Sample & Assay Technologies GeneRead DNAseq
Contents
1. Introduction DNA resequencing is a useful tool to detect genetic variations including somatic mutations SNPs and small insertions and deletions Targeted enrichment technology enables next generation sequencing NGS platform users to sequence specific regions of interest instead of the entire genome GeneRead DNAseq Gene Panels use multiplex PCR based target enrichment technology in combination with a sophisticated primer design and separation algorithm to enable amplification and enrichment of any gene or targeted region in the human genome in order to detect genetic variation using next generation sequencing Figure 1 GeneRead DNAseq Gene Panels are designed to analyze a panel of genes related to a disease state and can be used with any major next generation sequencing platforms The targeted enrichment process is essential for the efficient utilization of medium throughput sequencers such as Life Technologies lon Torrent PGM Sequencer and IIlumina s MiSeq Personal Sequencer GeneRead DNAseq Gene Panels have been optimized in combination with GeneRead Panel Mastermix to provide superior sensitivity and linear multiplex amplification The simplicity of the PCR method makes these panels accessible for routine use in every research laboratory Principle and procedure GeneRead DNAseg Gene Panels are provided as sets of four tubes each containing primer mix with up to 1400 primer pairs The number of 4 tube sets included is de2. and the GeneRead DNAseg Library Quant Array provides predispensed primer assays to measure those controls for determination of the quality of the prepared sample library Additionally the GeneRead DNAsegq Library Quant Array contains five predispensed sequential 10 fold dilutions of Illumina or lon Torrent DNA Standard mixed with a PCR primer assay in triplicate and PCR primer assays in the remaining wells of a 96 well 384 well or 100 well PCR plate The predispensed serially diluted DNA standards and PCR primer assay are a convenient method for quantification of library input In total the GeneRead DNAseg Library Quant Array determines quantity as well as quality of the prepared library GeneRead DNAseq Gene Panel Handbook 11 2012 13 DNA quantification and quality control For best results all DNA samples should also demonstrate consistent quality according to the following criteria Concentration and purity determined by UV spectrophotometry The concentration and purity of DNA should be determined by measuring the absorbance in a spectrophotometer Prepare dilutions and measure absorbance in 10 mM Tris Cl pH 8 0 The spectral properties of nucleic acids are highly dependent on pH MA 60 A239 ratio should be greater than 1 7 MA 60 Azg0 ratio should be greater than 1 8 M Concentration determined by Azs should be gt 2 5 ug ml DNA DNA integrity For best results the genomic DNA should be greater than 2 kb in length with s
3. see the respective QIAGEN kit handbook or user manual QIAGEN kit handbooks and user manuals are available at www giagen com or can be requested from QIAGEN Technical Services or your local distributor nrTe yTT wx 1 _ _ 1id1 1 91 iq i1t o kKiijiji ifi iimiii a ioodlolhli d lt 5D OaoOOO GeneRead DNAseq Gene Panel Handbook 11 2012 31 Notes 32 GeneRead DNAseq Gene Panel Handbook 11 2012 Notes GeneRead DNAseq Gene Panel Handbook 11 2012 33 Notes 34 GeneRead DNAseq Gene Panel Handbook 11 2012 Trademarks QIAGEN QIAamp QIAGEN Group AMPure Agencourt Beckman Coulter Inc miSeq Illumina Illumina Inc lon Torrent SYBR Life Technologies Life Technologies Corporation NEBNext OneTaq New England BioLabs Inc Phusion Thermo Fisher Scientific Registered names trademarks etc used in this document even when not specifically marked as such are not to be considered unprotected by law Limited License Agreement Use of this product signifies the agreement of any purchaser or user of GeneRead DNAseq Gene Panels to the following terms 1 GeneRead DNAseq Gene Panels may be used solely in accordance with the GeneRead DNAseq Gene Panel Handbook and for use with components contained in the Kit only QIAGEN grants no license under any of its intellectual property to use or incorporate the enclosed components of this Kit with any components not included within this Kit except
4. 0800 557779 Fax 55 11 5079 4001 Technical 0800 557779 Canada Orders 800 572 9613 Fax 800 713 5951 Technical 800 DNA PREP 800 362 7737 China Orders 86 21 3865 3865 Fax 86 21 3865 3965 Technical 800 988 0325 Denmark Orders 80 885945 Fax 80 885944 Technical 80 885942 Finland Orders 0800 914416 Fax 0800 914415 Technical 0800 914413 France Orders 01 60 920 926 Fax 01 60 920 925 Technical 01 60 920 930 Offers 01 60 920 928 Germany Orders 02103 29 12000 Fax 02103 29 22000 Technical 02103 29 12400 Hong Kong Orders 800 933 965 Fax 800 930 439 Technical 800 930 425 Ireland Orders 1800 555 049 Fax 1800 555 048 Technical 1800 555 061 Italy Orders 800 789 544 Fax 02 334304 826 Technical 800 787980 Japan Telephone 03 6890 7300 Fax 03 5547 0818 Technical 03 6890 7300 Korea South Orders 080 000 7146 Fax 02 2626 5703 Technical 080 000 7145 Luxembourg Orders 8002 2076 Fax 8002 2073 Technical 8002 2067 Mexico Orders 01 800 7742 639 Fax 01 800 1122 330 Technical 01 800 7742 436 The Netherlands Orders 0800 0229592 Fax 0800 0229593 Technical 0800 0229602 Norway Orders 800 18859 Fax 800 18817 Technical 800 18712 Singapore Orders 1800 742 4362 Fax 65 6854 8184 Technical 1800 742 4368 Spain Orders 91 630 7050 Fax 91 630 5145 Technical 91 630 7050 Sweden Orders 020 790282 Fax 020 790582 Technical 020 798328 Switzerland Orders 055 254 22 11 Fax 055 254 2
5. as described in the GeneRead DNAseq Gene Panel Handbook and additional protocols available at www giagen com Other than expressly stated licenses QIAGEN makes no warranty that this Kit and or its use s do not infringe the rights of third parties This Kit and its components are licensed for one time use and may not be reused refurbished or resold QIAGEN specifically disclaims any other licenses expressed or implied other than those expressly stated Ot UL The purchaser and user of the Kit agree not to take or permit anyone else to take any steps that could lead to or facilitate any acts prohibited above QIAGEN may enforce the prohibitions of this Limited License Agreement in any Court and shall recover all its investigative and Court costs including attorney fees in any action to enforce this Limited License Agreement or any of its intellectual property rights relating to the Kit and or its components For updated license terms see www giagen com 2012 QIAGEN all rights reserved GeneRead DNAseq Gene Panel Handbook 11 2012 35 _ eve EEE WW 4 gt amp amp F amp F mre ecRN FpE MmIrW YrcF e aoaurlrmeoe lt lt E EwyUovwNoN EEOSN www giagen com Australia Orders 1 800 243 800 Fax 03 9840 9888 Technical 1 800 243 066 Austria Orders 0800 28 10 10 Fax 0800 28 10 19 Technical 0800 28 10 11 Belgium Orders 0800 79612 Fax 0800 79611 Technical 0800 79556 Brazil Orders
6. beads have collected to the opposite side of the tube near the magnet turn the tube another 180 degrees Rotate the tube two more times each time waiting until the beads collect to the opposite side of the tube A7 Allow the solution to become clear and carefully remove and discard the supernatant A8 Repeat previous three steps A5 A7 A9 Pulse spin the tube return to the magnet and remove any residual ethanol with a pipet GeneRead DNAseq Gene Panel Handbook 11 2012 21 A10 A11 A12 Keeping the tube in the magnetic rack with the cap open air dry the beads for 5 minutes at room temperature Resuspend the beads in 150 pl sterile water Mix well by vortexing Pulse spin the tube return to the magnet and collect the supernatant Size selection Al A2 A3 AA AS A A7 A8 A9 A10 22 Add 105 pl 0 7x AMPure XP beads to 150 pl DNA solution Mix well on a vortex mixer or by pipetting up and down at least 10 times Incubate for 5 minutes at room temperature Pulse spin the tube and place tube on magnetic rack to separate beads from supernatant After the solution is clear about 5 minutes carefully transfer the supernatant to a new tube Discard the beads which contain the large fragments Note Do not the discard the supernatant Add 120 pl 0 8x AMPure XP beads to the supernatant mix well and incubate for 5 minutes at room temperature Pulse spin the tube and pla
7. degrees When the beads have collected to the opposite side of the tube near the magnet turn the tube another 180 degrees Rotate the tube two more times each time waiting until the beads collect to the opposite side of the tube B7 Allow the solution to become clear and carefully remove and discard the supernatant B8 Repeat previous three steps B5 B7 B9 Pulse spin the tube return to the magnet and remove any residual ethanol with a pipet B10 Keeping the tube in the magnetic rack with the cap open air dry the beads for 5 minutes at room temperature B11 Resuspend the beads in 150 ul sterile water Mix well by vortexing B12 Pulse spin the tube return to the magnet and collect the supernatant Size selection B1 Add 120 ul 0 8x AMPure XP beads to 150 ul DNA solution Mix well on a vortex mixer or by pipetting up and down at least 10 times B2 Incubate for 5 minutes at room temperature B3 Pulse spin the tube and place tube on magnetic rack to separate beads from supernatant After the solution is clear about 5 minutes carefully transfer the supernatant to a new tube Discard the beads which contain the large fragments Note Do not the discard the supernatant B4 Add 90 pl 0 6x AMPure XP beads to the supernatant mix well and incubate for 5 minutes at room temperature B5 Pulse spin the tube and place tube on magnetic rack and wait until solution is clear about 5 minutes Carefully remove
8. primer mix pools is determined by the panel size 5 Aliquot 15 pl of each PCR reaction mix and put it into the well with DNA samples accordingly Mix gently by pipetting up and down 6 Seal the wells with PCR tube caps Place strips or plate in thermocycler and set up reaction parameters according to Table 2 ee I lt GeneRead DNAseq Gene Panel Handbook 11 2012 15 Table 2 PCR program Cycle Temperature Time 95 C 10 min 20 95C 15s 60 C 2 min 72 C 10 min 1 4 C 00 7 After the reaction is complete place the reactions on ice and proceed with sample pooling and purification Note If the samples are to be stored prior to purification transfer them to a 20 C freezer 16 GeneRead DNAseq Gene Panel Handbook 11 2012 Protocol Sample Pooling and Purification Procedure 1 Combine all 4 or 8 reactions from the same sample into one well Mix thoroughly The volume of each sample should be approximately 80 ul for a 4 pool panel or 160 pl for an 8 pool panel 2 Transfer 25 pl from each sample to a 1 5 ml Lobind tube for purification Store the rest at 20 C 3 For each sample add 45 pl 1 8x volume of AMPure XP Reagent to the sample and mix by pipetting up and down Incubate for 10 minutes at room temperature 5 Pulse spin the tube and place in a magnetic rack for 5 minutes or until the beads have collected to the wall of
9. 2 13 Technical 055 254 22 12 D UK Orders 01293 422 911 Fax 01293 422 922 Technical 01293 422 999 20 0 USA Orders 800 426 8157 Fax 800 718 2056 Technical 800 DNA PREP 800 362 7737 QIAGEN cabala Sample amp Assay Technologies
10. DNAseq Gene Panel Handbook 11 2012 Troubleshooting Guide For technical support please call us at 1 888 503 3187 or 1 301 682 9200 For more information see also the Frequently Asked Questions page at our Technical Support Center www SABiosciences com support faqg php target PCR The scientists in QIAGEN Technical Services are always happy to answer any questions you may have about either the information and protocols in this handbook or sample and assay technologies for contact information see back cover or visit www qiagen com References QIAGEN maintains a large up to date online database of scientific publications utilizing QIAGEN products Comprehensive search options allow you to find the articles you need either by a simple keyword search or by specifying the application research area title etc For a complete list of references visit the reference database online at www SABiosciences com support publication php pcrarray or contact QIAGEN Technical Services or your local distributor ee GeneRead DNAseq Gene Panel Handbook 11 2012 19 Appendix A Library Construction using the NEBNext Fast DNA Library Prep Set for lon Torrent Procedure End repair of DNA A1 Add the components in Table 3 to a 0 2 ml PCR tube on ice Table 3 DNA end repair reaction components Component Volume PCR enriched DNA from previous step 25 pl NEBNext End Repair Reaction Buffer 6 ul NEBNext Repa
11. November 2012 GeneRead DNAseq Gene Panel Handbook For targeted exon enrichment for next generation sequencing QIAGEN Sample amp Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies enabling the isolation and detection of contents of any biological sample Our advanced high quality products and services ensure success from sample to result QIAGEN sets standards in Purification of DNA RNA and proteins Nucleic acid and protein assays microRNA research and RNAi Automation of sample and assay technologies Our mission is to enable you to achieve outstanding success and breakthroughs For more information visit www giagen com Contents Kit Contents 4 Shipping and Storage 5 Product Use Limitations 5 Product Warranty and Satisfaction Guarantee 5 Technical Assistance 6 Safety Information 6 Quality Control 7 Introduction 8 Principle and procedure 8 Equipment and Reagents to Be Supplied by User 11 Important Notes 13 DNA preparation and quality control 13 DNA quantification and quality control 14 Protocols m PCR Setup 15 Sample Pooling and Purification 17 Troubleshooting Guide 19 References 19 Appendix A Library Construction using the NEBNext Fast DNA Library Prep Set for lon Torrent 20 Appendix B NEBNext DNA Library Prep Master Mix Set for Illumina with NEBNext Singleplex Oligos for Illumina E7350 or NEBNext Multiplex
12. Oligos for Illumina Index Primers 1 12 E7335 25 Appendix C Library Quantification and Quality Control 29 Appendix D Data Analysis using QIAGEN Web Portal 29 Ordering Information 30 GeneRead DNAseq Gene Panel Handbook 11 2012 3 Kit Contents GeneRead DNAseq Gene Panel Primer Mixes 180941 Tubes with enough primers for 12 or 96 samples depending 4 on pack size Handbook 1 Gene panel tubes are labeled A1 B1 C1 and DI GeneRead DNAseq Gene Panel High Content Primer 180942 Mixes Tubes with enough primers for 12 or 96 samples depending 8 on pack size Handbook 1 t Gene panel tubes are labeled A1 B1 C1 D1 A2 B2 C2 and D2 GeneRead DNAseg Gene Panel Mix n Match Primer 180944 Mixes Tubes with laboratory verified primers for 24 samples 4 Handbook 1 t Selection limited to 124 genes GeneRead DNAseq Gene Panel Custom Primer Mixes 180946 Tubes with primers for any gene or genes in the human 4 genome for 500 samples Handbook 1 err_ E NR O e m lt 9 WMIUllllllly e l l biei gt z gt 5z lt z5zcz5o1 illiuOUWj E NUbiii kkii ili i l i MNSPAH H HKEG lil 4 GeneRead DNAseq Gene Panel Handbook 11 2012 GeneRead Panel Mastermix 0 6 ml 4 8 ml Catalog no 180962 180964 GeneRead Panel Mastermix Sufficient reagents Sufficient reagents for containing for 48 PCR 384 PCR HotStart DNA Tag amplification amplification Po
13. XP Kit 70 ethanol Low TE Magnetic rack for 1 5 ml tubes 1 5 ml LoBind tubes 0 2 ml PCR tubes 96 well reaction plates or PCR strips and caps Thermal cycler Multichannel pipettor Single channel pipettor DNase free pipet tips and tubes n or NGS library construction for lon Torrent PGM optional NEBNext Fast DNA Library Prep Set for lon Torrent Agencourt AMPure XP Kit 80 ethanol QIAGEN s GeneRead DNAseg Library Quant Array for lon Torrent PGM Thermal cycler A real time PCR machine compatible with 96 well plates For NGS library construction for Illumina MiSeq HiSeq optional E NEBNext DNA Library Prep Master Mix Set for Illumina M NEBNext Multiplex Oligos for Illumina index primers 1 12 for multiplex sequencing GeneRead DNAseq Gene Panel Handbook 11 2012 11 NEBNext Singleplex Oligos for Illumina for singleplex sequencing Agencourt AMPure XP Kit 80 ethanol QIAGEN s GeneRead DNAsegq Library Quant Array for Illumina Thermal cycler A real time PCR machine compatible with 96 well plates I _TF AAAUEM lt E lt FP IEEEE6B E OI IGiliI BEEG O l eoollllllli ll lAl k i iikLCq0q ZA iib i iiixexi WW W0 Qpb gt i iUu gt lt 12 GeneRead DNAseq Gene Panel Handbook 11 2012 Important Notes DNA preparation and quality control High quality DNA is essential for obtaining good sequencing results The most important prerequisite for any DNA seque
14. and discard supernatant Be careful not to disturb the beads which contain the DNA target Note Do not discard the beads B6 Add 400 pl fresh 80 ethanol to the tube while on magnetic rack Incubate at room temperature for 30 seconds and then carefully remove and discard the supernatant 26 GeneRead DNAseq Gene Panel Handbook 11 2012 B7 Repeat step B6 once B8 Briefly spin the tube and place on magnetic rack Completely remove residual ethanol and dry beads for 10 minutes while tube is on rack with lid open B9 Elute DNA target beads into 23 pl 0 1x TE buffer Mix well by vortexing Spin down briefly and place tube on rack until solution is clear B10 Transfer the supernatant to a clean PCR tube and proceed to PCR amplification PCR amplification of adaptor ligated DNA B1 Addthereagents in Table 8 to a 0 2 ml PCR tube Table 8 Reagents for PCR amplification of adaptor ligated DNA Component Volume Adaptor ligated DNA 23 pl Universal PCR primer 25 UM 1 ul Index primer 1 25 UM 1 pl Phusion High Fidelity PCR 25 pl Master Mix with HF Buffer 2X Total 50 pl If NEBNext Multiplex Oligos for Illumina Index Primers 1 12 are used for each reaction only one of the 12 PCR primer indices is used during the PCR step B2 Set up the cycler using the cycling conditions in Table 9 GeneRead DNAseq Gene Panel Handbook 11 2012 27 Table 9 Cycling conditions for PCR amplification of adaptor
15. ce tube on magnetic rack and wait until solution is clear about 5 minutes Carefully remove and discard supernatant Be careful not to disturb the beads which contain the DNA target Note Do not discard beads Add 400 ul fresh 80 ethanol to the tube while on magnetic rack Incubate at room temperature for 30 seconds and then carefully remove and discard the supernatant Repeat step A6 once Briefly spin the tube and place on magnetic rack Completely remove residual ethanol and dry beads for 10 minutes while tube is on rack with lid open Elute DNA target beads into 25 pl 0 1x TE buffer Mix well by vortexing Spin down briefly and place tube on rack until solution is clear Transfer the supernatant to a clean PCR tube and proceed to PCR amplification GeneRead DNAseq Gene Panel Handbook 11 2012 PCR amplification of adaptor ligated DNA Al Mix the components in Table 5 in a 0 2 ml PCR tube Table 5 Reaction components for PCR amplification Component Volume Adaptor ligated DNA 25 pl Primers 4 ul DNase free water 21 ul OneTaq Hot Start 2x Master Mix 50 ul Total 100 pl A2 Set up the cycler using the cycling conditions in Table 6 Table 6 Cycling conditions for amplification of adaptor ligated DNA Step Temperature Time Nick translation 68 C 20 min Initial denaturation 94 C 30 sec 5 cycles 94 C 30 sec 58 C 30 sec 68 C 1 min Hold 4 C o0 A3 Transfer the entire volum
16. e to a 1 5 ml Lobind tube Cleanup of adaptor ligated DNA Al Add 140 pl 1 4X volume of AMPure XP Reagent to the sample and mix by pipetting up and down A2 Incubate for 5 minutes at room temperature A3 Pulse spin the tube and place in a magnetic rack for 5 minutes or until the beads have collected to the wall of the tube and the solution is clear GeneRead DNAseq Gene Panel Handbook 11 2012 23 A4 Carefully remove and discard the supernatant without disturbing the beads A5 Keep the tube on the magnet and add 400 ul freshly prepared 80 ethanol A6 While keeping the tube in the magnetic rack rotate the tube 180 degrees When the beads have collected to the opposite side of the tube near the magnet turn the tube another 180 degrees Rotate the tube two more times each time waiting until the beads collect to the opposite side of the tube A7 Allow the solution to become clear and carefully remove and discard the supernatant A8 Repeat previous three steps A5 A7 A9 Pulse spin the tube return to the magnet and remove any residual ethanol with a pipet A10 Keeping the tube in the magnetic rack with the cap open air dry the beads for 5 minutes at room temperature A11 Resuspend the beads in 22 pl 0 1x TE buffer Mix well by vortexing A12 Pulse spin the tube return to the magnet and collect the supernatant Library quantification using GeneRead DNAseq Library Quant Array The library can be
17. ene Panel Handbook 11 2012 B11 Resuspend the beads in 22 pl 0 1x TE Buffer Mix well on a vortex mixer or by pipetting up and down and put the tube in the magnetic stand until the solution is clear B12 Transfer supernatant to a clean 1 5 ml LoBind tube Library quantification using GeneRead DNAseq Library Quant Array The library may be stored in a 20 C freezer prior to quantification Appendix C Library Quantification and Quality Control Quality control for the target enrichment and library construction process can be performed using QIAGEN s GeneRead DNAseg Library Quant Array With this array the correct dilution of the library can also be determined for sequencing Please refer to the corresponding user manual for library quantification and QC Appendix D Data Analysis using QIAGEN Web Portal After sequencing results can be analyzed using QIAGEN s Next Generation Sequencing Data Analysis Web Portal Our data analysis server will perform reads trimming removing primer sequences mapping to reference genome and variants identification Please refer to the corresponding document for data analysis GeneRead DNAseq Gene Panel Handbook 11 2012 29 Ordering Information Product GeneRead DNAseq Gene Panels GeneRead DNAseq Gene Panels High Content GeneRead Custom DNAseq Gene Panels GeneRead DNAseq Mix n Match Gene Panels GeneRead Panel Mastermix Related products GeneRead DNAseq Librar
18. er than misuse QIAGEN will replace it free of charge or refund the purchase price We reserve the right to change alter or modify any GeneRead DNAseq Gene Panel Handbook 11 2012 product to enhance its performance and design If a QIAGEN product does not meet your expectations simply call your local Technical Service Department or distributor We will credit your account or exchange the product as you wish Separate conditions apply to QIAGEN scientific instruments service products and to products shipped on dry ice Please inquire for more information A copy of QIAGEN terms and conditions can be obtained on request and is also provided on the back of our invoices If you have questions about product specifications or performance please call QIAGEN Technical Services or your local distributor see back cover or visit www giagen com Technical Assistance At QIAGEN we pride ourselves on the quality and availability of our technical support Our Technical Service Departments are staffed by experienced scientists with extensive practical and theoretical expertise in sample and assay technologies and the use of QIAGEN products If you have any questions or experience any difficulties regarding GeneRead DNAseq Gene Panels or GeneRead Panel Mastermix or QIAGEN products in general please do not hesitate to contact us QIAGEN customers are a major source of information regarding advanced or specialized uses of our products This info
19. ir Enzyme Mix 3 ul DNase free water 26 ul Total 60 pl A2 Mix the components by pipetting up and down several times A3 Incubate in a thermal cycler for 20 minutes at 25 C followed by 10 minutes at 70 C A4 Pulse spin the microfuge tube and return to ice Preparation of adaptor ligated DNA A5 Add the reagents in Table 4 to the PCR tube 20 GeneRead DNAseq Gene Panel Handbook 11 2012 Table 4 Reagents for preparation of adaptor ligated DNA Component Volume DNase free water 14 ul T4 DNA Ligase Buffer 10x 10 pl NEBNext DNA Library Adaptors 10 ul for lon Torrent T4 DNA Ligase 6 ul Total 40 pl A6 The total volume in the microfuge tube should be 100 pl Mix the contents by pipetting up and down several times A7 Incubate in a thermal cycler for 15 minutes at 16 C A8 Transfer the entire volume to a 1 5 ml Lobind tube Cleanup of adaptor ligated DNA Al Add 160 pl 1 6x volume AMPure XP Reagent to the sample and mix by pipetting up and down A2 Incubate for 5 minutes at room temperature A3 Pulse spin the tube and place in a magnetic rack for 5 minutes or until the beads have collected to the wall of the tube and the solution is clear A4 Carefully remove and discard the supernatant without disturbing the beads A5 Keep the tube on the magnet and add 400 pl freshly prepared 80 ethanol A6 While keeping the tube in the magnetic rack rotate the tube 180 degrees When the
20. ligated DNA Step Temperature Time Initial denaturation 98 C 30 sec 12 cycles 98 C 10 sec 65 C 30 sec 72 C 30 sec Index primer 1 25 uM 98 C 5 min Phusion High Fidelity PCR Master 98 C oo Mix with HF Buffer 2X B3 Transfer the entire volume to a 1 5 ml Lobind tube Cleanup using AMPure XP Beads B1 Add 60 ul 1 2x volume AMPure XP Reagent to the sample and mix by pipetting up and down B2 Incubate for 5 minutes at room temperature B3 Pulse spin the tube and place in a magnetic rack for 5 minutes or until the beads have collected to the wall of the tube and the solution is clear B4 Carefully remove and discard the supernatant without disturbing the beads B5 Keep the tube on the magnet and add 400 ul freshly prepared 80 ethanol B6 While keeping the tube in the magnetic rack rotate the tube 180 degrees When the beads have collected to the opposite side of the tube near the magnet turn the tube another 180 degrees Rotate the tube two more times each time waiting until the beads collect to the opposite side of the tube B7 Allow the solution to become clear and carefully remove and discard the supernatant B8 Repeat previous three steps B5 B7 B9 Pulse spin the tube return to the magnet and remove any residual ethanol with a pipet B10 Keeping the tube in the magnetic rack with the cap open air dry the beads for 5 minutes at room temperature 28 GeneRead DNAseq G
21. lymerase reactions reactions PCR Buffer m dNTP mix dATP dCTP dGTP dTTP DNase free water Shipping and Storage GeneRead DNAseg Gene Panel Kits are shipped frozen or at ambient temperature and should be stored at 20 C immediately upon arrival When stored properly at 20 C all reagents are stable for up to 6 months after delivery GeneRead Panel Mastermixes are shipped on cold packs For long term storage keep tubes at 20 C If the entire volume will not be used at once we recommend dividing into aliquots and storing at 20 C Avoid repeated freezing and thawing If stored under these conditions GeneRead Panel Mastermixes are stable for 6 months after receipt Product Use Limitations GeneRead DNAseq Gene Panels and GeneRead Panel Mastermix are intended for molecular biology applications These products are not intended for the diagnosis prevention or treatment of a disease All due care and attention should be exercised in the handling of the products We recommend all users of QIAGEN products to adhere to the NIH guidelines that have been developed for recombinant DNA experiments or to other applicable guidelines Product Warranty and Satisfaction Guarantee QIAGEN guarantees the performance of all products in the manner described in our product literature The purchaser must determine the suitability of the product for its particular use Should any product fail to perform satisfactorily due to any reason oth
22. nce analysis experiment is consistent high quality DNA from every experimental sample Therefore sample handling and DNA isolation procedures are critical to the success of the experiment Residual traces of proteins salts or other contaminants will either degrade the DNA or decrease the efficiency of if not block completely the enzyme activities necessary for optimal whole genome amplification and real time PCR performance Recommended genomic DNA preparation method The QIAGEN QlAamp DNA Mini Kit cat no 51304 and QlAamp DNA FFPE Tissue Kit cat no 56404 are highly recommended for the preparation of genomic DNA samples from fresh tissues and FFPE tissue samples Ensure that samples have been treated for the removal of RNA as RNA contamination will cause inaccuracies in DNA concentration measurements Do not omit the recommended RNase treatment step to remove RNA If genomic DNA samples need to be harvested from biological samples for which kits are not available please contact Technical Support representatives for suggestions For best results all DNA samples should be resuspended in DNase free water or alternatively in DNase free 10 mM Tris buffer pH 8 0 Do not use DEPC treated water Recommended library quantification method The QIAGEN GeneRead DNAseq Library Quant Array cat no 180601 is highly recommended for the quantification of the prepared library Each GeneRead DNAseq Gene Panel contains a set of spike in controls
23. ome fragments greater than 10 kb This can be checked by running a fraction of each DNA sample on a 1 agarose gel When working with chemicals always wear a suitable lab coat disposable gloves and protective goggles For more information please consult the appropriate material safety data sheets MSDSs available from the product supplier rr_ ___ _u Fo eMHg 9r ii1i ii Bi PF MAM fff i j i i _ gt 14 GeneRead DNAseq Gene Panel Handbook 11 2012 Protocol PCR Setup Procedure 1 Dilute DNA sample to 4 ng pl For each sample 80 ng 20 ul DNA is required for the 4 pool panel or 160 ng 40 pl for the 8 pool panel 2 Determine the number of reactions needed For a 4 pool panel 4 reactions for each sample are required For an 8 pool panel 8 reactions for each sample are required Prepare PCR strips or PCR plate according to the number of reactions Label with sample names and pool numbers 3 Aliquot 5 pl each DNA sample into each well 4 Prepare the PCR reaction mix on ice according to Table 1 For each sample 4 or 8 PCR reaction mixes will be needed Mix gently by pipetting up and down Table 1 Preparation of PCR reaction mix for each primer mix pool Component Per 1 sample Per n samples GeneRead Panel 11 ul llxngl Mastermix Primer mix pool x 5 5 ul 5 5x n ul Total volume 16 5 pl 16 5 x n pl The number of
24. rmation is helpful to other scientists as well as to the researchers at QIAGEN We therefore encourage you to contact us if you have any suggestions about product performance or new applications and techniques For technical assistance and more information please see our Technical Support Center at www giagen com Support or call one of the QIAGEN Technical Service Departments or local distributors see back cover or visit www qiagen com Safety Information When working with chemicals always wear a suitable lab coat disposable gloves and protective goggles For more information please consult the appropriate safety data sheets SDSs These are available online in convenient and compact PDF format at www giagen com safety where you can find view and print the SDS for each QIAGEN kit and kit component 24 hour emergency information Emergency medical information in English French and German can be obtained 24 hours a day from Poison Information Center Mainz Germany Tel 49 6131 19240 6 GeneRead DNAseq Gene Panel Handbook 11 2012 Quality Control In accordance with QIAGEN s Quality Management System each lot of GeneRead DNAseq Gene Panels and GeneRead Panel Mastermix is tested against predetermined specifications to ensure consistent product quality Tte Tr e ofbGill be e e gt O IWIii eg ii O E i lt _ P GeneRead DNAseq Gene Panel Handbook 11 2012 7
25. stored in a 20 C freezer prior to quantification 24 GeneRead DNAseq Gene Panel Handbook 11 2012 Appendix B NEBNext DNA Library Prep Master Mix Set for Illumina with NEBNext Singleplex Oligos for Illumina E7350 or NEBNext Multiplex Oligos for Illumina Index Primers 1 12 E7335 Procedure Adaptor ligation of PCR product B1 Add the components from Table 7 to a 0 2 ml PCR tube Table 7 Reagents for adaptor ligation of PCR product Component Volume Purified PCR product 25 ul Quick Ligation Reaction Buffer 5X 10 ul NEBNext Adaptor 2 ul Quick T4 DNA Ligase 2 ul DNase free water 11 pl Total 50 pl B2 Incubate in a thermal cycler for 15 minutes at 20 C B3 Add 3 pl USER enzyme mix by pipetting up and down and incubate at 37 C for 15 minutes B4 Transfer the entire volume to a 1 5 ml Lobind tube Cleanup using AMPure XP Beads B1 Add 90 ul 1 8X volume of AMPure XP Reagent to the sample and mix by pipetting up and down B2 Incubate for 5 minutes at room temperature B3 Pulse spin the tube and place in a magnetic rack for 5 minutes or until the beads have collected to the wall of the tube and the solution is clear B4 Carefully remove and discard the supernatant without disturbing the beads GeneRead DNAseq Gene Panel Handbook 11 2012 25 B5 Keep the tube on the magnet and add 400 pl freshly prepared 80 ethanol B6 While keeping the tube in the magnetic rack rotate the tube 180
26. termined by the number of genes in a panel GeneRead DNAseq Gene Panels can enrich selected genes using as little as 80 ng genomic DNA in two hours Figure 2 Briefly add genomic DNA to primer mix and PCR mastermix and put them into a regular thermocycler for PCR amplification After the reaction is complete pool the product for the same DNA sample and purify the enriched DNA The purified DNA then is ready for NGS library construction and sequencing using the NGS platform of your choice The sequencing results can be analyzed on our server at http ngsdataanalysis sabiosciences com and genetic variations can be detected Figure 3 Eel 8 GeneRead DNAseq Gene Panel Handbook 11 2012 A m n n N RENT Na UHM HHHH HHHH H H HHHH HHE HHHH E aa LARR Multiplex PCR primer sets Figure 1 Multiplex PCR based target enrichment scheme GeneRead DNAseq Gene Panels use multiplex PCR based target enrichment technology in combination with a sophisticated primer design and separation algorithm to maximize design coverage and minimize nonspecific amplification Isolate DNA URINA NHH NHIN Gene of interest Targeted enrichment PCR enabled ATA MEAL AAT VICI dB BBB ARCA MURA FARA UMM WN iHHNNUNNNH HUNAN PN Taunt Tinti Library proparahon Tannin e Start adaptor Turini e End adaptor Tui Library quantification Sequencing ATGCATG ATGGATTAAC AACGTATG ATGCATTATIT Guided assembly ATGCATGGATTAACGTATGCATTATTT Sequence anal
27. the tube and the solution is clear 6 Carefully remove and discard the supernatant without disturbing the beads 7 Keep the tube on the magnet and add 500 pl freshly prepared 70 ethanol 8 While keeping the tube in the magnetic rack rotate the tube 180 degrees When the beads have collected to the opposite side of the tube near the magnet turn the tube another 180 degrees Rotate the tube two more times each time waiting until the beads collect to the opposite side of the tube 9 Allow the solution to become clear and carefully remove and discard the supernatant 10 Repeat steps 7 9 11 Pulse spin the tube return it to the magnet and remove any residual ethanol with a pipet 12 Keeping the tube in the magnetic rack with the cap open air dry the beads for 5 minutes at room temperature 13 Resuspend the beads in 25 ul low TE Mix well by vortexing 14 Pulse spin the tube return to the magnet and collect the supernatant into a new Lobind tube 15 Proceed to library construction according to the sequencing platform of your choice Refer to Appendix A for recommended library construction protocol for sequencing with lon Torrent PGM Refer to GeneRead DNAseq Gene Panel Handbook 11 2012 17 Appendix B for recommended library construction protocol for sequencing with Illumina MiSeq HiSeq Note If reactions are to be stored prior to library construction transfer them to a 20 C freezer 18 GeneRead
28. y Quant Array GeneRead Library Quant Array GeneRead Library Quant Kit GeneRead qPCR SYBR Green Mastermix QlAamp DNA Mini Kit 50 30 Contents Sets of 4 tubes containing wet bench verified primer sets for targeted exon enrichment of a pathway focused panel of genes Sets of 8 tubes containing wet bench verified primer sets for exon enrichment of a pathway focused panel of genes Tubes containing primer sets for targeted exon enrichment of a customized panel of genes Tubes containing wet bench verified primer sets for targeted exon enrichment of a custom panel of genes Mastermix for use with the GeneRead DNAseq Gene Panel System Reagents for NGS sample library quantification following targeted exon enrichment with the GeneRead DNAseq Gene Panel System Reagents for NGS sample library quantification Reagents for NGS sample library quantification Mastermix for use with the GeneRead Library Quant Arrays and Kit For 50 DNA preps 50 QlAamp Mini Spin Columns QIAGEN Proteinase K Collection Tubes 2 ml reagents and buffers Cat no 180941 180942 180946 180944 Varies 180601 180611 180612 Varies 51304 GeneRead DNAseq Gene Panel Handbook 11 2012 Product Contents Cat no QlAamp DNA FFPE For 50 DNA preps 50 QlAamp 56404 Tissue Kit 50 MinElute Columns Proteinase K Collection Tubes 2 ml buffers For up to date licensing information and product specific disclaimers
29. ysis ATGCATGGATTAACGIATGCATTATIT Wild type ATGCATGGITTAACGTATGCATTATTI Sample 1 ATGCATGGATTAACCAGTGCATTATIT Sample 2 Figure 2 GeneRead DNAseq Gene Panel procedure GeneRead DNAseq Gene Panel Handbook 11 2012 9 Target library NGS Data DNA extraction A enrichment construction sequencing analysis QlAamp DNA Mini Kitor GeneRead DNAseq Gene library construction kit NGS sequencing kit QIAGEN NGS web portal QlAamp FFPE Tissue Kit Panel 30 min 120 min 120 min 2 3 days 4 hrs Figure 3 Overview of the NGS workflow with GeneRead DNAseq Gene Panels The procedure involves DNA extraction QIAGEN QlAamp DNA Mini Kit or QIAmp DNA FFPE Tissue Kit is recommended followed by target enrichment with GeneRead DNAseq Gene Panels NGS library construction sequencing and data analysis using the QIAGEN NGS Data Analysis Web Portal 10 GeneRead DNAseq Gene Panel Handbook 11 2012 Equipment and Reagents to Be Supplied by User When working with chemicals always wear a suitable lab coat disposable gloves and protective goggles For more information consult the appropriate material safety data sheets MSDSs available from the product supplier In addition to the GeneRead DNAseq Gene Panel and GeneRead Panel Mastermix the following supplies are required For genomic DNA isolation M See page 13 for specific recommendations For target enrichment High quality nuclease free water Do not use DEPC treated water Agencourt AMPure
Download Pdf Manuals
Related Search