Home

Paradise®Plus Reagent System User Guide

1. SuperScript Ill Paradise Plus tst Paradise Plus 2 STRAND E ENHANCER Enzyme ENZYME MIX provided by end user Figure A 1 Red 1 Red 2 Yellow Enhancer and SuperScript Ill Enzyme Add 1 Strand Synthesis components in the order listed in the following table If you are performing several amplifications you may wish to prepare a Complete 1 Strand Synthesis Mix based on the following table and add 9 0 uL Complete 1 Strand Synthesis Mix to each sample Mix thoroughly by flicking the tube and spin down DO NOT VORTEX Paradise 5 User Guide PN 12872 00 Rev C 56 Table A 7 Complete 1 Strand Synthesis Mix 6 reaction Master Component Amount pL Vial Mix with 10 overage uL Enhancer 2 Yellow E 13 2 1 Strand Master Mix 5 Red 1 33 0 1 Strand Enzyme Mix 1 Red 2 6 6 SuperScript Ill Enzyme 1 6 6 Total per sample 9 59 4 Not included in the kit 7 Incubate at 42 C for 1 5 hours then chill the sample to 4 8 C for at least one minute Do not hold samples at this step for a prolonged period of time Keep samples at 4 8 C while creating the standard curve Creating the Standard Curve Using the cDNA generated from the 100 ng of Universal Human Reference RNA create other standard curve points from subsequent serial dilutions Use the following guidelines gt The standard curve should consist of four standard points gt 100 ng 10 ng 1 ng and 0 1 ng p
2. Paradise S User Guide PN 12872 00 Rev C 5 Obtain Ct1650 Ct 1355 for the testing sample and the uRNA dilutions 6 Quantify the input RNA a Plot the standard curve of log uRNA amount vs Ct For each pair of primers one standard curve is generated b Obtain the uRNA equivalent of the testing sample from the corresponding standard curve Standard curve 1650 Standard curve 1355 c Usethe uRNA equivalent from 1650 primer set to estimate the RNA quantity use the ratio of RNA 1650 RNA 1555 to estimate the RNA quality Interpreting the Results The RNA concentration using the 3 Primer Set is the quantity of the sample RNA The ratio of 3 5 is obtained for each sample using the corresponding RNA concentration Table A 13 Example of results Primer Ct Quantity Primer Ct Quantity 3 5 Ratio 1355 1472 28 70 0 09 1650 1717 23 80 2 56 30 12 1355 1472 27 80 0 16 1650 1717 23 90 2 32 14 50 1355 1472 23 60 3 50 1650 1717 20 10 35 37 10 11 1355 1472 21 00 22 50 1650 1717 19 50 57 70 2 56 a The 3 5 ratio is the ratio of the quantities of each Primer Set For example in Sample 1 the ratio is equal to 30 12 this is derived from 2 56 0 085 Explanation of results The 3 5 ratio evaluates the abundance of the average B actin cDNA from the 3 end primer 1650 1717 compared to the abundance of a relatively 5 sequence primer 1355 1472 using the quantified PCR yields of ea
3. When incubation is complete mix the tube well by flicking and then briefly spin down by centrifugation Add 26 uL of the above first stand master mix to each reaction tube Mix well by flicking and then briefly spin down by centrifugation Incubate at 27 C for 10 minutes followed by 37 C for 2 hours in the thermal cycler Treat with 2 units of RNase H for 20 minutes at 37 C in the thermal cycler Immediately proceed to PCR product purification using QiaQuick PCR Purification Kit Pre treat the columns placed in collection tube by incubating 100 uL of QiaQuick PB buffer for 5 minutes and then centrifuge at 13200 rpm or full speed on a 5415C Eppendorf Centrifuge for 1 minute Add 260 uL of QiaQuick PB buffer to the sample tube Mix well by flicking and then briefly spin down by centrifugation Load the sample onto the pre treated columns Centrifuge at 6000 rpm for 1 minute Discard flow through Place the column into the same collection tube Wash with 750 uL of QiaQuick PE buffer Centrifuge at 13200 rpm for 1 minute Discard flow through Place the column back into the same collection tube Centrifuge at 13200 rpm for an additional 2 minutes to remove residual wash solution Place the column into a clean 2 ml microcentrifuge tube Add 50 uL of nuclease free water pH 8 5 directly onto the column membrane Incubate for 3 5 minutes and then centrifuge at maximum speed for minute Paradise 5 User Guide PN 1287
4. Figure A 11 RNA Elution Buffer Incubate at room temperature for one minute Place the assembly into the 2 mL support tube in the rotor with the 0 5 mL tube cap trailing the tube Centrifuge at 1 000 x g for one minute immediately followed by 16 000 x g for one minute Discard the purification column and retain the elution containing the labeled aRNA Measure the O D of the product at A and A soto determine the yield of labeled aRNA Perform electrophoretic analysis 1f necessary Proceed to protocols for microarray hybridization Rotation Figure A 8 Centrifuge Paradise 5 User Guide PN 12872 00 Rev C 72 A 10 A 11 CLEANING THE STAINING JARS The staining jars can be reused but must be cleaned Rinse jars with 10096 ethanol followed by distilled water then treat with RNase AWAY according to the manufacturer s protocol Rinse jars thoroughly with nuclease free water and allow to dry completely in the hood Do not use reservoirs to store solutions CENTRIFUGE INFORMATION The table below shows corresponding centrifugal forces g for selected rotations per minute rpm when working with the tabletop microcentrifuge Eppendorf 5415D Table A 17 Centrigual Forces g Rotations Per Minute rpm Centrifugal Force g 14 000 13 000 12 000 10 000 10 000 7 000 8 000 4 500 5 500 2 200 5 000 2 000 Paradise 5 User Guide PN 12872 00 Rev C 73
5. For Roche Light Cycler Preparing the PCR reactions 1 Prepare the PCR reaction mix according to the table below Paradise 5 User Guide PN 12872 00 Rev C 59 Table A 11 For the 3 B actin Primers Amount for Each Reaction Table A 12 For the 5 B actin Primers Component Volume uL Final Conc SYBR Green PCR Master Mix 2 BD Taqstart Antibody 0 16 25 mM MgCl 2 4 Uracil DNA Glycosylase 1 0 3 B actin Forward Primer 50 uM 0 25 625 nM 3 B actin Reverse Primer 50 uM 0 25 625 nM Water nuclease free 11 94 Amount for Each Reaction Component Volume pL Final Conc SYBR Green PCR Master Mix 2 BD Taqstart Antibody 0 16 25 mM MgCl 2 4 Uracil DNA Glycosylase 1 0 5 B actin Forward Primer 50 uM 0 25 625 nM 5 B actin Reverse Primer 50 uM 0 25 625 nM Water nuclease free 11 94 2 For each reaction add 18 uL of the PCR mix into a LightCycler capillary Add 2 uL of the cDNA 3 Spinthe capillaries at 500g for 5 second in their adaptor Load the capillaries into LightCycler 4 Run the LightCycler following programs as listed below set temperature transition rate to 20 Step yates Time Acquisition 1 Denaturation 95 1 min none 95 0 sec none 2 bien 35 58 5 sec none 72 10 sec single 95 0 sec none 3 Melting 65 10 sec none 99 0 sec cont 4 Cooling 40 1 min none
6. b Incubate the purification column with Conditioning Buffer for 5 minutes at room temperature c Centrifuge the purification column in the provided collection tube at 16 000 x g for one minute 2 Pipette 53 uL of Paradise Plus Reagent System Binding Buffer BB into the cell extract from Part 1 RNA Extraction Mix well by pipetting up and down DO NOT CENTRIFUGE Pipette 103 uL of Ethanol Solution EtOH into tube and mix well 3 The cell extract mixture will have a combined volume of approximately 206 uL 4 To bind RNA centrifuge for 2 minutes at 100 x g immediately followed by a centrifugation at 16 000 x g for 1 minute 5 Pipette 100 uL Wash Buffer 1 W1 into column and centrifuge for 1 minute at 8000 x g 6 Mix2 uL DNase Mix DNase with 18 uL of DNase buffer DNB Add 20 uL mixture to the column and incubate at room temperature for 20 minutes 7T Pipette 40 uL Wash Buffer 1 W1 into the purification column and centrifuge for one minute at 8000 x g 8 Pipette 100 uL Wash Buffer 2 W2 into the purification column and centrifuge for one minute at 8000 x g 9 Pipette another 100 uL Wash Buffer 2 W2 into the purification column and centrifuge for two minutes at 16 000 x g A Note Check the purification column for any residual wash buffer If wash buffer remains re centrifuge at 16 000 x g for one minute 10 Transfer the purification column to a new 0 5 mL microcentrifuge tube provided 11 Pipettel2 uL Elution Buf
7. There was insufficient disruption xtraction or lysis of cells Do not use over 150 uL of PK solution per sample for isolation For 2150 uL of PK solution perform multiple isolations Inappropriate reaction Optimize QRT PCR with positive controls to monitor the QRT PCR conditions performance Poor quality PCR mastermix Contact the vendor supplier of the PCR master mix uoce Mam Check dye component prior to data analysis chosen m Companen NaS Check that all the correct reagents were added Incorrect primer or probe Verify primer and probe sequences If necessary re synthesize with the sequence appropriate sequence PCR is not optimized Optimize PCR with cDNA standard curves to obtain a slope of 3 1 to 3 7 when plotting CT against the concentration of cDNA Degraded template ormo Repeat the extraction and RT reaction with fresh template template added Reaction inhibitor present Repeat with purified template Check technique and equipment to confine contamination Repeat the reaction with fresh reagents Run negative controls along with the samples to monitor template contamination Contamination of reagents or work area A 4 AMINO ALLYL aRNA LABELING This protocol is intended for use with amino allyl modified aRNA which was generated using the optional Amino Allyl IVT components of RA7010 and RA7012 Table A 14 Amino allyl aRNA Labeling Purification RA7012 Component Vial Color Via
8. gt Roche Light Cycler For ABI PRISM 7900HT 1 Prepare the PCR reactions per the table below combine the PCR master mix components in a clean nuclease free microcentrifuge tube To determine the total amount of PCR master mix required multiply the amount of each component by the number of reactions you are performing n plus one n 1 Table A 8 For the 3 p actin Primers Amount for Each Reaction Component Volume uL Final Conc SYBR Green PCR Master Mix 10 Uracil DNA Glycosylase 0 5 3 B actin Forward Primer 50 uM 0 25 625 nM 3 B actin Reverse Primer 50 uM 0 25 625 nM Water nuclease free 1 Table A 9 For the 5 p actin Primers Amount for Each Reaction Component Volume uL Final Conc SYBR Green PCR Master Mix 10 Uracil DNA Glycosylase 0 5 5 B actin Forward Primer 50 uM 0 25 625 nM 5 B actin Reverse Primer 50 uM 0 25 625 nM Water nuclease free 1 a The volumes listed above are specific to the Applied Biosystems 7900HT Fast Real Time PCR System Other real time PCR instruments may require adjustments to these volumes Please consult your instrument s user manual Mix thoroughly by inverting then spin quickly to collect the master mix at the bottom of the tube Paradise 5 User Guide PN 12872 00 Rev C 58 3 Proceed to Running the ABI PCR Reactions Preparing the reaction plate 1 Assemble the reac
9. Add250 uL of DNA Wash Buffer DW to the column and centrifuge at 16 000 x g for two minutes Check the purification column for any residual wash buffer If any wash buffer remains re centrifuge at 16 000 x g for one minute Figure 5 22 Wash Buffer DW Note Avoid splashing flow through in the collection tube onto the column If flow through waste liquid wets the outside of the purification column re centrifuge the column at16 000 x g to remove liquid a Discard the collection tube and flow through 6 Place the column into the provided 0 5 mL microcentrifuge tube and carefully add 11 uL of DNA Elution Buffer DE onto the center of the purification column membrane Gently touch the tip of the pipette to the surface of the membrane while dispensing DE to ensure maximum absorption of DE into the membrane Gently tap the purification column to distribute the buffer if necessary Paradise 5 User Guide PN 12872 00 Rev C 45 N Figure 5 23 Elution Buffer DE Incubate for one minute at room temperature Place each column tube assembly into the 2 mL support tube in the rotor with the 0 5 mL tube cap trailing the tube Centrifuge at 1000 x g for one minute followed immediately by 16 000 x g for one minute Discard the column and retain the elution containing the cDNA D It is safe to stop at this point in the protocol You may store the sample overnight at 20 C Rotation Figure 5 24 Centrifuge Note To a
10. C 43 Table 5 12 Complete 2 Strand Synthesis Mix 6 reaction Master Component Amount pL Vial Mix with 10 overage uL 2nd Strand Master Mix 29 White 191 4 2nd Strand Enzyme Mix 1 White 2 6 6 Total per sample 30 198 0 VVUVN Store at 4 C until use Incubate the sample s as follows 37 C 30 minutes 70 C 5 minutes 4 8 C Hold until ready to proceed up to a maximum of 30 minutes Note Place components back onto the cold block or refreeze immediately after dispensing the reagent Do not leave reagents at room temperature Paradise S User Guide PN 12872 00 Rev C 44 5 3 8 PARADISE PLUS ROUND TWO cDNA PURIFICATION 1 Add 250 uL of DNA Binding Buffer DB to a new purification column seated in the collection tube provided Incubate for five minutes at room temperature Centrifuge at 16 000 x g for one minute Figure 5 21 Binding Buffer DB Note DNA Binding Buffer DB must be at room temperature and thoroughly mixed before use A precipitate may form during long term storage Dissolve precipitate by mixing If necessary warm the DB vial to re dissolve 2 Add 200 uL of DB to the 2 Strand Synthesis sample tube mix well and pipette the entire volume into the purification column 3 To bind cDNA centrifuge at 100 x g or lowest speed setting available for two minutes immediately followed by a centrifugation at 10 000 x g for 1 minute to remove flow through 4
11. Transfer the slides to plastic slide jar h containing 95 ethanol for 30 seconds Transfer the slides to plastic slide jar i containing 100 ethanol for 1 minute Transfer the slides to plastic slide jar j containing xylene Hold slides in xylene until ready for microdissection The minimum incubation in xylene should be 5 minutes or up to a maximum of 2 hours Place the slides on a Kimwipe to dry in the hood for five to ten minutes prior to LCM LCM should be performed within 2 hours after removal from xylene Discard all used staining and dehydration solutions according to standard procedures Precautions Carry out the Staining and Dehydration segment of the protocol in a fume hood Wear clean disposable gloves 2 Xylene jar a must be changed after processing up to a maximum of 4 slides 2 75 Ethanol jar e must be changed after processing up to a maximum of 4 slides Staining times may vary depending on tissue types Performing Laser Capture Microdissection LCM Please consult the User Guide for the instrument you will use for detailed instructions Paradise 5 User Guide PN 12872 00 Rev C 12 4 1 4 1 1 4 2 4 2 1 4 RNA Extraction Isolation COMPONENTS REAGENTS AND SUPPLIES The Paradise Plus Reagent System RNA Extraction Isolation components include the following items Table 4 1 Paradise Extraction Room Temperature RA7001 Extr
12. flotation water bath Extraction and Isolation RNase contamination will cause experimental failure Minimize RNase contamination by adhering to the following recommendations throughout your experiment gt Always handle RNA in a manner that avoids introduction of RNases gt Wear disposable gloves and change them frequently to prevent the introduction of RNases from skin surfaces gt After putting on gloves avoid touching surfaces that may introduce RNases onto glove surfaces gt Do not use reagents not supplied with the Paradise Plus Reagent System Substitution of reagents or Kit components may adversely affect yields or introduce RNases Use only new plasticware that 1s certified nucleic acid free Use only new sterile RNase free pipette tips and microcentrifuge tubes Clean work surfaces with commercially available RNase decontamination solutions prior to performing reactions Vu Paradise S User Guide PN 12872 00 Rev C 6 Amplification RNase contamination will cause experimental failure Minimize RNase contamination by adhering to the following recommendations throughout your experiment gt gt gt gt gt Wear disposable gloves and change them frequently After putting on gloves avoid touching surfaces that may introduce RNases onto the glove surface Do not use reagents not supplied Substitutions of reagents or components may adversely affect yields or introduce RNases Use only ne
13. 16 000 x g for one minute Figure A 9 RNA Binding Buffer Add 200 uL of RB to the Transcript Labeling Reaction sample and mix thoroughly Pipette the entire sample volume into the purification column Centrifuge at 100 x g or lowest speed setting available for two minutes immediately followed by a centrifugation at 10 000 x g for 1 minute Add 200 uL of RNA Wash Buffer RW to the purification column and centrifuge at 10 000 x g for one minute Figure A 10 RNA Wash Buffer Paradise 5 User Guide PN 12872 00 Rev C 71 9 eo 10 11 12 RNA Binding Buffer RB must be at room temperature and thoroughly mixed before use A precipitate may form during long term storage Dissolve precipitate by mixing If necessary warm the RB vial to re dissolve Add 200 uL of fresh RW to the column and centrifuge at 16 000 x g for two minutes Check the purification column for any residual wash buffer If any wash buffer remains re centrifuge at 16 000 x g for one minute Discard the collection tube and flow through Place the purification column into a new 0 5 mL microcentrifuge tube provided in the kit and carefully add 30 uL of RNA Elution Buffer RE directly onto the center of the purification column membrane Gently touch the tip of the pipette to the surface of the membrane while dispensing RE to ensure maximum absorption of RE into the membrane Gently tap the purification column to distribute the buffer if necessary
14. 4 C 5 Assemble a master mix with the following components components listed are for one reaction Table A 3 Master Mix Components Item Volume pL Vendor Catalog First Strand Buffer 4 Invitrogen 18080 044 0 1M DTT 2 Invitrogen 18064 044 10 mM dNTP 1 Amersham US77212 500yL Rnasin 1 Promega N2511 Superscript III 1 Invitrogen 18064 044 Total 9 6 When incubation Step 4 is complete mix the tube well by flicking and then briefly spin down by centrifugation 7 Add9 uL of the First Strand Master Mix to each reaction tube Paradise 5 User Guide PN 12872 00 Rev C 53 A 2 8 Incubate at 27 C for 10 minutes followed by 37 C for 1 5 hours in the thermal cycler 9 The sample is now ready for Q PCR qRT PCR Please consult the protocol from the system manufacturer SAMPLE ASSESSMENT PROTOCOL MDS Analytical Technologies recommends performing this simple in process protocol to assess the quality of RNA in FFPE tissue blocks This protocol will enable estimation of RNA quantity and quality using a quantitative real time PCR assay with primers designed to B actin The assumption is that the B actin mRNA in the sample represents the average status of other RNA molecules in the same sample The total estimated RNA amount in a given sample is expressed as an equivalent of universal RNA that contains the same amount of B actin mRNA The protocol measures the average B actin cDNA length
15. 5 2 7 5 2 8 5 2 9 5 2 10 NUCLEIC ACID ELUTION USING SPIN COLUMNS Spin columns and 0 5 ml microcentrifuge tubes are provided for nucleic acid elution Improper orientation of tubes during centrifugation may result in cap breakage or sample loss To correctly use the column tube assembly insert a spin column into the 0 5 ml tube aligning the two cap hinges as illustrated Load Elution Buffer onto the column and incubate as directed Place the column tube assembly into a 2 ml lidless support tube PGC Scientific Catalog 16 8101 06 or similar in the centrifuge rotor alternately retain and reuse the 2 ml lidless collection tubes provided Some varieties of 2 ml tubes will not provide enough support Contact MDS Analytical Technologies Technical Support for other alternatives Skip one rotor position between assemblies and position assemblies with the 0 5 ml tube cap trailing the tube during centrifugation as shown Check for a mark on the centrifuge indicating rotation direction Centrifuge as directed in the protocol Rotation Figure 5 2 Centrifuge CONTROL AMPLIFICATIONS A control RNA sample is provided along with each kit to be used as a control template to verify amplification efficacy Use 10 uL of this RNA for control amplifications 10 uL of this RNA contains 5 ng of formalin fixed total RNA Enough control RNA is provided for three control reactions per six reaction kit The control RNA provides a good positive
16. 5 3 Gray 1 Add 1 0 uL of Primer 1 mix thoroughly by flicking the tube and spin down Incubate at 70 C for 1 hour then chill the samples to 4 8 C for at least one minute Spin down the contents and place on 4 8 C block before proceeding to the next step Place 1 Strand Synthesis components Red at 4 8 C cold block 1 Strand Master Mix Red 1 and Enhancer Yellow must be thawed thoroughly mixed with all solids dissolved and maintained at 4 8 C until used 1 Strand Enzyme Mix Red 2 and SuperScript III enzyme do not require thawing and can be placed directly at 4 8 C Mix enzyme thoroughly by inverting several times Spin briefly SuperScript Ill 1 Rog Plus 2 Paradise Plus 1st E Pei cs E 1st STRAND STRAND NHANC MASTER MIX ENZYME MIX as Shen PL as ree MDS provided by end user Araby e Andic Figure 5 4 Red 1 Red 2 Yellow E and SuperScript III Add 1 Strand Synthesis components in the order listed in the following table If you are performing several amplifications you may wish to prepare a Complete 1 Strand Synthesis Mix based on the following table and add 9 0 uL Complete 1 Strand Synthesis Mix to each sample Mix thoroughly by flicking the tube and spin down DO NOT VORTEX Paradise 5 User Guide PN 12872 00 Rev C 31 Table 5 8 Complete 1 Strand Synthesis Mix 6 reaction Master Component Amount pL Vial Mix with 10 overage uL Enhancer 2 Yellow E 13
17. 75 Ethanol 1L Nuclease free Water 1L Xylene 0 5L Table 3 2 Staining Components RA7014 component see Paradise Plus Stain 6 ml Slide jars 10x PRELIMINARY STEPS MATERIAL AND PROTOCOL REVIEW To get the most from your staining reagents take a few moments to examine the components of the kit and read the information in the following sections PROTOCOL SLIDE PREPARATION Precautions Wear clean disposable gloves throughout the Slide Preparation procedure Use clean RNase free instruments Wear clean disposable gloves throughout the Slide Preparation procedure Depending on humidity in the environment drying may take longer for the sections to dry The section must be dry before proceeding Do not allow sections to air dry for longer than 3 hours 1 Prior to starting slide preparation minimize RNase contamination of the equipment by cleaning as follows a Rotary Microtome Remove and discard old disposable microtome blade Use a Kimwipe soaked with RNase Away to wipe down the knife holder Dry holder with a clean Kimwipe Install a new disposable microtome blade into holder Paradise 5 User Guide PN 12872 00 Rev C 10 b Tissue Floatation Bath Use a Kimwipe soaked with RNase Away to wipe down and clean the interior of the water bath Rinse the interior with Milli Q or RNase free water Fill the water bath with Milli Q or RNase free water Heat water to appropriate temperature for the paraffin use
18. DRE NN ANN E abe e OY eese dye ecu xcd 10 Reagents and Supplies coser Motte buses eta ose d ceo n ease MA ean 10 Preliminary Sie ps sets wets cece Mods Een Mat ILU teen ba ah ao tac 10 Material and Protocol Review tese erret rere ene iens 10 lucro NM 10 Slide Preparations s ete pe E eer sot metu er tue edebat editos 10 Deparaffinization Staining and Dehydration sss 11 RNA Extraction Isolation Components e eer ro p o e II V a id ra ar iia N 13 R agents and Supplies sonurin oi erus ponemus Nod nit ac ia RARE abe DS 13 Preliminary Steps Geo cue incesto Quis Cohen tad takin urate 13 Material and Protocol Review aie eter teet na i teda 13 PEOLOCO IE 15 Protocol for Use with CapSure Macro LCM Caps esee 15 Protocol for Use with CapSure HS LCM Caps sees 17 Tissue Scrape Protocol ro etie ritardo a a Qut og adus 20 RNA Amplification COMPONEN eaa a E pus ctuadistduhiese a Raices cue 24 Reagents and supplies 225 oh oo te etuer ha to tdt ia 24 Preliminary Steps esce oe a e e eae RE Nee peti edt ee eh 25 Paradise 5 User Guide PN 12872 00 Rev C i Material and Protocol Review eeeeeeeeeeeeeeeeeeeeeeeee enne 25 OV CVV e 25 Thermal Cycler Programme bone sod estie ora ntes qu dnd 27 Time Requirements vii eer ener ren reete p RESI RE Ae UE 28 Pr t col Note S eoe eee ac pe
19. an aRNA sample The system requires very small quantity of sample Refer to the Agilent 2100 bioanalyzer and RNA LabChip Kit Instruction Manuals for details Equipment and Materials Required Agilent 2100 bioanalyzer System Agilent RNA 6000 Nano Assay Kit Agilent Ice or cold block 4 8 C Spectrophotometer Before you begin refer to the instruction manual for the RNA 6000 Nano Assay Kit Prepare necessary reagents and supplies as required by the kit Use RNase free technique Wipe all surfaces and equipment with RNase decontamination solution use RNase free solutions and plastic ware and wear disposable gloves Protocol 1 Determine the concentration of the aRNA generated through Paradise Plus by UV spectrophotometry 2 Based on the optical density reading prepare a dilution of the sample to a concentration of 200 300 ng uL 3 Store the sample on ice or in a cold block until ready to load on to the RNA chip 4 Follow the RNA 6000 Nano Assay Kit protocol loading 1 uL of the prepared sample dilution from step 2 For details of data interpretation refer to the bioanalyzer instruction manual The aRNA appears on the bioanalyzer as a single broad peak The size of the aRNA ranges in length from 200 to 2000 bases Paradise 5 User Guide PN 12872 00 Rev C 69 A 8 ANALYSIS OF aRNA BY AGAROSE GEL ELECTROPHORESIS Analysis of aRNA using agarose gel electrophoresis is one method to visualize the RNA profile
20. and relative quantity after amplification Standard protocols for agarose gel electrophoresis can be used The following is a suggested protocol using commercially available reagents Materials gt 1 25 Agarose Portrait Gel or 1 25 Agarose Medium Gel gt EmbiTec cat GE 6010 or GE 6030 gt 10X RNA MOPS Running Buffer gt EmbiTec cat EC 1020 2X Gel Loading Buffer various RNA Ladder various SYBR Gold Nucleic Acid Gel Stain Molecular Probes cat S 11494 or Ethidium Bromide Stain Nuclease free Water Protocol 1 Determine the concentration of the aRNA by UV absorbance with a spectrophotometer Refer to Appendix A 2 Dilute the aRNA sample s with nuclease free water Each gel well can be loaded with 1 3 ug of aRNA 3 Prepare aRNA gel sample by mixing 6 uL of diluted aRNA with 6 uL of 2X Gel Loading Buffer 4 Incubate for 3 5 minutes at 65 C Cool on ice 5 Prepare 1X RNA MOPS Running Buffer and fill gel electrophoresis unit Place agarose gel into the unit 6 Load 12 uL of sample per well of the agarose gel Include RNA Ladder in one or more lanes 7T Electrophorese at 5 7 volts per centimeter for 30 minutes 8 Stain the gel with SYBR Gold Nucleic Acid Gel Stain for 30 minutes or according to the protocol supplied with the reagent Alternatively stain with Ethidium Bromide 0 5 1 0 ug mL 9 Visualize the gel on a UV transilluminator The size of the aRNA ranges from 200 to 2000
21. any residual wash buffer If wash buffer remains at 16 000 x g for one minute Transfer the purification column to a new 0 5 mL microcentrifuge tube provided Pipette12 uL Elution Buffer EB directly onto the membrane of the purification column Gently touch the tip of the pipette to the surface of the membrane while dispensing the elution buffer to ensure maximum absorption of EB into the membrane Incubate the column for one minute at room temperature Place each column tube assembly into the 2 ml support tube in the rotor with the 0 5 ml tube cap trailing the tube Centrifuge the column for one minute at 1 000 x g to distribute EB in the column and then spin for one minute at 16 000 x g to elute RNA The entire sample may be used immediately or stored at 70 C or below NOTE Flow through waste following centrifugation is usually present as only a small volume and therefore it is not necessary to discard the flow through waste after every centrifugation step Make sure that the accumulated flow through waste does not make contact with the purification column Flow through waste should be discarded when the waste fluid level approaches the surface of the purification column Prior to use mix Binding Buffer BB thoroughly Binding Buffer BB may form precipitate upon storage Dissolve precipitate prior to use by mixing thoroughly If necessary warm the BB vial to re dissolve Binding Buffer prior to use Paradise 5 User Guide PN
22. any unused Proteinase Ksalution Figure 4 2 Proteinase K Extraction Solution 3 Insert the CapSure Macro LCM Cap with LCM captured cells into the microcentrifuge tube using the LCM Cap Insertion Tool 4 Invert the extraction tube with the inserted CapSure Macro LCM Cap and shake down the 50 uL volume of Proteinase K Extraction solution until it completely covers the inside surface of the CapSure Macro LCM Cap 5 Incubate at 37 C for the correct time period according to the following table Table 4 3 RNA Incubation Times Samples Age Incubation Time Samples gt 3 years old 16 hours Samples lt 3 years old 5 hours For complete extraction this time can be increased to 16 hours Note If multiple LCM captures are performed it is recommended that each cap be incubated in Pro K Mix immediately after collection Caps may be incubated up to 24 hours Paradise S User Guide PN 12872 00 Rev C 15 6 After incubation remove the tubes from the incubator place them in a microcentrifuge and centrifuge for one minute at 800x g 7 Remove the CapSure Macro LCM Cap Close the microcentrifuge tube containing the extract 8 Proceed with RNA isolation protocol or freeze cell extract at 70 C It is okay to stop at this point in the protocol RNA Isolation 1 Pre condition the MiraCol Purification Column as follows a Pipette 200 uL Conditioning Buffer CB onto the purification column filter membrane
23. bases in length Paradise 5 User Guide PN 12872 00 Rev C 70 A 9 GENERATION OF LABELED aRNA USING ALTERNATIVE IVT KITS The Paradise Plus Kits can be used with alternative IVT labeling such as Affymetrix labeling kit 900449 to yield suitable RNA sample for hybridizing to GeneChip Probe Arrays as described below These kit reagents and protocol are substituted during the second IVT reaction of the Paradise Plus Kit protocol Labeled aRNA is subsequently purified with the Paradise Plus Kit and MiraCol Purification Columns as described below 1 Perform Round One of amplification according to the Paradise Plus Amplification Kit protocol starting from the recommended input for the kit It is not recommended to use the minimum input amounts when using an alternative labeling kit due to IVT efficiency Perform Round Two of amplification through cDNA Purification according to the Kit protocol Stop at the end of Chapter 5 Section 3 Step H Round Two cDNA Purification Perform RNA transcript labeling according to the protocol of the IVT labeling kit using the sample from step 2 above as the cDNA template Adjust the final volume of the cDNA sample as necessary Antisense RNA Purification Note Use the remaining components from RA7011 used during the amplification process Add 250 uL of RNA Binding Buffer RB to a new purification column and incubate for five minutes at room temperature Centrifuge at
24. by quantification of the PCR product yield from the 3 end primer 1650 1717 and another relative 5 sequence primer 1355 1472 If all cDNA contains both the 3 and 5 sequence target the ratio of the PCR product for 3 5 would be 1 As the RNA from FFPE samples tends to exhibit some degradation the 3 S ratio is usually greater than one Depending on the ratio an estimation of the quality of the RNA can be made It is recommended to perform the reverse transcription steps with 100 200 ng of total RNA Be sure to determine the yield of the total RNA following isolation and make the appropriate dilutions to ensure your samples are within this concentration range Perform necessary dilutions of total RNA in 10 ng uL Poly I In parallel to the testing sample a control of 10 ng uL uRNA 100 ng in 10 uL Stratagene 740000 needs to be carried through the complete analysis as the quantitation standard for EVERY experiment Dilution factor may vary for aRNA generated after one round of amplification A MDS Analytical Technologies recommends this protocol to customers who are starting a new set of FFPE samples or new type of FFPE samples Experiments should be done on scraped sections The RNA quantity derived from the 3 primer set 1650 1717 should be used as the quantity measurement of the RNA in the FFPE sample The ratio of the RNA yield obtained from both sets of PCR primers is the 3 5 used as an indication of RN
25. control to assess amplification efficiency and success when run in parallel with samples following the procedures outline in the Appendix WORK SPACE RECOMMENDATIONS Due to the high sensitivity of the reagents it is very important to prevent RNA DNA and nuclease contamination Work surfaces should be cleaned before and after each use Perform all dispensing in a work hood that has been irradiated with UV to remove contaminants from previous amplification experiments IMPORTANT ADDITIONAL CONSIDERATIONS MDS Analytical Technologies strongly recommends performing quality assessment of FFPE samples In order to complete the Sample Assessment Protocol a universal reference RNA Stratagene must also be run in parallel in addition to the FFPE samples Please see the Appendix for protocol details A MDS Analytical Technologies recommends using quantitative real time PCR for the most accurate measurement of RNA quantity of FFPE samples Paradise S User Guide PN 12872 00 Rev C 30 5 3 PROTOCOL PARADISE PLUS ROUND ONE 1ST STRAND cDNA SYNTHESIS A Read all Detailed Protocol notes on the previous pages prior to beginning 1 2 Prepare RNA sample in a total volume of 10 11 uL ina 0 5 mL or 0 2 mL RNase free microcentrifuge tube and place on 4 8 C block Thaw Primer 1 Gray 1 thoroughly mix and spin down f Arcturus Paradise Plus 1 PRIMER 1 Store at 2 a A Mec 30 MDS Arabytical Techeckoges Figure
26. dehydration and staining reagents disposable staining jars specially treated slides and detailed protocol and troubleshooting guide KIT0401 72 slides HistoGene LCM Immunofluorescence Staining Kit The HistoGene LCM Immunofluorescence Staining Kit is the only kit designed to enable retrieval of high quality RNA from immunofluorescently stained frozen tissue It enables convenient and reliable staining dehydration and LCM of tissue sections with protocols streamlined and optimized both for optimal LCM captures and Paradise 5 User Guide PN 12872 00 Rev C 3 maintaining RNA quality for downstream applications that require intact RNA like microarray analysis and RT PCR KIT0420 32 slides PicoPure RNA Isolation Kit For extraction and isolation of total RNA from small samples particularly Laser Capture Microdissected LCM cells The PicoPure RNA Kit comes with optimized buffers MiraCol Purification Columns and an easy to use protocol to maximize recovery of high quality total cellular RNA ready for amplification with the RiboAmp Plus RNA Amplification Kits KIT0204 40 isolations PicoPure DNA Extraction Kit The PicoPure DNA Extraction Kit is optimized to maximize the recovery of genomic DNA from 10 or more cells captured by LCM The kit comes with reagents and protocol tested to ensure complete extraction of DNA from LCM samples prepared with any standard tissue preparation procedure DNA prepared usi
27. tube Dissolve completely by gently vortexing the tube to mix the reagents and place the tube on ice immediately Excessive mixing may denature Proteinase K Pipette enough Pro K solution to cover entire tissue section 25 uL 50 uL 75 uL 100 uL or 150 uL into a 0 5 ml extraction tube not provided Using a clean sterile scalpel blade take the dried slide and scrape off the tissue section and place the scrape into the microcentrifuge tube containing the Proteinase K solution Vortex slightly Visually inspect to ensure that the tissue scrape is in the Pro K solution and not stuck to the side of the microcentrifuge tube Incubate at 37 C for the correct time period according to the following table Table 4 5 RNA Incubation Times Samples Age Incubation Time Samples gt 3 years old 16 hours Samples 3 years old 5 hours For complete extraction this time can be increased to 16 hours Proceed to RNA isolation or store at 700C or below RNA Isolation 1 Pre condition the MiraCol Purification Column as follows a Pipette 200 uL Conditioning Buffer CB onto the purification column filter membrane b Incubate the purification column with Conditioning Buffer for 5 minutes at room temperature Paradise 5 User Guide PN 12872 00 Rev C 21 10 11 12 13 14 15 16 c Centrifuge the purification column in the provided collection tube at 16 000 x g for one minute Using
28. waste and re centrifuge the column for one minute at 16 000 x g Rotation Figure 4 3 Centrifuge A To avoid potential breakage of the microcentrifuge tube cap during centrifugation insert the purification column 0 5 mL tube assembly into a lidless 2 0 mL tube Insert this assembly into adjacent rotor holes as illustrated Rest the tube cap against the tube immediately clockwise to it Place an empty lidless 2 0 mL tube into the rotor hole adjacent in the clockwise direction to the last assembly 4 3 2 PROTOCOL FOR USE WITH CAPSURE HS LCM CAPS RNA Extraction 1 Dispense Pro K Mix and incubate as follows a Capture cells and assemble the CapSure HS Cap with the ExtracSure Extraction Device Refer to the CapSure HS Caps User Guide for complete instructions b Add 300 uL of Reconstitution Buffer to vial of dried Pro K Mix 600 ug tube Dissolve completely by gently vortexing the tube to mix the reagents and place the tube on ice immediately Excessive mixing may denature Proteinase K One vial of Pro K Mix is adequate for 60 extractions All mixed proteinase K solution should be used within one work day up to 12 hours The remaining unmixed Reconstitution Buffer should be stored at 20 C Discard any mixed Proteinase K solution that is not used within one day 2 Place the CapSure ExtracSure assembly in a CapSure HS Alignment Tray and pipette 10 uL Pro K Mix solution into the buffer well Place pipette tip down to the film surfac
29. with qRT PCR protocol as directed by instrument manufacturer Paradise 5 User Guide PN 12872 00 Rev C 42 5 3 7 PARADISE PLUS ROUND TWO 2 STRAND cDNA SYNTHESIS 1 Place sample on 4 80C block and allow to thaw if frozen at 4 80C 2 Thaw Primer 3 Gray 3 thoroughly mix spin down and place on 4 8 C block Arcturus Paradise Plus 3 PRIMER 3 B z Figure 5 19 Gray 3 3 Add 1 0 uL of Primer 3 to the sample Mix thoroughly by flicking the tube and spin down 4 Incubate the sample at 95 C for five minutes then cool sample to 4 8 C for at least one minute Hold the sample at 4 8 C until ready to proceed Spin down the contents and place on 4 8 C block before proceeding to the next step 5 Thaw 2nd Strand Master Mix at 4 8 C cold block White 1 Thoroughly mix and spin 2nd Strand Master Mix 2nd Strand Enzyme Mix White 2 does not require thawing Mix enzyme thoroughly by inverting several times spin briefly and place at 4 8 C Arcturus Arcturus ra Plus Plus 1 xm 2 ubi Figure 5 20 White 1 and White 2 6 Add 2nd Strand Synthesis components separately in the order listed in the following table If you are performing several amplifications you may wish to prepare a Complete 2nd Strand Synthesis Mix based on the following table and add 30 uL Complete 2nd Strand Synthesis Mix to each sample Mix thoroughly by flicking the tube and spin down Paradise 5 User Guide PN 12872 00 Rev
30. 10 11 12 13 14 Pre condition the MiraCol Purification Column as follows a Pipette 200 uL Conditioning Buffer CB onto the purification column filter membrane b Incubate the purification column with Conditioning Buffer for 5 minutes at room temperature c Centrifuge the purification column in the provided collection tube at 16 000 x g for one minute Pipette 11 uL of Paradise Plus Reagent System binding buffer BB into the cell extract from Part 1 RNA Extraction Mix well by pipetting up and down DO NOT CENTRIFUGE Pipette 21 uL of Ethanol Solution EtOH into tube and mix well Pipette the cell extract mixture into the preconditioned purification column The cell extract mixture will have a combined volume of approximately 110 uL To bind RNA centrifuge for 2 minutes at 100 x g immediately followed by a centrifugation at 16 000 x g for 1 minute Pipette 100 uL Wash Buffer 1 W1 into column and centrifuge for 1 minute at 8000 x g Mix 2 uL DNase Mix DNase with 18 uL of DNase buffer DNB Add 20 uL mixture to the column and incubate at room temperature for 20 minutes Pipette 40 uL Wash Buffer 1 W1 into the purification column and centrifuge for one minute at 8000 x g Pipette 100 uL Wash Buffer 2 W2 into the purification column and centrifuge for one minute at 8000 x g Pipette another 100 uL Wash Buffer 2 W2 into the purification column and centrifuge for two minutes at 16 000 x g Check the purification column for
31. 12872 00 Rev C 19 4 3 3 A Remove all traces of wash buffer prior to transferring purification column to the new A microcentrifuge tube To remove wash buffer discard flow through waste and re centrifuge the column for one minute at 16 000 x g Rotation Figure 4 5 Centrifuge To avoid potential breakage of the microcentrifuge tube cap during centrifugation insert the purification column 0 5 mL tube assembly into a lidless 2 0 mL tube Insert this assembly into adjacent rotor holes as illustrated Rest the tube cap against the tube immediately clockwise to it Place an empty lidless 2 0 mL tube into the rotor hole adjacent in the clockwise direction to the last assembly een SCRAPE PROTOCOL A A One vial of proteinase K is adequate for 3 tissue scrape samples Use a new scalpel blade for each sample to avoid cross contamination Discard flow through waste when the waste fluid level approaches the bottom surface of the purification column Slide preparation Follow slide prep protocol section 3 3 1 Deparaffinization Staining and Dehydration no staining BON P P Important If you are not staining your tissue use the following protocol Otherwise if you are staining you tissue use the deparaffinization staining and dehydration protocol found in Chapter 3 section III part b Label three plastic slide jars as follows a Xylene b Xylene c Xylene Fill each of the three jars with 25 mL of cert
32. 2 1 Strand Master Mix 5 Red 1 33 0 1 Strand Enzyme Mix 1 Red 2 6 6 SuperScript Ill Enzyme 1 6 6 Total per sample 9 59 4 Not included in the kit A Place components back onto the cold block or refreeze immediately after dispensing the reagent Do not leave reagents at room temperature 7 Incubate at 42 C for 1 5 hours then chill the sample to 4 8 C for at least one minute Do not hold samples at this step for a prolonged period of time Keep samples at 4 8 C until next incubation 8 Optional You may remove a 2 0 uL sample at this point in the protocol to assess the integrity of the starting mRNA by Quantitative Real Time PCR qRT PCR Note This may reduce your final yield P IMPORTANT QC Kit Customers KITO313 STOP HERE and continue to appendix section Il o Thoroughly mix and spin down 1 Strand Nuclease Mix Place on ice 10 Add 2 0 uL of 1 Strand Nuclease Mix Gold to the sample mix thoroughly by flicking the tube and spin down Paradise Plus 1st STRAND NUCLEASE MIX Figure 5 5 1 Strand Nuclease Mix Gold 11 Incubate the sample at 37 C for 30 minutes followed by 95 C for five minutes 12 Chill the sample to 4 8 C for at least one minute D It is okay to stop at this point in the protocol Sample may be stored at 20 C overnight Removal for qrtPCR confirmation may not be suitable for low RNA inputs Paradise 5 User Guide PN 12872 00 Rev C 32 5 3 2 PARADISEG PLUS
33. 2 00 Rev C 52 A 1 3 21 Ifthe column still shows residual probe add another 30 uL of nuclease free water pH 8 5 directly onto the column membrane incubate for 1 minute and centrifuge at maximum speed for 1 minute A After centrifuging make sure that the entire sample has passed through the column and that the column is completely dry If not centrifuge for an additional 1 minute at 6000 rpm When dry the column will be visibly pink Cy3 or blue Cy5 if the reaction was successful A ifthe labeling reaction was successful the eluate should be visibly pink Cy3 or blue Cy5 in color GENERATION OF TEMPLATE FOR QRT PCR The aRNA generated using the Paradise Plus Reagent System RNA Amplification reagents can be used in reactions measuring relative gene expression using quantitative PCR methods The amplification process generates product from the 3 end of the mRNA For best results use qRT PCR primer sets designed within the first 300 bases from the poly A tail The following protocol may serve as a guide for qRT PCR experiments using aRNA converted to cDNA as a template Protocol Reverse Transcription 1 MDS Analytical Technologies recommends an aliquot of 100 ng of amplified RNA from each sample in a volume of 10 uL 2 Add 1 uL of 5 mg ml random hexamer 3 Mix well by flicking and then briefly spin down by centrifugation for 2 minutes in thermal cycler 4 Incubate samples at 70 C for 10 minutes Chill sample to
34. 2872 00 Rev C Reverse Transcription Your experimental design should include gt gt A C N 100 200 ng of each sample 100 ng of universal reference RNA Stratagene cat 740000 to be used later as a standard curve for qRT PCR Note it is not necessary to run the control that comes with the kit That control RNA is an amplification control and is not of high enough concentration for the standard curve Note This is the same procedure as Section 5 3 1 Paradise amp Plus Round one 1st strand cDNA synthesis of this user guide Read all Detailed Protocol notes in Chapter 5 prior to beginning this procedure Prepare each 100 200 ng RNA sample in a total volume of 10 11 uL ina 0 5 mL or 0 2 mL RNase free microcentrifuge tube and place on 4 8 C block Thaw Primer 1 Gray 1 thoroughly mix and spin down Add 1 0 uL of Primer 1 mix thoroughly by flicking the tube and spin down Incubate at 70 C for 1 hour then chill the samples to 4 8 C for at least one minute Spin down the contents and place on 4 8 C block before proceeding to the next step Place 1 Strand Synthesis components at 4 8 C cold block 1 Strand Master Mix Red 1 and Enhancer Yellow must be thawed thoroughly mixed with all solids dissolved and maintained at 4 8 C until used 1 Strand Enzyme Mix Red 2 and SuperScript enzyme do not require thawing and can be placed directly at 4 8 C Mix enzyme thoroughly by inverting several times Spin briefly
35. A quality Paradise 5 User Guide PN 12872 00 Rev C 54 Materials Needed Table A 4 Materials needed Component Vendor Catalog RNase free water Invitrogen 18054 015 Universal Human Reference RNA Stratagene 740000 Poly l Sigma P4154 Uracil DNA Glycosylase Roche 1444646 Thermal cycler MLS Table A 5 Primer sequences HBAC1650 TCCCCCAACTTGAGATGTATGAAG 50 uM HBAC1717 AACTGGTCTCAAGTCAGTGTACAGG 50 uM HBAC1355 ATCCCCCAAAGTTCACAATG 50 uM HBAC1472 GTGGCTTTTAGGATGGCAAG 50 uM Stock concentration Table A 6 Materials needed for qrtPCR Component Vendor Catalog For ABI PRISM 7900HT QuantiTect SYBR Green PCR Master Mix Qiagen 204143 ABI optical Reaction Plate ABI 4314320 Optical Adhesive covers ABI 4311971 Splash Free Support Base for 96well plate ABI 4312063 Microseal F foil MJ Research MSF 1001 For Roche Light Cycler LightCycler DNA SYBR Green kit Roche 2158817 BD Taqstart Antibody BD Clontech 639251 IMPORTANT Depending on the exact model of the real time PCR instrument the protocol may vary Provided are protocols for the ABI PRISM 7900 HT Sequence Detection System and the Roche LightCycler Protocol Extraction Follow the protocol detailed in Section 4 3 3 Tissue Scrape Protocol of this user guide Quantitate the concentration of the RNA extracted see Appendix A 6 Paradise 5 User Guide PN 1
36. LCM cells The greatest factor affecting the Source tissue is of quality of isolated RNA is the integrity of the RNA in the original tissue compromised quality sample RNA degradation due to RNase activity occurs rapidly especially upon tissue removal such as Use the Paradise Plus Reagent System Staining components to prepare RNA degridation during staining slides for LCM Specialized staining protocols and reagents are required for process optimal RNA preservation in LCM samples MDS Analytical Technologies Isolated RNA IE GF has developed and validated the Paradise Poor Qualit T Perform LCM immediately after preparing LCM slides LCM sample slides are dehydrated in the final step of preparation so RNase activity is minimized However the risk of moisture and RNases entering the sample following preparation increases with the amo RNA degridation during LCM RNA quality compromised Use FFPE sections that are within 2 weeks of cutting Extended storage of during slide storage sections after being cut from blocks may result in RNA degradation Verify quality of initial tissue sample or LCM slide see A 1 Poor quality RNA may not bind effectively to the purification column membrane decreasing overall RNA yield RNA integrity has been compromised RNA Yield is Low Paradise 5 User Guide PN 12872 00 Rev C 62 A 3 3 AMPLIFICATION Amplification Starting RNA sample quality If you observe low yields with different RNA sam
37. Note To avoid potential breakage of the microcentrifuge tube cap during centrifugation insert the purification tube 0 5 mL tube assembly into a lidless 1 7 2 0 mL tube Insert this assembly into adjacent rotor holes as illustrated Rest the tube cap against the tube immediately clockwise to it Place an empty lidless 1 7 2 0 mL tube into the rotor hole adjacent in the clockwise direction to the last assembly End of Round 1 Paradise 5 User Guide PN 12872 00 Rev C 40 5 3 6 PARADISE PLUS ROUND TWO 1 STRAND cDNA SYNTHESIS 1 Thaw samples at 4 8 C if necessary Place samples on a 4 8 C block 2 Thaw Primer 2 Gray 2 thoroughly mix spin down and place on a 4 8 C block Arcturus Puisdesb Plus 2 rman Figure 5 17 Gray 2 3 Into eluted aRNA product from Round One add 1 0 uL of Primer 2 mix thoroughly by flicking the tube and spin down 4 Incubate the microcentrifuge tube at 70 C for 5 minutes then chill the samples to 4 8 C for one minute Spin down the contents and place on 4 8 C block before proceeding to next step 5 Place 1 Strand Synthesis components Red at 4 8 C 1 Strand Master Mix and Enhancer Yellow must be thawed thoroughly mixed with all solids dissolved and maintained at 4 8 C until used 1 Strand Enzyme Mix does not require thawing and can be placed directly at 4 8 C Mix enzyme thoroughly by inverting several times Spin briefly SuperScript Ill Paradise Plus Parad
38. Paradise US Reagent System User Guide Part of the Arcturus Systems for Microgenomics MADS Analytical Technologies Paradise P S User Guide PN 12872 00 Rev C MDS Analytical Technologies Paradise P ss WT RT User Guide Copyright Copyright 2007 MDS Analytical Technologies All rights reserved No part of this publication may be reproduced transmitted transcribed stored in a retrieval system or translated into any language or computer language in any form or by any means electronic mechanical magnetic optical chemical manual or otherwise without the prior written permission of MDS Analytical Technologies 1311 Orleans Drive Sunnyvale California 94089 United States of America This product is licensed for sale only for research use It is NOT licensed for any other use There is no implied license hereunder for any commercial use Commercial use is any use other than internal life sciences research and development including The sale lease license or other transfer of the material or any material derived or produced from it to any third party The sale lease license or other grant of rights to a third party to use this material or any material derived or produced from it and gt The use of this material to perform services for a fee for third parties If you require a license to use this material for commercial uses and do not have one please return this material unopened to MDS Analytical Technolog
39. RATION 1 Label 10 plastic slide jars as follows Xylene Xylene 100 ethanol 95 ethanol 75 ethanol Nuclease free water 75 ethanol 95 ethanol 100 ethanol xylene 2 Using the LCM certified solutions provided fill the labeled plastic slide jars with 25 ml of the appropriate solution 3 Remove up to four slides from the slide box or from the 70 C freezer and place in a 50 60 C oven for 2 minutes 4 Place the slides in plastic slide jar a containing xylene for 2 minutes Invert jar gently 5 Transfer the slides to plastic slide jar b containing xylene for 2 minutes Invert jar gently 6 Transfer the slides to plastic slide Jar c containing 100 ethanol for 2 minutes Invert jar gently 7 Transfer the slides to plastic slide jar d containing 95 ethanol for 1 minute T 7spo ceo0cb Paradise 5 User Guide PN 12872 00 Rev C 11 Ld 10 11 12 13 14 15 16 66 99 Transfer the slides to plastic slide jar e containing 75 ethanol for 1 minute Transfer the slides to plastic slide jar f containing nuclease free water for 30 seconds Using an RNase free pipette tip apply 100 uL of the Paradise Plus Staining Solution so that it covers the entire section Stain for 15 45 seconds at room temperature Tap off excess stain before proceeding with the following steps Transfer the slides to plastic slide jar g containing 75 ethanol for 30 seconds
40. ROUND ONE 2ND STRAND cDNA SYNTHESIS 1 Place sample on 4 8 C block and allow to thaw if frozen at 4 8 C 2 Thaw Primer 2 Gray 2 thoroughly mix and spin down Arcturus Paradse Pius 2 PRIMER 2 Figure 5 6 Gray 2 3 Add 1 0 uL of Primer 2 Mix thoroughly by flicking the tube and spin down 4 Incubate sample at 95 C for 2 minutes then chill and maintain the sample at 4 8 C for at least 2 minutes 5 Thaw 2 Strand Master Mix at 4 8 C cold block White 1 Thoroughly mix and spin 2 Strand Master Mix 2 Strand Enzyme Mix White 2 does not require thawing Mix enzyme thoroughly by inverting several times spin briefly and place at 4 8 C Arcturus Arcturus Para Plus Par Plus Par 1 2nd STRAN Figure 5 7 White 1 and White 2 6 Add 2 Strand Synthesis components separately in the order listed in the following table If you are performing several amplifications you may wish to prepare a Complete 2 Strand Synthesis Mix based on the following table and add 30 uL Complete 2 Strand Synthesis Mix to each sample Mix thoroughly by flicking the tube and spin down Paradise 5 User Guide PN 12872 00 Rev C 33 Table 5 9 Complete 2 Strand Synthesis Mix 6 reaction Master Mix Component Amount uL Vial with 1096 overage uL 2nd Strand Master Mix 29 White 1 191 4 2nd Strand Enzyme Mix 1 White 2 6 6 Total per sample 30 198 0 Store at 4 C until use Inc
41. ach emesis oem ies em OS 29 Sample and Reagents Preparation ate otra testa pa oet uus 29 Nucleic Acid Elution Using Spin Columns esses 30 Control Amplifieati Ds sssi Lou erat te peel ta cono evite oa NICA dE 30 Work Space Recommendatiofis usc oet pesos eo pedea 30 Important Additional Considerations esee 30 lucu M es 31 Paradise Plus Round one 1st strand CDNA synthesis 31 Paradise Plus Round one 2nd Strand CDNA synthesis 33 Paradise Plus Round one CDNA Purification es 35 Paradise Plus Round one In Vitro Transcription 37 Paradise Plus Round one aRNA Purification etes 39 Paradise Plus Round Two 1 Strand cDNA Synthesis 41 Paradise Plus Round Two 2 Strand CDNA Synthesis 43 Paradise Plus Round Two CDNA Purification ees 45 Paradise Plus Round Two In Vitro Transcription ees 47 Paradise Plus Round Two aRNA Purification e 49 Appendices Applications of aRINAN iuis aret bas es RR ORAS HATH SRM eue Eqs sa PRA 51 Direct aRNA Labeling with Turbo Labeling Kit sss 51 Direct cDNA Fluorescent Labeling cease erret thon dean rana 5 Generation of template for qRT PCR sse 53 Sample Assessment Protocol ee ettet dede
42. action Conditioning Buffer Blue CB Extraction Ethanol Solution Blue EtOH Extraction Wash Buffer 1 Blue W1 Extraction Wash Buffer 2 Blue W2 Extraction Elution Buffer Blue EB Extraction Binding Buffer Blue BB Pro k Reconstitution Buffer Pro K 0 5 mL Microcentrifuge Tubes Purification columns Table 4 2 Paradise Extraction Frozen RA7007 DNase Buffer DNase Mix PRELIMINARY STEPS MATERIAL AND PROTOCOL REVIEW To get the most from your extraction reagents take a few moments to examine the components of the kit and read the information in the following sections Overview Separate protocols are provided for extraction isolation of RNA from gt Microdissected samples using CapSure LCM Macro caps gt Microdissected samples using CapSure LCM HS caps or gt Tissue scrapes 0 5 cm x 0 5 cm The flow chart illustrates the Paradise Plus Reagent System RNA Extraction Isolation procedure 1 Extract RNA from a CapSure LCM Cap or tissue scrape 2 Mixand load cell extract onto a preconditioned purification column 3 Spin the extract through the column to capture RNA on the purification column membrane Paradise 5 User Guide PN 12872 00 Rev C 13 Wash DNase treat and wash again Wash the column twice with wash buffer and Elute the RNA in low ionic strength buffer nons Total Prepare Cellular Purification Extract Column N Add Fa Ethanol 2 r DNase Treatment t2 Wash 2 1 Elut
43. adise 5 User Guide PN 12872 00 Rev C 28 5 2 5 5 2 6 pe k Samples requiring labeling for microarrays biotin Cy3 Cy5 labeling protocol will take an additional 30 45 minutes For samples processed using the optional IVT Master Mix an additional 2 5 hours will be required for amino allyl aRNA labeling Do not allow incubation times and temperatures to deviate from the protocol The 4 C steps in the thermal cycler program allow for buffer and reagent addition and mixing steps at certain points during the amplification process and are not intended for indefinite hold unless noted PROTOCOL NOTES 1 2 When adding reagent to samples or master mixes pipette mixtures up and down several times to ensure complete transfer of reagent from the pipette tip Prior to the first use of an enzyme gently mix do not vortex and briefly microcentrifuge the vial to ensure that all enzyme is mixed and collected at the bottom of the vial Enzyme may collect on the vial wall or cap during shipment Keep thawed reagents and reaction tubes in cold blocks at 4 C while adding reagents to samples Prior to each incubation mix samples thoroughly by flicking the reaction tube unless noted otherwise in protocol to ensure process performance Spin down before proceeding DO NOT VORTEX REACTION SAMPLES Use a microcentrifuge to spin down all components and samples following each mixing step Clean all amplification process equipment w
44. are equipped with a cuvette port See the user guide for your instrument for details on use of the cuvette port Method Dilute RNA in RNase free water A total of 200 uL well of diluted RNA will be used for quantitation and diluting the sample more than 1 100 is not recommended Prepare additional diluted sample if multiple wells are desired for analysis Reading samples in triplicate is recommended Pipette samples into a 96 well UV transparent microplate include a set of wells containing 200 uL of RNase free water as blanks Assuming that all well volumes are identical and that all samples are blanked with the same solution water use the following method to subtract background OD due to the microplate Itself 1 Inthe template editor select three or more wells in the microplate to contain the blanking solution typically water Assign the appropriate wells as Blank Designate the appropriate wells as Samples and enter the dilution factor 2 In the instrument settings dialogue box make sure that the box for PathCheck is checked the Water Constant button is on and the box for Plate Background Constant is not checked 3 Pipette blanks and RNA samples into the appropriate wells of the microplate 4 Read the plate When the plate is read as indicated SoftMax Pro automatically applies PathCheck to all samples and blanks and also subtracts the average of the blanks from each well of the microplate Provided that all sample and b
45. aximum absorption of RE into the membrane Gently tap the purification column to distribute the buffer if necessary Figure A 7 RNA Elution Buffer 10 Incubate at room temperature for one minute 11 Place the assembly into the 2 mL support tube in the rotor with the 0 5 mL tube cap trailing the tube Paradise 5 User Guide PN 12872 00 Rev C 66 12 Centrifuge at 1000 x g for one minute immediately followed by 16 000 x g for one minute Discard the purification column and retain the elution containing the labeled aRNA 13 Measure the O D of the product at A260 A280 and Asso Asso to determine the yield and frequency of incorporation FOI by making a dilution of 1 10 5 uL sample 45 uL nuclease free water 14 Store any remaining samples at 70 C until ready for hybridization Rotation Figure A 8 Centrifuge Paradise 5 User Guide PN 12872 00 Rev C 67 A 5 RNA QUANTITATION USING SPECTRAMAX MICROPLATE READERS WITH ABSORBANCE MODE AND PATHCHECK SENSOR Introduction This protocol describes how to measure RNA concentration using a 96 well UV clear microplate e g Corning P N 3635 and SpectraMax microplate reader featuring the PathCheck sensor The PathCheck sensor measures the pathlength in each well of the microplate and normalizes absorbance values to a 1 cm pathlength so that they are the same as values obtained in a 1 cm cuvette Please note that some SpectraMax microplate readers
46. be immediately clockwise to it Place an empty lidless 1 7 2 0 mL tube into the rotor hole adjacent in the clockwise direction to the last assembly End of Round 2 Paradise 5 User Guide PN 12872 00 Rev C 50 A 1 A 1 1 A 1 2 A Appendices APPLICATIONS OF aRNA The Paradise Plus Reagent System can be used to yield a suitable labeled RNA sample for hybridization to nucleic acid in a variety of formats The RNA sample may be labeled in a number of different ways including those listed below DIRECT aRNA LABELING WITH TURBO LABELING KIT After analysis of the aRNA with the Agilent Bioanalyzer Appendix E or by gel electrophoresis Appendix F as described in Round Two Antisense RNA aRNA Purification aRNA may be directly labeled with a biotin or a fluorescent marker Direct mRNA labeling can be accomplished using the Turbo Labeling kits KIT0608 Turbo Labeling Biotin 12 reactions KIT0609 Turbo Labeling Cy3 12 reactions KIT0610 Turbo Labeling Cy5 12 reactions For more information go to www moleculardevices com turbo DIRECT cDNA FLUORESCENT LABELING For use with complete 2 round kits The protocol described here may be used to prepare Cy3 or Cy5 labeled cDNA from aRNA generated using the Paradise Plus Reagent System RNA Amplification Kit for hybridization to cDNA microarrays This protocol provides labeled probe of sense orientation from 5 10 micrograms of aRNA a sufficient quantity for replicate h
47. cation The Paradise Plus amplification kits have both room temperature and frozen components The room temperature components should be stored at normal room temperature The frozen components are shipped on dry ice and should be stored at 70 C until initial use After initial use 20 C is recommended to prevent unnecessary freeze thaws of the enzymes The control RNA and any RNA generated from Paradise Plus kits should always be stored at 70 C The Control RNA vial should be stored at 70 C or below immediately upon arrival to ensure maximum stability For optimal results using the reagents as soon as possible after receipt is recommended Expiration All reagents included with the system should be used within six 6 months of receipt MATERIAL SAFETY AND DATA SHEET MSDS Material Safety and Data Sheets MSDS for kit chemical components are available from the MDS Analytical Technologies web site at www moleculardevices com They may also be acquired by calling MDS Analytical Technologies Technical Services 1 800 635 5577 or 1 408 747 1700 or send an email inquiry to support moldev com RELATED ARCTURUS PRODUCTS Most common part numbers provided Additional configurations available depending on individual need HistoGene LCM Frozen Section Staining Kit The HistoGene LCM Frozen Section Staining Kit is used to process tissue sections for LCM that maximizes the quality and yield of RNA from LCM cells The kit comes with all
48. cessing Paradise 5 User Guide PN 12872 00 Rev C 61 A 3 TROUBLESHOOTING A 3 1 STAINING Staining Ensure that the ethanol solutions are fresh Ethanol is hygroscopic Keep the The sample may contain ethanol bottles tightly capped and do not pour ethanol solutions until you are residual water ready to use them If you suspect that the 100 ethanol solution has absorbed water discard and The sample may have dried in Carry out the Staining and Dehydration segment of the protocol at a steady between protocol steps pace Targeted cells do not lift from the slide during LCM The sample starting material Run a quality control assesmnet detailed in this protocol on the tissue block may contain poor quality RNA fto ensure it contains useable quality RNA RNA may become degraded Wear gloves use RNase free technique and RNase free instruments and RNA cannot be during RNA isolation reagents recovered from the RNA may not be fully extracted sample and isolated from cells on the LCM cap Perform RNA extraction immediately after LCM to ensure complete extraction and optimum recovery of RNA Capture more cells Amount of RNA in each cell may vary depending on cell type RNA quality and length of fixation For troubleshooting purposes try starting with 40 000 cells Amount of starting material may be insufficient A 3 2 EXTRACTION AND ISOLATION Extraction and Isolation Verify quality of source tissue of
49. ch amplicon If most of the cDNA contains both the 3 and 5 sequence target the ratio of the PCR product for 3 5 is close to 1 As the RNA from FFPE samples starts exhibiting some level of degradation the 3 5 ratio tends to become greater than 1 Depending on the ratio an estimation of the RNA quality can be made For studies in which a known set of genes is being evaluated ratios that are in a higher range 20 to 40 can be tolerated In cases where the FFPE samples are being used to discover gene sets to maximize the success and enable discovery of the maximum number of genes samples with lower ratios x20 are optimal Note MDS Analytical Technologies does not have a Strict cut off for ratios from which no data will be obtained As individual studies will have different tolerance levels MDS Analytical Technologies recommends running a few samples with a variety of ratios to determine where the cut off should be for a specific study It is also important to remember that in addition to the ratio the overall quantity reported for the 3 Primer Set can be helpful in determining the quality of the sample If a ratio of 10 is reported but the quantity for that sample is lt 5 pg there is likely not enough RNA in the sample to produce a quality result in a subsequent assay The quantity reported can serve as a guide for determining how much of the original sample should be used to meet the input requirements for further sample pro
50. d cell populations The staining components work with the additional modules provided in this reagent system Paradise Plus extraction and isolation reagents and RNA amplification reagents provide a complete solution for studying RNA from cells isolated by LCM The reagents and protocol have been optimized for use with Formalin Fixed Paraffin Embedded FFPE samples Extraction Isolation The Paradise Plus Reagent System RNA Extraction Isolation reagents enable researchers to recover total cellular RNA from formalin fixed paraffin embedded samples They are optimized for use with cells acquired using Laser Capture Microdissection LCM on CapSure LCM Caps Total cellular RNA isolated using the Paradise Plus Reagent System RNA Extraction Isolation reagents produces RNA in a small volume of low ionic strength buffer ready for use in linear amplification using Paradise 5 User Guide PN 12872 00 Rev C 1 1 2 1 3 1 4 1 5 the Paradise Plus Reagent System RNA amplification reagents The Paradise Plus Reagent System RNA Extraction Isolation Kit contains RNA extraction and purification reagents and MiraCol Purification Columns Amplification The Paradise Plus Reagent System RNA Amplification reagents enable the production of large quantities of amplified antisense RNA aRNA from small quantities of total cellular RNA This process for linear amplification provides efficient reproducible results through protocols rea
51. d in your laboratory typically 41 C43 C Do not add any adhesives to the water bath 2 Setcutting thickness to 7 um on the microtome 3 Place paraffin block into specimen holder Trim off any excess paraffin from the block face Cut and discard the first five sections after trimming 4 From the fresh surface cut 7 um sections from your specimen If you are cutting more than one specimen move to a new section of the blade use gauze soaked in RNase Away to clean blade or use a new disposable blade for each one to avoid cross contamination 5 Remove section s from microtome and float them onto heated water bath Allow section s to flatten Minimize time in water bath to no longer than 2 minutes Mount each section on a room temperature slide 6 Prop slide on end in a vertical not horizontal position to allow water to drain away from section Air dry the slide for a minimum of 30 minutes at room temperature Discard any slides that have wrinkles or folds in the section 7T Proceed immediately to the Deparaffinization Staining and Dehydration segment of the protocol or store slides at 70 C in a microslide box for up to two weeks 8 After completion of the slide preparation process remove any paraffin debris from the microtome Clean surfaces with a Kimwipe soaked with RNase Away and dry all surfaces Discard water from water bath and clean the interior with RNase Away and dry all surfaces DEPARAFFINIZATION STAINING AND DEHYD
52. dd 250 uL of RNA Binding Buffer RB to a new purification column seated in the collection tube provided Incubate for five minutes at room temperature Centrifuge at 16 000 x g for one minute Figure 5 27 RNA Binding Buffer A RNA Binding Buffer RB must be at room temperature and thoroughly mixed o before use A precipitate may form during long term storage Dissolve precipitate prior to use by mixing If necessary warm the RB vial to re dissolve Add 120 uL of RB to the IVT reaction sample and mix thoroughly Pipette the entire volume into the purification column To bind aRNA centrifuge at 100 x g or lowest speed setting available for two minutes immediately followed by a centrifugation at 10 000 x g for 1 minute Add 200 uL of RNA Wash Buffer RW to the purification column and centrifuge at 10 000 x g for one minute Figure 5 28 RNA Wash Buffer Avoid splashing flow through in the collection tube onto the purification column If flow through waste liquid wets the outside of the purification column re centrifuge the column at 16 000 x g to remove the liquid Add 200 uL of fresh RW to the purification column and centrifuge at 16 000 x g for two minutes Check the column for any residual wash buffer If any wash buffer remains re centrifuge at 16 000 x g for one minute Discard the collection tube and flow through Place the purification column into a new 0 5 mL microcentrifuge tube provided in the Kit and carefull
53. e Total RNA Pi Figure 4 1 Paradise Plus Reagent System RNA Extraction Isolation procedure The entire 1solation process including incubations can be completed in less than an hour and the isolated total cellular RNA 1s ready for use in downstream applications The Paradise Plus Reagent System RNA Extraction Isolation reagents are capable of isolating small amounts of RNA It is important not to introduce nucleic acid contamination Paradise 5 User Guide PN 12872 00 Rev C 14 4 3 PROTOCOL 4 3 1 PROTOCOL FOR USE WITH CAPSURE MACRO LCM CAPS RNA Extraction 1 Dispense Pro K Mix and incubate as follows a Capture cells using the CapSure Macro Cap Refer to the instrument User Guide for complete instructions b Add300 uL of Reconstitution Buffer to vial of dried Pro K Mix 600 ug tube Dissolve completely by gently vortexing the tube to mix the reagents and place the tube on ice immediately Excessive mixing may denature Proteinase K One vial of Pro K Mix is adequate for 12 extractions All mixed proteinase K solution should be used within one workday up to 12 hours Discard any mixed Proteinase K solution that is not used within one day 2 Pipette 50uL of mixed Proteinase K Extraction Solution into a 0 5 ml extraction tube not provided Cap Insertion Tool t f ft CapSure LCM Cap Microcentrifuge hd Tube Use Proteinase K Extraction Solution as quickly as possible following reconstitution Discard
54. e to avoid trapping a bubble Paradise 5 User Guide PN 12872 00 Rev C 17 Pipettor Tip Extrac Sure Sample Extraction Device Figure 4 4 CapSure HS Alignment Tray 3 Placea new 0 5 ml extraction tube not provided onto the CapSure ExtracSure assembly see CapSure HS Caps User Guide for more details about assembly 4 Cover with Incubation Block Figure 4 5 Incubation Block 5 Incubate at 37 C for the correct time period according to the following table Table 4 4 RNA Incubation Times Samples Age Incubation Time Samples gt 3 years old 16 hours Samples 3 years old 5 hours For complete extraction this time can be increased to 16 hours A If multiple LCM captures are performed it is recommended that each cap be incubated in Pro K Mix immediately after collection Caps may be incubated up to 24 hours 6 Centrifuge the microcentrifuge tube with the CapSure ExtracSure assembly at 800 x g for two minutes to collect cell extract into the tube 7 After centrifugation the microcentrifuge tube contains the cell extract required to complete the protocol Remove the microcentrifuge tube from the CapSure ExtracSure assembly and save the microcentrifuge tube with the cell extract in it 8 Proceed with RNA isolation protocol or freeze cell extract at 70 C D It is okay to stop at this point in the protocol Paradise 5 User Guide PN 12872 00 Rev C 18 RNA Isolation 1
55. er reverse transcription input of total RNA gt Use 10 ng uL Poly I as the diluent gt Perform the serial dilutions as illustrated below 2 ul 2 ul 2 ul Y y 110 110 j 130 100 ng 10 ng lng 0 1 ng V RT Reaction Mix gt cDNA dilutions for Real Time cDNA PCR Standard Curve Figure A 2 cDNA dilutions for Real Time PCR Standard Curve gt Store the unused volume of 100 ng cDNA at 65 to 80 C for use in creating subsequent standard curves Set up one RT reaction for each testing samples one for the blank and one for the uRNA standard Use 10 0 uL of testing samples 10 0 ul of water for a blank tube and 10 0 uL of the uRNA standard A Many real time PCR instrument systems utilize similar technology We provide protocols for the ABI PRISM 7900HT and the Light Cycler Modification to these P Paradise 5 User Guide PN 12872 00 Rev C 57 protocols for other real time platforms can be made according to the manufacturers recommendations Protocol 1 Following the RT reaction serially dilute the uRNA control for use as a standard curve The cDNA generated from the 100 ng of Universal Human Reference RNA Stratagene PN 740000 see above is used as the highest template mass point for the standard curve Therefore the 100 ng sample represents 100 of the reverse transcription product 2 Setup the PCR reactions following the steps below for the instrument you are using gt ABI PRISM 7900HT
56. es not include or carry any right or license to use the product in a clinical diagnostic tests for which the FDA Premarket Approval PMA and or Premarket Notification under section 510 k of the FFDCA is obtained or required The buyer of this product acquires no rights to resell or repackage for resale the product or components thereof No other license is granted to the buyer whether expressly by implication by estoppel or otherwise Disclaimer MDS Analytical Technologies reserves the right to change its products and services at any time to incorporate technological developments This manual is subject to change without notice Although this manual has been prepared with every precaution to ensure accuracy MDS Analytical Technologies assumes no liability for any errors or omissions nor for any damages resulting from the application or use of this information Warranty MDS Analytical Technologies warrants that the products described in this manual meet the performance standards described in literature published by the company If a product fails to meet these performance standards MDS Analytical Technologies will replace the product or issue credit for the full purchase price including delivery charges MDS Analytical Technologies provides no other warranties of any kind expressed or implied MDS Analytical Technologies warranty liability shall not exceed the purchase price of the product and shall not extend to direct indirect consequent
57. fer EB directly onto the membrane of the purification column Gently touch the tip of the pipette to the surface of the membrane while dispensing the elution buffer to ensure maximum absorption of EB into the membrane 12 Incubate the column for one minute at room temperature 13 Place each column tube assembly into the 2 ml support tube in the rotor with the 0 5 ml tube cap trailing the tube 14 Centrifuge the column for one minute at 1 000 x g to distribute EB in the column and then spin for one minute at 16 000 x g to elute RNA The entire sample may be used immediately or stored at 70 C Note Flow through waste following centrifugation is usually present as only a small volume and therefore it is not necessary to discard the flow through waste after every centrifugation step Make sure that the accumulated flow through waste does not make contact with the purification column Flow through waste should be Paradise 5 User Guide PN 12872 00 Rev C 16 discarded when the waste fluid level approaches the surface of the purification column A Prior to use mix Binding Buffer BB thoroughly Binding Buffer BB may form precipitate upon storage Dissolve precipitate prior to use by mixing thoroughly If necessary warm the BB vial to re dissolve Binding Buffer prior to use Remove all traces of wash buffer prior to transferring purification column to the new microcentrifuge tube To remove wash buffer discard flow through
58. gents and nucleic acid purification technology using MDS Analytical Technologies MiraCol Purification Columns The Paradise Plus RNA Amplification reagents can amplify total cellular RNA to generate sufficient aRNA ready for use in microarray quantitative real time PCR or other applications PERFORMANCE SPECIFICATIONS The Paradise Plus kits should yield enough amplified RNA aRNA to complete multiple microarray experiments when starting with the recommended amount of starting material from a tissue block which contains good quality RNA MASTER MIXES The Paradise Plus kits are designed with the assumption that master mixes will be made when using three or more samples and will not be used for two or less samples The kits have been designed with a 10 overage for 3 samples Exceeding 10 overage for master mixes may result in insufficient material to complete all reactions A suggested master mix size for six samples is included where appropriate RNA INPUT REQUIREMENTS The Paradise Plus kits are designed and optimized for use with Formalin Fixed Paraffin Embedded tissue samples The kit is designed to for use with an expected total RNA input amount of 5 40 ng The amount of total RNA found in a cell varies by cell type length of fixation age of the sample block and quality of the material prior to fixation Different sources of total RNA contain varying amounts of mRNA consequently the total RNA input needed to obtain microgram qua
59. gents may Nuclease Mix are incorrect due not be dispensed at optimal concentrations for the reaction Ensure that all to inadequate thawing or pipettes are properly calibrated to disp Low Molecular dispensing Weight Product Concentrations of Primer 1 Thoroughly mix and spin down the sample after adding the primers or 1 Appears on a Gel Primer 2 Primer 3 or 1 Strand Strand Nuclease Mix into the reaction mix and prior to incubation This Nuclease Mix are incorrect due ensures the correct concentration of primers or nuclease in each respective to inadequate mixing or reaction reaction mix volume collection inside the reaction tube Input RNA was not isolated Low molecular weight material may result from lack of RNA and carrier using the PicoPure RNA Using the PicoPure RNA Isolation Kit is recommended to prepare samples Isolation Kit and no nucleic acid that contain carrier carrier was added Paradise 5 User Guide PN 12872 00 Rev C 63 A 3 4 QUALITY ASSESSMENT PROTOCOL Quality Assesment Protocol Symptom Cause Suggestion Tissue homogenate is viscous and difficult to pipet resulting in low RNA yield ARn S No template Control Rn and there is no amplification plot ARn S No Template Control Rn and both reactions show an amplification plot Limit the extraction to 1 mm2 of tissue scrape per 1 uL of PK solution Use a minimum of 25 mm2 of tissue area in 25 uL of PK solution per
60. ial or incidental damages arising from the use results of use or improper use of its products The Paradise Plus Reagent System is intended for laboratory use Paradise P S User Guide PN 12872 00 Rev C Related Documents When using the Paradise Plus Reagent System User Guide the following user guides may be helpful references gt Arcturus Veritas AutoPix or PixCell amp LCM System User Guide gt Turbo Labeling kit user guide gt CapSure HS Caps User Guide Quality Control MDS Analytical Technologies performs functional testing on all components of the Paradise Plus Reagent System The information sheet provided with the system highlights the tests performed Staining MDS Analytical Technologies performs functional testing on the Paradise Plus Reagent System staining components to confirm the absence of nucleic acids and nuclease activity The staining components are functionally tested using LCM to ensure proper dehydration and that good quality RNA is recoverable Extraction Isolation MDS Analytical Technologies performs functional testing on the Paradise Plus Reagent System RNA Extraction Isolation using all components MiraCol Purification Columns are tested by lot to confirm the absence of nucleic acids and nuclease activity Column nucleic acid binding and recovery performance must meet quality standards Amplification Functional Testing MDS Analytical Technologies performs functional testing on each lot of
61. ies and any money paid for the material will be refunded Trademarks Arcturus HistoGene RiboAmp Systems for Microgenomics PicoPure AutoPix CapSure PixCell Paradise amp GenePix and Acuity are registered trademarks and Arcturus Turbo Labeling Veritas ExtracSure MiraCol are trademarks of MDS Analytical Technologies Other trademarks used in this manual are the property of their respective owners The PCR process is covered by patents owned by Hoffmann La Roche Inc and F Hoffman La Roche Ltd Some uses of the Paradise Plus Reagent System may require licenses from third parties Purchase of the Paradise Plus Reagent System does not include any right or license to use develop or otherwise exploit the product commercially Any commercial use development or exploitation of the Paradise Plus Reagent System or development using the product without the express written authorization of MDS Analytical Technologies is strictly prohibited This RNA Amplification product and or its use may be covered by one or more U S Patent numbers 5 716 785 5 891 636 and 5 958 688 which are licensed exclusively to Incyte Corporation The purchase of this product conveys to the buyer the limited non exclusive non transferable right under these patents to use this product for laboratory use as a General Purpose Reagent as an Analyte Specific Reagent or to provide gene expression services The purchase of this product do
62. ified histology grade Xylene Retrieve up to four of the prepared slides If the slides have been frozen place them in a 50 60 C incubation oven for 2 minutes Note Do not perform this step if the slides have been at room temperature Place the slides in jar A Xylene for 3 minutes Invert the jar gently three or four times IMPORTANT Jar A Xylene must be changed after processing up to a maximum of four slides Paradise 5 User Guide PN 12872 00 Rev C 20 10 11 12 Transfer the slides to jar B Xylene for 3 minutes Invert the jar gently three or four times Transfer the slides to jar C Xylene for 3 minutes Invert the jar gently three or four times Hold the slides in jar C Xylene until ready to perform tissue scrape IMPORTANT The minimum incubation in xylene should be 3 minutes up to a maximum of 2 hours When ready to perform tissue scrape remove the slides from the xylene then dry in a fume hood for 5 10 minutes IMPORTANT Perform RNA extraction and isolation within 2 hours after removing the slides from the xylene Repeat steps c through 1 for any remaining slides Discard the used xylene according to standard procedures and then clean the jars following the procedure Cleaning the Plastic Slide Jars found in the appendix of this document Proceed to RNA extraction and isolation Scrape and RNA Extraction 1 6 Add 300 uL of Reconstitution Buffer to vial of dried Pro K Mix 600 ug
63. ill the sample s to 4 8 C D At this point in the protocol you may hold the reaction mixture at 4 8 C in the thermal cycler overnight 4 Move the samples directly to a 4 8 C block 5 Add 1 uL DNase Mix Blue 4 Mix thoroughly and spin down Incubate at 37 C for 15 minutes Chill the sample s to 4 8 C Proceed immediately to aRNA purification Figure 5 12 Blue 4 Paradise 5 User Guide PN 12872 00 Rev C 38 5 3 5 PARADISE PLUS ROUND ONE aRNA PURIFICATION 1 Add 250 uL of RNA Binding Buffer RB to a new purification column and incubate for five minutes at room temperature Centrifuge at 16 000 x g for one minute Figure 5 13 Binding Buffer RB A RNA Binding Buffer RB must be at room temperature and thoroughly mixed before use A precipitate may form during long term storage Dissolve precipitate prior to use by mixing If necessary warm the RB vial to re dissolve 2 Add 120 uL of RB to the IVT reaction sample and mix thoroughly Pipette the entire volume into the purification column 3 To bind aRNA centrifuge at 100 x g or lowest speed setting available for two minutes immediately followed by a centrifugation at 10 000 x g for one minute to remove flow through 4 Add 200 uL of RNA Wash Buffer RW to the purification column and centrifuge at 10 000 x g for one minute Figure 5 14 Wash Buffer RW 5 Add 200 uL of fresh RW to the purification column and centrifuge at 16 000 x g for two minu
64. ise Plus tst Paradise Plus d iststRAND 2 sm E Enhancer Enzyme MASTER MIX ENZYME MIX provided by end user Figure 5 18 Red 1 Red 2 Yellow Enhancer and SuperScript Ill Enzyme 6 Add Ist Strand Synthesis components in the order listed in the following table If you are performing several amplifications you may wish to prepare a Complete Ist Strand Synthesis Mix based on the following table and add 9 0 uL Complete Ist Strand Synthesis Mix to each sample Mix thoroughly by flicking the tube and spin down DO NOT VORTEX Paradise 5 User Guide PN 12872 00 Rev C 41 Table 5 11 Complete 1st Strand Synthesis Mix 6 reaction Master Mix Component Amount uL Vial with 1096 overage uL Enhancer 2 Yellow E 13 2 1st Strand Master Mix 5 Red 1 33 0 1st Strand Enzyme Mix 1 Red 2 6 6 SuperScriptTM Ill Enzyme 1 6 6 Total per sample 9 59 4 Not included in the kit ON gt 9 P Incubate the sample s at 25 C for 10 minutes then at 37 C for 1 5 hours Chill the sample s to 4 8 C for at least one minute It is safe to stop at this point in the protocol You may store the sample overnight at 20 C Place components back onto the cold block or refreeze immediately after dispensing the reagent Do not leave reagents at room temperature for any extended period of time IMPORTANT qRT PCR Kit Customers KITO300 KITO300 NS KITO310 amp KIT0310 NS STOP HERE and continue
65. ith an RNase eliminator such as RNase AWAY Life Technologies to minimize the risk of RNase contamination During enzyme and buffer dispensing keep the reaction tube with sample on ice or chilled in a 4 C cold block Do not freeze samples unless it is indicated to be safe to do so in the protocol SAMPLE AND REAGENTS PREPARATION 1 Thaw frozen kit components as needed and mix with gentle vortexing or by inverting the tubes several times spin down and place on ice When enzyme mixtures must be removed from 20 C storage for use always keep them in a cold block or in an ice bucket at the lab bench Allow In Vitro Transcription IVT Buffer Blue labeled Vial 1 Master Mix Blue labeled Vial 2 and Enhancer Yellow labeled Vial to assume room temperature 22 25 C and mix by inverting or flicking the tube Spin down if necessary Dissolve all visible solids prior to use The Paradise Plus Reagent System RNA Amplification reagents are optimized for the input of formalin modified total cellular RNA Although excess enzyme and reagents are provided in all vials there is insufficient volume to prepare extra reactions Two IVT Master Mix reagents are provided with kits designed for amino allyl incorporation The amino allyl nucleotide mix should only be used in the second round IVT mix When making master mixes use only 10 overage per sample to avoid running out of reagent Paradise 5 User Guide PN 12872 00 Rev C 29
66. l Label RNA Binding Buffer Blue RB RNA Wash Buffer Blue RW RNA Elution Buffer Blue RE 0 5 mL Microcentrifuge Tubes Purification columns Paradise 5 User Guide PN 12872 00 Rev C 64 Table A 15 Fluorescent dyes not supplied with the kit Reagent Maker Catalog Cy3 mono reactive dye Amersham PA23001 Cy5 mono reactive dye Amersham PA25001 Alexa Fluor 647 reactive dye Molecular 32756 decapacks for microarrays Probes Alexa Fluor555 reactive dye Molecular A 32757 decapacks for microarrays Probes Protocol Labeling Reaction Re suspend 1mg monoreactive dye in 51 uL of DMSO Save unused vials in the dark at 2 6 C Figure A 3 DMSO 1 Take 15 ug of amino allyl aRNA in 7 5 uL of nuclease free water a Sample should be maintained on a cold block 2 Add2 5 uL of Labeling Buffer LB to the sample Figure A 4 Labeling Buffer 3 Add 10 uL of the re suspended dye into 10 uL of the sample 4 Mixthoroughly by flicking the tube Spin down briefly 5 Incubate at room temperature in the dark for 1 hour 6 Proceed directly to purification of labeled aRNA aRNA Purification 1 Pre treat column by adding 250 uL of RNA Binding Buffer RB to a new purification column Incubate the column at room temperature for 5 minutes Centrifuge at 16 000 x g for one minute 2 Add225 uL of RB to the transcript labeling reaction sample and mix thoroughly Pipette the entire sample vol
67. lank path lengths are identical potential error from applying path length normalization to OD microplate is cancelled out Table A 16 SpectraMax microplate reader settings for RNA quantitation Other instrument settings not listed here should be left on the default values Read Mode Absorbance Lm1 260 nm Wavelengths Lm2 280 nm PathCheck box is checked PathCheck Water Constant button is checked Plate background constants box is not checked Assay Plate Type 96 Well Standard clrbtm Wells To Read or Strips Highlight wells to be read Paradise 5 User Guide PN 12872 00 Rev C 68 A 6 A T aRNA YIELD AND PURITY DETERMINATION aRNA quantitation by ultraviolet light absorbance is the simplest approach to determining amplification yield An absorbance reading at 260 nm A260 using a spectrophotometer is taken on a diluted aliquot of aRNA Typically a 1 25 to 1 50 dilution of aRNA in nuclease free water is sufficient For single stranded RNA a measurement of A260 1 0 corresponds to 40 ug mL The yield can by calculated by A260 dilution factor 40 pg mL RNA Measuring Avg and calculating the Ax o A2s9 ratio indicates the purity of the RNA sample An Axo Argo ratio between 2 0 2 6 indicates very pure aRNA ASSESSMENT OF RNA QUALITY USING THE AGILENT BIOANALYZER The Agilent Lab on a Chip system provides a fast and effective approach to assessing the integrity of
68. lification only urus Paradise Plus 2 eling 12 reactions eling 12 reactions eling 12 reactions Solvents Stain Extraction Amplification Isolation of Room Room Room Room Room Frozen Frozen Frozen Samples temp temp temp temp temp 1x 1x 1x 1x 2x 2x 2x PRIMNS RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7008 x KITO321 1x 1x 1x 1x 1x RA7013 RA7014 RA7007 RA7001 UNS RD RA7008 KITO321 A dx TAE Tu RA7008 us staining components AITOSIZS Bins m us stain slide jars amp KITO312 J us 1 5 Round ES 0 e KITO321 NS 1x RATOA RA7008 due M es 5 So pie 1x sande KITO609 1x Nes 1 saree KITO610 1x Su RA7014 RA7007 RA7001 PN BAR RA7009 1x MAD S RA7009 Kit Configurations with Catalog Catalog Number us 1 5 Round 12 us 1 5 Round 12 us 1 5 Round 6 us 1 5 Round 12 RA7014 Bic pee aan canis us 1 5 Round 1x 1x Kamp RA7007 RA7001 Ern NONE E T E Un on RA7018 us 2 round um Dem BATH RAS REUS vee KITO312 Round with Biotin KITO312B Round with Cy3 KIT0312C Round with Cy5 KIT0312D Round 12 ext iso KITO322 Round 6 KITO322 A 1x 1x RA7007 RA7001 1x aris RA7014 E o EUN us2 1x RA7007 Mun 1x DU RA7014 Fidis E us2 1x RA7007 on 1x Tm RA7014 ee us 2 1x 1x 1x us 2 rcturus Paradise PI reactions No solvents us 2 Round 12 KITO312 NS n Wu BETA iR ae Ben ira Paradise S User Guide PN 12872 00 Rev C Extrac
69. llustrated Rest the tube cap against the tube immediately clockwise to it Place an empty lidless 1 7 2 0 mL tube into the rotor hole adjacent in the clockwise direction to the last assembly Paradise 5 User Guide PN 12872 00 Rev C 36 5 3 4 PARADISE PLUS ROUND ONE N VITRO TRANSCRIPTION 1 Thaw IVT Buffer Blue 1 Master Mix Blue 2 and Enhancer Yellow to room temperature and thoroughly mix to dissolve all solids IVT Enzyme Mix Blue 3 does not require thawing and can be put directly 4 8 C Mix enzyme thoroughly by inverting several times Spin briefly Figure 5 12 Blue 1 Blue 2 Blue 3 and Yellow E Note IVT reaction components must be thawed thoroughly mixed with all solids dissolved and brought to room temperature just before use N Add IVT components in the order listed in the following table If you are performing several amplifications you may wish to prepare a Complete IVT Reaction Mix according to the following table and add 12 uL Complete IVT Reaction Mix to each sample Mix thoroughly by flicking the tube and spin down Table 5 10 Complete IVT Reaction Mix 6 reaction Master Mix Component Amount uL Vial with 10 overage uL IVT Buffer 2 Blue 1 13 2 IVT Master Mix 6 Blue 2 39 6 IVT Enzyme Mix 2 Blue 3 13 2 Enhancer 2 Yellow E 13 2 Total per sample 12 79 2 Paradise 5 User Guide PN 12872 00 Rev C 37 3 Incubate at 42 C for 8 hours Ch
70. lternate reagents have not been tested The system is designed to be processed together The issue is that the formalin fixation causes cross linking and when the RNA is extracted the cross linking leaves artifacts on the RNA backbone These artifacts need to be dealt with before successful amplification can be achieved While our process is proprietary the Paradise Plus system deals with these cross linking artifacts during the amplification process So using only the isolation components may not be effective with another company s downstream reagents This user guide is divided into sections describing the steps involved using staining extraction isolation and amplification separately To get the most out of the Paradise Plus Reagent System please examine the components and read each section of the user guide carefully A principal application of this kit is use in conjunction with Laser Capture Microdissection LCM LCM experiments often involve the analysis of gene expression patterns in cells captured from specimens Obtaining accurate results from gene expression analysis experiments including microarray hybridization and quantitative PCR depends on careful preservation of intact RNA molecules in captured cells Staining The Paradise Plus Reagent System Staining components are part of a series of LCM certified LCM analysis products for preparing and staining tissues while preserving intact nucleic acid and protein species from capture
71. materials using the amplification protocol described in this manual Reagent Testing MDS Analytical Technologies tests each lot of enzymes to confirm activity Buffer components must perform correctly under reaction or nucleic acid purification conditions Purification Column Testing Purification columns are tested by lot to confirm the absence of nucleic acids and nuclease activity Column nucleic acid binding and recovery performance must meet quality standards Visual Inspection Finished kits are inspected for proper assembly Challenges of FFPE Tissue MDS Analytical Technologies strongly recommends performing quality assessment of FFPE samples Tissue that has degraded RNA prior to fixation will not yield good results nor will samples that have been over fixed If the quality of the source tissue is unknown then performing a quality assessment of the tissue block prior to spending the time and expense of Laser Capture and amplification is imperative The amplification process generates product from the 3 end of the mRNA For best results use qRT PCR primer sets designed within the first 300 bases from the poly A tail Expiration All reagents included with the system should be used within six 6 months of receipt Technical Support You may access services and support in the following ways Online connection at www moleculardevices com Phone at 1 800 635 5577 1 408 747 1700 Fax 1 408 747 3603 Web www moleculardevices com
72. ng the kit is PCR ready and needs no additional purification to perform amplification KIT0103 150 HS cap or 30 Macro cap extractions RiboAmp Plus RNA Amplification Kit The RiboAmp Plus RNA Amplification Kit enables the production of microgram quantities of antisense RNA aRNA from as little as picogram quantities of total cellular RNA Amplified RNA produced using the kit is suitable for labeling and use for probing expression microarrays The kit achieves amplifications of 1 000 3 000 fold in one round of amplification and amplifications of up to 1 000 000 fold in two rounds The kits include microarray labeling options such as biotin fluorescent dyes and amino allyl Kits are available in two sensitivity options RiboAmp Plus 5 40 ng and a high sensitivity version RiboAmp HS Plus 0 1 5 ng KIT0521 RiboAmp Plus 6 reactions KIT0525 RiboAmp HS Plus 6 reactions Paradise Plus Reagent System The Paradise Reagent System is the only reagent system designed to enable gene expression studies using formalin fixed paraffin embedded FFPE tissue samples Components include sample preparation and staining reagents RNA extraction and isolation reagents RNA amplification reagents and a comprehensive user guide KIT0312 12 samples Turbo Labeling Kits The TURBO Labeling Kits provide a proprietary non enzymatic technology for labeling of unmodified aRNA for Gene Expression profiling The unmodified aRNA is labeled po
73. nscription MiraCol aRNA Purification Optional reagents are supplied to Labeled Amplified aRNA Amplified aRNA ready for Labeling mable the generation of amino allyl VA NTA v7 SNA ww IT 1RNA for hybridization on to sense oligo arrays See Section VA NOW yv YN WN vn NN oN Application 3 for details wu vu 7 wmv ww A Figure 5 1 Paradise Amplification Schematic Using a thermal cycler with a heated lid is important The heated lid ensures proper temperature distribution within the reaction tube and prevents evaporative condensation that alters the reaction mixture concentrations Paradise S User Guide PN 12872 00 Rev C 26 5 2 3 THERMAL CYCLER PROGRAMMING Thermal cyclers provide a convenient and reproducible method of incubating reactions according to specified temperatures and times in the protocol A thermal cycler program for use appears on page 3 12 The program is not intended for automatic progression from one time and temperature set to another The program lists a 4 C hold after each incubation or incubation cycle when it is necessary to remove the reactions from the thermal cycler to add reagents After the addition of reagents place the sample back into the thermal cycler and resume the program Table 5 6 Paradise Plus Thermal Cycler Program Round 1 c Time 1 Strand 70 1 hour Synthesis T 42 1 5 hour 4 hold 37 30 minutes 95 5 minutes 4 h
74. ntities of aRNA depends on the total RNA source For example RNA from rapidly dividing cells may be relatively mRNA rich and thus may result in higher output of aRNA In general one can expect anywhere from 1 10 pg of total RNA per cell based on factors mentioned above We recommend brining in a minimum of 5 ng of total RNA into the Paradise Plus system amplification reaction STORAGE AND STABILITY MDS Analytical Technologies makes recommendations for storage temperatures throughout this document Realizing that not ever laboratory has a freezers set at these temperatures we have defined the acceptable temperature ranges for our recommendations Acceptable ranges for storage 70 C 65 C to 80 C 20 C 15 C to 30 C 4 C 2 C to 8 C Room Temperature 10 C to 30 C VUV Paradise S User Guide PN 12872 00 Rev C 2 1 6 1 7 Staining Inspect all kit components upon receipt Ethanol and xylene are flammable and should be unpacked and stored at room temperature in a fireproof storage cabinet or fume hood with adequate ventilation Cap bottles tightly between uses Store remaining kit supplies at room temperature in a clean dust free environment Extraction and Isolation Store the Paradise Plus Reagent System RNA Extraction Isolation components at room temperature Store the DNase I solution and DNase Buffer at 70 C until use Once the reagents are used storage at 20 C is recommended Amplifi
75. o get the most from your amplification reagents take a few moments to examine the components of the kit and read the information in the following sections OVERVIEW The Paradise Plus Reagent System RNA Amplification reagents are optimized to amplify formalin fixed RNA The reagents utilize two rounds of a five step process for linear amplification of the mRNA fraction of total cellular RNA Paradise 5 User Guide PN 12872 00 Rev C 25 e first strand synthesis reaction that yields cDNA incorporating a T7 promoter sequence second strand synthesis reaction utilizing exogenous primers that yields double stranded cDNA cDNA purification using specially designed MiraCol Purification Columns in vitro transcription IVT utilizing T7 RNA polymerase yields antisense RNA aRNA and aRNA isolation with the MiraCol Purification Columns To save time in vitro transcription may be performed overnight with the proper thermal cycler programming ROUND Total Cellular RNA ONE LP mRNA specific Ist Strand Synthesis Ist Primer cDNA Trem Exogenous 2nd Primer Y 2nd Strand Synthesis ds cDNA m MiraCol cDNA Purification In Vitro Transcription MiraCol aRNA Purification Amplified aRNA WC VA NOM WOW uM NOW WwW ROUND Ist and 2nd TWO Strand Synthesis ds cDNA mm mmu INIHI m7 KIT0301 KITO311 KITO302 KITO312 Commercially available MiraCol cDNA Purification Transcript Labeling Kit i In Vitro Tra
76. old 2 Strand 95 2 minutes Synthesis haid 25 10 minutes 37 30 minutes 70 5 minutes 4 hold IVT 42 8 hours 4 hold optional overnight hold 37 15 minutes 4 hold Paradise 5 User Guide PN 12872 00 Rev C 27 5 2 4 Table 5 7 Paradise Plus Thermal Cycler Program Round 2 c Time 1 Strand 70 5 minutes Synthesis TR 25 10 minutes 37 1 5 hour 4 Hold 2 Strand 95 5 minutes Synthesis wem 37 30 minutes 70 5 minutes 4 Hold IVT 42 8 hours 4 hold optional overnight hold 37 15 minutes 4 Hold A Using a thermal cycler with a heated lid is important The heated lid ensures proper temperature distribution within the reaction tube and prevents evaporative condensation that alters the reaction mixture concentrations TIME REQUIREMENTS The table below presents typical time requirements for completion of the protocol Times reflect total handling and reaction times of each step Note that there are safe stopping points for pausing the amplification process and the times presented reflect a continuous uninterrupted process Table 5 7 Paradise Plus Time Requirements Paradise Plus 1 Round 2 Round Steps hours hours 1 Strand Synthesis 3 5 2 2 Strand Synthesis 1 1 cDNA Purification 0 5 0 5 Total before IVT 5 3 5 In Vitro Transcription 8 8 aRNA Purification 0 5 0 5 Total 13 5 12 Par
77. on IVT Blue 1 Light Blue AA Blue 3 and Yellow E 2 Add IVT components in the order listed in the following table If you are performing several amplifications you may wish to prepare a Complete VT Reaction Mix according to the following table and add 12 uL Complete IVT Reaction Mix to each sample Mix thoroughly by flicking the tube and spin down Note IVT reaction components must be thawed thoroughly mixed with all solids dissolved and brought to room temperature just before use Paradise S User Guide PN 12872 00 Rev C 47 Table 5 13 Complete IVT Reaction Mix 6 reaction Master Component Amount pL Vial Mix with 10 overage uL IVT Buffer 2 Blue 1 13 2 IVT Master Mix 6 Blue 2 39 6 IVT Enzyme Mix 2 Blue 3 13 2 Enhancer 2 Yellow E 13 2 Total per sample 12 79 2 If doing Amino Allyl incorporation substitute Amino Allyl IVT Master Mix light blue AA here 3 Incubate at 42 C for 8 hours Chill the sample s to 4 8 C D At this point in the protocol you may hold the reaction mixture at 4 8 C in the thermal cycler overnight 4 Move the samples directly to a 4 8 C block Figure 5 26 Blue 4 5 Add uL DNase Mix Blue 4 Mix thoroughly and spin down Incubate at 37 C for 15 minutes Chill the sample s to 4 8 C Proceed immediately to aRNA purification Paradise 5 User Guide PN 12872 00 Rev C 48 5 3 10 PARADISE PLUS ROUND TWO aRNA PURIFICATION 1 A
78. ples run an amplification varies control using the Control RNA provided in the Paradise Plus Kit to verify kit functionality Starting RNA sample quality The greatest factor affecting amplification efficiency is the integrity of the has been compromised RNA used in the Paradise Plus amplification process Suspend RNA in nuclease free water prior to amplification Avoid using organic solvents such as phenol in RNA isolation pro There is no RNA in the input Run a control RNA sample with a known quantity of RNA to ensure that sample amplification is successful Reagent concentrations in Ensure all reagents are completely thawed mixed and all solids dissolved reaction mixtures are incorrect prior to use due to inadequate thawing or mixing Reagent concentrations in the Thoroughly thaw and mix all reagents prior to dispensing Ensure all reaction mixtures are incorrect reagents are dispensed at proper volumes Briefly spin down the reaction due to inadequate reaction mix prior to incubation to ensure all reagents are collected in the reaction volume collection in the reaction volume and the reaction mix has the Amplification yield tube is Poor Reagent concentrations in Briefly spin down the sample following incubation steps to maintain proper reaction mixtures are incorrect volumes and concentrations of reagents and ensure that all nucleic acid due to evaporative templates are mixed with reaction components Use a thermal cycle
79. r with a condensation onto the wall of heated lid the reaction tube during incubation Incubation temperatures are Verify the accuracy of all incubation temperatures If you are using a thermal incorrect cycler make sure that the programmed temperatures read correctly and the instrument has been calibrated to establish and maintain accurate temperature settings RNA yield is diminished during Verify centrifugal force used during nucleic acid purification Improper column purification binding washing and elution centrifugal forces can decrease the recovery of nucleic acid from the purification column Microcentrifuges should be calibrated to deliver the correct Message content is low within Check amplification efficiency using control RNA Use higher RNA inputs to the total RNA being used in compensate for lower message content your study Occasionally a predominant band below the expected aRNA smear will appear on a gel This band will lead to Quality of the starting RNA is Poor RNA quality can lead to the formation of the reaction artifact visible as inadequate a low molecular weight band Check the quality of your input RNA One approach is to utilize the Agilent Lab on a Chip System with an RNA LabChip Kit For additional recommen Concentrations of Primer 1 Thaw and thoroughly mix each reagent vial prior to dispensing If Primer 2 Primer 3 or 1 Strand incompletely thawed and mixed the concentrations of these rea
80. ranscription IVT RA7008 Component Vial Color Vial Label IVT Buffer Blue 1 IVT Master Mix Blue 2 IVT Enzyme Mix Blue 3 DNase Mix Blue 4 Table 5 3 In vitro Transcription IVT 2 round RA7009 Component Vial Color Vial Label IVT Buffer Blue 1 IVT Master Mix Blue 2 IVT Enzyme Mix Blue 3 DNase Mix Blue 4 Paradise S User Guide PN 12872 00 Rev C 24 5 2 5 2 1 5 2 2 Table 5 4 Amino Allyl IVT RA7010 Component Vial Color Vial Label IVT Buffer Blue 1 IVT Master Mix Blue 2 IVT Enzyme Mix Blue 3 DNase Mix Blue 4 Amino allyl IVT Master Mix Light Blue AA Labeling Buffer Light Blue LB DMSO Light Blue DMSO Table 5 5 aRNA Purification RA7011 Component Vial Color Vial Label DNA Binding Buffer Red DB DNA Wash Buffer Red DW DNA Elution Buffer Red DE RNA Binding Buffer Blue RB RNA Wash Buffer Blue RW RNA Elution Buffer Blue RE 0 5 mL Microcentrifuge Tubes Purification columns A Please read this entire protocol prior to performing amplifications MDS Analytical Technologies recommends using quantitative real time PCR for the most accurate measurement of RNA quantity of FFPE samples For maximum stability store the frozen reagents at 70 C or below until used After use Storage at 20 C is recommended PRELIMINARY STEPS MATERIAL AND PROTOCOL REVIEW T
81. re ec rint edi gae 54 Tro bleshootlng i ostia n epa Ud ate E i a tmv tapa a ats 62 SANIN E retor DI IU 62 Extraction and Iso at101EL ome en rites nein iique qu esten diha 62 Amplification ace adit nire d o ope a a pastos 63 Quality Assessment Protocol 64 Amino allyl aRNA Labeling usu en rie torte diia e ee PE ie ee iris 64 RNA quantitation using SpectraMax microplate readers with absorbance mode and PathCheck sensor eee 68 aRNA Yield and Purity Determination esssseeeeeeeees 69 Assessment of RNA Quality Using the Agilent Bioanalyzer 69 Analysis of aRNA by Agarose Gel Electrophoresis sss 70 Generation of Labeled aRNA using alternative IVT kits 71 Cleaning the staining Jats sien eesctec eet eet er abet ae rt he tases 73 Centrifuge In TOL IQ OM aos eade Pda Rossa voe tO req GS 73 Paradise 5 User Guide PN 12872 00 Rev C ii 1 1 1 Introduction BACKGROUND The Paradise Plus Reagent System provides an integrated system enabling gene expression studies using Formalin Fixed Paraffin Embedded tissue FFPE Components provided include gt Sample preparation and staining reagents gt RNA extraction and isolation reagents gt RNA amplification reagents Paradise Plus reagents are intended to be used together as a system They are not as a Staining kit Extraction and Isolation kit or Amplification kit by itself A
82. st amplification thereby avoiding the need to incorporate modified nucleotides The use of natural nucleotides in the amplification step results in unmodified aRNA with higher yields and longer aRNA fragments thus providing better representation of the mRNA transcript for downstream analysis Paradise S User Guide PN 12872 00 Rev C 4 1 8 KIT0608 Biotin 12 samples KIT0609 Cy3 12 samples KIT0610 Cy5 12 samples ADDITIONAL EQUIPMENT AND MATERIALS REQUIRED Ensure that you have ready access to the following laboratory equipment and materials before you begin These items are not included with the Paradise Plus Reagent System Staining Equipment gt Rotary Microtome Fume hood 70 C freezer Tweezers Cover glass forceps Microslide box plastic VWR Cat 48444 004 Tissue Flotation Water Bath Oven 20 200 uL pipettor VVUVVVVVY Materials Disposable gloves Detergent Fisher Scientific Cat 04 355 RNase AWAY Life Technologies Cat 10328 011 100 ethanol Kimwipes or similar lint free towels Disposable microtome blades Microslides Pipette tips nuclease free VUVVVVVY Extraction Isolation Equipment Microcentrifuge Eppendorf 5415D or similar 2 20 uL pipettor 20 200 uL pipettor Incubation oven 50 C Vy Materials gt Nuclease free pipette tips gt 0 5 ml extraction tubes Applied BioSystems N8010611 or USA Scientific Inc 1605 0000 Amplifica
83. support e mail to support moldev com For additional offices please see the contact information on the back cover of this User Guide Paradise 5 User Guide PN 12872 00 Rev C Comments and Suggestions MDS Analytical Technologies welcomes your comments and suggestions for improving our documents Send your comments to support moldev com MDS Analytical Technologies maintains an ongoing research program to test and validate the Paradise Plus Reagent System Call MDS Analytical Technologies Technical Support at 1 800 635 5577 or 1 408 747 1700 or send an email inquiry to support moldev com for an up to date list Paradise 5 User Guide PN 12872 00 Rev C Contents Introduction TACK PE OUNE as coste etn ey tub eunt e MEUM e E er 1 Perhormance Specifications iuis sete u tei tea ee Eb tesa do quin esp b ee dandas 2 Mia ster T naa 2 RNA Input requirements ous tese Seg ter tue Sos tuit RN dist etaed 2 Stordpe and STAD LY tac t esto eet atest ceases et A R tet 2 Material Safety and Data Sheet MSDS seen 3 Related Arcturus Products uie rastris He RR Ate iain A Ea P S ata open 3 Additional Equipment and Materials Required sess 5 Recommendations for Nuclease Free Technique sss 6 Configurations Kit Components apetece tie ple karten padece Guia annie needed 8 Sample Preparation and Staining COMPOMENES 2er err ret eu ER e en e EE
84. tes Check the purification column for any residual wash buffer If any wash buffer remains re centrifuge at 16 000 x g for one minute A Avoid splashing flow through in the collection tube onto the purification column If flow through waste liquid wets the outside of the purification column re centrifuge the column at 16 000 x g to remove the liquid 6 Discard the collection tube and flow through 7T Place the purification column into a new 0 5 mL microcentrifuge tube provided in the kit and carefully add 12 uL of RNA Elution Buffer RE directly to the center of the purification column membrane Gently touch the tip of the pipette to the surface of the membrane while dispensing RE to ensure maximum absorption of RE into the membrane Gently tap the purification column to distribute the buffer if necessary Paradise 5 User Guide PN 12872 00 Rev C 39 eo 10 11 Figure 5 15 Elution Buffer RE Incubate at room temperature for one minute Place each column tube assembly into the centrifuge rotor with the 0 5 mL tube cap trailing the tube Centrifuge at 1 000 x g for one minute immediately followed by 16 000 x g for one minute Discard the purification column and retain the elution containing the aRNA Immediately proceed to Round Two or store the purified aRNA at 70 C overnight Note Tubes must be properly oriented in the rotor during elution See Section 25 2 7 Rotation Figure 5 16 Centrifuge
85. the amounts indicated in the table below a Pipette the Binding Buffer BB into the cell extract then mix well by pipetting up and down b Pipette the Ethanol Solution EtOH into the cell extract then mix well by pipetting up and down Table 4 6 Binding solutions chart Solution Volume uL Cell extract PK Solution 25 50 75 100 150 Binding Buffer 27 53 80 106 159 Ethanol Solution 52 103 155 206 309 ge The volume of Binding Buffer is 1 06 x the volume of cell extract PK solution The volume of Ethanol Solution is 2 06 x the volume of cell extract PK solution rounded up e Pipette up to 210 uL of the cell extract mixture onto the preconditioned purification column IMPORTANT Do not load more than 210 uL of the cell extract mixture onto the purification column at one time Centrifuge the purification column for 2 minutes at 100 x g to bind the RNA on the column membrane Repeat steps c and d until all of the cell extract mixture has been loaded and bound to the purification column Once all of the cell extract mixture has been bound onto the purification column centrifuge the column for 1 minute at 16 000 x g to pellet the debris Repeat step d until all of sample mixture has been loaded and centrifuged Pipette 100 uL Wash Buffer 1 W1 into column and centrifuge at 76 000 x g for 1 minute Mix 2 uL DNase Mix DNase with 18 uL of DNase buffer DNB Add 20 uL mixture to the col
86. tion Amplification Paradise Plus Kit Configurations with Catalog Isolation Numbers continued oe Sel Samples temp temp tem tem temp Arcturus Paradise Plus 2 Round 12 ext iso 1x 1x 1x 1x Arcturus Paradise Plus 2 Round with Biotin 1x 1x 1x 1x Arcturus Paradise Plus 2 Round with Cy3 Arcturus Paradise Plus 2 Round with Cy5 1x 1x 1x 2x 2x 2x 1x Arcturus Paradise Plus 2 round Amino Allyl 1x 1x 1x 1x Arcturus Paradise Plus 2 Round Amino 1x 1x 1x 1x Allyl 12 ext iso 6 amp Pm fe ater aa ee gir RADIO kanie Am Arcturus Paradise Plus 2 Round Amino 1x Arcturus Paradise Plus 2 Round Amino 1x 1x 1x Arcturus Paradise Plus 2 Round Amino 1x 1x 1x Allyl 12 ext iso 6 amp No solvents COE E BOR ES eun Arcturus Paradise Plus 2 round Bulk 48 Arcturus oa Plus 2 round Bulk 48 Ax Arcturus oon Plus qrtPCR kit 12 4x Ax 4x 1x 1x poo EUN Arcturus Paradise Plus qrtPCR kit 1x 1x 1x 1x Arcturus Paradise Plus qrtPCR kit Bulk 48 1x Arcturus Paradise Plus qrtPCR kit Bulk 48 1x Arcturus Paradise Plus QC Kit 12 reactions 1x Note KIT0313 should follow Section II in the Appendix Paradise 5 User Guide PN 12872 00 Rev C 9 3 1 3 1 1 3 2 3 2 1 3 3 3 3 1 3 Sample Preparation and Staining COMPONENTS REAGENTS AND SUPPLIES The Paradise Plus Reagent System Staining components include Table 3 1 Staining Solvents RA7013 component see 100 Ethanol 0 5L 95 Ethanol 0 5L
87. tion Equipment Thermal cycler with heated lid Microcentrifuge for 1 5 mL and 0 5 mL tubes Eppendorf 5414D or similar 0 5 10 uL pipettor 20 uL pipettor 200 uL pipettor VUVVY Paradise S User Guide PN 12872 00 Rev C 5 1 9 gt 1000 LL pipettor gt Ice bath or cold block 4 C gt Vortex mixer optional Materials gt 0 5 mL or 0 2 mL RNase free microcentrifuge tubes gt 2mL lidless tube for centrifuge PGC Scientific Cat 16 8101 06 gt Nuclease free pipette tips Reagents gt SuperScript III Reverse Transcriptase 200 U uL Enzyme only Invitrogen part number 18080 093 18080 044 or 18080 085 RECOMMENDATIONS FOR NUCLEASE FREE TECHNIQUE Staining RNase contamination will cause experimental failure Minimize RNase contamination by adhering to the following recommendations throughout your experiment gt Wear disposable gloves and change them frequently gt Use RNase free solutions glassware and plasticware gt Do notre purify Paradise Plus Reagent System Section Staining Kit components They are certified Nuclease Free gt Wash scalpels tweezers and forceps with detergent and bake at 210 C for four hours before use gt Use RNase AWAY Life Technologies according to the manufacturer s instructions on the horizontal staining rack and any other surfaces that may come in contact with the sample gt Use Kimwipe soaked in RNase Away to wipe down and clean the interior of tissue
88. tions in an optical tube or optical reaction plate a Dispense 12 uL of the 3 Primer Set into the appropriate wells or tubes b Dispense 12 uL of the 5 Primer Set into the appropriate wells or tubes c Add 8 uL of the diluted cDNA into the appropriate wells or tubes d Add 8 uL of the nuclease free water into the appropriate NTC wells or tubes Note For both the 3 and 5 Primer Sets include the RNA samples positive control diluted control for a standard curve and the blank NTC in the sample layout 2 Sealthe tube or reaction plate with an optical cap or optical adhesive cover 3 Vortex the tube or reaction plate for 20 seconds then spin quickly to collect the reactions at the bottom of the tube or wells 4 Proceed to Running the ABI PCR Reactions Running the ABI PCR Reactions 1 Place the tube or reaction plate in your real time PCR instrument 2 Program the thermal cycling conditions as follows Table A 10 Thermal Cycling Conditions Step ds a Time Hold 50 2 minutes 2 Hold 95 15 minutes 95 15 seconds 3 TIE 58 30 seconds 72 32 seconds A IMPORTANT The thermal cycling conditions listed above have been optimized for use on the Applied Biosystems 7900HT Fast Real Time PCR System 3 Optional If your instrument has the ability include a dissociation curve 4 When the run is completed export the results into Microsoft Excel software 5 Proceed to Interpreting the Results
89. ubate the sample as follows 25 C 10 minutes 37 C 30 minutes 70 C 5 minutes 4 8 C Hold until ready to proceed up to a maximum of 30 minutes gt VVVVN Place components back onto the cold block or refreeze immediately after dispensing the reagent Do not leave reagents at room temperature for any extended period of time Paradise S User Guide PN 12872 00 Rev C 34 5 3 3 PARADISE PLUS ROUND ONE cDNA PURIFICATION 1 Add 250 uL of DNA Binding Buffer DB to a DNA RNA Purification Column seated in the collection tube provided Hold for five minutes at room temperature Centrifuge at 16 000 x g for one minute Figure 5 8 Binding Buffer DB Note DNA Binding Buffer DB must be at room temperature and thoroughly mixed by shaking before use A precipitate may form during long term storage Dissolve precipitate prior to use by mixing If necessary warm the DB vial to re dissolve 2 Add 200 uL of DNA Binding Buffer DB to the 2 Strand Synthesis sample tube mix well and pipette the entire volume into the purification column 3 To bind cDNA to column centrifuge at 100 x g for two minutes or lowest speed setting available immediately followed by a centrifugation at 10 000 x g for one minute to remove flow through 4 Add250 uL of DNA Wash Buffer DW to the column and centrifuge at 16 000 x g for two minutes Check the purification column for any residual wash buffer If any wash buffer remains re centrif
90. uge at 16 000 x g for one minute Figure 5 9 Wash Buffer DW a Discard the flow through and collection tube 6 Place the column into the provided 0 5 mL microcentrifuge tube and carefully add 11 uL of DNA Elution Buffer DE onto the center of the purification column membrane Gently touch the tip of the pipette to the surface of the membrane while dispensing the elution buffer to ensure maximum absorption of DE into the membrane Gently tap the purification column to distribute the buffer if necessary Incubate for one minute at room temperature Figure 5 10 Elution Buffer DE Paradise 5 User Guide PN 12872 00 Rev C 35 Place the assembly into the centrifuge as shown and centrifuge at 1 000 x g for one minute and then at 16 000 x g for one minute Discard the column and retain the elution containing the cDNA in the microcentrifuge tube for further processing Note Avoid splashing flow through in the collection tube onto the column If flow through waste liquid wets the outside of the purification column re centrifuge the column at16 000 x g to remove liquid It is safe to stop at this point in the protocol You may store the sample overnight at 20 C Rotation Figure 5 11 Centrifuge Note To avoid potential breakage of the microcentrifuge tube cap during centrifugation insert the purification tube 0 5 mL tube assembly into a lidless 1 7 2 0 mL tube Insert this assembly into adjacent rotor holes as i
91. ume into the purification column Paradise 5 User Guide PN 12872 00 Rev C 65 9 Figure A 5 RNA Binding Buffer Centrifuge at 100 x g or lowest speed setting available for 2 minutes immediately followed by a centrifugation at 10 000 x g for 1 minute Do not use re suspended dye that is over 2 days old DMSO is hygroscopic Store tightly capped To obtain 15 ug of aRNA in 7 5uL you may dry down 15ug of aRNA and re suspend in 7 5 uL of nuclease free water or concentrate the aRNA to 2 ug uL and use 7 5 uL of the sample Do not allow the samples to incubate longer than 1 hour Use reagents supplied in the Labeling Purification Reagents box Discard flow through Place the column into the same collection tube Add 250 uL of RNA Wash Buffer RW to the purification column and centrifuge at 10 000 x g for 1 minute Figure A 6 RNA Wash Buffer Repeat Step 5 Add 250 uL of fresh RW to the column and centrifuge at 16 000 x g full speed for 2 minutes Check the purification column for any residual wash buffer If any wash buffer remains re centrifuge at 16 000 x g for one minute Discard the collection tube and flow through Place the purification column into a new 0 5 mL microcentrifuge tube provided in the kit and carefully add 50 uL of RNA Elution Buffer RE directly onto the center of the purification column membrane Gently touch the tip of the pipette to the surface of the membrane while dispensing RE to ensure m
92. umn and incubate at room temperature for 20 minutes Pipette 40 uL Wash Buffer 1 W1 into the purification column and centrifuge for one minute at 8000 x g Pipette 100 uL Wash Buffer 2 W2 into column and centrifuge at 16 000 x g for 1 minute Pipette 100 uL Wash Buffer 2 W2 into column and centrifuge at 16 000 x g for 2 minutes Transfer column to a 0 5ml microcentrifuge tube provided in the Kit Pipette 12 uL of Elution Buffer EB direction onto the membrane of the purification column Incubate for 1 minute at room temperature Centrifuge at 1 000 x g for 1 minute and then at 16 000 x g for 1 minute The sample maybe used immediately or stored at 70 C or below Paradise 5 User Guide PN 12872 00 Rev C 22 A Gently touch the tip of the pipette to the surface of the membrane while dispensing the elution buffer to ensure maximum absorption of EB to the membrane Paradise S User Guide PN 12872 00 Rev C 23 5 1 5 1 1 5 RNA Amplification COMPONENTS REAGENTS AND SUPPLIES Table 5 1 Paradise Plus cDNA kit RA7018 1 Strand Master Mix Red 1 1 Strand Enzyme Mix Red 2 Enhancer Yellow 1 Strand Nuclease Mix Gold 2 Strand Master Mix White 1 2 Strand Enzyme Mix White 2 Primer 1 Grey 1 Primer 2 Grey 2 Primer 3 Grey 3 Control RNA White C Also requires SuperScript III enzyme not included In vitro Transcription IVT Table 5 2 In vitro T
93. void potential breakage of the microcentrifuge tube cap during centrifugation insert the purification tube 0 5 mL tube assembly into a lidless 1 7 2 0 mL tube Insert this assembly into adjacent rotor holes as illustrated Rest the tube cap against the tube immediately clockwise to it Place an empty lidless 1 7 2 0 mL tube into the rotor hole adjacent in the clockwise direction to the last assembly VU IMPORTANT 1 5 Round Customer KIT 0301 KITO301 NS KITO311 amp KITO311 NS STOP HERE and proceed to Appendix IX Paradise 5 User Guide PN 12872 00 Rev C 46 5 3 9 PARADISE PLUS ROUND TWO IN VITRO TRANSCRIPTION 1 ThawIVT Buffer Blue 1 Master Mix Blue 2 and Enhancer Yellow to room temperature and thoroughly mix to dissolve all solids IVT Enzyme Mix does not require thawing and can be put directly 4 8 C Mix enzyme thoroughly by inverting several times Spin briefly Note IVT reaction components must be thawed thoroughly mixed with all solids dissolved and brought to room temperature just before use 2 IVT ENZYME MIX Paradise Plus E ENHANCER Store at DS MC 10 300 MaD g 7cmw c J Acalytcd Techroboges Anyta obea Figure 5 24 Normal IVT Blue 1 Blue 2 Blue 3 and Yellow E or Analytical Technologies 1 WT WT 3 vT BUFFER AA AMINO ALLYL ENZYME MIX MASTER MIX nasima steve at M ama faos oec dADS teme d ADS crees Andy cad Tach Figure 5 25 Amino Allyl incorporati
94. w sterile RNase free pipette tips and microcentrifuge tubes Work surfaces should cleaned with commercially available RNase decontamination solutions prior to performing reactions Amplified aRNA Contamination Stray amplified aRNA and cDNA in work area can contaminate precious samples if the work area is routinely used for performing amplifications To ensure a work area free of amplified aRNA please do the following 1 2 Irradiate the work area hood with UV overnight every three to four days Clean surfaces and devices pipettors racks centrifuge etc with commercially available decontamination solutions everyday or more frequently depending on use Paradise S User Guide PN 12872 00 Rev C 7 2 1 2 Configurations KIT COMPONENTS Table 2 1 Paradise Plus Kit Configuration with Catalog Numbers Paradise Plus Numbers Description rcturus Paradise PI eactions rcturus Paradise PI xt i iso 6 amp rcturus Paradise PI mplification only rcturus Paradise PI extractions only urus Paradise PI samples rc 24 rcturus Paradise PI slides 24 samples rcturus Paradise PI eactions urus Paradise PI No rc xt iso 6 amp rcturus Paradise P eactions No solvents solvents lus 1 5 Round Bulk 48 KITO301 rcturus Paradise PI eactions rc ab rcturus Paradise PI ab rcturus Paradise PI ab rcturus Paradise PI 6 amp rcturus Paradise PI mp
95. y add 30 uL of RNA Elution Buffer RE directly to the center of the purification column membrane Gently touch the tip of the pipette to the surface of the membrane while dispensing RE to ensure maximum absorption of RE into the membrane Gently tap the purification column to distribute the buffer if necessary Paradise 5 User Guide PN 12872 00 Rev C 49 co 10 11 12 13 Figure 5 29 RNA Elution Buffer Incubate for one minute at room temperature Place each column tube assembly into the 2 mL support tube in the rotor with the 0 5 mL tube cap trailing the tube Centrifuge at 1000 x g for one minute followed immediately by 16 000 x g for one minute Discard the column and retain the elution containing the aRNA Measure the O D of the product at A260 and A so Analyze the aRNA using the Agilent Bioanalyzer or by gel electrophoresis The purified aRNA is ready for use in a labeling reaction with the TURBO microarray labeling kit see Appendix Appendix 1 Application 1 or in a reverse transcription application with the Paradise cDNA kit see related Arcturus reagents or www molecualrdevices com for more information Rotation Figure 5 30 Centrifuge Note To avoid potential breakage of the microcentrifuge tube cap during centrifugation insert the purification tube 0 5 mL tube assembly into a lidless 1 7 2 0 mL tube Insert this assembly into adjacent rotor holes as illustrated Rest the tube cap against the tu
96. ybridizations on cDNA microarrays However such probes are typically not used for oligonucleotide arrays since the targets on such arrays are also generally in the sense orientation Table A 1 Suppliers Reagents Used Maker Catalog RNase AWAY Invitrogen 10328 011 Cy3 labeled dUTP Amersham PA53022 Cy5 labeled dUTP Amersham PA55022 RNAsin Ribonuclease Inhibitor Promega N2515 SuperScript III RT and Buffer Invitrogen 18080 044 Nuclease Free Water Invitrogen 10977 023 Rnase H Invitrogen 18021 071 Random Hexamer Operon custom made QiaQuick PCR Purification Kit Qiagen 28106 Paradise 5 User Guide PN 12872 00 Rev C Protocol 1 A ah OND Take 5 10 ug of amplified aRNA and adjust the volume to 22 uL with nuclease free water Adjust to 22 uL using a vacuum concentrator paying attention to not completely dry down the aRNA sample Add 2 uL of 5 mg ml random hexamer Mix well by flicking then briefly spin down by centrifugation Heat the tube to 70 C for 10 minutes then 4C for 2 minutes in the thermal cycler During incubation prepare the first strand master mix as described below Table A 2 First Strand Master Mix 1x co 10 11 12 13 14 15 16 17 18 19 20 First Strand Buffer 10 uL 0 1 MDTT 5 yl 25 mM dNTP 1 uL 1 mM dUTP Cy3 or Cy5 2yL 1 mM dTTP 2yL RNAsin amp 2 uL Superscript RT 4 uL Total 26 uL

Paradise®Plus Reagent System User Guide

Contents

Download Pdf Manuals

Related Search

Related Contents

Paradise&reg;Plus Reagent System User Guide

Contents

Download Pdf Manuals

Related Search

Related Contents

Paradise®Plus Reagent System User Guide