XLibraryDisplay User Manual
Contents
1. XLibraryDisplay Version 2 User Manual Creating a template Click 1 Enter template and the following dialog box will open Enter your template DNA sequence Please load your template DNA from a file or enter it below in raw or FASTA format ORF Finder View ORFs Rev complement Clear Load file Cancel OK The example MjTyrRS dataset includes an MjTyrRS template truncated txt file which you can load into the box using the Load file button Click OK to use the DNA sequence in the box as the template Here s the MjTyrRS example template in FASTA format gt MjTyrRS truncated atggatgaatttgaaatgattaaacgcaacaccagcgaaattattagcgaagaagaactgcgcgaagtgc tgaaaaaagatgaaaaaagcgcgtacattggctttgaaccgagcggcaaaattcatctgggccattatct gcagattaaaaaaatgattgatctgcagaacgcgggctttgatattattattctgctggcggatctgcat gcgtatctgaaccagaaaggcgaactggatgaaattcgcaaaattggcgattataacaaaaaagtgtttg aagcgatgggcctgaaagcgaaatatgtgtatggcagcgaatttcagctggataaagattataccctgaa cgtgtatcgcctggcgctgaaaaccaccctgaaacgcgcgcgccgcagcatggaactgattgcgcgcgaa gatgaaaacccgaaagtggcggaagtgatttatccgattatgcaggtgaacgacatccattatctcggcg tggatgtggcggtgggcggcatggaacagcgcaaaattcacatgctggcgcgcgaactgctgccgaaaaa agtggtgtgcattcataacccggtgctgaccggcctggatggcgaaggcaaaatgagcagcagcaaaggc aactttattgcggtggatgatagcccggaagaaattcgcgcgaaaattaaaaaagcgtattgcccggcgg gcgtggtggaaggcaacccgattatggaaattgcgaaatattttctggaatatccgctgaccattaaacg cccggaaaaatttggcggcgatctgaccgtgaacagct2. 0 3284 0 1719 0 1233 XLibraryDisplay Version 2 User Manual 12 Note the no DNA sample IDs The asterisk lets XLibraryDisplay know that this data is intended to always be graphed There does not need to be any sequence data for sample IDs with asterisks They are intended for controls In this case no DNA negative controls were run to determine background levels for the assay It is ok to have multiple identical sample IDs with asterisks since they do not need to be uniquely associated with sequences The program will check your data for consistency or other issues when you try to correlate sequences to activity data exclude by activity data or auto pick hits It will help you by pointing out any issues so feel free to enter your data and simply try to use it Correlating sequences to activity data To correlate all the sequences to the activity data click Correlate to activity from the XLibraryDisplay ribbon To correlate a subset of sequences to activity data select sequences on the Aligned sheet right click the selection and click Graph activity data It is useful sometimes to graph non neighboring sequences by holding down Ctrl while selecting different sequences Excluding sequences based on activity data Click Exclude by activity from the XLibraryDisplay ribbon Dialog boxes will pop up that let you set the cut off criteria for each column of data entered on the Activity sheet
3. You can specify if you want to exclude sequences if values are below or above the cut off This is useful to filter out negative clones using multiple experimental inputs This does not take into account sequence information so you have the possibility of keeping redundant clones Picking unique leads based on activity data Click Auto pick hits from the XLibraryDisplay ribbon A dialog box will pop up that lets you select a single column of activity data to pick leads You can specify whether you want leads to have high values or low values You can also specify a cut off which will exclude clones below or above a defined value Clones will be sorted by the specified activity data Top ranked unique clones will be picked Sets of unique clones are grouped into tiers Auto pick hits only takes into account one column of activity data It is mainly intended to maximize the diversity minimize the redundancy of hits Weblogo analysis Click Export sequences from the XLibraryDisplay ribbon and select Library AAs and click Export Go to the weblogo server http weblogo berkeley edu logo cgi and XLibraryDisplay Version 2 User Manual 13 upload the exported file It should generate a weblogo plot If it doesn t work then you might need to curate your sequences to remove bad quality data Align to structure Click Analyze structure from the XLibraryDisplay ribbon Select the protein data bank pdb fil
4. GTACGCGCTTTTTTCATCTTI ETA EFE TE I IV Start ORFs with M ATG IV Unknown amino acids Xs allowed 3 Cancel OK Adjust your parameters and select the correct reading frame for your sequence and click OK To help refine your template the View ORFs button will open the following Open reading frame viewer 5 131 Frame 1 M D EUFUE M TK R N 2 S ET ES EE EE LR E V2 513 Frame 2 OW u N L Ro 2 CR ON A POP OA CR CE CA CR KONG An Ke 5 3 Frame 3 GOT A ON D RO O HORNY UR RRT AR SAE DNA template ATGGATGAATTTGAAATGATTAAACGCAACACCAGCGAAATTATTAGCGAAGAAGAACTGCGCGAAGTGCTGi 2l The DNA sequence in the Open reading frame viewer can be edited and copied pasted ctrl c ctrl v back into the original template sequence text box Loading library sequences Click 2 Load sequences select all your sequence files shift left click and click Open The example dataset contains 96 seq files and 96 Phred phd 1 files Phred files contain QC data that is useful for assessing data quality The sequences will populate the RawData worksheet after loading Column A shows the sequence names Column 2 shows the read length Column 3 shows the percent bases that have been assigned everything that s not an N Column 4 contains the sequences If you opened the phd files you should also see a RawQC worksheet Columns 1 3 have the same information as RawData sheet Column 4 now shows the m
5. OOb0000000000000000 00 0Bo0006 XLibraryDisplay Version 2 User Manual 11 Analysis Tools Entering activity data Open the Activity worksheet and enter data into columns The activity Sample IDs must be uniquely associated with individual sequence names but they don t need to be complete sequence names For instance say you have the following sequence names SequenceA01 SequenceB01 SequenceA10 and SequenceA11 Your Sample IDs on your Activity sheet can simply be A01 BO1 A10 and A11 But they can t be A1 B1 A10 and A11 The program will not be able to match A1 with SeguenceA01 Instead Al is a sub string of SeguenceA10 and SequenceA11 so it is ambiguous which sequence A1 refers to For the same reason it s NOT OK to have identical sample IDs For instance A01 B01 A10 A01 It would also be a problem to have the following Sample IDs because the program cannot tell if 01 refers to SeguenceA01 or SequenceB01 01 10 11 Here s some example data from Stafford et al PEDS 2014 Sample ID VEGF HER2 Streptavidin Uncoated A01 0 2164 0 2757 0 1367 0 1007 3A2 0 2405 0 3572 0 2288 0 1757 3A3 0 3843 0 2123 0 1987 0 1469 3A4 1 7928 0 3086 0 2387 0 1565 no DNA 0 1209 0 1057 0 1255 0 1117 3A6 0 9062 0 4041 0 3196 0 124 3A7 0 5825 0 5499 0 3248 0 149 3A8 0 9928 1 1023 0 7612 0 5218 no DNA 0 0959 0 1031 0 0839 0 0892 3A10 1 6264
6. XLibraryDisplay Version 2 User Manual Ryan Stafford December 2015 Table of Contents General Overview Getting Started DNA Analysis Creating a template Loading library sequences Trimming sequences Filtering sequences Translating and aligning sequences Protein Alignment Dataset Preparation Right click menu Manually marking library positions Visualization Tools Sorting clones Hiding columns Coloring sequences Analysis Tools Entering activity data Correlating sequences to activity data Excluding sequences based on activity data Picking unique leads based on activity data Weblogo analysis XLibraryDisplay Version 2 User Manual 10 10 10 11 11 11 11 12 12 13 13 13 13 Align to structure Export a PyMOL script XLibraryDisplay Version 2 User Manual 14 14 General Overview Thanks for downloading and using XLibraryDisplay and actually reading the user manual Hopefully the program is so intuitive that you do not actually need to read this What is XLibraryDisplay XLibraryDisplay is a program that helps scientists analyze sequences and experimental data for protein engineering projects It can also be used for routine cloning analysis or as a tool for aligning and annotating protein sequences Why did you write XLibraryDisplay We were unable to find a program to help us efficiently analyze all the DNA sequences we collected during our antibody and enzyme engineer
7. ary positions For other scaffolds the randomized positions can be found by the percent mutation relative to the template Please read the message and check the template to make sure the correct residues are marked in magenta Often the 3 ends of sequences are of poor quality so the program has trouble finding the designed mutations in the noise You can adjust the parameters to get the automatic detection to work but if there are any difficulties it is recommended that you manually assign your library positions using the right click menu Right click menu Right clicking on any worksheet will open a menu Mark library position Clear library position mark Remove from alignment Local DNA AA alignment View translated ORFs Edit DNA sequence Graph activity data ee JE eiia Export PyMOL script a Most of these buttons are intended to be used on the Aligned sheet except for View translated ORFs and Export PyMOL script which can be used on other sheets View translated ORFs works on the most DNA processing sheets e g BadDNA GoodDNA etc and the Aligned sheet Manually Marking Library Positions To manually mark your library positions right click on each column on the Aligned sheet and select Mark library position Your marked library positions will now be colored in magenta in the template If you marked a column that s not a library position you can unmark XLibraryDisplay Version 2 User Ma
8. atgaagaactg Please note the DNA template is a critical component used as a reference for the majority of the analysis steps For the program to work as intended your DNA template should e bein the reading frame you want to analyze e cover the part of the protein you want to analyze e include only the most reliable part of the sequencing data e have 5 and 3 ends that are found in all your sequences default is 20 bps You can make your own template DNA sequence file outside of the program using Microsoft Notepad or your favorite text editor but it is recommended you use the tools available in XLibraryDisplay to help Simply copy ctrl c and paste ctrl v your DNA sequence into the box XLibraryDisplay Version 2 User Manual or load a DNA sequence file It is best to use the parent DNA sequence if available but a good quality sequence from your dataset can also be used if processed properly To prepare your template sequence to meet the criteria listed above click the ORF Finder button This will display the following dialog box Open reading frame finder 53 Frame 1 ATGGATGAATTTGAAATGATTAZ C 35 Frame 1 ATGAATGCACACCACTTTTTTCC 654 bps M D E F E M IT XK 5 bps MN A Hn FF FPE ONs 0 Xs 4 2 0 Ns 0 Xs C 53Frame2 TGA C 35Frame2 TAA 3bps 3bps ONs OXs ONs 0 Xs C 53Frame3 ATGTGGCGGTGGGCGGCATGGAZ 35 Frame 3 96 bps M W R W A A W N 98bps ONs 0 Xs ONs 1X AT
9. e which contains a homologous structure to your template PDB files can be downloaded here http www rcsb org pdb home home do It is probably best to use a sequence based search for the most similar sequence to your translated template Select the chain in the pdb file that matches your template Click OK to align using the Needleman Wunsch algorithm This will align your sequences to the chain in the pdb file and its secondary structure This is useful for assessing how mutations might impact the protein structure Export a PyMOL script After aligning your sequences to a structure you can right click individual residues and select Export PyMOL script This creates a PyMOL readable pml script file which needs to be opened in the same folder as your pdb file to work When the pml file is opened it will read in the pdb file and color your template chain in the same manner as your alignment This helps to visualize mutations in 3D XLibraryDisplay Version 2 User Manual 14
10. ean QC score and the remaining columns show the individual bases for each sequence The color coding indicates the data quality The color key is at the bottom of the XLibraryDisplay Version 2 User Manual RawOC sheet Sequences on the RawData and RawOC sheets are never modified by the program Trimming Sequences Click 3 Trim sequences and OK to trim using the default parameters The TrimmedDNA worksheet shows your sequence names again in column A Column B and C tell you if the 5 and 3 end of each sequence is OK i e if they match the template Column D tells you if the trimmed sequence length is not divisible by 3 suggesting there is a frameshift Column E reports how many assigned bases everything not an N are in your trimmed sequence Column F shows the trimmed sequence lengths And Column G shows the trimmed sequences You can adjust the match length and the match required to trim For example if the match length is 20 and and the match required to trim is 18 then 18 of 20 bases need to match on the 5 or 3 end of the template to trim your sequence If you experience trouble with trimming you probably should consider changing your template before adjusting the trimming parameters If you loaded phred phd files you will see a TrimmedQC sheet New information includes the mean QC score for the trimmed sequence and the total internal bad bases i e bases with low QC scores in the middle of otherw
11. ength of the majority of the seguences If you choose a different template length it is usually best to have a longer template than a shorter one because fixing deletions is faster than insertions The Needleman Wunsch algorithm ClustalW2 ClustalO or MAFFT recommended should be used for other libraries when the library has many different sequence lengths Note that ClustalW2 ClustalO and MAFFT need to be installed before they can be used please click the Help button for installation details Mutations can be highlighted by various coloring schemes to highlight physicochemical differences relative to the parent template using published matrices Grantham Science 1974 185 862 864 Miyata et al J Mol Evol 1979 12 219 236 Risler et al J Mol Bio 1988 2013 1019 XLibraryDisplay Version 2 User Manual 1029 This Identity matrix option will highlight mutations in orange Silent mutations can be highlighted in peach The template sequence can also be converted to the consensus Dataset Preparation For libraries made by targeted mutagenesis the randomized library positions should be marked This can be done automatically by either clicking the Auto find library button on the XLibraryDisplay ribbon or manually by using the interactive right click menu recommended as described in the next section For antibodies one can use the Auto find library and select By antibody CDRs to mark the CDRs as libr
12. found on the Log worksheet Library segments can also be colored by similarity which is particularly useful for antibody analysis to identify groups of related CDRs afacoooooococococoo ooooMooooaaac ajooaooocacoaoooon aoac coccocoooooooooccocoooooooooaac cosooccococcocuoococcococsoowoscc vouuvovvuuvuuvuuuvuvuouoouuuuvuuuuuouuc rer LLEEEEEEEEEEEEEEEEEE ES HEEB pe pe pe pm Pe Pe De p EERE EE REE He Pe Gl l Ha e a e ufu tt llt le le ll oll ll Ul Ll l ll Ul Ll Ll ll U Ul l ll l L wafu ua us us a ua aa aa uu ua UG Ua a Ua U a U Ua Ua U L abanaanaocnenanaccumaanaccnnanc acooooooooo090ar000055550000590x BIRR RRR RRR RRR RRR ERE uuuuuuuuuuuuuuuuuuuuuuuubbbuuur obooooooooooo00000000000000000 Bee R RRR RRR RRR REPRE Seret G5 w0066600550555550650050055501 ajocoooooooooooooooooonoooooonnar daaqadcccadtetadadddrtatatadccccaas uiueuu uueuvuNuNMuNNNNN YN NNN YY YEN YY ws gosooooscoooooooooooooooooooooot ajooooocooocooooooooonooooooonnat viyyvvvewyyyvyyyyyyyyY livvvvyvyyys deccc0000000000000000000R0R0RR0RC olsoooo099009590990099999000550 ple ee an gt gt gt gt gt benar err an l d d l d gt d D d d d D gt 3 gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt gt dlssasasaddtaaatadataaattd aaat ooo000000000000000000000000000x VODOOHHODOHHHODDOOOOOOOHHOOOH we AAA dddadtadstadaaaaaae fE E E E E E E E E E E E E E E E E E E E E E E E E E E E E E ojo FC
13. g Macros have been disabled Then click Enable content Your warnings may differ slightly based on the version of Excel Now you should see the XLibraryDisplay ribbon on the top of the screen Fie Home Insert PageLayout Formulas Data Review ew Developer Team LibraryDispla e6 coaes tet BH of MMe A REST Aso Bu Print alignment ey Log ON OFF Clear Analyze Align Mutoti nd Clear aes ary Re align A sae Show Col ier Colo ae 5 iae ie pi out la Iculate Res An see Annotate Search gt sheets DNA proteins library marks se quences 3 mns librai ail ivity by mil perties liabi stru antibo dies byname lg Export sequences Copyright Start Prepare isualize Finish Help If you already have protein sequences then click Align proteins Otherwise click Analyze DNA if you are starting from raw DNA sequences that need to be processed first DNA Analysis If you don t have a dataset of your own you can follow along using the Methanococcus jannaschii tyrosyl tRNA synthetase MjTyrRS example dataset available for download on SourceForge The MjTyrRS library has been described in Zimmerman et al Bioconjugate Chem 2014 25 351 61 To process raw DNA sequences first click the Analyze DNA button on the XLibraryDisplay ribbon which will open the following menu Analyze DNA x 1 Enter template 2 Load sequences 3 Trim sequences 4 Filter sequences 5 Translate amp align
14. ing projects and correlate them with experimental data What s new in version 2 XLibraryDisplay now sports a colorful custom ribbon interface which makes sequence analysis easier and reduces screen clutter Many other analysis tools have been added too Why are there features not described in the manual The manual is intended to get you started Updates to the program are also more frequent than updates to the manual Please email ryanstafford1 gmail com if you have questions about a particular feature Will XLibraryDisplay run on my Mac No sorry Maybe someday will modify the code to work on a Mac How much does XLibraryDisplay cost XLibraryDisplay is free Where can I get XLibraryDisplay http sourceforge net projects XLibraryDispla Where do I report bugs or offer suggestions Please email ryanstafford1 gmail com This is very helpful and sincerely appreciated XLibraryDisplay Version 2 User Manual Getting Started To run XLibraryDisplay you simply need to have Excel installed The code for XLibraryDisplay is directly integrated into a Microsoft Excel workbook and has been tested on Windows XP 7 and 8 using Excel versions 2007 2010 and 2013 After opening the XLibraryDisplay Excel xlsm file you need to enable macros If you see Protected View This file originated from an Internet location and might be unsafe then click the Enable Editing button Then you will probably see a Security Warnin
15. ise good data Column G shows the program s attempt at classifying the sequences as either bad data mixed no match but OK not clear and OK You should probably be wary of all sequences not marked OK or no match but OK as there might be base miscalls or other issues so you ought to check their chromatograms if you want to be certain about their sequence Please note that the mixed classification is only about 50 60 accurate but you can usually get a good idea if a sequence is mixed by looking at the colored DNA sequences Filtering sequences Click 4 Filter sequences and click OK to use the default parameters to remove all sequences that do not match your template The example dataset will transfer A06 GO6 and E12 to the BadDNA sheet as they show no match to the 5 and 3 end of the template i e 5 BAD and 3 BAD Sequences that pass the filters are copied to the GoodDNA worksheet and those that don t are passed to the BadDNA worksheet The default parameters are meant to be permissive so that nothing is excluded that shows any match to your template Specifically if the sequence shows 5 OK or 3 OK it will be transferred to the GoodDNA worksheet You can also remove sequences that appear to have frameshifts have unassigned bases Ns or XLibraryDisplay Version 2 User Manual that are smaller or larger than your tem
16. nual 10 Library positions are usually it but right clicking and selecting Unmark library position apparent as having a high mutation rate i e mostly orange columns Visualization Tools To assist with analysis the aligned sequences can be sorted and colored in many different ways using the XLibraryDisplay ribbon Sorting To sort your aligned clones click Sort by and select one of the options Sorting by annotation will move all sequences that are have stop codons red frameshifts blue unknown amino acids yellow Xs deletions light gray and insertions dark gray to the top Clones can also be sorted according to the total number of mutations relative to the template by name or alphabetically by whole sequence or just the library sequence iding columns Columns can be hidden to help you focus on library sequences or columns with mutations Large insertions can also be hidden Coloring sequences All the amino acids in the alignment or just the assigned library positions can be colored according to various schemes Residues can be colored by type according to IMGT Lesk or Rasmol schemes Several other IMGT schemes are also available to highlight groups of residues with similar properties Residues can be colored according to physicochemical differences relative to the template according to Grantham Miyata or Risler matrices see pg 9 References for the coloring scheme used can be
17. plate Advanced parameters are available if Phred files are loaded For the first pass through the dataset it usually makes sense to use the default parameters Translating and aligning sequences Click 5 Translate amp align and then select one of the alignment methods See the Protein Alignment section below for additional details Protein Alignment Proteins can be aligned directly by clicking the Align proteins button on the XLibraryDisplay ribbon or by processing raw DNA sequences as described above Multiple alignment options are available from the following dialog box Please choose the alignment method X C Simple global alignment to template for most libraries usually fast Needleman Wunsch global alignment for loop length libraries slow C ClustalW2 alignment for loop ength libraries fast not very reliable ClustalO alignment for loop ength libraries fast reasonably accurate MAEFT alignment for loop ength libraries usually fast and accurate Highlight F Silent mutations M Mutations by Grantham matrix I Convert template to the consensus sequence Perform alignment Cancel Help The simple global alignment is usually the best option for most libraries As a general rule if there is not intentional length variation in the library then the simple global alignment should be used To improve alignment speed and accuracy the template should be the l
Download Pdf Manuals
Related Search