PDF - 200.21 kbytes - Istituto Superiore di Sanità
Contents
1. In case of overlapped peaks only the peak showing the higher intensity will be considered if peak values are comparable the result is rejected In case of Assemblage B it is acceptable that the 194 bp and 200 bp band are unresolved consequently appearing as a single band of higher intensity 7 2 10 2 Result Interpretation of the enzymatic digestion by agarose gel electrophoresis The size of the amplification bands revealed by the electrophoresis is evaluated by e visual comparison with the DNA size marker 6 28 and with the positive extraction and amplification controls on the virtual gel comparison between the band size calculated by the software and the expected band size e In case the sample shows a not expected band the sample will not processed further and the identification will not be possible The enzymatic digestion test is considered valid if the digestion of the positive control shows a profile of bands product in accordance with Table A The species identification is made after enzymatic digestion of the amplified fragments comparing the size of the band s produced by the sample s with those shown in Table A In case of Assemblage B it is acceptable that the 194 bp and 200 bp band are unresolved consequently appearing as a single band of higher intensity In case the sample shows a not expected band the sample will not processed further and the identification will not be possible page 13 of 14 we2. RAA TO numbering of the tubes point 7 2 6 b n The first and last wells are loaded with 10 uL of the L50 solution 6 18 Connect the electrophoresis apparatus with the power supply and set 5 v cm of gel p Run the gel for about 60 min or until the fastest dye contained in the loading buffer 6 9 reaches a distance of 1 cm from the gel border q Stain the DNA by transferring the gel in 400 ml of ddH20 with 4 uL of ethidium bromide solution 6 13 Gently shake the gel on a orbital shaker 5 16 r After 30 min remove the staining solution and replace it with 400 ml of ddH20 Gently shake the gel on a orbital shaker 5 16 for 15 min Repeat the washing step s After 30 min place the gel under UV illumination and check the band separation The electrophoresis run is adequate if it is possible to easily distinguish all bands of molecular weight marker ranging from 25 and 1000 bp If the separation is incomplete continue the run t At the end of the run transfer the gel to the imaging system and print the result 7 2 10 Result Interpretation of the enzymatic digestion 7 2 10 1 Result Interpretation of the enzymatic digestion by capillary electrophoresis For the data analysis only the bands that satisfy the following characteristic will be considered band size greater then 15bp band comprise between the two bands of the alignment marker 6 27 Intensity of the emission peak greater than a threshold value of 5
3. European Union Reference Laboratory for Parasites Department of Infectious Parasitic and Immunomediated Diseases Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanita lt WTO Z Nys 4 8 Results The results are expressed as follows If the digestion profile with Haelll is 201 150 110 50 bp the sample is identified as G duodenalis assemblage A If the digestion profile with Haelll is 150 117 110 84 26 24 bp the sample is identified as G duodenalis assemblage B If the digestion profile with Haelll is 194 150 102 50 15 bp the sample is identified as G duodenalis assemblage C If the digestion profile with Haelll is 200 194 117 bp the sample is identified as G duodenalis assemblage D If the digestion profile with Haelll is 186 150 110 26 24 15 bp the sample is identified as G duodenalis assemblage E If the digestion profile with Haelll is 186 150 110 50 15 bp the sample is identified as G duodenalis assemblage F If the digestion profile with Haelll is 194 165 102 50 bp the sample is identified as G duodenalis assemblage G In case the digestion test was valid but the sample displays a profile of bands not comparable with those reported in Table A identification at assemblage level will be considered impossible 9 Characteristics of the method This method has been characterised in terms of repeatability and specificity The results o
4. the procedure is carried out at room temperature Each working session requires that an aliquote of the positive control for the DNA extraction 6 21 will be submitted to the DNA extraction procedure and identified as positive control for the extraction Transfer 1 mL of each faecal sample containing 50 ethanol in 1 5 ml vials Centrifuge 5 1 vials at 8 000 x g for 5 min Discard the supernatant and add a volume of H20 equivalent to the starting volume of the sample Centrifuge 5 1 vials at 8 000 x g for 5 min Repeat washing as in c Transfer 200 uL of faecal sample in 2 ml vials Add 1 4 mL of ASL lysis buffer 6 1 and vortex to homogenate the sample For the positive control for the DNA extraction 6 21 add the ASL lysis buffer 6 1 directly to the sample still frozen than vortex to to homogenate the sample agatroanay eee ees h Incubate at 95 C in termomixer 5 3 and 1 400 rpm for 10 min i Centrifuge 5 1 vials at 12 000 x g for 1 min j Collect supernatant and transfer in new 2ml vials k Add one tablet of InhibitEX 6 2 and vortex for 1 min l Incubate for 1 min m Centrifuge 5 1 vials at 12 000 x g for 3 min n Add 25 uL of Proteinase K 6 3 in new 2 mL vial o Collect supernantant m and add to the 2 mL vial j p Add 600 uL of lysis buffer AL 6 4 in the same vial q Incubate at 70 C in termomixer 5 3 for 10 min r Add 600 uL of ethanol 6 5 and vortex brefly s For each
5. 12 and check the band separation The electrophoresis run is adequate if it is possible to easily distinguish all bands of molecular weight marker ranging from 250 and 1500 bp If the separation is incomplete continue the run q At the end of the run transfer the gel to the imaging system 5 7 and print the result 33 sx 3 ae Q2 Re wa 7 2 4 Result Interpretation The amplification test is considered valid if i the amplification of the positive control shows an amplification product of 511bp ii the amplification of the negative control does not show any amplification product or eventually only bands related to unused oligonucleotides and or primer dimer iii the positive control of the extraction product shows an amplification product of 511bp 7 2 4 1 Interpretation of the PCR amplification results on capillary electrophoresis The data analysis shall consider only those bands satisfying the following requirements 1 Band size bigger than 50 bp 2 Comprised between the two Alignment marker bands 6 27 page 9 of 14 Nhe European Union Reference Laboratory for Parasites RAD TO 2 Department of Infectious Parasitic and Immunomediated Diseases Y aw Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanita 3 Intensity of the emission peak greater than a threshold value of 5 In case of overlapped peaks only the peak showing the higher intensity will be considered if peak value
6. 6 8 Washing buffers Commercial solutions Ql Aamp DNA Stool Handbook QIAGEN to be prepared according to manufacturer s instruction and identified as AW1 e AW2 Store at room temperature 6 9 Eluting buffer Commercial solution QlAAamp DNA Stool Handbook QIAGEN identified as AE buffer Store at room temperature 6 10 PCR master mix 2x commercial solution Promega codes M7501 M7502 M7505 composition dATP 400 uM dCTP 400 uM dGTP 400 uM dTTP 400 uM MgCl2 3mM Taq DNA polymerase 50 U mL other commercial PCR master mixes should be considered suitable for PCR amplification Store according to the manufacturer s recommendations 6 11 SetA The oligonucleotide mixture 6 12 used for the PCR the mixture is obtained combining an equal volume of the 2 oligonucleotides bGiarF and bGiarR 6 12 The final concentration corresponds to 20 pmol uL 100uL aliquots are prepared and stored frozen up to 24 months 6 12 Oligonucleotides Commercial preparation Table B the lyophilized products is reconstituted with TE 0 1x according to the manufacturer s recommendations at a concentration of 100 pmol yuL the lyophilized product can be stored frozen for up to 5 years the reconstituted product can be stored frozen up to 18 months Table B Oligonucleotides present in the setA 6 11 their codes and amplified nucleotide sequences Oligonucleotide sequence Code Amplified sequence 5 GAACGAACGAGATCGAGGTCCG 3
7. Department of Infectious Parasitic and Immunomediated Diseases gt w Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanita Table A Size in base pairs of the beta giardin fragments after Haelll endonuclease digestion expected for each G duodenalis Assemblage Assemblage Digestion fragments 201 150 110 50 150 117 110 84 26 24 194 150 102 50 15 200 194 117 186 150 110 26 24 15 186 150 110 50 15 194 165 102 50 QQ TM olol gt Using the PCR RFLP technique it is possible to distinguish between the G duodenalis Assemblage A B C D E F and G based on the number and size of the digestion fragments with the Haelll enzyme of the 511bp fragment of the beta giardin gene 3 References Adam RD 2001 Biology of Giardia lamblia Clin Microbiol Rev 14 pp 447 475 Amar CF East CL Grant KA Gray J lIturriza Gomara M Maclure EA McLauchlin J 2005 Detection of viral bacterial and parasitological RNA or DNA of nine intestinal pathogens in faecal samples archived as part of the English infectious intestinal disease study assessment of the stability of target nucleic acid Diagn Mol Pathol 14 pp 90 96 Horiuchi K Zinder ND 1975 Site specific cleavage of single stranded DNA by a Hemophilus restriction endonuclease Proc Natl Acad Sci U S A 72 pp 2555 2558 ISO FDI 20837 2006 E Microbiology of food and animal feeding stuff
8. G psittaci in birds and G duodenalis syn lamblia and intestinalis in mammals Giardia duodenalis is the causative agent of giardiasis and it is the only species infecting both humans and other mammals including livestock and companion animals Seven morphologically indistinguishable Assemblages of Giardia duodenalis referred to as Assemblages A to G have been described which can be identified based on genetic analysis Only Assemblages A and B have been isolated from humans and a wide panel of mammals whereas the other Assemblages C G have host specificity and are not infectious for humans Monis et al 1999 Monis et al 2003 Sulaiman et al 2003 Molecular methods based on PCR RFLP have allowed the identification at Assemblage level of G duodenalis cysts present in human and animal faecal samples Between these methods the widely used is based on the 511 base pairs bp fragment of the beta giardin gene coding for a structural giardial protein obtained by PCR amplification with two specific primers The further digestion of the PCR fragment with the restriction endonuclease Haelll allow the individual identification of each assemblage based on the pattern of digestion fragments size Lalle et al 2005 The size of the fragments produced by Haelll digestion of the beta giardin PCR fragment for each G duodenalis Assemblage are shown in Table A page 2 of 14 Nhe European Union Reference Laboratory for Parasites RAA TO 2
9. Pre denaturation 2 min 95 C Amplification 30 s 95 C 30 s 55 C 60 s 72 C Number of cycles 35 Final extension 7 min 72 C At the end of the amplification phase centrifuge 5 1 the tubes at maximum speed for a few sec Add 5 0 uL of loading buffer 6x 6 13 if not present in the used PCR master mix Vortex 5 14 and centrifuge 5 1 the tubes at maximum speed for a few sec Keep tubes on ice or refrigerated 5 5 until starting electrophoresis Result display The analysis will be primarily conducted by capillary electrophoresis In case of samples to be analysed are less than 8 or the capillary electrophoresis apparatus is out of order the analysis can be done by conventional agarose gel electrophoresis 7 2 3 1 Capillary electrophoresis Switch on the Qiaxcel instrument 5 14 and launch the software BioCalculator on the connected PC Access to Instrument control panel by the menu File Move the tube tray to the access position by selecting Change Buffer from the Instrument control panel Check the presence of 12 tubes containing at least 10 uL of the Alignment Marker 6 27 in the MARKER 1 position of the buffers bowl Then move the tube tray to the working position by selecting Park from the Instrument control panel Put the samples minimum volume 10 uL in rows of 12 starting from line A If necessary add an appropriate number of tubes containing QX DNA dil
10. digestion with defined pH and saline concentration The buffers are commonly sell together with the corresponding restriction enzyme Store refrigerated according to manufacturer s recommendations 6 25 Reference trophozoite DNA DNA extracted from in vitro coltured trophozoites of G duodenalis WBCE6 clone Assemblage A Store frozen for up to 5 years 6 26 QlAxcel kit commercial products from Qiagen code 929002 and 929004 Include separation cartridge and buffers for sample preparation and gel running Store each component as indicated by the manufacturer 6 27 Alignment marker commercial products from Qiagen code from 929520 to 929529 Store according to manufacturer s instructions 6 28 DNA size marker commercial products from Qiagen code from 929550 to 929558 Store according to manufacturer s instructions page 6 of 14 Nhe European Union Reference Laboratory for Parasites 2 Department of Infectious Parasitic and Immunomediated Diseases gt Y Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanit RAA TO 7 Procedure 7 1 Sample preparation Test faecal samples already checked for the presence of Giardia cysts are inspected to verify the preservation conditions Vials must be intact without any sign of material leakage If the condition are not suitable the test is not performed 7 2 Method 7 2 1 DNA extraction from faecal sample to be tested If not otherwise specified
11. sample put one binding column 6 6 in a collection tube 6 7 t Transfer 600 uL of lysate q in a binding column 6 6 and centrifuge 5 1 at 12 000 x g for 1 min u Discard the collection tube 6 7 and transfer the binding column 6 6 in a new collection tube 6 7 v Repeat from s to t for additional two times z Add 500 uL of wash buffer AW1 6 8 to the binding column 6 6 and centrifuge 5 1 at 12 000 x g for 1 min a1 Discard the collection tube 6 7 and transfer the binding column 6 6 in a new collection tube 6 7 b1 Add 500 uL of wash buffer AW2 6 8 to the binding column 6 6 and centrifuge 5 1 at 12 000 x g for 3 min c1 Transfer the binding column 6 6 in a new 1 5 mL vial d1 Add 200 uL of elution buffer 6 9 to the binding column 6 6 and incubate for 1 2 min e1 Centrifuge 5 1 at 12 000 x g for 1 min discard the binding column 6 6 store the 1 5mL vials with the eluted DNA f1 The obtained DNA will be defined DNA faecal sample and store frozen 5 2 for up to 5 years 7 2 2 PCR amplification Unless otherwise clearly stated store tubes on ice use tips with barrier and wear disposable gloves At each working session use a positive and a negative amplification control Use reference faecal DNA 6 22 as positive control and water 6 20 as negative control The following procedure use a 2x concentrated PCR master mix in case of different concentration adjust the protocol acc
12. selecting Change Buffer from the Instrument control panel d Check the presence of 12 tubes containing at least 10 uL of the Alignment Marker 6 27 in the MARKER1 position of the buffers bowl Then move the tube tray to the working position by selecting Park from the Instrument control panel e Put the samples minimum volume 10 uL in rows of 12 starting from line A If necessary add an appropriate number of tubes containing QX DNA dilution buffer minimum volume 10 uL contained in the QIAxcel kit 6 26 to complete the row f For each round of analysis including a maximun of 8 runs of 12 samples each a tube containing DNA size marker 6 28 must be added g Set run parameters in the Instrument control panel as follow Method OM500 Sample sample code Pos starting line Time leave empty Runs number of runs User ID Mi 08 Plate ID operator s name h Check off the 12 Chan boxes i Check off the Automatically analyze after data acquisition box j Push Run button to start the run k At the end of the run close the software and switch off the instrument 7 2 9 2 Allignment of the reference size marker The picks corresponding to the alignment markers 6 27 are identified by comparison of the electrograms of each sample with the electrogram of the negative control Remove all the picks before and after the alignme
13. and or dimension it is possible to choose an oligonucleotide pair allowing for its amplification The PCR amplification is characterized by a high sensitivity and specificity It is possible to combine the standard PCR with the Restriction Lenght Fragment Polymorphism RLFP that means the analysis of DNA restriction fragments The technique allow to distinguish PCR fragments of comparable length by enzymatic digestion with one or more endonucleases enzyme able to cut DNA by recognition of short and specific oligonucleotide sequences In our case it is possible to amplify the same portion of DNA from different species and then distinguish them based on the size of restriction DNA fragments The protozoan parasites of the genus Giardia infect the upper part of the small intestine of vertebrates including humans The parasite s life cycle consists of a vegetative stage the trophozoite a teardrop shaped binucleated cell which divide by binary fission and colonizes the host intestine and the tetranucleated cyst the infective and resistant stage which is able to survive outside of the host Infection is acquired by cysts ingestion that undergoes excystation into trophozoites in the proximal small intestine after the exposure to the acidic environment of the stomach Six species have been described based on the host specificity the morphology and the phenotype Giardia agilis in amphibians G muris and G microti in rodents G ardeae and
14. bGiarF Beta giardina 5 CTCGACGAGCTTCGTGTT 3 bGiarR 6 13 Loading buffer 6x Commercial product allowing DNA molecule electrophoresis to be performed Store according to the manufacturer s recommendations 6 14 Agarose and high resolution agarose Commercial products suitable for performing DNA molecule electrophoresis The high resolution agarose is suitable for the analysis of small DNA fragments 25 700 bp improving their separation in gel electrophoresis Store at room temperature for up to 24 months 6 15 TAE solution 50x Commercial product 2M Tris acetate 50mM EDTA pH 8 2 8 4 at 25 C Store at room temperature for up to 24 months 6 16 TAE solution 1x 1000 mL preparation take 20 mL of the 50x solution and bring to 1000 mL with water Store at room temperature for up to 1 month 6 17 Ethidium bromide solution Commercial product 10 mg L For the working condition dilute 1 100 000 for 100 mL solution add 1 0 uL Store in the dark at room temperature for up to 24 months page 5 of 14 Nhe European Union Reference Laboratory for Parasites 2 Department of Infectious Parasitic and Immunomediated Diseases Y aw Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanita RAA TO NOTE Ethidium bromide is potentially mutagenous carcinogenic and teratogenic wear disposable gloves and handle the solution containing this substance very carefully 6 18 L50 Commercial produc
15. ch enzymatic digetion mix by vortexing and centrifuge 5 1 at maximum speed for a few sec e Transfer 10uL of the cumulative amplification mix to each tube point c f Add 10 uL of the PCR product to be tested to each tube g Close the tubes mix by vortexing and centrifuge at maximum speed for a few sec h Incubate the tubes in thermomixer 5 3 at 37 C for 4h without shaking i At the end of the amplification phase centrifuge 5 1 the tubes at maximum speed for a few sec l Add 4 uL of loading buffer 6x 6 13 m Vortex and centrifuge 5 1 the tubes at maximum speed for a few sec n Keep tubes on ice or refrigerated 5 5 until starting electrophoresis page 11 of 14 Nhe European Union Reference Laboratory for Parasites RAA TO 2 Department of Infectious Parasitic and Immunomediated Diseases gt Y Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanit 7 2 9 Result display The analysis will be primarily conducted by capillary electrophoresis In the case in which samples to be analysed are less the 8 or the capillary electrophoresis apparatus is out of order the analysis can be done by conventional agarose gel electrophoresis 7 2 9 1 Capillary electrophoresis a Switch on the Qiaxcel instrument 5 14 and launch the software BioCalculator on the connected PC b Access to Instrument control panel by the menu File c Move the tube tray to the access position by
16. ern C Gilman R H Trout J M Schantz P M Das P Lal A A Xiao L 2003 Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis Emerg Infect Dis 9 pp 1444 1452 Thompson RC Hopkins RM Homan WL 2000 Nomenclature and genetic groupings of Giardia infecting mammals Parasitol Today 16 pp 210 213 UNI EN ISO 22174 2005 Microbiology of food and animal feeding stuffs Polymerase chain reaction PCR for the detection of food borne pathogens General requirements and definitions page 3 of 14 Nhe European Union Reference Laboratory for Parasites 2 Department of Infectious Parasitic and Immunomediated Diseases gt wy Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanita RAA TO 4 Definitions Beta Giardin coding sequence for a structural protein of the G duodenalis cytoskeleton Oligonucleotide short sequence 15 30 nucleotide bases used to amplify a specific DNA fragment SetA mix of 2 oligonucleotide base pairs amplifying a 511 bp fragment of the beta giardin gene from all G duodenalis Assemblages Reference faecal DNA purified genomic DNA from faeces containing cysts of G duodenalis Assemblage A Positive control for the DNA extraction aliquots of faeces containing cysts of G duodenalis Assemblage A analysed in the same working session of test samples to verify the efficacy of the DNA extraction session Reference tro
17. f the validation protocol are used to confirm that the method is suitable for the expected aim and are reported in the validation report which can be received upon request 10 Safety measures This method has to be carried out only by authorized personnel The operator should wear individual protection devices during the test performance For general safety measures refer to the guidelines of CDC page 14 of 14
18. g system 5 8 Adjustable volume pipettes volume range 1 10uL 2 20uL 20 100uUL 50 200uL 200 1000uL 5 9 Analytical grade water system production resistivity 2 18 Mohm cm 5 14 Vortex 5 10 Analytical balance readability 0 1g 5 11 UV transilluminator 5 12 Orbital shaker 5 13 Qiaxcel vertical capillary electrophoresis system page 4 of 14 Nhe European Union Reference Laboratory for Parasites RAA TO 2 Department of Infectious Parasitic and Immunomediated Diseases y aw Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanita 6 Reagents and chemicals 6 1 Lysis buffer Commercial solution QlAamp DNA Stool Handbook QIAGEN identified as ASL buffer Store at room temperature 6 2 InhibitEX Tablet Commercial solution QlAamp DNA Stool Handbook QIAGEN identified as ASL buffer Store at room temperature 6 3 Proteinase K Commercial solution QlAAamp DNA Stool Handbook QIAGEN identified as ASL buffer Store according to manufacturer s instruction 6 4 Tampone di lisi Lysis buffer Commercial solution QlAamp DNA Stool Handbook QIAGEN identified as AL buffer Store at room temperature 6 5 Ethanol 96 100 Commercial solution 6 6 Binding Column Commercial solution QlAamp DNA Stool Handbook QIAGEN identified as QlAmp Mini Spin Columns 6 7 Collection tube Commercial solution QlAamp DNA Stool Handbook QIAGEN identified as Collection tube 2 mL
19. gment will be amplified from the tested samples the presence of inhibitors will be excluded and the sample will be considered as negative On the contrary a new DNA extraction from the test sample will be performed 7 2 8 Enzymatic DNA digestion with endonuclease Unless otherwise clearly stated store tubes on ice use tips with barrier and wear disposable gloves At each working session independent digestions with Haelll enzyme are performed The proper digestion will be checked by contemporary digestion of a positive control represented by the PCR amplification product of the reference faecal DNA The procedure use a restriction enzyme at the initial concentration of 10 20 U ul and 10x concentrated restriction enzyme buffers In case of different concentration adjust the protocol according to the manufacturer s instruction a Thaw PCR products restriction enzymes and 10X restriction enzyme buffers b Mark with a progressive number an adequate number of 1 5 mL tubes c Prepare a adequate cumulative volume of the enzymatic digestion mix for each restriction enzyme Evaluate the volume on the basis of a single sample enzymatic digestion mix Table H and of the total number of samples plus the positive control Table H Enzymatic digestion mix for a single sample components and volumes 10x buffer 6 24 2 0 uL Restriction enzyme 6 23 5u 0 5 uL PCR product 10 uL H20 7 5 uL Total 20 uL d Mix ea
20. ice or in a refrigerated box use tips with barrier and wear disposable gloves At each working session use a positive and a negative amplification control Use reference reference trophozoite DNA 6 25 as positive control and water 6 20 as negative control The following procedure uses a PCR master mix at a 2X concentration If the concentration is different modify the procedure following the manufacturer s recommendations a Thaw DNA faecal samples 2x PCR MasterMix 6 10 SetO 6 11 amplification positive control reference trophozoite DNA 6 25 b Mark with a progressive number an adequate number of 0 2 uL PCR tubes c Prepare an adequate cumulative volume of amplification mix Calculate the volume on the basis of a single sample amplification mix Table F and of the total number of samples plus two 1 for the positive amplification control and 1 for the negative control Table F Amplification mix for a single sample components and volumes 2x PCR MasterMix 6 10 25 uL H20 17 uL SetB 6 26 1 uL Totale 43 uL d Mix the amplification mix by vortexing and centrifuge 5 1 at maximum speed for a few seconds e Transfer 43 uL of the cumulative amplification mix to each PCR tube point b f Add 2 uL of reference trophozoite DNA 6 25 and 5 uL of the DNA faecal samples to be tested to each tube g Close the tubes mix by vortexing and centrifuge 5 1 at maximum speed for a few seconds h Sta
21. nt markers then reprocess data using the command reprocess from the Analysis menu or using the corresponding icon The described procedure is standard for routine use However for any further requirement the user must refer to the Qiaxcel user manual 7 2 9 3 Agarose gel electrophoresis a Assemble the electrophoresis apparatus 5 6 according to the manufacturer s recommendations For the gel preparation use a comb suited for the number of samples b Add 3 gr of high resolution agarose 6 10 in 100 mL TAE 1x 6 16 in a glass beaker c Gently resuspend the powder by rotation and leave at 4 C in the refrigerator 5 5 for 30 min Boil the agarose suspension for 30 sec If the solution is not homogeneous continue to boil for another 30 sec e Restore with water the volume lost by boiling f Allow the agarose solution to cool g Pour the agarose in the gel tray previously prepared point a h Wait for the gel to solidify which requires at least 30 min i Place the tray with the gel in the electrophoresis apparatus I Cover the gel with TAE 1x buffer 6 16 and gently pull out the comb m Load in each well the enzymatic digestion product point 7 2 6 n respecting the progressive page 12 of 14 Nhe European Union Reference Laboratory for Parasites 2 Department of Infectious Parasitic and Immunomediated Diseases gt Y Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanit
22. oERIO itt RAD TO Re European Union Reference Laboratory for Parasites Department of Infectious Parasitic and Immunomediated Diseases x Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanit CINN Identification of Giardia duodenalis cysts at the Assemblage level by PCR RFLP 8 9 AOO OI S T TS a Aim and field of application Principle of the method References Definitions Devices instruments Reagents and chemicals Procedure 7 1 Sample preparation 7 2 Method Results Characteristics of the method 10 Safety measures INDEX RWW NM NY KD o a aA page 1 of 14 Nhe European Union Reference Laboratory for Parasites RAA TO 2 Department of Infectious Parasitic and Immunomediated Diseases gt w Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanita 1 Aim and field of application To determine the identity of cysts of the protozoan Giardia duodenalis at the assemblage level by a PCR RFLP analysis This method can be applied to faecal material of human and animal origin already positive for the presence of Giardia cysts 2 Principle of the method The PCR is a molecular biology technique that allows for the amplification of specific nucleic acid fragments of which the initial and terminal nucleotide sequences are known oligonucleotide pair If a species or genotype has its own characteristic DNA portion due to its composition
23. ording to supplier a Thaw DNA faecal sample 2x PCR MasterMix 6 10 SetA 6 11 and positive amplification controls page 7 of 14 Nhe European Union Reference Laboratory for Parasites RAA TO 7 2 Department of Infectious Parasitic and Immunomediated Diseases aw Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanita m n 7 2 3 reference faecal DNA 6 22 Mark with a progressive number an adequate number of 0 2 uL PCR tubes Prepare a adequate cumulative volume of the amplification mix Evaluate the volume on the basis of a single sample amplification mix Table D and of the total number of samples plus two 1 for the positive amplification control and 1 for the negative one Table D single sample amplification mix components and volumes 2x PCR MasterMix 6 6 25 uL H20 19 uL SetA 6 7 1 uL Total 45 uL Mix the amplification mix by vortexing and centrifuge 5 1 at maximum speed for a few sec Transfer 45 uL of the cumulative amplification mix to each PCR tube point b Add 5 uL of the DNA faecal sample to be tested to each tube Close the tubes mix by vortexing 5 14 and centrifuge 5 1 at maximum speed for a few sec Start the amplifying cycle Table E on the thermocycler device wait for the temperature to reach 95 C and insert the tubes in the thermoblock by pausing the instrument Table E amplification cycles
24. phozoite DNA DNA extracted from in vitro coltured trophozoites of G duodenalis WWBC6 clone Assemblage A Used as spike in the control PCR reaction to assess the presence of PCR inhibitors in the faecal sample to be tested Positive control for the amplification purified genomic DNA from faeces containing cysts of G duodenalis Assemblage A this control is used in the amplification session to verify the efficacy of the PCR Negative control for the amplification reagent grade water this control is used in the amplification session to verify the efficacy of the PCR PCR Polymerase Chain Reaction Restriction Enzyme Restriction enzyme are enzyme of bacterial origin able to cut DNA at specific site that are sequences of 4 8 base of length different for each enzyme allowing the DNA fragmentation in a reproducible and specific manner Endonucleases cut inside to the DNA chain Enzyme concentration is measured as enzymatic units U In this case 1U correspond to the amount of enzyme needed to completely digest 1 ug of DNA The definitions and terminology used in the UNI EN ISO 22174 standard are applied in the present protocol 5 Devices instruments 5 1 Bench top refrigerated centrifuge for 1 5 mL tubes minimum 10 000xg 5 2 Freezer lt 15 C 5 3 Thermomixer with vibration temperature range 25 100 C 5 4 PCR thermocycler 5 5 Refrigerator temperature range 1 8 C 5 6 Horizontal electrophoretic apparatus 5 7 Digital imagin
25. r to the Qiaxcel user manual 7 2 3 3 Agarose gel electrophoresis a Assemble the electrophoresis apparatus 5 6 according to the manufacturers recommendations For the gel preparation use a comb suited for the number of samples b Add 2 gr agarose 5 11 in 100 mL TAE 1x 6 12 in a glass beaker c Gently resuspend the powder by rotation Boil the agarose suspension for 30 sec If the solution is not homogeneous continue to boil for another 30 sec e Restore with water the volume lost by boiling f Allow the agarose solution to cool Before it solidifies add 1 0 uL of ethidium bromide solution 6 17 h Shake gently to dissolve uniformly the ethidium bromide and pour the agarose in the gel tray previously prepared a i Wait for the gel to solidify which requires at least 30 min Place the tray with the gel in the electrophoresis apparatus Cover the gel with TAE 1x buffer 6 16 and gently pull out the comb Load in each well 10 uL of the amplification product point 7 2 2 n respecting the progressive numbering of the tubes point 7 2 2 b The first and last wells are loaded with 15 uL of the L100 solution 6 19 Connect the electrophoresis apparatus with the power supply 5 6 and set 10 v cm of gel Run the gel for about 30 min or until the fastest dye contained in the loading buffer reaches a distance of 1 cm from the gel border After 30 min switch off the power supply place the gel under UV illumination 5
26. rt the amplification cycle Table G on the thermocycler device 5 4 wait until the temperature reaches 95 C and insert the tubes in the thermoblock by pausing the instrument Close the lid and restart the cycle Table G Amplification cycle Denaturazione iniziale 5 min 95 C Amplificazione 10 s 95 C page 10 of 14 Nhe European Union Reference Laboratory for Parasites RAA TO 2 Department of Infectious Parasitic and Immunomediated Diseases aw Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanita Denaturazione iniziale 5 min 95 C 30 s 55 C 30 s 72 C Numero di cicli 35 Estensione finale 3 min 72 C i At the end of the amplification step centrifuge 5 1 the tubes at maximum speed for a few seconds j Leave the tubes on ice or in a refrigerator 5 5 before the electrophoresis 7 2 6 Result display To visualize the results follow the procedure described at point 7 2 3 7 2 7 Interpretation of the PCR amplification results on agarose gel and capillary electrophoresis To interpret the results follow the procedures described in 7 2 4 The amplification test is considered valid if i the positive control shows an amplification product of 511bp ii the amplification of the negative control does not show any amplification product or eventually only bands related to unused oligonucleotides and or primer dimer If the expected 511bp fra
27. s Polymerase chain reaction PCR for the detection of food borne pathogens Requirements for sample preparation for qualitative detection ISO FDI 20838 2006 E Microbiology of food and animal feeding stuffs Polymerase chain reaction PCR for the detection of food borne pathogens Requirements for amplification and detection for qualitative methods Lalle M Pozio E Capelli G Bruschi F Crotti D Caccid SM 2005 Genetic heterogeneity at the beta giardin locus among human and animal isolates of Giardia duodenalis and identification of potentially Zoonotic subgenotypes Int J Parasitol 35 pp 207 213 Lebbad M Mattsson JG Christensson B Ljungstr m B Backhans A Andersson JO Sv rd SG 2010 From mouse to moose multilocus genotyping of Giardia isolates from various animal species Vet Parasitol 168 pp 231 239 Qiagen QlAamp DNA Stool Handbook Second edition July 2007 Monis P T Andrews R H Mayrhofer G Ey P L 1999 Molecular systematics of the parasitic protozoan Giardia intestinalis Mol Biol Evol 16 pp 1135 1144 Monis P T Andrews R H Mayrhofer G Ey P L 2003 Genetic diversity within the morphological species Giardia intestinalis and its relationship to host origin Infect Genet Evol 3 pp 29 38 Sato S Hutchison C A Ill Harris J l 1977 A thermostable sequence specific endonuclease from Thermus aquaticus Proc Natl Acad Sci USA 74 pp 542 546 Sulaiman M Fayer R B
28. s are comparable the result is rejected The size of the amplification bands revealed by the electrophoresis is evaluated by i visual comparison with the DNA size marker 6 28 and with the positive extraction and amplification controls on the virtual gel ii comparison between the band size calculated by the software and the expected band size 7 2 4 2 Interpretation of the PCR amplification results on agarose gel electrophoresis The size of the amplification bands 511bp revealed by the electrophoresis is evaluated by their comparison with the reference molecular weight L100 6 19 and with the positive control of extraction and amplification The visual evaluation is considered sufficient and adequate In case the sample shows a not expected band the sample will not further processed and the identification will not be possible If the sample shows no amplification reference trophozoite DNA 6 25 will be add to the DNA faecal sample to be tested and amplified according to paragraph 7 2 5 in order to verify the presence of PCR inhibitors If the fragment of 511bp will be amplified the extraction of DNA will be done again starting from the faecal material to be tested The species identification is made after enzymatic digestion of the amplified fragments comparing the size of the band s produced by the sample s with those shown in Table A 7 2 5 Test for the presence of inhibitors by PCR If nor otherwise stated keep tubes on
29. t containing markers for DNA molecular weight multiple of 50 bp All commercial products containing molecules of multiples of 50 bp within the 50 500 bp range can be used Store refrigerated according to manufacturer s recommendations 6 19 L100 Commercial product containing markers for DNA molecular weight multiple of 100 bp All commercial products containing molecules of within the 100 1500 bp range can be used Store refrigerated according to manufacturer s recommendations 6 20 Milli Q grade water Resistivity 18 Mohm cm 6 21 Positive control for the DNA extraction aliquots of faeces containing cysts of G duodenalis Assemblage A analysed in the same working session of test samples to verify the efficacy of the DNA extraction session Store in refrigerator 5 5 for up to 2 years or frozen 5 2 for up to 5 years 6 22 Reference faecal DNA purified genomic DNA from faeces containing cysts of G duodenalis Assemblage A Store frozen for up to 10 years 6 23 Restriction enzymes Haelll Commercial products suitable for DNA enzymatic digestion Store refrigerated according to manufacturers recommendations The oligonucleotide sequence recognized by each enzyme is reported in Table C Table C Oligonucleotide sequence recognized by Haelll restriction enzyme Restriction Enzyme Target sequence Haelll 5 GC CC 3 3 CC GG 5 6 24 Restriction enzyme buffers Commercial products suitable for DNA enzymatic
30. ution buffer minimum volume 10 uL contained in the QIAxcel kit 6 26 to complete the row For each round of analysis including a maximun of 8 runs of 12 samples each a tube containing DNA size marker 6 28 must be added Set run parameters in the Instrument control panel as follow Method 0M500 page 8 of 14 Nhe European Union Reference Laboratory for Parasites RAA TO 2 Department of Infectious Parasitic and Immunomediated Diseases Y Unit of Gastroenteric and Tissue Parasitic Diseases Istituto Superiore di Sanit Sample sample code Pos starting line Time leave empty Runs number of runs User ID Mi 08 Plate ID operator s name h Check off the 12 Chan boxes i Check off the Automatically analyze after data acquisition box j Push Run button to start the run k At the end of the run close the software and switch off the instrument 7 2 3 2 Allignment of the reference size marker The picks corresponding to the alignament markers 6 27 are identified by comparison of the electrograms of each sample with the electrogram of the negative control Remove all the picks before and after the alignament markers then reprocess data using the command reprocess from the Analysis menu or using the corresponding icon The described procedure is standard for routine use However for any further requirement the user must refe
Download Pdf Manuals
Related Search