200 bp to 10 kb For simplicity and particularly for high throughput cloning we recommend adding 1 2 ul of PCR product into the cloning cells Regardless of the PCR product s concentration and size it will generate enough colonies 5 100 colonies in general for downstream work 4 Save glycerol stocks for later expression and verification of positive clones Pick 2 5 colonies propagate in LB Amp and incubate at 37 C overnight Save an aliquot of each clone in LB Glycerol medium containing 100 ug ml ampicillin at a final concentration of 15 Glycerol Isolate the plasmid DNAs using a DNA miniprep kit Confirm the positives by restriction digestion i The PCR insert can be cut out at two unique sites EcoRI Hpal ii Run a 1 2 agarose gel You should see two bands 4 kb backbone the PCR insert or multiple bands when the cuts exist within the PCR insert Final sequencing verification Use the provided sequencing primer pair The sequencing primer comes in a ready to use di
8. lution use 1ul for each sequencing reaction with 500ng plasmid in 20ul volume Cat Vector Forward primer Reverse primer IC 1002 pEco suCMV _ IC 1002 fwd IC 1002 rev nHis neo 5 gatttaggtgacactatag 5 tagaaggcacagtcgagg 5 Protein expression Once positive clones are confirmed they can be used directly for protein expression without re transformation into another strain Add 10 ul of your positive clones in 4ml of LB medium with 100ug ml ampicillin grow at 37 C overnight shaking 225 250 rpm pEco suCMV nHis Neo PCR manual Page 5 of 8 www gentarget com GenTarget Inc Copyrights 2015 t 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com The next day measured OD should be approximately 1 2 Inoculate a large volume by making a 1 100 dilution of overnight culture in LB or SOB medium containing 100 ug ml ampicillin Grow the cultures at 37 C with shaking to an OD600 0 5 Induce expression by adding L arabinose in a range of final concentrations from 0 2 to 0 00005 to find the concentration for optimal expression Remove a 1 ml aliquot of cells from each tube for analysis of protein expression Be sure to save aliquots of uninduced control samples Analyze protein expression by SDS PAGE or other methods Harvest cells by centrifugation Lyse the cell pellet using lysis reagent
9. ori 3681 4354 Amp 5359 4499 7 Troubleshooting Problems Solution No colony Be sure to set up a positive control transformation using the provided positive PCR insert1 which should give you 10 100 colonies Spread all of the transformation mixture onto the plate pa Background Be sure to set up a background control plate in which no colonies PCR product was added to the cells It should generate 0 5 colonies or less than 10 compared to plates with the insert Note in the absence of a PCR insert cells force vector self ligation resulting in a few background colonies Make sure that the PCR s template does not cause background colonies If it does clean PCR products by gel isolation or treatment with DPNI Plate less transformation mixture onto the plate Satellite Be sure to use the right amount of antibiotics in the LB colonies plate and make fresh LB plates if necessary Use carbenicillin instead of ampicillin if applicable Do not incubate plates longer than 16 hours pEco suCMV nHis Neo PCR manual Page 7 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Try to avoid picking the tiny satellite colonies References 1 Oliner et al 1993 Nucleic Acids Res 1 5192 97 2 Aslanidis et al 1994 Genom
10. t 2 Target amplification by PCR Amplify your target using any PCR amplification protocol that works for you To minimize PCR errors we recommend using high fidelity DNA polymerase Use any PCR purification column to clean your PCR products If you do not obtain a single discrete band from PCR gel purify your fragment Important if your PCR template can generate background clones having Amp resistance treat the PCR product with DPNI or perform gel purification 3 Transformation Thaw Eco Cloning cells in ice water After they are completely thawed add 1 2 ul purified PCR product from 20ng to 150ng into each vial of cells and mix briefly by tapping the tube with your finger For control vials add 1ul positive PCR insert provided as a positive control and then add ul water to a negative control cells vial Put tubes back on ice and proceed to heat shock at 42 C for 40 seconds Note Do not leave DNA cells mixture on ice for prolonged period less than 15min are fine Put tubes back on ice for 1 min add 250 pl of SOC medium and incubate at 37 C shaking for 1hr pEco suCMV nHis Neo PCR manual Page 4 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Plating take a 50 pl 200 pli aliquot spread out on pre warmed LB agar plates conta
Download Pdf Manuals
Related Search
pEco pecos login pecos lookup peacock pecorino pecorino romano pecos medicare pecorino cheese pecos enrollment pecos texas pecos bill pecora pecos portal log in pecorino romano cheese pecos league peco energy pecos opedge peco outage map peco energy company peco bill pay peco pallet peconic bay medical center pecos bill disney pecoma pathology outlines peco log in peco customer service number