miR-KO System User Manual
Contents
1. Genotypirig erit ete iens 13 IV Validation Data for miR KOS 16 A High frequency of double 16 B Permanent and complete Knockouts 17 V References ues aaa ential 18 VI Technical raras 18 VII Licensing and Warranty 19 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual Introduction Overview of miR Knockouts miR KO MicroRNAs miRNAs evolutionarily conserved transcriptional regulators that induce translational repression and mRNA destabilization Various technical tools have been developed to probe the functions of miRNAs yet such tools e g antisense oligos have been limited by low efficiency and specificity Although genetic knockouts are considered the gold standard for abolishing and studying gene function the traditional transgenic methodology is less efficient and not readily applicable to most cultured somatic cells or disease models 1 2 Engineered nucleases cleave chromosomal DNA in a site specific manner thus producing a DNA double strand break DSB which in turn triggers either nonhomologous end joining NHEJ or homology directed repair HDR to confer gene knockout with high efficiency To achieve miRNA specific knockouts we developed a transcription activator like effec2. SBI System Biosciences miR KO System TALENs and Matched HR Vectors Cat MIR KO XXX MIR KO XXXHR 1 User Manual Grow bacterial stock on receipt Make plasmid DNA for experiments A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual miRNA KO Cat MIR KO XXX MIR KO XXXHR 1 Contents 1 d troductiOri cirea ERR etes 2 A Overview of miR Knockouts 2 B Available miR KO TALE Nucleases Corresponding HR Donor Vectors and Stable Cell Lines 5 C Additional Required Materials eenen 7 D Related Producis nana 7 Il Protocol for using miR KOs without HR Donor Vector 8 A How to use miR KOs to disrupt miRNA seed region 8 B Propagation of miR KOS 8 C Transfection of miR KOs into target 9 D Screening for indels in miRNA seed region 10 III Protocol for use of miR KOs with HR Donor Vector 11 A How to use miR KOs with miR specific HR vector to remove entire MIRNA hairpin 11 Transfection of miR KOs into target 11 C Selection for HR events 13
3. region whereas the Pir and P2f are donor plasmid specific primers Page 14 ver 1 20140620 www systembio com miRNA KO Cat MIR KO XXX MIR KO XXXHR 1 S e mw X X X XV X ww 1500 bp 1200 bp a qm c 1000 bp gt 900 bp 7 800 bp J Y Y Pif Pir P2f P2r 830 bp 1281 bp Figure 5 Genotyping by junction PCR analysis using EZ Genotyping Kit Amplification of genomic DNA from Clone 1 shows no predicted PCR products indicating no HR events occurred or random integration of donor whereas Clone 2 and Clone 3 exhibit correct junction PCR products confirming HR integration Genotyping for double knockouts To completely knock out a miRNA gene in diploid cells both miRNA alleles must be disrupted Because NHEJ occurs more frequently than HR events most selected cells will be double knockouts with the second allele being disrupted by NHEJ mediated mutation Fig 3 In some cases both miRNA alleles are removed by an HR event Fig 6A clone 5 Genotyping PCR can be used to detect HR events Clones that reveal one HR modified allele can be further tested by amplifying and sequencing of the miRNA seed region Fig 6B 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual MM WT 1 5 6 7H HR 1231 bp WT NHEJ 1067 bp jeed region TCGGGT AGC TTAT CAGACTGATGTTGACTGT
4. transfection pool please see Section D below Screening for indels in miRNA seed region The percentage of alleles carrying indels within the miRNA seed region can be assessed with a commercial genotyping kit e g EZ Genotyping Kit SBI Cat GE200A 1 or by High Resolution Melt Analysis HRMA analysis 4 keeping in mind that TALE nucleases typically cut the mammalian genome with a frequency of 0 5 40 The efficiency varies greatly depending on the cell type s being targeted as well as the transfection method employed After transfection isolating bi allelic knockouts requires single cell derivation serial dilution approaches http csmedia2 corning com LifeSciences Media pdf Single_ cell cloning protocol pdf single cell sorting followed propagation of the clone and finally screening of clones via PCR and Sanger sequencing While it is possible to screen for these knockouts via genotyping of single cell derived clones the process can be laborious and time consuming Thus we recommend combining miR KOs with an HR donor vector pre made and available for each miR TALE nuclease pair to greatly simplify screening for bi allelic knockouts Page 10 ver 1 20140620 www systembio com miRNA KO Cat MIR KO XXX MIR KO XXXHR 1 lll Protocol for use of miR KOs with HR Donor Vector A How to use miR KOs with miR specific HR vector to remove entire miRNA hairpin Combining miR KOs with a pre made HR donor
5. vector is a convenient way to generate miRNA double knockouts The HR vector arms are designed to delete the entire miRNA stem loop structure 70 200 bp The HR donor vector includes an insulated cassette for RFP and puromycin markers to allow positive selection by drug treatment and or fluorescent activated cell sorting This approach has been shown to be highly efficient for generating bi allelic miRNA knockouts 3 B Transfection of miR KOs into target cells Depending on the cell type being transfected please choose a transfection protocol that results in maximal transfection efficiencies For adherent cell lines such as HEK293T passive transfection methods using cationic lipid based methods e g Lipofectamine 2000 3000 FuGene HD work well For other types of cells such as primary stem or suspension cells we suggest transfection using electroporation methods NucleoFection or Neon for optimal results 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual Note 1 For HEK293T cells we suggest 0 5 1 0 ug of each miR KO plasmid 1 2 ug total for miR KO pair and 1 ug of the HR donor vector For other cell types we suggest optimizing the amounts of plasmid DNA Note 2 The plasmids should be mixed well in minimal serum no antibiotic media plus cationic lipid transfection reagent or electroporation buffer to maximize efficiency of delivery Note 3 For selection of target ce
6. 000 FuGene HD work well For other types of cells such as primary stem or suspension cells we suggest transfection using electroporation methods e g NucleoFection or Neon for optimal results Note 1 For HEK293T cells we suggest 0 5 1 0 ug of each miR KO plasmid 1 2 ug total for miR KO pair for efficient cleavage For other cell types we suggest optimizing the amounts of plasmid DNA Note 2 The plasmids should be mixed well in minimal serum no antibiotic media plus cationic lipid transfection reagent or electroporation buffer to maximize plasmid delivery 1 Plate 150 000 to 200 000 cells e g 293T cells into a single well of a 12 well plate in 1 ml of appropriate growth medium Include a single well of cells as negative control which can be non relevant plasmid DNA 2 Next day or when cells are 50 60 confluent co transfect target cells with miR KO pair using a suitable transfection reagent or method following the manufacturer s recommended protocol for 12 well plates 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual 3 Allow at least 12 hours before changing transfection media to complete growth media 4 Assay for miR KO functionality at 48 96 hours after co transfection General cutting efficiency of miR KOs can be measured by Surveyor Nuclease Assay For more thorough analysis of targeted cells single cell colonies will need to be derived from the initial
7. TGAATCTC WT TCGGGT C ATCAGACTGATGTTGACTGTTGAATCTC 1 TCGGGC TGAATCTT CAGACTGATGTTGACTGTTGAATCTC 7H Figure 6 Genotyping of selected clones A PCR to detect HR integration in one or both alleles B Clones that display one HR event typically display mutated seed regions in the other allele Validation Data for miR KOs A High frequency of double knockouts miR KOs combined with HR donor vectors have been shown to be highly efficient in generating double miRNA knockouts 3 For example a miR KO strategy against human miR 21 in HEK293T cells resulted in 30 puromycin resistant lines out of 96 single cell derived clones Subsequent PCR based genotyping of 23 successful PCR amplifications revealed that 96 22 23 were mono allelic i e one allele with HR and other with NHEJ or WT Page 16 ver 1 20140620 www systembio com miRNA KO Cat MIR KO XXX MIR KO XXXHR 1 and 4 1 23 were bi allelic e g both alleles undergone HR for HR induced miR 21 deletion Furthermore sequencing of PCR products spanning the targeted seed region of miR 21 revealed that 91 10 11 were NHEJ modified Taken together these results show a 87 bi allelic modification rate 20 out of 23 clones when the miR KOs are combined with HR donor vector 3 B Permanent and complete knockouts To confirm complete loss of miRNA expression we quantified miR 21 expression in three independent miR 21 double knockouts Clone 1 and 7 carry one deletion of
8. arget genes thus indels within the miRNA seed region completely abolish miRNA function If there is a highly efficient transfection protocol available for the specific target cells one may use miR KOs alone to induce indels However screening for bi allelic Knockouts can still be laborious In case of difficult to transfect cells or genomic loci not easily accessible we suggest combining miR KOs with pre made HR donor vectors please refer to Table Il for available vectors for enrichment of genetically modified cells For more information please see Section III pg 12 for using miR KOs with HR donor vectors Propagation of miR KOs miR KOs act as pairs because the nucleases need to dimerize in order to cut DNA Left and right miR KOs are shipped as two separate E coli streaks We recommend propagating the two plasmids prior to starting the experiments Bacteria can be grown at 37 C overnight in LB medium containing 50 ug ml of carbenicillin After overnight growth plasmid DNA can be isolated from culture using an endotoxin free DNA plasmid kit Page 8 ver 1 20140620 www systembio com miRNA KO Cat MIR KO XXX MIR KO XXXHR 1 Transfection of miR KOs into target cells Depending on the cell type being transfected please choose a transfection protocol that results in maximal transfection efficiencies For adherent cell lines such as HEK293T passive transfection methods using lipid based methods e g Lipofectamine 2000 3
9. gure 1 Design of miR KOs A miR KOs disrupt the miRNA seed region B Pairing miR KOs with an HR donor replaces the entire miRNA hairpin structure with an insulated selectable marker cassette While the use of miR KOs alone can successfully abolish miRNA function screening for bi allelic indels can be laborious Due to the small changes seen with indels many clonal lines have to be established through limited dilution or single cell sorting techniques and subsequently genomic DNA is PCR amplified cloned into vectors and subjected to genotyping by Sanger sequencing Since many cells will only have either zero or one alleles modified tremendous work is often required to obtain bi allelic indels Fig 3 Left Panel 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual To facilitate the screening process one may combine miRNA specific TALE nucleases with HR donor vectors Fig 1B which enables positive selection and convenient screening of targeted cells Fig 2 Because NHEJ occurs more frequently than HR donor integration the majority of cells that undergo HR integration on one allele carry an indel in the miRNA seed region of the second allele This strategy has been shown to be highly efficient in generating bi allelic miRNA knockouts Fig 3 3 Phase RFP Figure 2 A positive selection strategy reveals puromycin resistant and RFP positive single cell derived colonies maj
10. lls we recommend testing different concentrations of puromycin on untransfected cells to determine the optimal concentration which should kill 90 100 of cells within 48 72 hours after drug administration 1 Plate 150 000 to 200 000 cells e g 293T cells into a single well of a 12 well plate in 1 ml of appropriate growth medium Include a single well of cells as negative control which can be non relevant plasmid DNA 2 Next day or when cells are 50 60 confluent co transfect target cells with miR KO pair using a suitable transfection reagent or method following the manufacturer s recommended protocol for 12 well plates 3 Allow at least 12 hours before changing transfection media to complete growth media 4 48 96 hours after co transfection sort cells using FACS or start Puromycin selection please see Section C below Page 12 ver 1 20140620 www systembio com miRNA KO Cat MIR KO XXX MIR KO XXXHR 1 C Selection for HR events Select for HR events by puromycin or by FACS based sorting for RFP When using selection by puromycin grow single cell under puromycin pressure for a minimum of 20 days to obtain enough cells for genotyping and storage Using FACS based sorting for the RFP marker assay for positive HR events using approximately 25 000 positive sorting events as a minimum for genotyping analysis please see Section D below and assessing the percent of cells that have undergone homologous recombi
11. nation Note The percentage of alleles carrying indels within the miRNA seed region can be assessed with a commercial genotyping kit e g EZ Genotyping Kit SBI Cat GE200A 1 or High Resolution Melt Analysis HRMA analysis HR efficiency can be determined via FACS analysis as 96 of RFP positive cells D Genotyping Genotyping for HR event via junction PCR Genotyping of selected cells can be done by PCR of genomic DNA insert junctions at 5 and or 3 ends of HR site Figure 4 Design PCR primer pairs with one of the primers in the genomic 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual DNA region and the other located in the HR vector 3 In this way only positive HR events will result in correct PCR products whereas random integration or no HR cells will not produce PCR products Figure 5 shows the positive and negative clones using EZ Genotyping Kit to confirm HR events Donor vector 9m LoxP X insu EFL 2A Puro polyA nsu LoxP 5 gt A MOO 3 WT Locus 3 5 Mir XXX 5 T am 7 3 lo vs EFL A Lox E D Sam o Par o arm 5 830bp 1281bp P1f Pir P2f P2r Figure 4 Schematics of primer location to confirm HR donor integration The primers of P1f and P2r are located outside the 5 or 3 arm
12. ority of which are double knockouts i e HR event on one allele and indel in seed region of second allele Page 4 ver 1 20140620 www systembio com miRNA KO Cat MIR KO XXX MIR KO XXXHR 1 Cells in Culture 5 Transfection TALEN Pairs TALEN Pairs HR Donor aad Selection Non discriminated Screening aD PCR Genotyping 5 Screening Subcloning PCR product and PCR Genotyping sequence confirmation And or direct sequencing Figure 3 Overview of miR KO strategies with miR KOs alone and in combination with an HR donor vector The HR donor vector enables positive selection which allows for simple and efficient generation of cells harboring double knockouts Available miR KO TALE Nucleases Corresponding HR Donor Vectors and Stable Cell Lines miR KO TALE Nuclease pairs were assembled into CMV driven expression cassettes using the EZ TAL Assembly Kit Cat GE100A 1 SBI 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual A complete list of currently available miR KO TALE Nucleases HR Donor Vectors and Complete Kits can be viewed here http www systembio com microrna research microrna knockout mirko ordering Product Formats MIR KO XXPA 1 miR KO hsa miR XX 2 x Bacterial TALE Nuclease pair Streaks MIR KO XXHR 1 miR KO hsa miR XX 1 x Bacterial HR Donor Vector Dual Streak Selection RFP Pu
13. ro MIR KO XXPA miR KO hsa miR XX 1 Kit contains 3 x KIT Complete Kit includes Bacterial Streaks TALE Nuclease pair and HR Donor Vector MIR KO 293 PL HEK 293 Control Line 2x10 6 cells vial RFP negative puromycin sensitive miR KO MIR21 Stable hsa miR 21 2x10 6 cells vial Knock Out HEK 293 Cell Line RFP positive puromycin Page 6 ver 1 20140620 www systembio com miRNA KO Cat MIR KO XXX MIR KO XXXHR 1 resistant Additional Required Materials 1 Zyppy Endo Free Plasmid Maxiprep Kit Zymo Research Irvine CA D4028 2 LB Broth Teknova L8000 3 Carbenicillin Teknova C2130 4 1kb Plus Ladder Life Technologies 10787 018 5 Lipofectamine 2000 or 3000 Life Technologies 11668 027 L3000 008 6 Lonza NucleoFector Neon Electroporation for difficult to transfect cells Related Products 1 EZ Genotyping Kit Cat GE200A 1 2 EZ TAL Assembly Kit Cat GE1xxA 1 3 PrecisionX HR Targeting Vectors Cat HR1xxPA 1 4 PrecisionX Cas9 SmartNuclease System Cat CAS7xx CAS9xxA 1 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual Protocol for using miR KOs without HR Donor Vector How to use miR KOs to disrupt miRNA seed region It is possible to use miR KOs alone i e without an HR donor vector to generate indels small insertions or deletions within the miRNA seed region Seed regions are responsible for miRNA annealing to their t
14. the miR 21 hairpin structure via HR and one indel within the seed region via NHEJ clone 5 carries bi allelic deletions of the hairpin structure bi allelic HR As shown in Fig 6 we found complete abolishment of miR 21 expression in all three cell lines 0 9 os E 293 cells 0 7 1 E Clone 1 0 6 E Clone amp 5 0 5 0 4 4 0 3 5 0 2 4 0 1 E Clone 7 Normalized miR 21 expression levels miR 21 888 266 5066 Toll Free 650 968 2200 outside US Page 17 VI System Biosciences SBI User Manual Figure 6 Quantitative PCR analysis reveals complete ablation of miR 21 expression in bi allelic miR 21 knockouts References 1 D M Patrick R L Montgomery X Qi S Obad S Kauppinen J A Hill E van Rooij E N Olson Stress dependent cardiac remodeling occurs in the absence of microRNA 21 in mice J Clin Invest 120 2010 3912 3916 2 C Y Park L T Jeker K Carver Moore A Oh H J Liu R Cameron H Richards Z Li D Adler Y Yoshinaga M Martinez M Nefadov A K Abbas A Weiss L L Lanier P J de Jong J A Bluestone D Srivastava M T McManus A resource for the conditional ablation of microRNAs in the mouse Cell Rep 1 2012 385 391 3 C Uhde Stone Sarkar T Antes Otoc Y Kim Y J Jiang B Lu A TALEN based strategy for efficient bi allelic miRNA ablation in human cells RNA 2014 4 R Hu J Wallace T J Dahlem D J Grunwald R M O Connell Targeting H
15. to replacement of Product or a credit limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual Page 20 ver 1 20140620 www systembio com
16. tor TALE nuclease based system called miR KO to target human miRNA genes TALE Nucleases have been shown to permanently abolish miRNA function with reduced risk of off target effects compared to other miRNA targeting strategies affording researchers a new and exciting set of tools to study miRNA biology miR KOs are transcription activator like effector TALE nucleases that precisely edit specific miRNAs in mammalian cells We designed miR TALE nucleases to cleave within the miRNA seed region Fig 1 In the absence of HR donor vectors the Page 2 ver 1 20140620 www systembio com miRNA KO Cat MIR KO XXX MIR KO XXXHR 1 cellular machinery repairs such breaks via non homologous end joining NHEJ This is an error prone system that typically generates small deletions or insertions indels at or near the site of cleavage Since the seed region defined as bases 2 8 of the microRNA directs miRNA binding to its target DNA indels within the seed region completely abolish miRNA function 3 4 A r iind B Donor cassette MIR 21 EF1 RFP T2A Puro PolyA 0 m gua Ac UGUUG ga 5am toe insu eri Rep tza puro insu toe WH TITE LOLI T LI Itt Seed region UCGGGUAG CUGAC 3 UG MIR 21 TMEM49 TMEM49 Locus d Per UTM ETT 4 TCCATGGCTGTACCACCTTGTCGGGTAGCTTATCAGACTGATGTTGACTI AGGTACCGACATGGTGGAACAGCCCATCGAATAGTCTGACTACAACTGACAA z u ui Wt Fi
17. uman MicroRNA Genes Using Engineered Tal Effector Nucleases TALENs PLoS One 8 2013 e63074 Technical Support For more information about SBI products or to download manuals in PDF format please visit our website http www systembio com For additional information or technical assistance please call or email us at tech systembio com 650 968 2200 Page 18 ver 1 20140620 www systembio com VII miRNA KO Cat MIR KO XXX MIR KO XXXHR 1 Licensing and Warranty Statement System Biosciences SBI warrants the product meets the specifications described in this manual SBI cannot guarantee the biological function and cleavage efficiency of miR KOs in a particular cell line HR donor vector sequences may vary slightly from annotated Genbank sequences due to SNPs and satellite repeat variations As microRNAs are non coding such variations may not interfere with the biological function nor with recombination of the HR donor vector SBI is committed to providing our customers with high quality products If it is proven to the satisfaction of SBI that the Product fails to meet the specifications outlined in this manual SBI will replace the Product or provide the purchaser with a credit This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited
Download Pdf Manuals
Related Search