Home

User Manual 5.0

Contents

1. ADARCS ADARC6 lt ADARCS ADARC4 lt ADARCS 4 ADARC2 Exporting contig summaries When you are displaying the Summary view of a contig see Summary Report View in Chapter 12 Editing Contigs you can export the contents of the report to a text file Go to the File menu and choose Export then the Summary submenu This is particularly useful if you wish to add annotations to a report of your assembly in standard page format SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 163 20 Output In this chapter we discuss printing options We will explain how to set up pages copy pictures print and use different report formats Copy picture Sequencher can copy the images from many of its windows including text windows to a picture on the clipboard Select the window you want copied go to the Edit menu and choose Copy As then click on Picture Print setup Before printing go to the File menu and choose Print Setup to change the options that are specific to your printer Some options that may be available on your printer include portrait or landscape printing vertical or horizontal orientation paper size reduction enlargement or special handling for color printing See Chapter 21 Customizing Sequencher and User Preferences for more information
2. Contig The Contig preferences control the vertical sorting of the fragments when a new contig is created or when fragments are added to an existing contig You can use the Contig Font option to change both the font and the font size This allows you to use fonts other then the default Monaco 9 point font in the contig editor You can see a sample of your current font selection below the font Size drop down menu in the Sample portion of the preference pane SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 178 Figure 21 14 Contig preference settings User Preferences General B Settings Sort New Contigs Auto Save C Don t Sort e by Position ae C by Date C by Size Menu C by Name C by Strand Sound New Project i E Display Contig Font Chromatogram Font Lucida F Contig Chromatogram Feature Motif Size nn ei Format Ruler Sampl e ACGTN Start Stop Variance Table Input Output File Import Report Feature Motif The Feature Motif preferences control the default settings for new features and motifs When you import a sequence from GenBank into Sequencher these settings determine the name and appearance of the feature within both the Overview and Sequencher s editor windows For more information on GenBank Feature tables refer to the Appendix 28 Feature Keys and Qualifiers When you click the Define Feature Key Default Styles
3. seeeeeeeeeeeeeeeeeeeeees 196 28 APPENDIX FEATURE KEYS AND QUALIFIERG ccccccssseeeseeeeees 199 GenBank Feature tables i2 ssc ceisscts cxcsigeacniacets EEN 199 Pe ature table qualitiers 2 25 sts eis acts tal e lee 201 29 APPENDIX DEFAULT FEATURE QUALIFIERS cccccceessseeseseeees 203 30 GLOSSARY ccwceicanicateciucnateucysantvenuubtewspiceneaviuatoauuseiuccnnicaniannostwesnuccaminnnaate 206 xiii 1 Preface Sequencher is the premier DNA software choice for DNA sequence assembly and analysis Its capabilities include Multiple configurable DNA assembly algorithms Comprehensive DNA sequence editing tools Full support of sequence data confidence values Powerful Reference Sequence and Variance Table to find SNPs quickly and easily Restriction Mapping Extensive data import amp export capabilities including customizable GenBank Feature handling Specialized tools for Forensic mtDNA analysis Comprehensive HTML Help throughout Almost 20 years of daily use by biologists in labs around the world have refined Sequencher s tools and interface You get the power and the speed to get the best most accurate results from your DNA analysis and get back into the lab more quickly Gene Codes Gene Codes is a biotechnology oriented software developer whose headquarters are in Ann Arbor Michigan Our goal is to write powerful software tools that are easy to use If you have any suggestions on how to im
4. Base counts are displayed at the bottom of the window If your sequence also includes confidence scores you will also see a base count for each of the three confidence ranges If you use an ABI sequencing system click the Show ABI Info button Sequencher displays a window with information from the ABI data sheet shown in Figure 8 6 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 50 Figure 8 6 ABI data sheet info Chromatogram Info Quality E Quality eight Data Collection File Name gipt12 br3_k38 1512899 ab1 Sample Name k38 1512899 Comment gipt12 br3 15 Lane Number Number Of Pts 11060 Number Of Bases 755 Run Started At Thu Sep 16 2004 7 57 PM Run Stopped At Thu Sep 16 2004 8 53 PM Gel Data File mot availabe Dye Set Primer KB_3730_POP7_BDTv1 mobj Comb Name grot available Instrument Name DORI 1522 005 Collection Vers 2 0 Data Analysis Primer Peak Loc 1264 Base Call Start 1264 Base Call End 11060 Signal G 2326 A1258 T 1114 C 1948 Metrix Filename grot available Channels Awgd 1 Foalysis vers KB 1 1 Base Spacing 13 9044 Selecting Bases Sequencher offers a number of ways to select bases You can choose commands from the Select menu or you can use a keyboard combination To select bases in the opposite orientation press and hold the Shift key when using any Select Next command from the menu or with a keyboard shortcut
5. Although the Selected Columns radio button is checked you can change your selection to include all rows by clicking the Entire Table radio button You can copy your Translated Variance Table into another document or application that accepts tabbed text To copy the contents of your Translated Variance Table Report click on the Copy as Text button The data can now be pasted into its new location SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 121 Exporting data for selected variants Each row in the table represents a variant If you need to export selected rows make your selection by using Shift click for a continuous range or Ctrl click for a discontinuous range see Figure 13 30 Then click on the Reports button The Translated Variance Table Reports dialog box appears The Selected Rows radio button is checked Three buttons are enabled Cancel Copy as Text and Save as Text Save as Text is the default setting Figure 13 30 Translated Variance Table selected variants z Compare Translation to Reference K DR Description 12 consensus sequences compared to Reference 3 exon Reference Comparison Range Unfiltered Base Positions 15394 15644 Amino Acid Positions 1 83 Cee RL E e A 400 SE AAG 15 406 5 15 412 ATG TAT TAT TAT H M Y Y Y E E E E 12 a e SI WT ti C C eM The rows you have selected will be saved in one table Click the Save as Text b
6. Select All Matches Deselect All Matches Select None Done SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 156 Have Names Containing If you want to select all the sequences in the Project Window whose names contain a specific text string go to the Select menu and choose All Items That and then Have Names Containing to display a dialog box Figure 18 9 Figure 18 9 Have Names Containing dialog box All Items Whose Names Contain Find What Case Sensitive 0 items selected out of 8 Select All Matches Deselect All Matches Select None Done Were Edited On Or Since If you want to select all the sequences and contigs in the Project Window that were edited on a specified day go to the Select menu and choose All Items That and then Were Edited On Or Since to display a dialog box You can use the drop down menu to specify a preset day such as today yesterday 1 week ago or even 2 months ago You can also type a date in the Find What box Note You can also include items edited on all the days since a specific date by checking the And All Days Since box SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 157 19 Exporting Data In this chapter you will learn how to export your work This chapter discusses how to export sequences consensuses and contigs and also how to export defined data such as selected bas
7. button a new window also called Define Feature Key Default Styles appears On the left hand side of the window is a pane listing Feature Keys To set new attributes select the appropriate Feature Key On the right hand side you will see a pane where you can set attributes such as the Default name Display style and Color You can restore the default settings at any time by clicking the Restore to Defaults button Click the Done button when you have finished When you click on an item in the left hand Feature Key pane you will see the same text appear in the Default Name box In most instances there will be extra text enclosed in square brackets The enclosed text is the default feature qualifier GenBank have defined several Feature Qualifiers for each Feature Key You can replace the text within the square brackets with your preferred Feature Qualifier For more on Feature Qualifiers see Appendix 28 Feature Keys and Qualifiers and for a listing of Sequencher s default Qualifiers see Appendix 29 Default Feature Qualifiers Note If a Label indicated by label some text is used in a Feature Table it takes precedence over any default keys or qualifiers since it unambiguously identifies a feature or item Click the Display Feature in Editors checkbox if you want a specific feature to be displayed in the sequence or contig editors SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights
8. 1991 2011 Gene Codes Corporation Inc All rights reserved 111 Figure 13 18 Review mode showing Sister Tables Compare Consensus to Reference E D x B ABV EE E E E EE Description 5 consensus sequences compared to reference JE NC_001807a 3 end TGTAGTACATAAAAACCCA CACATCAAACCCCCCccc s sequence NC_001807a 2 end 4E _ABV19999CPrimeriR ITGTAGTACATAAAAACCCA Comparison Range Unfiltered AE _ABV_12251924_PrimertRIITGTAGTACATAAAAACCCA Base Positions 15884 16571 AE _ABV_12261924_PrimertF TG TAGTACATAAAAACCCA 5 frag bases selected at B Chromatograms from ABV _ABV_1999 X_Primer1R Fragment base 16 172 Base 148 of 328 i TAAA AAC C AC nET TETE ES T A d d Compare Translation to Reference E EI KA T i i 8 i VO oi Ak wier ele ec We a ER Se bach EI T Description 5 consensus sequences compared to reference Tai a T T 7 ee sequence NC_001807a 3 end Comparison Range Unfiltered Base Positions 15894 16571 Amino Acid Positions 1 229 ga Y A T ALA A A Lap O T Pn Delt SCH t M 172 L v2 of K C Variance Table Reports The format of each Variance Table report is broadly similar The report starts with a Common Header This header includes the date the project name the type of table Comparison Range base positions and options This is followed by a header containing more pertinent information and finally the body of the report Variance Table Report The Variance Table
9. 1991 2011 Gene Codes Corporation Inc All rights reserved 126 Enabling the protein display To enable the protein display in the summary view go to the View menu and click on Translation You can then choose from the following list of menu sub options Single Stranded Double Stranded Protein First Frame Protein Second Frame Protein Third Frame and Protein All Three Frames To see the protein translations for the opposite strand go the View menu and select Reverse amp Comp Then select the desired option Where the assembly algorithm has inserted a gap in a fragment Sequencher will translate the codon correctly Figure 14 3 Summary Report displaying translation across a sequence gap WE HLA HLAOO 617 CGGACCCCCCCCAAGACACATATGACCCACCACCCCATCTCTGACCATGAGGCCAC AspProProGlndspThrTyraspProProProHisLeuSTPProSTPGlyHis WE HLA HLAOO 617 CGGACCCCCCCCAAGACACATATGACCCACCACCCCATCTCTGACCATGAGGCCAC AspProProGlndspThrTyraspProProProHisLeuSTPProSTPGlyHis E HLA HLAOL 617 cocaB cGCCCCCAAAACGCATATGACTCACCACGCTGTCTCTGACCATGAAGCCAC Asp AlaProLysThrHisMETThrHisHisAlaValSerAspHisGluaAlaThr Protein translations for the Consensus or Reference Sequence This option is context sensitive If you do not have a Reference Sequence or you have selected the Consensus radio button you will be able to show protein translations for the consensus Click on the Consensus check box at the bottom of the Summary Options dialog window If you have a R
10. Fragment Sequences You can choose to hide the fragment sequence by clicking on the Fragment Sequences box This gives you a very compressed report that can be useful when viewing protein translations Figure 14 2 above shows a summary line without the consensus line but with Bullets Pluses and amp Dashes all checked Matching Bases as Dashes Matching Bases As Dashes is a very powerful option when you are interested in any kind of mutation detection When you check this option all the bases that match each other are converted to dashes If you have selected Display Color Bases the dashes will be marked in the color of the original base call If you also go to the View menu and chose Colors as Background each dash will appear embedded in a small color block Bases that disagree are displayed as characters and as such stand out in stark relief With this option you can easily see mutation hot spots or clusters and potential SNPs Protein translations and the Summary Report Sequencher can show protein translations for individual fragments and mark matching amino acids with dashes This helps you see whether a particular discrepancy in an alignment has functional implications or whether it may simply be a silent mutation If you combine options you can turn off the DNA display altogether and just focus on your translations Alternately you can use a mixture of options to tailor the report to your specific needs SEQUENCHER User Manual
11. Gi Polylinker SS Use Vecbase File Name P Polylinker Use Vecbase File If the cloning technique you are using places your insert between two sites replace the vector sequence between the two sites with a single bullet just as your insert replaces this sequence Specifying the insertion site manually If the vector you select in VecBase does not have polylinker information or if you are screening for contamination using a sequence not already in VecBase you must enter the information manually In the Specify Vector Insertion Sites window paste the sequence maximum 250 bases into the polylinker window Insert an asterisk by holding down the Shift key and the 8 key not the one from the number keypad to represent the sequence you wish to retain Saving and loading vector sites You can save manually entered vector information to a file by clicking the Save Sites button You can reload the file in the future by using the Load Sites button This allows you to save your preferences and parameters for a later session SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 37 Setting Vector Trimming Criteria Sequencher has a set of default criteria to facilitate the recognition of any contaminating sequence These criteria are listed in the top region of the Vector Insertion Sites window If these parameters do not work for your specific circumstances you c
12. Id e Ek ln Ee eters e Cancel Note To import traces you must import the actual trace file If you import a text file containing ASCII characters you will not import traces Text files will be only a couple of kilobytes in size whereas trace files will be well over 50 kilobytes Sequencher uses a very efficient algorithm to compress the imported traces This conserves disk space so a project file containing several sequences from an automated sequencer may be smaller than any one of the original trace files Folder of sequences When you have many sequences to import you can import all those files from within a single folder Select the Project Window and go to the File menu and choose Import and Folder Of Sequences from the submenu The standard Browse for Folder dialog box appears select the folder that holds the data you want to import and click OK Use the Include TXT and SEQ files check box to include or exclude these files from your import Sequencher tells you how many files are in the folder and asks whether you want to import them all If you do click Import All Files in Folder Sequencher imports all the files assigning a separate icon to each You can specify that you want files imported into the Project Window or directly into the trim window see Chapter 6 Preparing your Data for Assembly SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 19 Figure 4 2 Browse for
13. Jase Soronia n EREE OOC ERER OCORRE 153 Any Lut Ee E E 153 Finding bases by Number eieiei REES 153 Extend Select Oi eege 153 Other Search options EE 153 Project Window SElECHOM sk weiieccseeastateaccecedsasiaacnescacdewna EE A E R deans 153 Finding a item by E 153 Selecting allat ms thatessi eels aie Ag Ae Aa a aaa hee ae headed ete ages Agi eats elie eked 154 WEE H WEE 155 Contamiliems Named EE 155 Contain Items With Names Containing eresie e E A AAAA EEE AANS 155 Haer store 156 Have Comments Contain g os vt ccssecd sch asct sich ocak sedtascs ced deier iaiaaeaia 156 Have Labels Contamin gis Ae 156 Have Names Contain EE 157 Were Bdited On On Since secs te Meese tacts dees teete ee 157 19 EXPORTING DATA TE 158 Exporting data from Sequencher ios siyi2seiccs cas avdaceende ceacudges lanes Goeaacciaetaavaats osageagustaventuens 158 EX POPU SEENEN 158 PX porting a CONSENSUS age 159 Fern SEELEN 160 Exporting Selection as Subproject 2 ssiiic chcssencicees estes ee EENS 160 Exportselected DEE 161 Egeter eieiei eege REES 161 Ee 161 Exporting protein translations sccis s setieisieazisdccsstieccieagtaigiead teeta EES edel 162 EXport OAS A A TAEAE AAEE E EEE Ee 163 EXpOrtin CO Sa ES a is coal Gest on dele oe gis 163 20s ei n EK EE 164 Copy pIChitGs ta dee Eeer 164 PrintSetup EE 164 Print Trace in One Page ee EE EE 164 Printing imc E 164 Setting header footer and margin Options 0 0 eee cess eseeeeseeeeseeeesee
14. Sep 13 2004 3 46 49 PM E IS_AS_2001 X_Primer2R 392 BPs Auto Seq Frag Mon Sep 13 2004 3 45 40 PM aE IS_AS_2001 X_Primer3F 442 BPs Auto Seq Frag Thu Sep 23 2004 8 19 31 PM AE S_AS_2001 X_Primer4F 414 BPs AutoSeq Frag Thu Sep 23 2004 8 19 31 PM E IS_AS_2001 X_Primer4R 322 BPs Auto Seq Frag Sep 13 2004 3 46 44 PM E IS_AS_2001 X_PrimerSF 226 BPs AutoSeq Frag Sep 23 2004 8 19 31 PM E A_FDR_01301882_Primer1 F 440 BPs AutoSeq Frag Sep 23 2004 8 19 33 PM a A_FDR_01301882_Primer1R 327 BPs AutoSeq Frag Sep 13 2004 3 46 49 PM L A_FDOR_01301882_Primer2R 446 BPs AutoSeq Frag Sep 13 2004 3 46 40 PM You can enable Assemble By Name by clicking on the Assembly Parameters button and checking the Enabled checkbox at the bottom of the window Once you have clicked on the APN button this box will already be checked Setting Assembly Parameters Sequencher uses the values set in the Assembly Parameters window to control the way it assembles sequences Once you have set your required options you can store these as your default Assembly Parameters Click on the Set as Defaults button at the bottom of the window and Sequencher will use your preferred Assembly Parameters whenever it launches If you just click OK to dismiss the Assembly Parameters window Sequencher will use your new parameters only with this project or session of Sequencher Performing an Assembly with Assemble by Name Once you have chosen your Name Delim
15. Td Figure 11 2 Contig overview options dialog box Overview Options Iw Scale Diagram To Window Size Cancel Iw Display Diagram Key Labels Of Fragments Names Of Fragments AtLeft Positions Of Fragments a Ia Start amp Stop Codons Base Numbers At Transitions Base Numbers Every x Bases Condensed Base Numbers 1141 Scale Diagram To Window Size Selecting Scale Diagram To Window Size shrinks the whole overview to fit in the window even if the names of the individual sequences become unreadable When you turn this option off you make the names of the sequences readable but you may have to scroll the window to see all the sequences in the diagram Diagram Key Clicking this checkbox displays or hides a key that explains the Overview Labels Of Fragments You must have already defined and applied some labels to your sequences with User Preferences see Chapter 21 Customizing Sequencher and User Preferences and the Label command Clicking Labels of Fragments will display or hide any fragment label names Names Of Fragments Clicking this checkbox displays or hides the sequence names in the Overview You may have this and the previous item checked at the same time Names Of Fragments At Left Clicking the At Left box in conjunction with Names of Fragments lists the fragment names down the left side of the window instead of on top of each arrow as shown in Figure 11 3 If for example the sequences are al
16. The Assemble Interactively window provides you with detailed information regarding overlap mismatch and gapping for any given sequence and a set of candidate sequences The candidate assemblies are driven by your user defined assembly parameter settings Performing an interactive assembly Bring the Project Window to the front and select the items you want to assemble Click on the Assemble Interactively button at the top of the Project Window or go to the Contig menu and choose Assemble Contigs and then Interactively from the submenu Sequencher displays the Assemble Interactively dialog box shown in Figure 9 4 The sequences and contigs you selected are displayed in the Candidates list The panel on the right showing a face in the upper left corner is called the agent It displays information about the comparisons you have requested In the center is the Matches panel which displays the possible matches For each match in the panel Sequencher lists the Match the approximate number of Overlap bases the number of Mismatch bases the number of Gaps and the New Contig Length The top line shows the Candidate sequence and the line below this shows the Match sequence Below these two lines is the consensus sequence There is a small button to the right of the consensus labeled with a black circle If you click repeatedly on this button you can display the first second third reading frame or all three reading frames at once The label
17. To select a discontinuous list of sequences hold down the Control key while clicking on the sequences Go to the Edit menu and choose the Remove From Table command Note This does not remove sequences from the underlying contig You can then export the remaining data as normal To export all the data in the table click on the Reports button The Variance Table Reports dialog box appears A radio button called Entire Table will be checked Below that you will see a drop down menu called Report Format Choose either Variance Table Report or Individual Variance Table Reports If you choose Variance Table Sequencher will generate a single table If you choose Individual Variance Table Reports each sample will appear in a separate report There are four buttons below the Report Format drop down menu Cancel Reports Copy as Text and Save as Text Save as Text is the default setting If you click on the Save as Text button Sequencher presents you with a dialog to assign the name and location of your export The report is saved in a tabbed text format Note You can select and then remove columns from your table using the Remove From Table command before you export your data Exporting selected sample sequences Each column in the table represents a sequence or consensus If you need to export specific columns in the table make your selection by using Shift click for a continuous range or Ctrl click for a discontinuous range see Figure
18. amp Name Menu Sound New Project Display Chromatogram Contig Chromatogram Contig Feature Motif Format Ruler Start Stop Variance Table Input Output File Import Report Confidence Ranges Wen Low Medium High Specify values to set the confidence ranges Sequencher combines the medium and high ranges to calculate your Quality SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 173 Label amp Name The Label amp Name preferences control the labels and descriptions used to mark sequences and contigs Use the boxes grouped under Available Labels to choose label colors use the pull down color menus at the left of the label name and descriptions for marking individual sequences Once you have set your preferences here you can apply them to sequences contigs and refrigerators while you are working in a project by selecting the icon s in the Project Window Go to the Edit menu and choose the Label submenu Under the Default Names section of the Label amp Name pane you can enter default names for the new contigs and fragments A bracketed asterisk tells Sequencher to add a number to the name and increase it for each new contig or fragment you add to the project Figure 21 7 Label and name preference settings User Preferences General Settings Available Labels Ato Save MEI Confidence Label 2 Label amp Nam
19. fields Changing the selected enzyme You can also bring up the dialog by clicking the Select Enzymes button in the button bar of any cut map Alternately you can go to the Window menu and choose Specify Restriction Enzymes The enzyme editor dialog box is shown in Figure 16 7 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 140 Figure 16 7 Restriction enzyme editor Restriction Enzymes Load Enzymes Enzyme Name Recognition Sequence Saci Effect of NaCl Concentration gt 30 active 10 30 active lt 10 active J J d Not specified a Om 50mhM 100mM 150m Cancel Available enzymes appear in the scrolling list on the left side of the window To view information about a particular enzyme click on its name Sequencher highlights the enzyme and puts the appropriate information in the Enzyme Name and Recognition Sequence fields If an enzyme is currently selected for display in the map the square to the left of the name is filled with an x An enzyme not selected for the map has an empty square When you move the cursor to the checkbox column it changes to a check mark To change your map selections click the checkmarks to toggle them on or off Figure 16 8 shows the list in detail SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 141 Figure 16 8 Checkmarked enzyme list Select All v If you are inte
20. go to the Select menu and choose Bases by Number A dialog box lets you enter the range of bases you want to highlight Extend Selection You can extend the current selection to the beginning or end of your sequence by going to the Select menu and choosing Extend Selection Then choose the suboption to Left End or To Right End Note In a contig chromatogram the Extend Selection command can extend your selection across the entire sequence in one click Other search options You can also search for ambiguous bases by going to the Select menu and using the Next Ambiguous Base command You can search for edited bases using the Next Edited Base option These are described in more detail in Chapter 8 The Sequence Editor You can also search for potential open reading frames using the Next Met to Stop gt 0b option This is described in more detail in Chapter 21 Customizing Sequencher and User Preferences Project Window selection Finding an item by name To locate a specific sequence or contig select the Project Window Type the name of the item you are trying to find for example Sequence C As you type Sequencher starts looking in the Project Window for an icon with the name you are typing and highlights a match If it finds more than one it highlights the first one SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 153 Note If you pause between characters for more th
21. in the consensus line Therefore if you delete gaps from the consensus this will not affect the Reference Sequence unless it also has gaps at the position of the deleted bases SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 43 For example you can delete a range of bases from all fragments by selecting a range within the Consensus sequence When the deleted bases are in the middle of a fragment they will be replaced with gaps to maintain the alignment with the Reference Sequence Since the action cannot be reverted using the Undo command you must use the Revert to Experimental Data command from the Sequence menu to recover Fill Coverage Gaps with Reference Under normal circumstances the Reference Sequence does not contribute to the calculation of the consensus However there is a special instance where the only data available in a particular region may be the data in the Reference Sequence This might happen if you have aligned cDNAs to a genomic reference The command Fill Coverage Gaps with Reference from the Contig menu will allow you to fill the gap with bases from the Reference Sequence The bases from the Reference Sequence are dropped into the consensus line but only in those places where there is no other data Figure 7 4 Figure 7 4 Filling gaps with the Reference Sequence B Fill Gaps OX P Ultanan 20 303 bases Contains D ambiguities 0 gaps amp 0 edits Select Next Ambi
22. or handle1_handle2_handle3 However a Name Delimiter can also be a combination of letters numbers and characters To define your Name Delimiter Sequencher provides a set of commonly used characters as a drop down menu in the Assemble by Name Settings dialog You will see this menu if you go to Assembly Parameters and click on the Name Settings button When your naming convention does not use simple characters as Name Delimiters you can use formal descriptors known as regular expressions instead which we describe later in this chapter Once you have defined an Assembly Handle you will be able to assemble all of the sequences in your project Only sequences that share the same Assembly Handle will be analyzed for assembly into the same contig In a clinical application for example several contigs might be created with each contig representing sequence data from only a single patient provided that each sample patient has a unique Assembly Handle in its name Setting the Assemble by Name Conditions Configuring Assembly Handles using a Single Delimiter Starting in the Project Window click on the Assembly Parameters button At the bottom of the Assembly Parameters window click on the Name Settings button The Assemble by Name Settings window appears in Figure 10 1 below Figure 10 1 Assemble by Names Settings window Assemble by Name Settings Name Delimiters _ Underscore EI Assembly Handles e 1 Date C 2 Clon
23. slider To set the minimum number of bases that must overlap use the Minimum Overlap slider SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 60 Figure 9 2 The Clean Data algorithm with Maximum Loop Out Size shown Assembly Algorithm Dirty Data e Clean Data C Large Gap The clean data algorithm is FASTER than the dirty data algorithm Unknown base calls are considered matches to anything Maximum Loop Out Size 2 H Assembling with Large Gap The Large Gap algorithm is specifically for data that has or might have large insertions or gaps This might include data from evolutionary studies different organisms or comparing cDNA to genomic DNA When you select the Large Gap algorithm there are two sliders for changing minimum match values To set the proportion of bases that have to match use the Minimum Match Percentage slider To set the minimum number of bases that must overlap use the Minimum Overlap slider Not e Assemble to Reference cannot be used with the Large Gap algorithm Assemble By Name You can enable Assemble By Name by clicking in the checkbox called Enabled Click the Names Settings button Choose your delimiter from the Name Delimiters drop down menu Then type names for the Assembly Handles into the fields in the Assembly Handles pane To activate an Assembly Handle click the adjacent radio button When you are done click the OK button You will notice that the drop d
24. 2011 Gene Codes Corporation Inc All rights reserved 51 Figure 8 7 ORF selected by Next Met to Stop command E Quality four D Par ES RT RR Espen Residue 88 to 192 D Low Confidence 0 0 0 Ambiguous 0 0 NNN NNN NNN NCT CTC GNN NCG GGT CCT GGT GAA TGC CTG GAA ATC AAA GAN NAN CCA TGG GGT TCT ra CCC GC G TTi T G TCA CAG AGC GGC GCG GTT GGT GCC GCG GCG GCG TGC TGA CGA CTA GCT GCG GTA ATA CCC TCA CAT Sequence features Looking at codon maps Click the Codon Map button located in the button bar at the top of the Sequence Editor or go to the View menu and choose Display Codon Map The three outlined bars at the top of the editor window represent the three forward frames of translation Each green flag sticking partially into the top of a frame marks the position of a start codon while each red line cutting through the frame and extending below marks the position of a stop codon Clicking between any two markers highlights that section of the sequence Figure 8 8 Sequence Editor with codon map button selected B Quality four D Fra Pn GES RTR RSR Sow Cronaozon Residue 1 Sequenced Strand Sequence Length 794 Frame 1 7 me Frame 2 7 s NNN NNN GGN NNN NNN NCT CTC CTG GNN NCG GGT CGA GTT CCT GGT GAA TGC CTG GAA ATC AAA GAN NAN ACC CCA TGG GGT TCT CAT ATG ACA CCC GCT GTT TTG ACT CAA CGG TCA CCG AGA GTG ATA TCC GTG TTG AGG AGT CAA TTT ACC AAT GTT GTG ACT TGG CCC CCG AAG CCA GA
25. 3 but you can change this using the Complement check box Use the Display Style pull down menu Figure 17 6 to specify strand type color case and underlining You may select one attribute from each of the four style categories When you have finished entering or editing your features click Done If you have chosen a GenBank Feature Key Sequencher will insert a default name in the Feature Name field using the Feature Key and Feature Qualifier You may edit this if you wish Enter the starting and ending base numbers for the feature in the Feature Location boxes The default strand is 5 gt 3 but you can change this using the Complement check box Use the Display Style pull down menu Figure 17 6 to specify strand type color case and underlining You may select one attribute from each of the four style categories When you have finished entering or editing your features click Done Check the Display Feature in Editors checkbox and then go to the View menu and click on Display Features to have your feature appear in the sequence or contig editor and the associated overviews When you set a feature to include Protein or DNA RNA this will only be displayed in appropriate views SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 148 Figure 17 6 The display style menu Features from Feature Display Style Feature Key Sequencher sl Feature Name New Feature Ne
26. 821 BPs 550 BPs Ref Contig of 3 Refrigerator Ref Contig of 3 Ref Contig of 3 Auto Seq Frag ABI Fer ON Fragment Auto Seq Frag ABI Ref Contig of 3 Ref Contig of 3 AutoSeq Frag ABI AutoSeq Frag ABI AutoSeq Frag ABI AutoSeq Frag ABI Ref DNA Fragment Fri Mar 24 2006 2 02 14 PM Fri Mar 24 2006 1 59 39 PM Fri Mar 24 2006 1 58 59 PM Fri Mar 24 2006 1 58 59 PM Fri Dec 16 2005 4 06 10 PM Tue Dee 13 2005 4 39 43 PM Fri Dec 16 2005 4 06 10 PM Fri Mar 24 2006 1 58 59 PM Fri Mar 24 2006 1 58 59 PM Fri Dec 16 2006 4 06 11 PM Fri Dec 16 2005 4 06 11 PM Fri Dec 16 2006 4 06 10 PM Fri Dec 16 2005 4 06 10 PM Tue Dec 13 2005 4 39 43 DM Has SNPS that need to a accessing Help then the Project Window context page will appear This will be the case for most of Sequencher s major windows If you see a flagged icon this means you can click on a link to get further information If you place the cursor over this icon a Tool Tip with the title of the Help article will be displayed The button bar The button bar contains buttons for frequently used commands It appears just below the top of many windows see Figure 2 2 Figure 2 2 The Project Window button bar D Assembly Parameters Assemble Automatically Assemble Interactively Assemble to Reference On many Sequencher windows you can use the smaller left hand button which has an up arrow on it to hide the button bar Click on the but
27. Agent Describes current selection and the current status of the spacebar shortcut D Splitter bar Controls the width of list message area and the editing area dragging the splitter bar to the left or right changes the size SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 81 Label Name Function of these items E Sequence Displays the sequence bases aligned Bases F Sequence Scrolls up and down through the sequence bases in the Scroll contig G Base Shows which bases you are viewing numbered from the Numbers beginning of the contig H Consensus Shows the calculated consensus of the sequences that were line aligned to form this contig l Ambiguities Displays a plus below any ambiguous base calls in the contig line and a bullet below any base calls with disagreeing bases above them This area also displays protein translations with a bullet J Base Scroll Scroll left and right through the bases of the contig K Translation This button toggles the display of protein translations on and Button off Five options are available Frames 1 2 or 3 all three reading frames or In Frame with the Reference Sequence L Notation Displays translation of Reference Sequence and user text Line notes M Reference This button toggles the display of the Reference Sequence Translation translation on and off Toggle Viewing sequence names If the names of your sequences are very long you
28. Figure 21 19 File import preference settings User Preferences General Settings E 2 Puto Save E Confidence Review Trim Parameters bel amp N See ER Add Imported Sequences to Trim Window Sound Alllmported Sequences New Project e OF Sie ep All That Have Less Than 1500 Bases Gorki See All That Have a Chromatogram Contig IT All That Have Unknown Bases Feature Matt Format Ruler Import Options Start Stop Prefer File Names to Data Names Variance Table Input Output File Import Report The Report preferences command controls the default page setup for report printouts Use the fields in the Page Margins box to set the margins and gutter Click Page Setup to open the printer page setup dialog box The page setup settings will apply to all windows you open thereafter Figure 21 20 Report margin preference settings User Preferences General g S Settings Page Margins Futo Save Left os in Top 0 5 in Kette ar 0 5in Bottom 0 5 in Label amp Name k en Gutter 0 5 in Sound New Project Sequenchentm Project Name Display Enter your default header and footer Chromatogram into the fields above and below lo EEN Fay of the following bracketed strings Feature Matt included in the header or footer will be Format Ruler replaced with the requested Start Stop information Page Total Pages Mime Date Project Name amp User Variance
29. Finding Ambiguous Bases One of the most frequently executed commands is Next Ambiguous Base under the Select menu You can use this command in the Sequence Editor or the contig editor By using this command in the consensus sequence of a contig Sequencher will display the next position in your contig that contains an ambiguity or disagreement The shortcut for this command is Ctrl N for more on keyboard shortcuts see Appendix 23 Keyboard shortcuts If you use the Shift key with this key combination you will go back to the previous disagreement Once you have used any of the Select Next commands Sequencher will activate the space bar to execute that operation If you use either the menu command or the shortcut key combination two consecutive times Sequencher will remind you that this easier alternative is available Finding Open Reading Frames ORF Choose Next Met to Stop gt 0b to highlight the next pair of start and stop codons in one of the three forward reading frames The number of bases shown in this command depends on whether you specified a preference for a minimum length in the User Preferences For instructions on how to set a specified minimum length for open reading frames see Chapter 21 Customizing Sequencher and User Preferences If you set preferences to highlight ORFs only when they are of some minimum length the menu command will display the number of bases you specified SEQUENCHER User Manual 1991
30. Folder dialog box Browse For Folder Select Folder Location Include TXT and SEQ files O Gene Codes B O Sequencher 4 6 Sample Data E Mitochondrial Sequence Sample Fragments O T G Sample Data oma Folder ADARC Projects in specific formats Sequencher supports importing projects as ACE projects GCG contigs and as CAF projects The contents of these files include confidence values feature annotation and assembly information Select the Project Window and go to the File menu and choose Import and then choose the specific project format from the submenu The standard Open dialog box appears select the folder that holds the data you want to import and click Choose Read more about importing confidence values in the section Importing Confidence Scores later in this chapter Sequencher projects At times you may want to merge two projects or combine your own work with that of a colleague To combine Sequencher projects first open one of the projects Go to the File menu and choose Import and then Sequencher Project from the submenu Select your other project and click the Open button Sequencher displays all the imported projects in the initial Project Window retaining all comments edits and even the relative positions of the icons To keep track of which sequences came from which project you may want to establish a naming convention for sequences before combining them Since the importe
31. Gutter fo in Foy of the following bracketed strings included in the header or footer will be replaced with the requested information Page Total Pages Time Date Project Name amp User Name Cancel Report formats Special report formats are used for printing the contents of the contig editor Specify the report format you want by clicking the Report Manual or Poster radio buttons from the Style pane of the Set Header amp Footer dialog box Sequencher then adjusts the report accordingly The Report option is for reports printed on single sided pieces of paper that need to be displayed one page at a time Each page is fully labeled The Manual option is for two sided printouts when the user can look at a left and a right page simultaneously Only the left hand page of each pair will have all the labels for each sequence printed in a report the right page uses the additional space for more data The Poster option is for displaying all your data together It minimizes the amount of labeling and assumes that the entire report is to be laid out as one big rectangle for paste up and display Page breaks Page breaks which are shown on screen as in Figure 20 2 appear in the Sequence Editor and in the Summary Report view of a contig SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 165 Figure 20 2 A page break in the Summary report 213 tgCGCCGCTACAGGGCGCGTCCATTC
32. Next Commands cere ceaiac a teh A A dues atbsues Dt lesyat aden sbesavapal AAA A 133 Editing b ses froni traces sereine iii aes A das A A EE lt eb OAE ag 134 Reverting to experimental data ee NEEN ee 134 Reverting assembled sequences back to experimental data s ssssessssssesssssestststseseerestststsrsrsrsrsesresesestsese 135 Adjusting trace POSITIONS tee Ee ENNEN EE 136 16 RESTRICTION MAPS iieiinsssicssneusreseneratenseensineenncensinmndieninnainninnnsiindauniitias 137 Displaying a Restriction Map 2 ntentecustiahdedtiatedastieducadhantedwetewuuuackundydn 137 Restriction Map display Optom lt aiccsivesssdsccc dec esdpucslancededesaes saysensaeicescouaesasate Gewese boone 137 How to select EE 137 How to show cut positions or fragment satzeg eee escseeseeseeeseeeeseseeseseeseeeesesscseeseseeseecseeaeseeaesetaeseeas 138 How fo settheimap style eege 138 Setting the map Widths ee EEN 139 Setting the map Capon EE 139 Getting more information about an CNZYME ou cesses eseeeeseeseseeseseeseeeesceecseeecsecacseeseseeseacseeesseeaeeeaeeeeas 140 Changing the s lect d enzyme eege 140 Changing the default enzy mesic nerone nna AROE AER ARAA OO ORROA R RRRA 142 Adding and editing EE 142 Changing the recognition sequence 00 eee eesceeseeseteeseeeseeeseescsseseseeaesecsesecseaesesacseeaeseeseacseeasseeaeseeaeeeeas 143 Salt concentration CLICCIS ege 143 Saving new or modified enzwvmes eee ese eeeseeeeseeseseeseseeseseeseeeseeecseeacseeseseesee
33. Red 2 gene 3 misc_signal a promoter 1 CAAT_signal 2 TATA_signal 3 35_ signal 4 10_signal 5 GC_signal b RBS c polyA_ signal d enhancer e attenuator SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 196 Feature Display Color Style Second Strand f terminator g rep_origin h oriT 4 misc_RNA a prim_transcript 1 precursor_RNA a mRNA f exon y Blue g CDS y Blue Protein 1 sig_peptide 2 transit_peptide 3 mat_peptide h intron y Cyan Invert case i polyA_site j rRNA k tRNA 1 sCRNA m snRNA n snoRNA 5 Immunogobulin related a C_region b D_segment c J_segment d N_region e S_region f V_region g V_segment 6 repeat_region a repeat_unit b LTR c satellite d transposon 7 misc_binding primer_bind protein_bind STS primer a b c d 8 misc_recomb a iDNA SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 197 Feature Display Color Style Second Strand 9 misc_ structure a stem_loop b D loop 10 gap 11 operon 12 source Unrecognized Note The Unrecognized key is at the same level at misc_feature SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 198 28 Appendix Feature Keys and Qua
34. Report consists of three parts the Common Header the Variance Table and the Comparison Range Coverage table This table lists the name of each sequence the type of coverage complete or incomplete and the range of bases in the comparison see Figure 13 19 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 112 Figure 13 19 Extract from Variance Table Report Ah Variance Table Report Date July 12 2007 Project Name 1 exon HPS4 Tutorial Compare Consensus to Reference 3 exon Reference 30 end 50 end Comparison Range Unfiltered Base Positions 15 394 to 15 644 Options Large gap insertions 10 or more bases excluded Matches to ambiguous reference positions excluded Reference 128 152 Total 15 576 15 517 15 401 1 15 400 15 395 15 394 15 612 15 403 15 624 15 615 Total BO N AALALA A a Hj r ml al u b i wl wl wlw DI N Sequence Name Comparison Range Coverage 128 Complete 15 394 to 15 644 152 Complete 15 394 to 15 644 Individual Variance Reports You can create a separate report for each sample in the table The Individual Variance Report lists the variants in a single column This table is followed by the Comparison Range Coverage table which lists the name of each sequence whether coverage is complete or incomplete and the range of bases in the comparison see Figure 13 20 Figure
35. The Project Window then displays the sequences and contigs as shown in Figure 3 4 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 10 Figure 3 4 Project Window with Large Icons Untitled Project SEE D Assembly Parameters Assemble Automatically E Assemble Interactively f Assemble to Reference Parameters Dirty Data With ReAligner 3 gap placement Min Overlap 20 Min Match 85 ZS ef e e ef Quality eight Quality Quality Quality Quality two Quality five Quality nine peer seven Quality three Note A new project defaults to the icon view unless you previously specified a different view View as Small Icons To fit more information onto the screen you can view project items as smaller icons Go to the View menu and choose Project Icons As and then choose Small Icons from the submenu The Project Window then displays the sequences and contigs as shown in Figure 3 5 Figure 3 5 Project Window with Small Icons Untitled Project DER Assembly Parameters Assemble Automatically Assemble Interactively Assemble to Reference Parameters Dirty Data With ReAligner 3 gap placement Min Overlap 20 Min Match 85 AE Quality eight aE Quality four AE Quality one aE Quality six AE Quality two AE Quality five E Quality nine AE Quality seven aE Quality three Moving icons To reposition a sequence or contig icon click the icon and drag it
36. User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 114 Comparison Range coverage This report consists of two types of tables a Population Table and individual Detail Tables The Population Table lists the variants in each population group It displays information on the number of samples which contain each variant base as well as the total number of samples in each population group Each population group is given a name based alphabetically on the first member of the group see Figure 13 22 The Detail Table includes information on the frequency of the population group and the location of the variants with reference to the exemplar It also lists the names of the contributing samples Figure 13 22 Extract from a Population Report Participating Data 5 population groups consisting of 5 samples Nonparticipating Data 0 samples dropped from the report due to incomplete comparison range coverage Populations Reference 116 128 150 152 156 Total Samples 15 576 G PLELT UTI IS 15 517 A GiG iG GjG js 15 401 1 Li TIT TIT YIS 15 400 TIAJTAITATA IA IS 15 395 G Cle tcic ic is 15394 T Afa JaA fafa IS 15 612 G w RIRI3 15 403 E S S 2 15 624 G R 1 15 615 G 1 Total Samples 1 1 1 1 1 116 Like Frequency 20 00 Variants 7 15576 T 15517 G 15401 1 T 15400 A 15395 C 15394 A 15403 S Samples 1 116 Working with Vari
37. anar Fragment base 16 is selected Base 16 of 727 Editing modes The Edit command allows you to replace overstrike insert or erase a base call The specific option you choose from the Edit menu will create that behavior When you use Replace When Editing the base you have just edited will remain highlighted When you use Overstrike When Editing the cursor will move one base to the right and this base will then be highlighted Insert When Editing allows you to insert bases before the currently selected base pushing all of the following bases forward This also allows you to add bases beyond the end of a sequence Sequencher uses Replace When Editing as its default setting Note If you insert or delete a base from any one sequence the sequence may no longer align with other sequences after the point where you made your change The consensus line will reflect this by showing lots of ambiguities in the form of bullets e If you have made only one change go to the Edit menu and the Undo command will remove it Viewing Base Edits To assess the quality of your data you need to be able to see how much modification has already been done to your contig as you edit it When a base is edited Sequencher changes its appearance by displaying it in magenta and bold faced text If you want edits to stand out even more for instance in a black and white printout you can also invert the case of the characters e g change all edits from
38. and choose View Options A dialog box Figure 16 2 lets you change several attributes of the restriction map SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 137 Figure 16 2 Restriction map options Restriction Map Options Cutters r Show Iw Unique Cutters Iw 2 Cutters C Fragment Sizes Iw 3 Cutters Ze Cut Positions Iw 4 amp More Style wh Single Line Inches 12 Se 7 Multiple Lines C Text l Scale to window J L Iw List enzyme names at bottom of map Cancel Use the Cutters checkboxes to display enzymes according to the number of times they would cut For example you could select just 2 Cutters that is only those enzymes that cut in two locations If you select the All button this turns on all of the checkboxes simultaneously How to show cut positions or fragment sizes Use the Show options to choose the Fragment Sizes display or the Cut Positions display by clicking on one of the radio buttons How to set the map style Use a radio button from the Style pane to choose one of the three basic map styles The Single Line map is the default display Choose Multiple Line map Figure 16 3 if you want to show each enzyme on its own line Figure 16 3 Multiple line restriction map KT C Apal 2 f E HA Drall 5 ES Kpal 1 PstI 2 SacI 2 e 234 k E Sacll 4 f ES Xmalll 1 M
39. between the exemplar sequence and your chosen sequence s The results may be from just one contig but can represent an assembly of hundreds or even thousands of sequences If you are performing activities such as de novo sequencing clone checking or resequencing you may want to use this form of the Variance Table The Variance Table and consensus sequences You can also create a Variance Table that summarizes all of the differences between selected contig consensus sequences see Figure 13 1 below in your project and a common Reference Sequence consensus Variance Table When you are working with multiple samples from multiple sources and have used Assemble by Name with a Reference Sequence you should use this Variance Table If you are performing activities such as comparative sequencing clone checking or SNP analysis you probably want to use this form of the Variance Table SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 94 The Translated Variance Table If you are interested in focusing on the differences between sequences or contigs at the amino acid level you should use the Translated Variance Table This table differs from the Variance Table by displaying both codons and their associated amino acid residues Each row in the Translated Variance Table summarizes the variations among all of the selected sequence translations at a given amino acid position relative to the exemplar You can als
40. button to dismiss the Assembly Parameters window Assembly Algorithms To choose which assembly algorithm you want to use click on the Assembly Parameters button on the Project Window and then click on one of the three radio buttons at the top of the window Your choice will depend on your data SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 59 For instance if you click the Clean Data radio button contig assembly is faster but Sequencher may miss some possible matches if the ends of your sequences contain a large number of ambiguities For best performance make sure that you have trimmed poor quality data from your sequences The Dirty Data algorithm is somewhat slower because Sequencher is performing more rigorous comparisons between the sequences You should note that automated sequencers create dirty data and Sequencher s algorithm is optimized to deal with that The Large Gap algorithm allows you to assemble sequences that are expected to contain insertions and deletions gaps greater than 10 bases long Such gaps are typically found in evolutionary studies and sequence comparisons from different organisms The Large Gap algorithm is similar to and slower than the dirty data algorithm but allows larger gaps to occur when performing the assembly Typical examples of assemblies that require the Large Gap algorithm include the comparisons of a cDNA sequence to a genomic sequence and the assembl
41. by the smallest category of ambiguity that covers all available data In the example in Figure 11 7 a column with one sequence containing a G and the other containing a C is shown in the consensus line as an S the IUPAC code for C or G This consensus is particularly useful in any work involving mutations Figure 11 7 Consensus Inclusively example CCCCATGGGGTTCTCATATGAC CCCCAT GGGGTTCTCATATGAC CCCCAT GGGGTTCTCATATGAC CCCCATGGGCTTCTCATAT GAC 670 CCCCATGGGSTTCTCATAT GAC Consensus By Plurality Consensus By Plurality is Sequencher s default setting With this consensus calculation Sequencher determines the consensus line bases by majority rule If there is no clear majority Sequencher chooses the smallest category that fits the available data In the example in Figure 11 8 below a column with two sequences that contains a T and an A is still shown in the consensus line as a W because there is no clear majority However a column with three sequences that contains a gap in one sequence is shown in the consensus line as an ambiguity code in the consensus line only if the other two sequences do not agree Figure 11 8 Consensus by Plurality example CACCCGCTGTTTTG CACCCGCTGTTTTGACA CACCCGCTGTTTTGACTCAACGGTCA CACCCGCTGTTTTGA CAACGGACA 710 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 83 Consensus to Forensic Standards In certain applications such as forensic mtDNA sequen
42. cancel the operation simply press the Cancel button Chromatograms occupy a lot of memory but Sequencher uses a very efficient algorithm to compress trace data However we suggest that you only duplicate the text if you don t need the chromatograms See Chapter 15 Chromatograms for more information Reverse and Complement The data you bring into Sequencher may not necessarily be in a particular biologically relevant orientation To change the orientation of the sequence go to View and choose Reverse amp Comp Sequenced Strand To display the original orientation go to the View menu and choose Sequenced Strand Note You will always have two copies of your data in Sequencher the original data and the edited version This duplication allows you to revert to the original data as discussed in more detail below About experimental data Creating a baseline Sequencher notes the original base sequence when you import your data so that after editing the sequence you can still discard all of your edits and revert to the baseline experimental data You can also do this for sequences that you enter from the keyboard When you close a Sequence Editor that has not had its data recorded as experimental data the program explicitly asks whether the contents of the Sequence Editor should be recorded as experimental data see Figure 8 4 Click on Record As Experimental Data if you are finished editing the sequence If you are not finished
43. click the Not Yet Finished button Figure 8 4 The Record as Experimental Data dialog box Sequencher i Are you finished entering Frag 0001 from the keyboard If you are LD finished this sequence of bases will be recorded as experimentally determined data Record As Experimental Data SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 48 Note When a sequence becomes part of a contig the data are automatically recorded as experimental data if they have not previously been stored in that form Once a version of the sequence has been recorded as experimental data all future changes are considered to be edits to it As a data quality tool all such edits can be marked in color and displayed in Bold Magenta or lower case text This feature is invoked in the View menu under the Base Edits As command The default is set to Bold Magenta but you can also choose Not Highlighted or bOLD amp cASE cHANGE Resetting a baseline If you decide that some of the original data was incorrect perhaps a simple typing error that has been corrected in the edited version of the sequence go to the Experimental Data version of the sequence by clicking the Show Experimental button and then click the New Baseline button Note Setting a new baseline for a sequence resets all of the bases to a not yet edited state None of the bases that were edited will appear in Bold Magenta letters Viewin
44. click the OK button SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 149 If you create a feature while selecting bases in the consensus of a contig you will actually create a feature for each of the sequences that contribute to the consensus at the selected bases Note If a fragment spans only a portion of the bases selected for a feature that fragment will not carry the new feature If you do not define display properties the display attributes will default to the ones you specified in the Feature Motif section of the User Preference settings See Chapter 21 Customizing Sequencher and User Preferences for more information Figure 17 7 The Mark Selection As Feature dialog box Mark Selection As Feature Feature Key variation Feature Name variation Feature Color ME Feature Style Invert Case V Underline Display C Complement e Single Strand Only Protein RNA Translation To alter default styles go to the Feature Mot panel in user preferences Cancel Showing and hiding features Go to the View menu and use Display Features to toggle feature display on and off For each individual feature you must also enable or disable its display in User Preferences See Chapter 21 Customizing Sequencher and User Preferences for more information Listing a sequence s features If you want to get a complete list of all your sequence s fea
45. features Use the Edit Features command to create a series of features which share the same name followed by a bracketed number CDS 01 CDS 02 see Figure 13 13 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 104 Figure 13 13 Creating a Joined feature Features from Reference Feature Key CDS Feature Name CDS 02 CDS 01 v Display Feature in Editors Feature Location 376 570 Which strand Complement Display Style v St Remove To alter default styles go to the Feature Motif panel in user preferences Setting the Variance Table Display Options Throughout Sequencher you can customize the display of your sequences using the commands from the View menu When creating a Variance Table you can also specify a number of display options see Table 13 1 Table 13 1 View Options Translated Translated Variance consensus Table Variance Table Variance consensus Table Variance Table Base Ambiguities Base Edits Display Color Bases Display Motifs Colors As Backgrounds Display Base Confidences Labels m Im Je Je ys In In In S O e Ir e Ir Features me me Im me O EELER mm Is Is Im To highlight variants in your data go to the View menu and click on Display Base Confidences This will add a background color to the cells in your Variance Table to SEQUENCHER User Manual 1991 2011 Gene Codes Co
46. found Assemble Interactively Candidates Matches Watch Overlap Mismatch Gaps Hew Contig Len Assembly Parameters HLA HLAO0002 Alert Jl Sory nothing matches the selected candidate within the HLA HLAODOOS parameters currently set HLA HLAO0009 HLAHLAO0010 i R HLAHLA00011 HLA HLAO0012 ATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTACTCTCGGGGGCCCTGGCCCTGACCY 46 Candidate EE 1 10 20 30 40 50 6 When you click a possible match in the Matches list Sequencher recalculates the optimal positioning for gaps The agent then displays a message about the selected sequences and their computed overlap SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 65 The start of an overlap and the base consensus appear in the fields at the bottom of the interactive assembly box Figure 9 7 You can explore the alignment further by moving the scroll bar to the right Figure 9 7 Interactive Assembly window showing overlap Assemble Interactively Candidates Matches Overlap Mismatch Gaps New Contig Len HLA HLAOO001 HLA HLAO0004 HLAcHLAODOD2 HLA HLAO0002 HLA HLAD0004 HLA HLAO0009 iJ Overlap of 1098 bases HLA HLAOD00S HLA HLAO0018 49 bases mismatch HLA HLAO000S HLA HLAOOD17 Inserted 0 Gaps HLA HLAO0008 HLA HLAO0005 9553 of Overlap matches Contig Length of 1098 bases HLA HLAO0010 HLA HLAO000S HL HLAO0011 HL cHLA00016 HLA HLAOOD12 HLA HLAOOD 12 AT GGCCGT CAT GGCGCCCCGAACCO
47. report is a text box that automatically displays pertinent warnings In the report shown in Figure 22 1 the two mtDNA profiles disagree The bases in conflict are highlighted in yellow Also there are positions where there is data for one mtDNA profile but not for the other The base position is distinguished by a yellow highlight and the cell with the missing data has a pink X though it The cells are unshaded where the two profiles both agree and confirm each other SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 184 Figure 22 1 The Validate mtDNA Profiles window S Validate mtDNA Profiles 9 07 07 16 26 PM Export CME mtDNA Profiles Disagree Reference Profile 1 Profile 2 HV1 and HV2 Ranges Disagree Reference Sequence rCRS Profile 1 Incomplete Coverage for HV1 Name ABV HV1 Range 16298 to 16569 HV2 Range 1to 576 Profile 2 Name JK HV1 Range 16024 to 16569 HV2 Range 1to 576 Wamings Create Reports At the top of the Validate mtDNA window is a button bar Click on the Create Report button A new window called Analyst Report opens This contains a version of the Validate mtDNA report that you can send to a printer by clicking the Print button You may also save this report by clicking on the Save button Note The report includes spaces for the analysts and reviewer s signatures Export CMF You can create a CMF report by clicking on the Expor
48. rights reserved 110 Figure 13 17 The Translated Variance Table in Review Mode Cox Description 10 sequences compared to reference sequence NC_001807a 3 end of contig GWB Fragment base 16127 is selected Base 103 of 332 B Chromatograms from GWB a BG Idi 16 220 113 16 226 115 Note You cannot edit your sequences directly from the Translated Variance Table although you can do so in the ordinary Variance Table Any edits to the Translated Variance Table must be made in the Contig Editor In order to see the results of your changes in the Translated Variance Table click on the Refresh button in the button bar The Review Mode and Sister Tables You can generate a Sister Table when you are working in an individual Variance Table If you have generated a Variance Table you can see the Translated Variance Table for the same data set by going to the button bar and clicking on the Translation button see Figure 13 18 Similarly if you have already generated a Translated Variance Table you can see the Variance Table for the DNA sequences of the same data set by going to the button bar and clicking on the Bases button If you are in Review mode and have generated a Sister Table you can arrange all four windows and save the layout by going to the Window menu and choosing Remember Window Layout Then click on Double Table Variance Review from the submenu SEQUENCHER User Manual
49. s button bar You can also SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 143 display this view by going to the View menu selecting Bases Map Overview and then choosing Restriction Map from the submenu If you click between two cut sites Sequencher highlights the resulting restriction fragment Hold down the Shift key and click in the rectangle between other cut sites Your selection is extended from the original site you selected When you return to the Bases view you will see that the sequence representing the chosen region has been highlighted also See Figure 16 9 Figure 16 9 Fragment selected in map view and its equivalent bases highlighted E Contig 0001 D Bases Overview Select Enzymes Options B Contig Editor D Pa Era En RH stow Cronaoganel Reser ITCTGCAG itctctd CTGTGTGi ITCTGCAG ktctctd CTCTGTG TCTGCAG GGGG CTGTGTG 111 frag bases amp 37 consensus bases selected at consensus position 474 Select Next Ambiguous Base spacebar Copying the map After you have made a selection in the restriction map as in Figure 16 9 above you can copy the bases between the two cut sites by going to the Edit menu and choosing Copy Selection You can also copy the entire diagram for use in an illustration program by going to the Edit menu and choosing Copy As and Picture from the submenu SEQUENCHER User Manual 1991 2011 Gene Codes Corpora
50. supports confidence values from PHRED ACE and Trace Tuner files as well as SCF ABI 3730 and ESD files Importing PHRED called data Sequencher can read in the SCF FASTA and Qual files generated by PHRED and supports PHRED base calls and confidence values To view the confidence levels you must first set the user preferences for displaying confidence values See Chapter 21 Customizing Sequencher and User Preferences for more information Then go to the View menu and choose Display Base Confidences To import the data into Sequencher it must first be organized in a folder containing three subfolders These subfolders are chromat_dir which contains the trace files edit_dir which contains the text files and phd_dir which contains the quality scores Select File then go to Import and then Folder of Sequences to import the phd_dir folder To import the sequences you would like to view you may also go to the File menu and choose the Import command with the Sequences submenu Importing PHRAP Files Sequencher can import the ACE projects created by PHRAP To import an ACE project select File then go to Import and then the ACE Project submenu Browse to a file that ends with ace or ace x such as ace 1 ace 2 etc This file will typically be located in the subfolder edit_dir Select the highest numbered ACE file to account for all editing and reassembling Sequencher automatically imports and incorporates as much auxiliary da
51. the first occurrence of the search string anywhere and then selects the string in the editor Find Next finds the next occurrence after the current selection whether it is a match found by Sequencher or a selection that you marked The Find Bases dialog box stays in front until you click Done If you want to repeat the same subsequence search but without invoking the Find Bases dialog box you can go to the Select menu and use the Find Bases Again command SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 152 Refining a subsequence search You can refine any of your searches by using one of the radio buttons The default setting is Exact Matches Exact matching If you click Exact Matches the search is based on exact character matches and disregards matches that occur due to ambiguities For example AGGTW would only match AGGTW Matching ambiguous bases If you click Specified Bases the search finds only matches that are identical or more specific than the sequence you entered in the Find What field For example the string AGGTW would match AGGTT or AGGTA since W is the ambiguity code for T or A Any ambiguous match If you click Any Ambiguous Match the search will find any degenerate DNA that may match the sequence you have entered including matches consisting of all unknown bases For example AGGTW would match NNGTN or even NNNNN Finding bases by number To select a range of bases quickly
52. the reader that the gene is alcA the product of the gene is alcohol dehydrogenase and that the evidence is experimental Figure 28 2 Qualifier examples Key Location Qualifiers CDS 6006 gt 6253 gene alcA experiment experimental evidence no additional details recorded note ADHI ethanol regulon codon_start 1 product alcohol dehydrogenase I Information on the Feature Keys and Tables and Qualifiers has been taken from the official GenBank documentation which can be obtained from the following URL http www ncbi nlm nih gov collab FT index html SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 202 29 Appendix Default Feature Qualifiers In this table you will find the default Feature Qualifier for each Feature Key as implemented in Sequencher Feature Key Default Feature Qualifier Sequencher A misc_feature misc feature note 1 misc_difference misc difference note a conflict conflict compare b unsure unsure difference c old_sequence old sequence compare d variation variation note e modified_base gene modified base mod_base Allele allele Mutation mutation 2 gene gene gene 3 misc_signal gene misc signal a promoter gene promoter 1 CAAT_signal gene CAAT signal 2 TATA_signal gene TATA signal 3 35_ signal gene 35 signal 4 10_signal gene 10 signal 5 GC_signal gene GC signal b RB
53. to the new location Note Icons can be positioned on top of each other thereby obscuring one or more of them from view Cleaning up Sequencher has clean up commands to help you organize the icons in your Project Window Go to the View menu and choose the Sort Cleanup command to see a submenu SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 11 that will let you rearrange the icons according to date edited name kind size etc See Figure 3 6 Figure 3 6 Small icons sorted by name S small icons SPF E O x D Assembly Parameters Assemble Automatically Assemble Interactively Assemble to Reference Parameters Dirty Data With ReAligner 3 gap placement Min Overlap 20 Min Match 85 PS ON 46 88_123_for 4E 0D_123_for 363 FF_123_for 46E 00_456_for PS JE Sp 13 re AE 00_123_rev 46 FF_123_rev afg MORI PS 46 CC_123_for 46 EE_123_for 46 6G_123_for afg MORI E CC 133 re FS EE_123_rev AE GG_123_rew View as a list You can show your project items as a list rather than as icons Go to the View menu and choose Project Icons As and then select A List from the submenu The Project Window will look like the one shown in Figure 3 7 Figure 3 7 Project Window with list view S Untitled Project DER Assembly Parameters Assemble Automatically Assemble Interactively zz Assemble to Reference Parameters Dirty Data With ReAligner 3 gap placement bells Overlap 20 Min M
54. your sequences You will learn how to use these functions when you add sequence data to a project We discuss the various criteria you can use such as trimming off ambiguities trimming off low confidence data how to screen for specific vector contamination and how to change all the trim tools criteria to your own specifications Removing undesirable data Sequencher s trimming tools allow you to trim one sequence at a time or thousands of sequences at a time The two trimming commands under the Sequence menu are Trim Ends and Trim Vector Both the Trim dialogs share a similar interface All the sequences to be examined are collected in a single table The criteria that you set determine how much data you trim off The trimmed data are fully recoverable because Sequencher always stores two copies of every imported file the original sequence and the edited version In this way you can always use the Revert to Experimental Data command from the Sequence menu to recover the original untrimmed sequence Trimming poor quality data Selecting and trimming fragment data Select one or more fragment s in the Project Window by clicking on them Then go to the Sequence menu and choose the Trim Ends command Note that if you select contigs the Trim Ends function only affects unassembled fragments All the sequences are collected in to a single table At the top of the table is a button bar Figure 6 1 that you use to manage trim criter
55. 13 20 Extract from Individual Variance Report AA Individual Variance Reports Date July 12 2007 Project Name 1 exon HPS4 Tutorial Compare Consensus to Reference 3 exon Reference Comparison Range Unfiltered Base Positions 15 394 to 15 644 Options Large gap insertions 10 or more bases excluded Matches to ambiguous reference positions excluded V Owe Nw Vi MII VI MII Vi Sequence Name Comparison Range Coverage 128 Complete 15 394 to 15 644 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 113 Note This can produce a very long report Variance Detail Report As its name indicates the Variance Detail Report contains comprehensive information on the variants in a Variance Table Below the Common Header you will see detailed information for each of the described variants The information for each variant consists of the sample name and comparison range for the parent sequence The Detail Table is divided into two parts The first part contains the sequence name orientation confidence score where available base call primary peak base call secondary peak base call and the height of the secondary peak as a percentage of the primary peak The second part of the table contains a tracelet which is an extract of the sequence trace of the variant combined with some flanking bases see Figure 13 21 The tracelet only appears in
56. 13 27 Then click on the Reports button The Variance Table Reports dialog box appears the Selected Columns radio button is checked Choose a Report Format from the drop down menu SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 118 Select Individual Variance Reports if you want to save each column sample as a separate file Select Variance Table Report if you want the selected columns in one table Click the Save as Text button Sequencher presents you with a dialog to assign the name and location of your export You can copy your Variance Table into another document or application that accepts tabbed text To paste the contents of your Variance Table Report in the document of your choice click on the Copy as Text button The data can now be pasted into its new location Figure 13 27 Variance Table with discontinuous range of columns selected Sequencher Compare Consensus to Reference D File Edit Select Contig Sequence View Window Help Options Comparison Range Description 8 consensus sequences compared to Reference 3 exon Reference Comparison Range Unfiltered Base Positions 15394 15644 Display Options Large gap insertions 10 or more bases included Matches to ambiguous reference positions excluded e KR EECH RRE Total Ew AF o gt Se E EAN La an on an cn cn on an on olin ey eed ees 0 ojojo o ea 4 03 Sjaj s G R R Exportin
57. 13 7 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 100 Figure 13 7 Translated Variance Table for consensus sequences from different contigs S Compare Translation to Reference E ml x Description 5 consensus sequences compared to reference sequence NC_OOT8O07a 3 end Comparison Range Unfiltered Base Positions 15984 16571 Amino Acid Positions 1 229 ATC ACC T Setting the Variance Table Conditions Restricting the Comparison Range You can restrict the Comparison Range by Feature Key if you have any Features in your exemplar Construct a Variance Table then go to the button bar and click on the Comparison Range button The Comparison Range dialog window appears see Figure 13 8 In the default setting the Unfiltered radio button is checked Leave this radio button checked if you decide to leave your table unfiltered If you want to restrict the Comparison Range click the Filter by radio button Once you have clicked the Filter by radio button the Feature Key drop down menu becomes active You can now choose which Filter Key to use by making a selection from this menu Once you have selected a Feature Key you will see a list of features annotated with that key in the pane located below the Feature Key drop down menu You can select a single feature a continuous range or a discontinuous range of features You can also select all the features within this pane by c
58. 173 kabel amp Name eavededdia ied id ted tladta had ial dita lia tlie tlt alittle dere 174 Me eer ecrprre rere ere ener pe ceprre ne eelere 174 SOUNG EE 175 KEE EE 175 Displayen etare nnen Sesaee ge e Se d a E a e aa aa a EEEE 176 ERT E 176 Contig Chromatograms ees EENS EEN 177 CONG pcs ee ee ce ih Ae eo A E ee 178 EE eendeitege egal iesse EE E ofc 179 Format E 180 Start DO REESEN e 181 teil e EE 182 Pee Kr EE 182 REPOME GE 183 22 FORENSIC FEATURES siciisctisctiscdicctisctienadcutiaumiacnacceiaseasuusauetsehitceiauancdads 184 Working with mtDNA Promles iisstadion ea ea A E E EAT 184 Validating mitochondrial DNA profiles AE 184 Create Reports E 185 Export CMB so eet 185 Purther Commands Or EE 186 Set Circ lar Genome S enone nren a tege geseet ker 186 How to mark a sequence as a Reference Sequence 0 ieee eeseeeeeeseeeeseeeeseesesesacseeseseeseecseeeeseeseseeaeeeeas 187 New Project From Templaten aneen arae AO verdad taalerd endian ben egener See 187 Display secondary peak iesietent she asenenatien ani nlanienhinda niet enanienvitin ENTOTE 187 23 APPENDIX KEYBOARD SHORTCUTS ccccccsseeeeseeeeeeeeeeeeeeeeeeeneeeees 189 24 APPENDIX ADVANCED EXPRSSIONS cccccssseeeeseeeeeeeeeeeeeeeeeeseneees 191 25 APPENDIX IUPAC IUB STANDARD CODE ccss eeeeeeeeeseeeeeeeeeees 193 26 APPENDIX STANFORD EXTENDED CODE eeeeceeeeeeeeeeeeseeeees 194 27 APPENDIX DEFAULT FEATURE STYLES
59. 24 View bw SUMIM ALY eege NEEN geleed 124 Summary Teporbidisplay Options eler gelee eelere 125 I Colo EE 125 Bullets Pluses and Dashes cseiiviciecsvcestesshtestesvstan tea tea hes EENS 126 VE DEE 126 Lage UE 126 Matching Bases ag Dashess 2a2 250i genee Be bat oie Batak oda ta O 126 Protein translations and the Summary Report 126 Enabling the protein displays cic scsi seivesesceecciss eb sven cede seas eaa GEARR RRR RRR REER RA 127 Protein translations for the Consensus or Reference Sequence 0 ei eeeeesseeseeseeeeseeeeseeeeseeeeseeseeeseeeens 127 Protein translations for Fragment e ec eesceeseeseeeeseeeeseeeeseeecsesseseeseseescacseesesesscseeseseeseseesesasseeseseeaseeeas 127 Matching Proteins As Dashes eise ee 127 Using the formatting Merron rs cae etn eileen ENEE 128 Reverse and Complement a contig oo cesceesesseseeseeeeseeeeseesesessesessesesseseeseesesesacsesseseesesecseeesseeseseeaseeeas 128 15 GRROMATOGRANIS oseegeeeueueukENegugAgENeVENEgEgEeSEEEEEENEKEEEEEeEgEENE NENNEN 129 Working with automated sequencer data i cc s isssssscieccestedeseadancsceestedesesasncncanateseseesveens 129 Viewing chromatograms from a Sequence Editor eeseeseeseeeeseeeeseeeeseesesecaeseeseeesesesseeeeseesseeaeeeeas 129 Viewing chromatograms from a Contig editor oo eee eeeseeseseeseeeseeeeseeeseescsesaesecseseeseeeseeseseeaeseeaeeeeas 130 Understanding the Trace Display ees 131 Display Secondary peak eege geess ee EEN 132 Select
60. 6 This lets you select items in the Project Window where the search string is based on only part of the complete name Figure 18 6 Contain Items With Names Containing dialog box All Items That Contain A Fragment Name Containing Find What Case Sensitive 0 items selected out of Select All Matches Deselect All Matches Select None Done Have Chromatograms If you want to find out which fragments have a chromatogram or which contigs contain fragments with chromatograms go to the Select menu and choose All Items That and then Have Chromatograms Have Comments Containing If you want to select all the sequences in the Project Window whose comments contain a specific text string go to the Select menu and choose All Items That and then Have Comments Containing to display a dialog box Figure 18 7 Figure 18 7 Have Comments Containing dialog box All Items Whose Comments Contain Find What Case Sensitive 0 items selected out of 8 Select All Matches Deselect All Matches Select None Done Have Labels Containing If you want to select all the sequences in the Project Window whose label contains a specific text string go to the Select menu and choose All Items That and then Have Labels Containing to display a dialog box Figure 18 8 Figure 18 8 Have Labels Containing dialog box All Items Whose Labels Contain Find What IT Case Sensitive 0 items selected out of 3
61. 8 37 PM J10_74969_0045E7 SNPS8R_ Pt 670 BPs Fri Dc 16 2005 4 06 10 PM Fererence 550 BPs Tue Dc 13 2005 4 39 43 PM J10 74969 OO4SEISHPSBF PI 667 BPs Fri Dec 16 2005 4 06 70 PM Viewing the information for a sequence or contig The Get Info command displays additional information about a selected or open sequence or contig To view additional information about an open sequence or a contig editing window go to the File menu and choose Get Info If you do not have an open sequence or contig editing window you can select the icons of your sequences or contigs from the Project Window and then go to the File menu and choose Get Info Figure 3 10 The Get Info window Get Info JO4_14210_0045E1SNP88R_P1 E J04_14210_0046E1SNP88R_P1 Kind AutoSeq Frag ABI Size 824 BPs Where In contig 14210 Original Imported from disk Created Tue Feb 24 2004 9 49 AM Modified Fri Dec 16 2005 4 06 PM Version Modifiable Comments Base Count 226 As 240 Ts 157 Cs 171 Gs 30 Ambigs D Edits 0 Gaps Confidence 270 Low 255 Med 299 High Show ABI Info SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 14 If you have sequences from an ABI sequencing system Sequencher can display information from the ABI data sheet In the Get Info window shown in Figure 3 10 note the Show ABI Info button Editing the information for a sequence or contig You can annotate the sequence b
62. 95_0045E1SNP83R_P1 738 BPs i Dec 16 2005 4 06 10 PM 2 J14_15135_0045E1SNP88F_P1 662 BPs i Dec 16 2005 4 06 10 PM 2 J14_15135_0045E1SNP88R_P1 752 BPs i Dec 16 2005 4 06 10 PM J16_15155_0045E1SNPS88F_P1 663 BPs i Dec 16 2005 4 06 10 PM 2 316_15155_0045E1SNP88R_P1 673 BPs i Dec 16 2005 4 06 10 PM A J18_15239_0045E1SNPS88F_P1 664 BPs i Dec 16 2005 4 06 10 PM J18_15239_0045E1SNP83R_P1 727 BPs i Dec 16 2005 4 06 10 PM 2 J20_15303_0045E1SNP88F_P1 661 BPs i Dec 16 2005 4 06 10 PM 3 J20_15303_0045E1SNP88R_P1 668 BPs i Dec 16 2005 4 06 10 PM Selecting using menu commands Selecting all icons You can change the icons selected in the Project Window by going to the Select menu and clicking on the Select All Select None and the Invert Selection commands Selecting all items containing sequence To select all items in the Project Window that contain a particular subsequence go to the Select menu and choose All Items That command Then select Contain Subsequence from the submenu Sequencher displays a dialog box that lets you type two sequences the box has buttons to specify how you want the sequences matched to items in the Project Window You can use the drop down menus to specify restriction enzyme recognition sequences Finding assembled sequences To locate data assembled in a contig go to the Select menu and click on one of the following options from All Items That then Contain Subsequence or C
63. A A A For more details on regular expressions see Appendix 24 Advanced Expression and the tutorials in the Tutorials folder Setting your Assembly Handle Names Starting in the Project Window click on the Assembly Parameters button At the bottom of the Assembly Parameters window click on the Name Settings button The Assemble by Name Settings window appears as in Figure 10 4 You can describe up to eight Assembly Handles of which only one is active at any one time For each Assembly Handle you can use the default name Sequencher automatically gives your contigs or you can type a descriptive title into the text box Click on the radio SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 71 button to the left of the handle you wish to activate Sequencher displays the number and the name of the Active Handle at the bottom of this dialog Click on the OK button to dismiss this window and return to the Assembly Parameters window Figure 10 4 The Assemble by Names Settings window Assemble by Name Settings Name Delimiters Advanced Expression v Define Assembly Handles 1 fOrigin 2 Clone C 3 Date 4 Primer C 5 Handle5 C 6 Handle6 C Handle C 8 Handle8 Active Handle 2 Clone Cancel Choosing a New Assembly Handle There are two ways to choose an Assembly Handle If you are in the Assembly Parameters window you can change the handle by
64. ATC 46 Ji l e rp o o H The table header indicates how the Comparison Range was restricted For some Feature Keys the actual feature is composed of several components joined together see Figure 13 9 The Base Positions indicate the exact range of bases used for each component Features which share the same Feature Key such as CDS and which are joined the Feature has a Join qualifier will appear in the Feature Listing as CDS 01 CDS 02 The same Feature will appear in the Translation Range dialog window as a single item see Figure 13 11 See Chapter 17 Motifs and Features and Appendix 28 Feature Keys and Qualifiers for more information SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 103 Figure 13 11 Feature key with more then one component Translation Range C Translate Entire Sequence Feature Key misc_structure x misc structure 3 features Select All Cancel If you prefer to have each component of a Joined Feature as a separate item you must give them different names You can do this by editing the Feature using the Edit Features command see figure below Figure 13 12 Appearance of features once they have been renamed Translation Range C Translate Entire Sequence Feature Key misc_structure x Fred 131 150 Ginger 291 340 mise structure 391 400 Select All Cancel You can also create your own joined
65. BPs Guto Zeg Frag Interesting FS AA 466_rew 591 BPs Auto Seq Frag Interesting AE BB_123_for 589 BPs Auto Seq Frag Mutations AE BB_123_rev 594 BPs Auto Seq Frag Mutations AE CC_123_for 581 BPs Auto Seq Frag Mutations AE CC_123_rew 594 BPs futo Seq Frag Mutations FS FF_123_rev 592 BPs Futo Seq Frag Mutations FS GG_123_for 590 BPs Futo Seq Frag Mutations DS DD 3 tor 583 BPs Futo Seq Frag Resequence AE DD 23 re 594 BPs Futo Seq Frag Resequence PS EE_123_for 591 BPs Auto Seq Frag Resequence Gf EE_123_rev 594 BPs futo Seq Frag Resequence Saving your work Saving your Project To save a project go to the File menu and choose Save Project which saves all your changes to the current project file When you use the Save Project command for a new project Sequencher will prompt you to name your project with the Save As dialog Enter a name for the new project in the File name field then click Save Auto Save If you are working on complex projects you may find it helpful to have Sequencher automatically save your work at pre set time intervals You will need to enable the Auto Save user preference from User Preferences in the Window menu See the Chapter 21 Customizing Sequencher and User Preferences for more details Saving a duplicate of a current project If you wish to create a second copy of a current project you can use the Save Project As command to create the new copy of your project with a different name When yo
66. Boolean and search using two specifiers for the subsequence Enter the first specifier in the Contains field and the second in the And field There are also two drop down menus to assist you in the search for specific restriction enzyme sites Figure 18 4 Contain subsequence dialog box Add To Selection All Items Containing C Exact Matches e Specified Bases C Any Ambiguous Base Contains 1 items selected out of 8 Select All Matches Select None Reverse amp Comp Deselect All Matches Done Contain Items Named If you want to find which contig contains a specific fragment go to the Select menu and choose All Items That and then Contain Items Named to display a dialog box Figure 18 5 This lets you select items in the Project Window that contain a fragment bearing the specified name Figure 18 5 Contain Items Named dialog box All Items That Contain A Fragment Named Find What I Case Sensitive 0 items selected out of 8 Select All Matches Deselect All Matches Select None Done Contain Items With Names Containing If you are looking for several fragments with related or similar names and need to check which contig or refrigerator they are in go to the Select menu and choose All Items That Click on the submenu option Contain Items With Names Containing to display SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 155 a dialog box Figure 18
67. C AGG CCA TAA GGT CGC TCA CAG AGC GGC TTT ACG TCG GGG GTC CCC TGA CNA ATT CAA AAG GGC AGA ACT Frame 3 In the example shown in Figure 8 9 a click between a start and a stop codon of the first reading frame has selected the corresponding bases in the editor Note that User Preferences have been set to highlight ORFS of more than 100 bases There is one such ORF in Frame 2 marked with a hash pattern To dismiss the map click on the Codon Map button again Figure 8 9 Sequence Editor with codon map E Quality four Dan ep Pue RR Emtee Residue 88 to 192 D Low Confidence 0 0 D Ambiguous 0 0 Frame 1 Frame 2 a Frame 3 5 r3 NNN NNN GGN NNN NNN NCT CTC CTG GNN NCG CCT GGT GAA GAN NAN ACC CCA TGG GGT TCT d TT C CC GTG TTG sT CAA T G T TGC CGC TCA ACG TCG TGA CNA ATT CAA AAG GGC AGA ACT Looking at Restriction Maps You can look at a restriction map for the sequence by clicking the Cut Map button at the top of the Sequence Editor A restriction map replaces the sequence in the window See Chapter 16 Restriction Maps for a general discussion of restriction maps SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 52 Sequencher can add a pane showing the restriction map for a sequence into the same window as the sequence itself At the top of the Sequence Editor is a button showing an icon for a staggered enzyme cut shown in F
68. CGGGGAC TCTACCTGCTCCCCAACC gatnacg Trim 18 five prime bases 11 Ambigs SK iz Trim 7 three prime bases 1 Ambigs d Quality four Has Chromatogram 674 good bases 4 Ambigs AnAnnnggnnnnnnnnetctectygnnn CGGGTCGAGTICCTGGTG CCTTATGGGCAAGGATGA ttctgatgactcacttcttctecatcc Trim 28 five prime bases 17 Ambigs SK iz Trim 92 three prime bases 3 Ambigs 3 Quality nine Has Chromatogram 634 good bases 0 Ambigs Annnectnnnnngnaggagtaggeace ACATGAACCAGCGGGGTC GGAGGAGCATGATGTTAT cagctccaagtcgtattctggtcgggg Trim 42 five prime bases 20 Ambigs 5H Hz Trim 120 three prime bases 3 Ambigs Sorting items In order to assist you with the review of your data prior to trimming you can sort the fragments Click on the Sort Items button at the top of the Ends Trimming window to order the fragments being trimmed Figure 6 5 shows the sort criteria Figure 6 5 Sort Fragments dialog box Sort Fragments by Fragment Name ees by Items Checked For Trimming C by Original Sequence Length C by Amount To Be Trimmed by Length Of Fragment After Trimming Executing the trim Once you have reviewed your data and are happy with the criteria you have set you proceed with the trim by clicking on the Trim Checked Items button Sequencher warns you that this command cannot be reversed with the Undo command To proceed click the Trim button Any red lines or bases will disappear from the Ends Trimming window Now you
69. C_000022 of contig Comparison Contig Comparison Range Filtered on CDS plus 0 flanking bases Base Positions 2093 2136 4503 4590 6719 6864 10918 11023 11437 11555 A aeo CZ i 152 3815 A E 32490 BPs DNA Fragment fl 19863 c Passed ojr ass o _ asa o _ as o _ am o aso o aa o s30 e nme o E Pe r E WT ET te D O Olo oO o o Setting the Consensus Calculation for a Variance Table You can generate a Variance Table where the exemplar is a consensus sequence rather then the Reference Sequence by using the Compare Bases To command from the Sequence menu You generate a consensus Variance Table using the Compare Consensus to Reference command from the Contig menu SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 106 In either case the method you choose to calculate your consensus can affect your results Generally using the command Consensus Inclusively will report more variants than Consensus by Plurality Sequencher recalculates the consensus on the fly so if you change the methods you are using to compute your consensus you can reconstruct the Variance Table quickly Just click on the Refresh button in the button bar at the top of the Variance Table to display the results of the new consensus calculation For more information on consensus calculations see Chapter 11 The Contig Editor Variance Table Options If you need to chang
70. ER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 168 Figure 21 1 Ambiguity editor Ambiguity Editor h Load Ambiguities IUPACAUB Ambiguity Set Adenine Color Green e Character to Display Keystroke 1 Ia Keystroke 2 cm I Extended Ambiguity Set Jase the Clear All command in the Edit menu to clear all the key definitions Cancel Each base and each ambiguity has a display character which is drawn on the screen and sent to the printer to represent that base or ambiguity The display character interprets ASCII text files imported into Sequencher Each code is also assigned a color which can be displayed in fragments or contigs by going to the View menu and clicking on Display Color Bases Select a base or ambiguity from the scrolling list at the left by clicking on its name When the item is highlighted information about it appears on the right side of the dialog box To change the display character click the box to highlight it Replacing an existing character keystroke code Each base code can be assigned up to two alternate keys from the keyboard Using either of these keys generates the desired base code when using the sequence or contig editors These keystroke settings do not affect importing of data To change a keystroke setting for a base code select the base code from the list on the left of the window Click on one of the keyboard keys to highlight it and then press the
71. GCCATTCAGGCTGCGCAACTGTTGGGA AGGGCGATCGEGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGat AGGGCGATCGGTECGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGat 42 anarci gTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGT gTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGT 4 anarce TAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGG x Blannen TGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGG TGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGG E EE Eanarca gt 1 gt GNTGCTCGAGCGGCCECCANTGTGatgGATATCTGCAGAATT k P 4Baarce 52 CCCTCTAGatgCatgCTCGAGCGGCCECCAGTGTGat gGATATCTGCAGAATT 42 anarci 425 COCTCTAGatgCatgCTCGAGCGGCCGECCAGTGTGat gGATATCTGCAGAATT SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 166 21 Customizing Sequencher and User Preferences In this chapter we discuss how to set your view preferences such as colors custom codes features and motifs and the genetic codes you want to use We also discuss how to set your user preferences such as confidence scores labels and names assembly parameters and how you want to display chromatograms You will learn that all of these preferences can be saved as individual or group preferences View Preferences Sequencher offers you a number of options for specifying how you want to view your data in the sequence and contig editors These options can provide visual cues which help to differentiate your data Ambiguous bases Sequencher can u
72. K AAG AAA GAG AGC ATC CTG CCT GGG CAA CAT AGT GAA ACC CTG CCT K K E 5 I L P G Q H S E T L P SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 54 The sequence margins you set with the formatting ruler are not the same as your absolute print margins which allow room at the left to show the first base number of a line To change the absolute limits go to the File menu and choose Set Header amp Footer and enter new values into the Margin boxes or drag the triangular markers just under the Translation and Base Grouping icons as shown in Figure 8 13 above Translation On the left just under the word Residue and above the ruler is a set of three small icons that let you specify sequence representation single stranded double stranded or single stranded with a protein translation If you select the third translation icon the numbered button at the right controls which frame or whether all three frames will be displayed You can also use the translation commands in the Translation submenu of the View menu Single Stranded Double Stranded Protein 1st Frame Protein 2nd Frame Protein 3rd Frame or Protein All 3 Frames see Figure 8 14 Figure 8 14 Translation icons on the Formatting ruler im SE EBB BIE I Io IGN Font Di i gt SR 3 1 4H 4 15 See Chapter 21 Customizing Sequencher and User Preferences for information on editing the genetic code or using
73. Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 120 If you prefer to copy your Translated Variance Table to another document or application which accepts tabbed text click on the Copy as Text button The data can now be pasted into its new location Exporting selected sample sequences Each column in the table represents a sequence or consensus If you need to export specific columns in the table make your selection by using Shift click for a continuous range or Ctrl click for a discontinuous range see Figure 13 29 Then click on the Reports button The Translated Variance Table Reports dialog box appears see figure above A radio button called Selected Columns will be checked Figure 13 29 Discontinuous selection of columns O Compare Translation to Reference E EI EN Description 12 consensus sequences compared to Reference 3 exon Reference Comparison Range Unfiltered Base Positions 15394 15644 Amino Acid Positions 1 83 See Le Te Kette GR GST GCT GCT D A AAG AAG AAG TAT TAT TAT ee y F AGT GET A AAG K G K K K T A Z 415 Choose one of the three enabled buttons in the Translated Variance Table Reports dialog box Cancel Copy as Text and Save as Text Save as Text is the default setting If you click on the Save as Text button Sequencher presents you with a dialog to assign the name and location of your export The report is saved in a tabbed text format
74. Ot W 1M OW ee dee dE EA dee 23 E Wu CO EE 23 5 ORGANIZING PROJECT VIEWS cc ccccccsceeesseneeeeeeeeeeeeeeeneeeeeeeeeeeseeeeeeeeenee 25 Working with icons WE 25 Changing between project VieWS eege SEENEN 23 EEn Uer 25 E Ee EE He Selecting Sequences and Bn 26 Selecting with the MOUSE meena ra a A T ireland etre eeivin tein aaa 26 Selecting by ty pine nrinn et ari a GENEEN EOE ROTERER 26 Selecting multiple items with a Marquee cesceseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeaeeseeseeseeseeaeeaeeaeeaes 26 Selecting using menu commands eege eat Net 27 GEDEELT A AEE E EET 27 Selecting all EE RE UE 27 Finding ass mbled Sequences eer dE EE 27 iv ru DER EE 28 Renaming Using the Mouse een ee Ae ie ee eal ele Ia A OEMS he 28 Renaming sng the MenWiaeuescssndaudddddndvaddduwdiaddiidadtaddddaddanddiwdnaddadadiewe 28 Labeling items in the Project WindOWaauaddcndgudiid cine uadiaaddanaad lei ae 28 pe RIGID TAD 50 ME deed 29 Savine your Projectors chee eA EE AOO RR R AA AA ET A E A es 29 a UONE NA A ER E ee Eet EE E E E E 29 Saving a duplicate of a Current Project iiri rnanan EAE E E ERARA RARA EEEE 29 Reverting to the saved version of the project cece sesessesseseeeeseeecseeeesesscseesesecscecseeeeseseesesassesaeeeaeeeeas 29 Closing the Project WNdoW eegene 30 Exporting datano ai a aA R ee ENEE SE 30 Exiting th pro gratin E 30 6 PREPARING YOUR DATA FOR ASSEMBLY sscssseeeeeeeeeeeeeeeeeeeeeeees 31
75. Print Trace in One Page This command appears within the File menu and allows you to print an individual trace so that the entire sequence fits on one page Printing in detail Most windows that contain data can be printed To print select a window by bringing it to the front Then go to the File menu and choose Print and enter your print specifications Setting header footer and margin options Specify header footer and margins for any printout by going to the File menu and choosing Set Header amp Footer You enter the text of the header and footer and a code style for elements into a dialog box Figure 20 1 that Sequencher will automatically increase incrementally The code elements are Date Time Page Total Pages SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 164 Project Name and User Name You can also add your own free text in either the header or the footer Headers and footers are supported in all reports Set the margins by typing appropriate numbers into the Left Right Top Bottom and Gutter boxes in the Margin pane Remember not to set margins smaller than those your printer can handle Figure 20 1 Setting margins for printouts Set Header Footer amp Margins Header Sequencher tm Project Name Foote Deel Page Pageti ot TotalPages Margin Style Left man Report Right asin Book Top 0 5 in o C Poster Choose a printer Bottom D I in
76. Project From Template command allows you to open a new project containing all the sequences settings and preferences associated with your chosen template Go to the File menu and click on New Project From Template Select a template from the submenu A new blank Project Window will open Import from Template You can add preferences settings and sequences to an existing project by importing a template If you have an open project go to the File menu and click on the Import command and then choose From Template Select a template from the submenu The settings and or sequences from the template will be applied to your open project automatically SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 16 4 Importing data In this chapter we will discuss how to import data from automated sequencing equipment and other programs into Sequencher projects The different techniques we will discuss include dragging and dropping copy and paste and using import commands We also explain how to deal with projects in specific formats how to import confidence scores and how to remove unwanted sequences and contigs from a project Quick and easy importing of data Dragging and dropping files You can drag files from the desktop right into the Project Window and Sequencher will import and load those files Sequencher will alert you if it cannot read and load the files If you drag sequences onto the Sequencher icon on
77. Remoymeg undesirable data E 31 Trimming poor q ality Mata EE 31 Selecting and trimming fragment data 31 Performing a trim with default settings 00 eee eseseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeseeaeeaeeseeaeeaeeaeeaeeaeeaeeaeees 32 Automatically selecting sequences for ends triMming 0 eee eee ese cece eseeeseeeeseeeseeeeseeseseesesesaesesaeeeeas 32 How to set the Ends Trimming criteria eesceceseeseseeseseeseeeseeecseeecsessesesacsesseeeseeeseseesesseseeaseeeaeeeeas 32 Using Contidencesto TUM Em Svecsiseets iesscsszheiesssaigleag ganiesd eos lacd soalecte eas laesesigeged EE 33 Reviewing the Trim ee 33 SOINE Items 268i eet ee tes ee Rees a RA etn SAR ten Aes en Ren a RA 34 Set lr RE 34 Trimming vector contamination EE 35 Selecting sequences for Vector Trim eoa Ea RAEE E E Aia 35 Specifying a vector using VecBaErecocuio onena a RAA A O EA T AA E 35 Sp cifyine GEN LEE 37 Saving and load ne e EE 37 setting Vector Trimming Criteriatec ntecaieitadalelatedelivewlednitintedaeelytadal elated 38 How Sequencher screens Sequences sin ve eae cadena eege ege deet deed eege 39 Executing the trim command Ee 39 7 JHE REFERENCE SEQUENCE piicscisscccistisesiastoamnccuraantavteasneaemugnmanteamnagemi 40 Whats Reference Sequence erone ee 40 Why use a Reference Sequence 20 nioi iaaa aAa RR RARER dele onsite 40 Reference Sequence e EE 40 Basic Reference Sequence properties oo ee ceeseeeeseeseseeseseseseeseseeseeecseeeesessesesacsesacse
78. S gene RBS c polyA_ signal gene polyA signal d enhancer gene enhancer e attenuator gene attenuator SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 203 Feature Key Default Feature Qualifier f terminator g rep_origin h oriT 4 misc_RNA mRNA g 1 sig_peptide 2 transit Deptide 3 mat_peptide h intron i polyA_site j rRNA k tRNA 1 seRNA m snRNA n snoRNA 5 Immunogobulin related a C_region c J_segment d N_region e S_region f g V_segment 6 repeat_region a repeat_unit b LTR c satellite Transposon 7 misc_binding a primer_bind b STS c protein_bind Primer 8 misc_recomb a iDNA 9 misc_ structure gene terminator gene replication origin gene oriT gene misc RNA gene primary transcript gene precursor RNA gene MRNA gene 5 clip gene 3 clip gene 5 UTR gene 3 UTR gene exon gene CDS gene signal peptide gene transit peptide gene mature peptide gene intron gene polyA site gene rRNA gene tRNA gene scRNA gene snRNA gene snoRNA Immunogobulin related gene C region gene D segment gene J segment gene N region gene S region gene V region gene V segment gene rpt_type repeat region rpt_family gene rpt_type repeat unit gene LTR gene rpt_type satellite transposon misc binding of bound_m
79. Sequencher User Manual The complete software solution for sequencing DNA Windows Gene Codes Corporation THIS IS AN AGREEMENT BETWEEN YOU THE END USER AND US GENE CODES BY OPENING THE SEALED DISK PACKAGE YOU ARE AGREEING TO BE BOUND BY THE TERMS OF THIS AGREEMENT IF YOU DO NOT AGREE TO THESE TERMS PROMPTLY RETURN THE UNOPENED DISK PACKAGE AND ALL ACCOMPANYING MATERIALS TO US OR TO YOUR DEALER FOR A REFUND License We grant you the right to use the enclosed software program the Software on a single terminal connected to a single computer The Software is accompanied by a hardware locking device that prevents its full use on any computer without the device if the Software is used without the locking device it operates in demonstration mode only You may not use the Software on a network without obtaining a license for each terminal on which the Software will be used You may not use the Software for any purpose related to the use development analysis testing or research on biological weapons Copyright The Software is protected by United States copyright laws and international treaty provisions You must treat the Software like any other copyrighted material such as a book or musical recording You may however either a make copies of the Software for backup or archival purposes b transfer the Software to a single hard disk provided you keep the original or c make copies of the Software to give to others for purposes o
80. T CCT CCT GCTACTCTCOGGGGCCCTGGCCOCTGACCY yf Candidate AT GGCCGTCATGGCGCCCCGAACCCTCGTCCTGCTACTCTCGOGGGGCTCTGGCCCTGACCY AE Match 1 10 20 30 40 50 6 Assemble If you choose to create this assembly click on the Assemble button Name the new contig in the Set Name dialog window and click OK Sequencher takes only a short time to assemble or reassemble a contig and the name of the new contig now appears at the top of the Candidates list Note that as a sequence is assembled its name is removed from the Candidates list Figure 9 8 The new contig displayed in the Assemble Interactively Window Assemble Interactively Candidates Matches Overlap Mismatch Gaps Rew Contig Len gt HL HLA00017 Assembly Parameters HLAcHLAOD002 HLA HLAO0004 HLA HLAOD00S HLA HLAO000S HLA HLAOD00S HLA HLAO0009 HLA HLAO0009 HLA HLAO0016 HL amp HLAOO010 HL HLAO0012 HLA HLAO0011 HL HLAO014 HLA HLA00012 f HLAHLA00020 ATGGCCGTCATGGCGCCCCGAACCCTCSTCCTGCTACTCTCGGGGGCYCTGGCCCTGACCY E Candidate EE 1 10 20 30 40 50 6 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 66 The new contig will appear in the Project Window when you close the Assemble Interactively dialog by clicking on the Done button Changing parameters for an interactive assembly If you suspect that your fragments should form a contig but Sequencher cannot suggest candidate matches you can change the parameters for assembly To do this whi
81. Table Name Input Output Page Setup d File Import Date Page Page of Total Pages You can specify headers and footers on reports generated from any window in which you are working Any text you type into the field above the page layout will appear in the header and text you type in the field below the layout will appear in the footer For variable elements date time page and total number of pages enclose the word typed with an initial capital in square brackets as shown in Figure 21 20 above SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 183 22 Forensic Features If you have the forensic version of Sequencher you have access to special functions for DNA based identification In this chapter we describe how you can validate mtDNA create reports and export your results Working with mtDNA profiles Validating mitochondrial DNA profiles The Validate mtDNA Profiles command allows you to compare the results of separate analysts Select two contigs which have been assembled to the same Reference Sequence Go to the Contig menu and click on the Validate mtDNA Profiles item This command creates a report in a new window The title bar includes a date and time stamp as shown in Figure 22 1 below The report includes the name of the Reference Sequence used the name of the contigs being examined and the HV1 and HV2 ranges Underneath the main body of the
82. The Variance Table also displays the total number of differences for each position to the right of each row There are two Total buttons at the bottom left and top right corners of the Variance Table These act as Sort buttons SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 107 The Total button on the bottom left of the table sorts the sample columns so that the samples with the greatest number of differences move to the left Click Total again and the columns sort in the opposite order There are two ways to define the sort order for the rows You can sort by total number of differences or you can sort by 5 3 order In the default unsorted display of the Variance Table rows are sorted by base position in ascending 5 3 order When you click on Total in the top right corner of the Variance Table the rows are rearranged so that those with the greatest number of differences sort to the top Click the Total button again to reverse the order To restore the order by base position click on the button in the top left corner of the Variance Table Click here again to have the rows sort by position in descending 3 5 order Note The text on the sort button is context sensitive and will change depending on the Compare Bases To command used to generate the Variance Table Removing columns from the Variance Table As you start to work with your Variance Table you may decide that some se
83. The New Project From Template command allows you to open a new project containing all the sequences settings and preferences associated with your chosen template Go to the File menu and click on New Project From Template Select a template from the submenu A new blank Project Window will open Note A template called rCRS is provided This contains the Revised Cambridge Reference Sequence and is the default template for this command For more information on Templates see Chapter 3 The Project Window There is a tutorial on analyzing mtDNA with Sequencher in the Tutorials folder Display secondary peak You can identify heterozygotes by identifying the second highest peak beneath the primary peak If you have a particular candidate for a heterozygote first open the chromatogram for the individual sequence then click on the base call s Go to the Sequence menu and choose Call Secondary Peaks A dialog box lets you specify how the secondary peak should be called The slider lets you specify how significant the second highest peak must be to generate a change SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 187 If you want Ns to be replaced then select the Allow Ns to be replaced checkbox If you ve already edited bases by hand and don t want them changed you must deselect the checkbox called Allow edited bases to be replaced If you select Only make changes that result in an ambig
84. UENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 95 The range of bases included in a Variance Table is called the Comparison Range The length of the exemplar determines the default Comparison Range and sets the base numbering The extent to which the exemplar matches any sample sequence is called the Coverage Range The Coverage Range can be complete full range or incomplete If the range is full the entire length of the sample sequence has been compared to the entire length of the exemplar sequence If the range is listed as incomplete the display of the sample sequence comparison runs along only part of the exemplar sequence If a sequence extends the full length of the Comparison Range its column header will be shaded in gray If a sequence in the Table does not extend the full length of the Comparison Range its column header will be shaded in pink Figure 13 2 Components of a Variance Table Description 5 sequences compared to Reference Reference Comparison Range Unfiltered Base Positions 1 856 Display Options Large gap insertions 10 or more bases excluded Matches to ambiguous reference positions excluded EC a a CAE EEN Sort Rows by Number of Variants Sort by Position of Variants a 6 Shading Reflects Confidence of Base Call A 356 c ez 6 Resize Column S Sort Columns by Number of Variants Posi
85. VecBase File button in the Vector Insertion Sites window Sequencher displays a list of the vectors Select the vector you want and click the Select button Figure 6 6 Selecting a vector Vector Selection Change Current VecBase File Current File 3 Vectors from VecBase TXT Vectors BluekSm M13mp8 DLC ie Cancel The polylinker region of the vector you select is displayed in the window shown in Figure 6 7 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 35 Figure 6 7 The polylinker window Polylinker Prime Other Strand Select All SacI Bet 5 GTTGTABAACGACGGECAGTGAATTGTAATACGACTCACTATAGGGC GAATTGGAGCTC CACCEGGCTCE SacII XmalIT Spel Smal EcoRI HindIII Sall CGGCCECTCTAGAACTAGTGGATCCCCCGGGETGCAGGAATTC GATATCAAGCTIATC GATACCCTCGAC NotI Xbal Bank PstI Ec okt Clal Drall KpnI qre GAGEGGCGGE QCGGCTACCCAGCTITTGTICCCTITAGCTGAGGETTAATTCCGAGCTIGGCGTAATCA Si Xhol amp pal a Bluek Gm Cancel Note Not all vectors in VecBase have polylinker information Sequencher cannot work with VecBase vectors that do not include polylinker data Add these manually see below Click the enzyme restriction site s where your sequence fragment was inserted into the vector The name of a selected site s changes to green and is boxed If you change your mind and decide on a different site you must click the selected site again to deselect it It will then return to its or
86. WB_2001 05_PrimertF CGGTACCATAAA 3 A GWB _07061948_Primer1F CGGTIACCATAAAT d A_GWB_2001 05_PrimerF 2 A_GWB_07061948_Primer3F 3 A_GWB_2001 05_Primer2R 3 A_GWB_2001 05_Primer4F 3 A GWB _07061946_Primer4F 5 frag bases selected at 6120 16 O 1 consensus position 16 127 25 7 o o ce op a E rm cca GAAT ATT Vtt 16 226 16 237 EB Chromatograms from GWB A_GWB_2001 05_I T een base 16 127 Base 103 of g A Ta T GTA k 3 wy rags 127 Ga ee S T TA S AT EE EE TG i J haa byl yw dvr aioli A_GWB_2001 05_Prim 9 ger paze VG 127 Zi 103 E T E ATAT ARTA GE f Cat A D AA Cette on D SS bi The Review Mode and the Translated Variance Table The Translated Variance Table also has a Review button in its button bar When you click this button you will see the associated Contig Editor and chromatograms see Figure 13 17 When you click on an individual cell in the table its codon is highlighted in the Contig Editor and the first base is selected You will notice that the equivalent codon in the exemplar sequence is also highlighted Once you have arranged the individual windows to your satisfaction you can save the layout by going to the Window menu and choosing Remember Window Layout Then click on Single Table Variance Review from the submenu SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All
87. WHICH VARY FROM STATE TO STATE NO LIABILITY FOR CONSEQUENTIAL DAMAGES IN NO EVENT SHALL WE BE LIABLE FOR ANY DAMAGES WHATEVER INCLUDING LOSS OF PROFITS ARISING OUT OF THE USE OR INABILITY TO USE THIS SOFTWARE EVEN IF WE HAVE BEEN ADVISED IN ADVANCE OF THE POSSIBILITY OF SUCH DAMAGES BECAUSE SOME STATES DO NOT ALLOW THE EXCLUSION OR LIMITATION OF LIABILITY FOR CONSEQUENTIAL OR INCIDENTAL DAMAGES THIS LIMITATION MAY NOT APPLY TO YOU U S Government Rights The Software and documentation are provided with RESTRICTED RIGHTS Use of duplication or disclosure by the Government is subject to restrictions set forth in subparagraph c 1 ii of the Rights in Technical Data and Computer Software clause at 52 227 7013 The contractor manufacturer is Gene Codes Corporation Ann Arbor Michigan 2011 Gene Codes Corporation Inc All rights reserved Sequencher is a trademark of Gene Codes Corporation Microsoft is a registered trademark of Microsoft Corporation Macintosh is a trademark of Apple Computer Inc ABI Applied Biosystems and 3730 are trademarks of Applied Biosystems Inc ALF is a trademark of Pharmacia Biotech All other trademarks are the properties of their respective owners er E 1 Gene EE EE 1 2 USING THIS MANUAL eessen Vekeseeug ee KENNEeNREeENENKEENANEENES ENEE 3 Conventions used in this mamm si 3osc ssn se sass ceseye eens asda euasocaig sd cashed shin SEENEN tee 3 Installing ScQuenchen ee e 3 Sequencher H
88. able and go to the button bar and click on the Translation Range button The Translation Range dialog window appears You will see that the Translate Entire Sequence radio button is checked This is your default Leave this radio button checked if you decide to leave your table unfiltered SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 102 If you want to restrict the Comparison Range click the Filter Translation by radio button Once you have clicked the Filter Translation by radio button the Feature Key drop down menu becomes active You can now choose which Filter Key to use by making a selection from this menu Once you have selected a Feature Key you will see a list of features annotated with that key in the pane located below the Feature Key drop down menu You can select a single feature a continuous range or a discontinuous range of features You can also select all the features within this pane by clicking on the Select All button Once you have made your selection click the OK button The Translated Variance Table will be rebuilt automatically see Figure 13 10 Figure 13 10 Translated Variance Table restricted by Translation Range Compare Translation to Reference Translation Range Description 58 consensus sequences compared to Reference Reference Comparison Range Translate only CDS Base Positions 169 249 376 570 Amino Acid Positions 1 92 a en en 8 430 ACC
89. ains a listing of the standard feature keys which have been implemented in Sequencher Table 28 1 Feature keys groups and hierarchies Feature Specificity or detail Functional grouping A misc_feature 1 misc_difference a conflict b unsure c old_sequence d variation e modified_base f mutation g allele Difference and change features 2 gene 3 misc_signal a promoter CAAT_signal TATA_ signal 35_signal 10_ signal GC_signal b RBS polyA_ signal enhancer attenuator terminator g rep_origin h oriT 1 2 3 4 5 c d e f Expression signal features 4 misc_RNA a prim_transcript 1 precursor_RNA a MRNA 1 sig_peptide 2 transit_peptide 3 mat_peptide h intron Transcript features SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 200 Feature Specificity or detail Functional grouping i polyA_ site j rRNA k tRNA 1 scCRNA m snRNA n snoRNA C_region D_segment J_segment 5 Immunogobulin related N_region 6 repeat_region repeat_unit Repeat features LTR satellite transposon primer_bind Binding features protein_bind STS primer iDNA Recombination features stem_loop Structure features D loop 7 misc_binding 8 misc_recomb a 9 misc_structure 10 gap 11 operon 12 source F
90. ambiguous matches and large gaps will be treated If you wish to include ambiguous matches in your table click the Include Ambiguous Matches checkbox If you wish to exclude large gaps from your table click the Exclude Large Gaps checkbox When you generate a Variance Table you would expect to have blank cells where the base at that position matches the exemplar If you would like to see all bases across the comparison range whether they match or are different to the exemplar then click the Populate All Cells checkbox see Figure 21 18 Figure 21 18 Variance Table preference settings je Include Ambiguous Matches Jv Exclude Large Gaps Input Output File Import File Import preferences control how Sequencher applies the automatic trim function to imported files Use the checkboxes grouped under Add Imported Sequences To Trim Window to specify which sequences Sequencher should examine for poor quality ends and then trim You can also specify how you want to resolve conflicts between the names of imported files and names stored with particular sequences If you click the Prefer File Names To Data Names checkbox Sequencher uses the file name Clicking the Review Trim Parameters button displays the Ends Trimming dialog box in which you can set trim criteria See Chapter 6 Preparing your Data for Assembly for details SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 182
91. amed or Have Chromatograms from the Select menu You can indicate if you want these names to be case sensitive or not Note The subcommand Contain Items with Names Containing only works on contigs For more detailed information on these commands see Chapter 18 Finding Items Selecting with the mouse First make sure the Project Window is at the front When you click on an icon or hold down the Shift key while clicking on several icons Sequencher highlights the icon s When you have finished selecting a group of icons release the Shift key before you try to do anything with the group You can deselect an icon by clicking on it while holding down the Ctrl key If you do not hold down the Shift Ctrl key Sequencher deselects the last highlighted icon s as soon as you click on another If you click in the white space between icons and names Sequencher deselects all the highlighted icons When you display the list view of a Project Window or a contig you can select a range of fragments by using Shift click You can make a discontinuous selection by using the Ctrl key and clicking on the individual fragments Selecting by typing Type the name of a sequence fragment or contig As you type Sequencher searches the Project Window for an icon with that name If it finds the name it scrolls to the point at which the icon is visible and highlights the icon Note If you pause for more than a second or two while typing a name Seque
92. an a few seconds the program assumes you ve started typing a different name and looks for the new name Another way to locate a sequence is to go to the Select menu and choose Item Named This brings up the dialog box shown in Figure 18 3 Figure 18 3 Item Named dialog box Find What my sequence frd Erann Done Type the name of the sequence you want to find and click Find Sequencher searches through all the sequences displayed in the Project Window for a name that matches the name you entered e When it finds a sequence the sequence is displayed and highlighted in the Project Window If Sequencher does not find a sequence with the exact name you typed it looks for a sequence with a name starting with the first few letters you typed e If Sequencher still does not find a match it looks at all the sequences contained in contigs If it finds a matching sequence within a contig it highlights the contig that contains the matching sequence If Sequencher can find no matches anywhere it stops searching and informs you that the item was not found e If there is more than one sequence with a matching name Sequencher selects and highlights the first one If that is not the one you want click Find Next This continues the search in alphabetical order Note The Find window is movable Selecting all items that The Select menu s All Items That command provides a series of suboptions based on different cri
93. an alter the vector screening parameters As an example if there is ambiguity in the region of the vector junction you can increase the likelihood that Sequencher will recognize the vector sequence by decreasing the approximate match percentage If it is essential to remove even a single base of vector contamination you can decrease the minimum overlap to be considered as vector contamination You can change any of the five independent parameters in order to improve your trim Elevator buttons are used to increase or decrease the parameter value The following table describes the recognition criteria for contaminating sequence Parameter Minimum overlap to consider as vector contamination Approx match percentage to consider as contamination Minimum overlap allowed without exact matches Additional bases to remove from a contaminated 5 end Additional bases to remove from a contaminated 3 Description The smallest amount of overlap to consider as vector contamination The default value is three bases The percentage match Sequencher needs to find before considering the matching sequence to be vector contamination Ambiguities do not count as full matches or mismatches The smallest number of matching bases within which an inexact match is permitted If fewer bases than this match they must match exactly Extra material if any to be trimmed off the 5 end of the remaining DNA sequence along with the vector co
94. ance Table Reports You now have a number of ways to present the data from your Variance Table You can use the table s Reports function to print your data or to export it The options vary depending on the data you have chosen to use in your report Printing a Variance Table Report You can print the data from an entire table selected columns or selected rows The type of report you can generate will depend on this initial selection see Table 13 2 Table 13 2 Table 13 2 Variance Table print options Variance Table Individual Variance Detail Population Report Variance Table Report Report Reports Entire Table Yes Yes Yes Yes Selected Yes Yes Yes Yes Columns Selected Rows Yes n a Yes n a SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 115 To print all the data in a table click on the Reports button The Variance Table Reports dialog box appears see Figure 13 23 A radio button called Entire Table will be checked Below that you will see a drop down menu called Report Format Choose either Variance Table Report Individual Variance Table Reports Variance Detail Report or Population Report Click the Open Report button The Sequencher Report Viewer opens in a new window Figure 13 23 Variance Table Reports drop down menu Variance Table Reports e Entire Table ts E Report Format Population Report nd Variance Table Report Cancel Individ
95. appen Deleting bases You can delete bases in the middle of a sequence by simply highlighting them and then using the Delete key Sequencher asks if you want to fill the gap with bases moved from either the left or the right of the void you have created Click on either Yes Fill Void From Left or No Fill Void From Right button Figure 12 4 Sequencher then moves the rest of the bases accordingly Click on Cancel if you do not want to delete anything You can also perform the deletion by going to the Sequence menu using the Delete Bases command and then choosing either Fill Void From Left or No Fill Void From Right from the submenu SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 89 Figure 12 4 Fill Void dialog box 1 When deleting the bases to the right or to the left of the deletion can fill LD inthe empty space The relative positions of the fragments seem to indicate filling in bases from the left would be appropriate Delete Bases Fill From Right Yes Fill Void From Left TAGAGTGGAGGTG AGGIgTGACAGCCGTAGG No Fill void From Right pd GCCGTAGCATTTT Cancel Delete Bases Fill From Left Iw Continue Editing Hints Deleting bases from the 5 or 3 ends Although you may have automatically trimmed your sequences for poor quality data when you imported them see Chapter 6 Preparing your data for assembly you may still need to delete a few 5 bases to correct any
96. apping all cutsites Hoa Catters BomiI Bsp106 BetXI EcoRI EcoRV KindIl NotI Sall Smal Spel XbaI amp XhoI SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 138 Choose the Text representation Figure 16 4 to list the cut sites in tabular form In this view the number in parentheses following each enzyme shows the number of times that particular enzyme cuts Figure 16 4 Text restriction map Anal 2 48 707 Drall 5 44 45 328 476 704 Sail 431 PstI 2 631 800 SacI 2 781 1029 Bacll 4 123 234 425 496 Xmalll 1 117 Mapping all cutsites Hoa Catters BamHI B p106 BstXI EcoRI EeoR HindIII NotI Sall Smal Spel XbaI amp XhoI Setting the map width The restriction map normally scales to the width of the window When you print a restriction map it scales to the size of the printed page To set the width of the diagram in inches turn off the Scale to window checkbox and use the elevator button to set the width in inches see Figure 16 5 This option is particularly useful when copying a map to paste into a drawing or presentation program Figure 16 5 Map options showing width in inches Restriction Map Options Cutters Show Iw Unique Cutters V 2 Cutters C Fragment Sizes Iw 3 Cutters e Cut Positions Iw 4 amp More ER Style width Single Line Inches 18 Se Multiple Lines Ls C Text l Scale to widow Iw List enzyme names at bott
97. arch field at the top right corner of the Help Viewer When your search is complete double click on an item to display it Figure 2 1 The Sequencher Help dialog window E Sequencher Help GEN GH Hide Back Home Print Options Contents Index Search Project Window Screen 0 Sequencher Applic A E Assembly Paran E Contig Chromato E Contig Editor Ow E Contig Editor Cut E Sequence Editor E Motif Definitions S Project Window no AbN SPF A Gees me n SE Assemble il a hameters Dirty Data O items Name i Modified E Assemble by Ne B Project Window B Project Window E Trim Ends Scree E Trim Vector Scre E User Preference H Sequencher User v o Preface Using This Mant CH The Project Wint 9 Sequencher amp Project views B View as la E View as st Y gt mE 14210 Je be edited S567 Fe T4839 ER Reference VW J08_14839_U09SEt CnER EI 14969 EI 15095 3 P20_1011MARa_0046E15 2 P20_1011MARa_0045E1S 3 e 13808 enee A J02_13806_0045E1 SNP88 3 Reference Context Sensitive Screens Context sensitive screens provide easy links to information about the region of Sequencher you are currently using If you have the Project Window displayed when SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 912 BPs 69 items 930 BPs 763 BPs 674 BPs 550 BPs 666 BPs 758 BPs 831 BPs 679 BPs 609 BPs 663 BPs
98. at are not covered by sequence data indicating that the status of the base at that position is unknown SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 99 Figure 13 6 Translated Variance Table for sequences in the same contig Compare Translation to Reference Se _ oK Description 10 sequences compared to reference sequence NC_001807a 3 end of contig GWB Comparison Range Unfiltered Base Positions 15884 16571 Amino Acid Positions 1 229 St erre 16 127 TAC 82 Sj 16 172 ACC 97 T 16 184 CCC 101 R 16 199 CCC 103 E 16 196 ATG 105 M 16 202 ge 107 16 205 Se 108 16 208 109 a E TT eeng The Translated consensus Variance Table Sequencher allows you to compare the translation of a consensus sequence to the translation of a Reference Sequence Go to the Contig menu and click on Compare Translation to Reference You can also use the Compare Translation to Reference command to compare the translations of consensus sequences from multiple contigs to the translation of their common Reference Sequence These contigs are formed when you use the Assemble By Name with a Reference Sequence command For both of these operations select one or more contigs in the Project Window that share a common Reference Sequence Then from the Contig menu choose Compare Translation to Reference The Translated consensus Variance Table appears in a new window see Figure
99. atch 85 ety l a leng d oaea AE Quality ei 755 BPs Auto Seq Frag n 2004 AE Quality fi 758 BPs g FutoSeq Frag S 2004 lt AE Quality 794 BPs d futoSeq Frag i 2004 AE Quality ni 796 BPs 5 FutoSeq Frag 2004 AE Quality 798 BPs FutoSeq Frag i 2004 AE Quality 791 BPs h futo Seq Frag A 2004 AE Quality si 805 BPs FutoSeq Frag i 2004 lt AE Quality 796 BPs f FutoSeq Frag i 2004 AE Quality 798 BPs i Guto Zeg Frag You can navigate the list by using the up and down arrow keys To select a continuous list of sequences choose the first sequence in the list and then holding down the Shift key select the last sequence in the list To select a discontinuous list of sequences hold down the Control key while clicking on the sequences Project Window Columns When you are in the list view Sequencher displays the attributes such as the item name or kind of each sequence as a series of columns You can control which columns are displayed Go to the View menu and choose the Project Window Columns command Then choose your desired option from the submenu If you are working with ABI sequences you can view the sample name by going to the Project Window Columns command and choosing the Sample command SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 12 The column labeled Quality displays a value for ea
100. ation in the Enzyme Name and Recognition Sequence fields When you click Done Sequencher adds the new enzyme to the list in alphabetical order SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 142 Changing the recognition sequence The recognition sequence field shows a double stranded sequence If you type in the sense strand the anti sense strand will be calculated automatically Sliders above and below the recognition sequence window are used to move the lines which indicate the cleavage positions You can use the mouse to move the sliders left and right Note The maximum length for a recognition sequence is fifteen bases If you exceed this length the right end will be truncated Salt concentration effects You can record buffer sensitivity with the Effect of NaCl Concentration slider controls The default is an unspecified value for all concentrations of NaCl Use the slider controls to indicate the percentage activity for a given NaCl concentration Saving new or modified enzymes If you enter an enzyme that you will want to use later click Save Enzymes to save the enzyme set as a file Click Load Enzymes to retrieve a saved file Setting the sequence selection in a Sequence Editor When you click on the Cut Map button a full page cut map is displayed If you click between two cut sites Sequencher highlights the resulting restriction fragment Hold down the Shift key and click in the re
101. atogram button in the button bar or go to the Window menu and choose Chromatogram You can scroll either vertically the default or horizontally To change orientation click the appropriate button in the left bottom corner of the fragment chromatogram window SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 129 Note Remember that even if a sequence fragment is incorporated into a contig you can still open its editor by double clicking the sequence name in the list at the left of the contig editor Viewing chromatograms from a contig editor The Sequencher contig editor allows you to view simultaneously all chromatogram data relevant to a consensus base call If you are at the 5 end of the contig Sequencher selects the most 5 base in the consensus and displays all the associated traces If you are elsewhere in the contig Sequencher selects the center most consensus base in the contig display and displays the associated traces This allows you to check the signal strength of any peak in conjunction with its base call and edit your data accordingly Select a contig column by clicking on its base in the consensus line Figure 15 1 Then click the Show Chromatogram button or go to the Window menu and choose Chromatogram Sequencher opens a window to display the traces Figure 15 1 The bases you highlighted in the contig editor will also be highlighted in the trace windows Figure 15 1 Selected c
102. ave a growing data set Sequencher compares all the selected new items to the unselected old items It will also compare the new items to each other It has been designed to increase the efficiency of handling large numbers of sequences in efforts such as DNA library clustering and genome assembly Therefore it will not compare any unselected items to each other again Go to the Contig menu and click on Add Selected Items To Others and then on Assemble Contigs Assemble to Reference The Assemble to Reference command allows you to assemble samples to a single Reference Sequence regardless of inconsistencies between the individual fragments Because it is a many to one comparison instead of the normal many to many comparison Assemble to Reference is much faster than the standard Assemble Automatically algorithm To use this command you need to have a Reference Sequence already designated Click on your sequence and then go to the Sequence menu and select Reference Sequence Now select the sequence fragments you want to assemble including the Reference Sequence Click the Assemble to Reference button or choose the Assemble Contigs command from the Contig menu and Assemble to Reference from the submenu SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 63 Interactive assembly The Assemble Interactively algorithm can be used whenever you want complete control over the assembly of a batch of sequences
103. ble in Review mode Select the cell to be edited in the table then type in your desired change The change will be reflected in the Variance Table and the Contig Editor immediately Note You can create features in the Variance Table by going to the Sequence menu and clicking on the Mark Selection as Feature command Figure 13 15 Comparing Sequences in Review Mode D Green Bases to Reference Sequence DIS Bow o o OX ai E E EE EE DEE RER EE E Description 10 sequences compared to reference sequence E NC_001807a 3 end CAGCCACCATGAATATTGTACGGTACCATAAATACTTGAC NC_001807a 3 end of contig GWB 3 A_GWB_2001 05_PrimerIR ICAGCCACCATGAATATTGMACGGTACCATAAATACTTGAC Comparison Range Unfiltered 3 A_GWB_07061946_PrimerIRIIC AGC CACCATGAATATTGCACGGTACCATAAATACTTGAC Base Positions 15884 16571 s 3 A GWB_2001 05_PrimeriF JCAGCCACCATGAATATTGCACGGTACCATAAATACTTGAC 3 A GWB _07061946_PrimeriF CAGCCACCATGAATATTGCACGGTACCATAAATACTTGAC A_GWB_2001 05_Primer3F A_GWB_07061946_Primer3F 2 A_GWB_2001 05_Primer2R 2 A GWB _2001 05_Primer4F 2 A GWB _07061948_Primer4F Hir e highlight base call disagreements CAGCCACCATGAATATTGCACGGTACCATAAATACTTIGAC 4 highlight ambiguities B Chromatograms fom GWB A_GWB_2001 05_Primer1R Fragment base 16 127 Base 103 of 332 ble C A GCC A C TG A A Ca CIGR AC GGT dd T Idd T d ALT FAT AA Td Td JT JT AT al BR ER The Review Mode and Compare Consensus to Reference The C
104. can change these settings later from within a specific editor When you click an icon in the sets of icons above the ruler your selection is explained and confirmed in the panel below the ruler Figure 21 16 For example use the Preferred Bases per Line counter to increase or decrease the preferred number of bases in each line Note that if you request a line length that will not fit on the printed page Sequencher uses the maximum line length that will fit If you want the margin to be automatically adjusted when you increase the size of a window check the Auto Adjust Margin if Window is Resized checkbox SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 180 Figure 21 16 Format ruler preference settings User Preferences General Settings Use the ruler below to choose the default settings for Futo Save rulers that appear in Sequencher s editor windows Confidence Menu Sound New Project Single Stranded DNA Display Break every 10 bases Chromatogram Single spaced Contig Chromatogram UPPERCASE BASES Contig Feature Motif Font Courier New l2pt Format Ruler Start Stop Preferred Bases per Line 40 gt Variance Table Input Output Auto Adjust Margin if Window is Resized File Import Report Laval E aE 0 EE IESE Ta E Foe DI e El E KEE KENE E Start Stop The Start Stop preferences control the locating of open reading frames fro
105. can dismiss the window with the command from the File menu called Close Window Remember to save your work at this point by going to the File menu and using the Save Project command since none of your trim work will have been recorded onto disk Alternatively use the Auto Save function to save your work at user defined intervals see Chapter 21 Customizing Sequencher and User Preferences SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 34 Trimming vector contamination Selecting sequences for Vector Trimming Select one or more fragment s in the Project Window and go to the Sequence menu and choose the Trim Vector command Note that even if you select contigs the Trim Vector function only affects unassembled fragments Specifying a vector using VecBase After you have selected the Trim Vector command and if you have not previously specified vector insertion sites a window will appear Click the Choose Insertion Site Now button if you are ready to work with the vector trim function Otherwise click on OK to dismiss You can also go to the Window menu under Specify Vector Insertion Sites to see this dialog Once you have pressed the Choose Insertion Site Now button the Vector Insertion Sites dialog box appears In the bottom part of the window you will see that you can screen for up to five vectors at once Load vector information from the VecBase database by clicking the Use
106. ce w ox Options Description 9 sequences compared to reference sequence NC_001807a 3 end of contig JK Comparison Range Unfiltered Base Positions 15884 16571 i SES Pe tee Perel et The consensus Variance Table When you want to compare a consensus sequence to a Reference Sequence you use the Contig menu s Compare Consensus to Reference command You can also use the Compare Consensus to Reference command to compare the consensus sequences from multiple contigs that share the same Reference Sequence These contigs are the result of using the Assemble By Name command with a Reference Sequence For each of these operations go the Project Window and select one or more contigs that share a common Reference Sequence Then from the Contig menu choose the Compare Consensus to Reference command The Variance Table appears in a new window see Figure 13 5 Each cell in the resulting Variance Table will display a consensus base when that base differs from the Reference Sequence Pink shading in the header and footer cells of the Variance Table highlight contigs where the consensus sequence does not cover the span of the Reference Sequence The pink X s mark specific cells where coverage is missing SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 98 see Figure 13 5 It is possible for a sequence to have partial coverage a pink header and footer but not have any pink X s in
107. ch Auto Save Use the Idle Time Before Auto Save slider to set how long your computer should be idle before Sequencher executes an Auto Save The latter setting will prevent Sequencher from performing an Auto Save while you are typing SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 172 Figure 21 5 Auto Save preference settings User Preferences S e e Settings P al Jv Auto Save Project Files A Confidence Label amp Name Menu Sound New Project Display Chromatogram Contig Chromatogram Contig Feature Motif Format Ruler Start Stop Variance Table Input Output File Import Report Confidence Iw Ask Before Each Auto Save Time Between Saves minutes Idle Time Before Auto Save minutes SE 2 Many of the new base callers generate confidence values associated with each base Sequencher supports confidence values from PHRED ACE Trace Tuner SCF ABI ESD and compatible files The Confidence preferences control the display of base calls and confidence values from these files Sequencher s default settings show confidences below 20 as dark blue the midrange values as a medium blue and high confidences that is above 40 as a light blue Change the threshold values by altering the numbers in either Confidence Ranges box Figure 21 6 Confidence Ranges settings User Preferences General Settings Futo Save Confidence Label
108. ch sequence that has confidence scores The Quality value is the percentage of bases in a sequence that is above the Low Confidence Range threshold The default setting is 20 You can alter the Low threshold value in the Confidence pane of the General settings See Chapter 21 Customizing Sequencher and User Preferences for more details You can sort your list by item name size quality kind label or modification date Click on the title of the column you want to use for your sort For example to sort by size click the word Size at the top of that column Sequencher will reorder the list by size You can also sort the list by going to the View menu choosing Sort Cleanup and then selecting from the options on the submenu If you sort by Kind the order of precedence is first an unassembled Reference Sequence or any Contigs which contain Reference Sequence fragments then Contigs without Reference Sequences and finally Sequence Fragments at the bottom of the list Figure 3 8 Project Window Columns submenu Project Icons As LW Sort Cleanup D Project Window Columns Sample Expand ll v Size Collapse All v Quality ms EL v Kind Base Ambiguities As v Label Base Edits As es Display Color B v Modified isplay Color Bases Conners Display Features Display Motifs Colors As Backgrounds 4 vy Display Base Confidences Note You can toggle between types of views if you hold down the Alt key and click in the header area just ab
109. choosing a new one from the drop down menu Note The probable number of contigs that can be formed using this handle is indicated in square brackets to the right of the handle Figure 10 5 Assembly Handles drop down menu Origin amp Clone 16 4 Origin 10 Clone 16 g You can also click on the Name Settings button and then click on the radio button next to your preferred handle Enabling Assemble by Name There are two places from which you can enable Assemble by Name From the Project Window click on the AbN button in the button bar If you are in the List View you will notice a new column titled Handle which lists the active handle for each sequence You will also see that the text of the assembly command buttons has changed to Auto Assemble by Name and To Reference by Name The new assembly status is also reflected in the current parameters above the column headers SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved ZS Figure 10 6 The Project Window with Assemble by Name enabled Assemble by Name SPF A OX Assembly Parameters ap Auto Assemble by Name Assemble Interactively To Reference by Name Parameters Assemble by Clone Dirty Data With ReAlignen Min Wa 20 Min Match 85 2 items selected out of 212 po Name Harte Size ing Megtei E 1S_AS_2001 X_Primert F 408 BPs AutoSeq Frag Thu Sep 23 2004 8 19 31 DM a E IS_AS_2001 X_Primer1R 332 BPs AutoSeq Frag Mon
110. cing there is an established standard reference for human identification This calculation is based on the coverage of fragments at a given position and taken from work at the US Armed Forces DNA Identification Laboratory AFDIL in Rockville Maryland e All positions with a coverage of only one fragment are marked as N ambiguous e All IUPAC codes apart from ACG and T are treated as N e If any positions disagree where the coverage is between two and four this position is marked as N If the coverage is between five and seven any position with a disagreement will be marked as ambiguous e If there are two or more disagreeing bases at a position this will be called an N regardless of the coverage Figure 11 9 Consensus to Forensic Standards example GCAATCAA CCTTCAACTA GCAATCAA CCTTCAACTA GCAATCAA CCTTCAACTA GGAAATAGNTCAACTA ANTA 30 40 GCANNNAANNNNTCAACTA Assigning a Reference Sequence To designate a sequence as a Reference Sequence select the sequence icon in the Project Window and check the Reference Sequence item in the Sequence menu From now on that sequence icon will include a small letter R to remind you that it has been marked as a Reference Sequence see Chapter 7 The Reference Sequence for more information SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 84 12 Editing Contigs In this chapter we explain how to find bases such as ambiguities and low conf
111. code You can take any one of the pre existing genetic codes and edit it in the genetic code editor to change the codon translations The genetic code editor has two main parts abbreviations and three letter or one letter codes Go to the Window menu and choose Genetic Code Choose the code you want to edit and then click the table entry you want to change Finally click the abbreviation you want in that position To undo any changes select the appropriate genetic code from the Reset Code pull down menu Abbreviations To edit the abbreviations click the Abbrvs button in the bottom right corner of the dialog box Another dialog box Figure 21 3 then lets you change both the three letter abbreviations for the amino acid names and the corresponding one letter codes The standard abbreviations and one letter codes are available as the default cases SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 170 Figure 21 3 Abbreviations editor Amino Acid Abbreviations 1 Letter Codes For Aspartic Acid 3Letter Asp Set to Defaults Remember Window Layout The Remember Window Layout command lets you define default positions for the Contig Editor and Contig Chromatogram when you are editing in the Bases view First you must organize the windows Then go to the Window menu and choose the command called Remember Window Layout Figure 21 4 Select the submenu option called Contig Chromatogram E
112. ct the project you want to work with Click the Open button in the lower right area of the dialog box or click the Return key Working with items in the Project Window To work with items in the Project Window first select the item s you need by clicking on them Then choose the appropriate menu command SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 9 Icon types In the Project Window a sequence is represented by an autorad icon However there are other data types you may have in your project To get familiar with some of the icons Sequencher uses for these data types see Figure 3 3 Figure 3 3 Examples of Sequencher icons A sequence fragment E RSR Frag 0001 g A sequence fragment with edited E q g comments Frag 0002 A contig Contig 0065 H A refrigerator Storage Refr igerator E A Reference Sequence R ref E A sequence in the inverse complement Frag 0002 orientation Other information may be displayed in addition to the basic icon For example the downward pointing arrow on a sequencing image icon shows that this sequence is stored in its original orientation the sequence travels down the gel The arrow points up when the data is inverse complemented as shown in Figure 3 3 above Project views View as Large Icons To display large icons in your Project Window go to the View menu and then choose Project Icons As Then select Large Icons from the submenu
113. ctangle between other cut sites Your selection is extended from the original site you selected When you toggle back to the Bases view you will see that the sequence representing the chosen region also has been highlighted If you wish to display the sequence and the cut map at the same time click the button showing the staggered enzyme cut icon A window with the restriction map appears You can adjust the size of the panes by dragging the splitter bar that separates the scroll bars for each pane Like the full page cut map this window is linked to the Sequence Editor If you click on the name of an enzyme Sequencher boxes the recognition sites If you click between two cut sites Sequencher highlights the resulting restriction fragment Hold down the Shift key and click in the rectangle between other cut sites Your selection is extended from the original site you selected You can copy the bases between the two cut sites by going to the Edit menu and choosing Copy Selection You can use this command to excise a particular restriction fragment by clicking on it in the cut map and switching back to the Bases view Once you are in the Bases view you can remove the highlighted fragment by going to the Edit menu and using the Cut Selection command Setting the sequence selection in a contig editor When you are working in the Bases view of a contig editor you can display a restriction enzyme map by clicking on the Cut Map button in the editor
114. d ReAligment Complete will appear This window displays a summary of the disagreements gaps and ambiguities before and after the ReAlignment Note ReAlignment is not the same as reassembly If you wish to reassemble your sequences you must first dissolve your contig See Chapter 9 Sequence Assembly for more information Moving sequences If you hold down the Ctrl key the grabber tool is invoked It resembles a small hand You can use the grabber tool to drag an entire sequence to the left or right This method of moving entire sequence fragments also works in the Overview The grabber tool is shown in Figure 12 3 You may notice that some or all of your sequence no longer aligns and that a large number of bullets appear in the consensus line If you decide that the new position is not correct you can use the Undo command to restore it to its previous place Figure 12 3 Grabber tool E Contig 0001 DER G CCATTTTTCTCCACTAATATAT CCATTTTTCTCCACTAAGATAT TCCATTTTTCTCCACTATTATA CCATTTTTCTCCACTAATATAT CCATTT TY TCCACTAATATAT 0 540 550 disagreements c CAT TT T TC T CCACTAATATAT s highlight e ee ese esee oeeee ambiguities Select Next See Base pacebs Note Moving sequences in a low coverage region could leave a hole in the middle of the contig This is not recommended since the hole may cause the contig to align inappropriately with other data Sequencher will warn you if this about to h
115. d sequences and contigs are highlighted after import you could also use sequence Labels to differentiate them See Chapter 21 Customizing Sequencher and User Preferences Files from VecBase VecBase is a file of vector sequences in your Sequencher application folder You can import a vector from VecBase just as if it were any other DNA sequence Go to the File SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 20 menu and choose Import then the subcommand Sequence From VecBase The Vector Selection dialog box appears choose the desired file and click Select If you wish to import more than one file you can use Shift or Command click for continuous or discontinuous listings of sequences Creating a new sequence Another way to bring new data into Sequencher is to create a new sequence fragment To do this go to the Sequence menu and choose Create New Sequence Sequencher displays a dialog box asking you to name the new sequence Figure 4 3 The default name in this case Frag 0001 can be set as a user preference A sequence name can be a maximum of 255 characters including any punctuation and spaces but 31 characters is recommended for export functions When you have typed the name you want or if you accept the default name click OK or press the Enter key A new Sequence Editor appears showing the name you selected in the title bar The new Sequence Editor lets you enter and cha
116. dvaadeeta arden tediavebah eee 88 Moving sequencess 3 EN 89 Deleting bases s 2 sh sh eid each dele ced AE AE dad Aen ele ne ee ed aed eh eee 89 Deleting bases from the 5 or 3 end oo sees esseeeseeeeseeseseeseseeseseeseseeseceeseeseseesesessesesseeesesassesaeseeaseeeaeeeeas 90 Inserting gaps Or bases into a Contig eee eseeeeseeeeseesesesscseescseeseseeseaeseescseescsecseseeseeesessesesassesaeseeaeeeeas 90 Making edits from the consensus line oo eee sees esceeeseeeeseeseseeseseesesecsceeseacseeacsesacsesaeesseeeseeesseeaesees 90 Split After Selectionner fied led ed eich hash tel Rel ceed Mee see Raed les eh dee 91 Auto Match tose ssc ai sd haved iere Hes teases Sleds Heath had Heng ee eh en Rhee ee eed ee lh Benes 91 Create new sequence from a Consensus on ese eseeeeseeeeseeseseeseseeseseeseseeseeeseeseseeaesesseseeseseesesasseeasseeaesesaeeeeas 92 Removing sequences from a CONTIG ese eeeeeseeeeseeseseesesesscseeseseeseeesceacseeacsseacsesacseeseseeseeessessesesaeseeaeeeeas 93 Dissolvin ea COnte eniin ee tee RA AA a A Me e 93 L THE VARIANCE TABLE wwinsostsccccsicieieiastsneedaceisiennetiasnnceddebeasneneucanncetanuceeds 94 dhe Variance Lable Stated y EE 94 W atisa Variance aleet 94 The Variance Table and consensus sequences eects eeseeseseeseeeeseneeseescsecscseescsecacsesseseeseeessesasseeaeseeaeeeeas 94 The Translated Variance Table emgeet 95 The Stuenmte oat the Variance Table geet 95 Structure of the Translat
117. e CES Primed K Handie4 C 5 Handle5 C 6 Handle6 CF Handle c 8 Handle Active Handle 1 Date Cancel SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 69 If your Assembly Handles are separated by a single character included in the Name Delimiters drop down menu choose that character from the list Otherwise follow the directions for an Advanced Expression Figure 10 2 The Name Delimiters drop down menu Assemble by Name Settings Name Delimiters Y Underscore Bar Colon l Dash Dollar Equals Period Plus m E Handles C E Handie6 m 7 Handle7 C amp Handles Active Handle 1 Handle1 Cancel Configuring Assembly Handles using Advanced Expressions You will need to create an Assembly Handle using a regular expression if your Assembly Handle is not separated by one of the characters in the Name Delimiters drop down menu What is a regular expression A regular expression is a way of describing a text pattern using letters numbers and special characters These expressions follow certain syntactical rules Starting in the Project Window click on the Assembly Parameters button At the bottom of the Assembly Parameters window click on the Name Settings button The Assemble by Name Settings window appears Choose Advanced Expression from the Name Delimiters drop down menu You will notice that the Define butt
118. e Calls e to Unknowns F Convert all ambiguities to unknown Remove inserted gaps from sequences The Browse button opens a window called Choose a Folder From this window you can choose where to store the new text file s You may create a new folder in which to store your sequences by clicking on the New Folder button at the bottom left of the window Click on the Choose button to record your chosen location The Format drop down menu allows you to choose a format type for your exported sequence You may set the case of the exported sequence the sequence strand to export and the treatment of ambiguities and gaps To choose these settings click on the Options button select the options you want and click OK see Figure 19 2 Finally click on the Export button to execute the command Figure 19 2 Export Sequences drop down menu Export Sequences Export Location CADocuments and EES Settings Administratorn Desktop _Browse Forma ASCII Plain v Options V UselASCII Plain a Unformatted bases onb Note If you have added features to a sequence and chosen GenBank as your export format these will be exported as a GenBank Feature Table Exporting a Consensus To export a consensus sequence click on the contig icon s in the Project Window Then go to the File menu and choose Export and Consensus from the submenu The SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserv
119. e Detail REpOre E 114 Population Repottgis tase s iere ack adh Meta abes geed eieiei 114 Working with Variance Table Reports eeeeeesscececcceeeeeeeenneeeeeeceeeeeeeeenaeeeeeeeeeeeeeea 115 Printing a Variance Table Report 115 Printing selected data from a Variance Table A 116 Exporting a Variance Table Report cece eeceecseeeeseeseeeseseeseeeseeecseeeesessesecsesecsceeseessseesssesseeeeseeesseeseeges 118 Exporting selected sample SeQUeNCES 0 eee cess eeeeeseeeeseeeeseesesecsesecsesecsesecseacsesscsesseseesesacseeasseeaesetaeeeeas 118 Exporting data for selected vartantz rerien aa a 119 Translated Variance Table Report sissscsciccccedeedssanavatie ctdeea Saauatesccadecivsaaviansctlacddeeneetavaans 120 Translated Variance Table Report 2s cneytieine denny heads cdldkn nd ddedunaeuandien 120 Working with a Translated Variance Table Report 120 Exporting a Translated Variance Table Report 120 Exporting selected sample SeQUueNCES eects eeeseseeeeseeeeseeseseeseseesesecseseeseesesesacseeseseeseaeseeaeseeaeseeaeeeeas 121 Exporting data for selected vartantz seis eeseeseeeeseeeeseeeeseescsesseseescsecseeeseesesecacseeseseeseacseeasseeasseeaeeeeas 122 Removing data from a table before export ee eee eee eseeeeeeseseeseseeseeeseecseesesesacsecseeeseecsesaesesseseeaeeeeas 123 14 THESUMMARYRERORT ever eeesgugesugeegekCgegegNDEEEEENENEEegNESEEEEENEEKE Een 124 Ehesummary Report VIG W is scsiecteseea E a ean ates eee eee eae 1
120. e User Preferences for your Variance Table click the Options button in the Variance Table button bar The User Preferences dialog opens in a new window See Chapter 21 Customizing Sequencher and User Preferences for more detailed information Working with the Variance Table Navigating a Variance Table To navigate through any form of Variance Table use the arrow keys to move across the rows or down the columns When you are working with any Variance Table and only want to focus on differences use an arrow key with the Alt key This will skip any cells that match the comparison sequence If you try to move the cursor beyond the edge of the table you will be alerted by a beep Note If you are using the Compare Consensus to Reference command you will see the consensus base s for each contig you have selected in the same position If you are using the Compare Translation to Reference command you will be viewing the consensus codon for each contig you have selected in the same position Sorting the Variance Table The Variance Table s Sort functions are useful when for instance you need to segregate clone sequences that perfectly match your Reference Sequence or cluster sequences of like alleles see Figure 13 14 The Variance Table simultaneously displays differences and calculates summary information about your selections The Table lists the total number of differences for each sequence at the bottom of that sequence s column
121. e bases 0 Ambigs pi BlueKSm 370 good bases 0 Ambigs BlueKSm SEENEN EES You can print out the Vector Contamination window as a record for your lab notebook by going to the File menu and choosing Print This is particularly useful if you use the Show Bases button to show which sequences are to be trimmed You can also sort the window using various criteria by clicking on Sort Items Executing the trim command To perform the vector screen and trim go to the Sequence menu and choose Trim Vector Once you have reviewed your data and are happy with the criteria you have set proceed with the trim by clicking on the Trim Checked Items button Sequencher warns you that this command cannot be reversed with the Undo command To proceed click the Trim button Any red lines or bases will disappear from the Ends Trimming window Now you can dismiss the window with the command from the File menu called Close Window If you wish to revert some or all of your sequences to their original state you can go to the Sequence menu and click on the Revert to Experimental Data command Remember to save your work at this point by going to the File menu and using the Save Project command since none of your trim work will have been recorded onto disk Alternatively use the Auto Save function to save your work at user defined intervals see Chapter 21 Customizing Sequencher and User Preferences SEQUENCHER User Manual 1991 2011 G
122. e es Wenu weg Sound Je label 4 New Project Display Label 5 Chromatogram Iesel Label 6 Contig Chromatogram Il SOS S S Label 7 or Feature Monit Default Names Format Ruler Start Stop E Contigs Contigr Variance Table JE Other Fragments Frag Input Output File Import The 1st asterisk in each name will be replaced with an item number Report which is incremented each time an item of that type is created in the project Menu The Menu preferences control command options that let you optimize the way you work in your own lab Use the buttons under Use Ctrl O For to program the Ctrl O key combination to open a project or open a window Use the pull down menus grouped under User Defined Command Keys to create keyboard shortcuts for any of the menu commands After you have assigned a keyboard shortcut to a menu item the shortcut will be listed to the right of the menu command on the drop down menus SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 174 Figure 21 8 Menu preference settings User Preferences Settings Futo Save Confidence T Label amp Name User Defined Command Keys Use Ctrl 6 For ond E Sequence gt Rename Sequence v New Project Display Use Ctrl For Chromatogram None Contig Chromatogram Contig Use Ctrl 8 For Feature Motif None Format Ruler Start Stop Use Ctrl 9 For Variance Table None Inpu
123. e the Summary Report This is a static report which has a number of options making it a useful addition to the Variance Table for mutation hunting verifying re sequenced fragments comparisons to a Reference Sequence or just as a report for your lab notebook The Summary Report view View by Summary You can display this report by going to the Contig Editor and clicking on the Summary button in either the Bases View window or the Overview Alternatively you can go to the View menu choose Bases Map Overview and then click on Summary Report You will be presented with a new window which shows the assembled sequences within your chosen contig There are five buttons arranged in a button bar see below Button Description Bases This button returns you to the contig editor Overview This returns you to the contig overview Ruler This button brings up a simple text editor like ruler Options This controls which information will be displayed Find This button brings up a window into which you can type a substring and perform a search see Chapter 18 Finding Items SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 124 Summary report display options Sequencher has a default format for the summary report but you can change it to display different types of information Click the Options button or go to the View menu and choose View Options The Summary Options are divided into those
124. eature table qualifiers Genbank Feature Qualifiers convey many different types of information To accommodate this breadth there are several value formats Table 28 2 Feature Qualifiers Qualifier Type Description Free text Free text qualifiers are usually descriptive phrases enclosed in double quotation marks Controlled vocabulary or Controlled vocabulary or enumerated values enumerated values qualifiers are selections from a controlled vocabulary list and are entered without quotation marks Examples of controlled vocabularies can be found in the Appendices to the GenBank Feature Table documentation http www ncbi nlm nih gov collab FT index html Citation or reference numbers A citation or reference number is enclosed in square SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 201 Qualifier Type Description brackets to distinguish it from other numbers Sequences Since 1998 it has not been acceptable to use a literal sequence of bases as the Sequence Qualifier Feature labels The feature label qualifier supports clarity in reporting by making sure your references are unambiguous An example of a feature label would be alcA see example below The figure below shows a typical example of a feature table entry with qualifiers In this example the feature key is CDS The location is expressed as two numbers The qualifiers tell
125. ecial windows that the operating system or Sequencher displays when it needs to alert you to something you need to know or needs to ask you a question Usually a character such as or which separates elements of a sequence name Click twice in quick succession You can set the amount of time you have before the machine decides that you have performed a second single click rather than a double click Press the mouse button and hold it down while you move the mouse and thus the cursor across the screen A very small scroller that allows you to increase or decrease a numerical value by using the mouse An elevator button has an up arrow and a down arrow In this manual enzyme always refers to a restriction endonuclease Chosen or primary sequence Literal meaning typical example or excellent model A rectangle in which the user can or in some cases must enter names or other information The portion of a sequence name between two consecutive delimiters Also known as Assembly handle A hidden menu that looks like a command until you invoke it When you move the cursor over the name of the hierarchical menu it appears to the right of the parent menu A hierarchical menu is indicated by a right pointing triangle A dialog box that requires a response before you can continue with regular actions in the application In Sequencher this is a short subsequence of 50 bases or less The mouse is integral to the interface It c
126. ed 159 Format drop down menu allows you to choose the format type for your exported sequence Clicking on the Options button displays the window where you turn options on or off In most cases you will want to just click on Export and use the original consensus name The Browse button opens a window called Browse For Folder From this window you can choose where to store the new text file s You may create a new folder in which to store your sequences by clicking on the Make New Folder button at the bottom left of the window Click on the OK button to record your chosen location Uncheck the Use Default Names checkbox if you wish to set a specific export name Exporting Contigs To export a contig click on the item you want to export Go to the File menu and click on Export and Contig from the submenu Sequencher displays the export dialog The browse button allows you to choose a disk and folder to store the new text file s The format button allows you to choose the format type for your exported contig You can choose from MSF Nexus Interleaved Nexus Sequential Aligned FastA and CAF You may also set a number of options Clicking on the Options button displays the window where you turn options on or off Finally clicking on the Export button executes the command The Use Default Names option gives each export the name of its contig Uncheck the Use Default Names checkbox if you wish to set a specific export name The Br
127. ed Variance Table 97 Creatine BV AULA CSM KEE 98 Variance Table for sequences in the same contig oo eeeeeeeeeeeeeeseneeseeseseeeeseescseeseseeseeeseeaesesasseeaseeaeeeeas 98 The consensus Variance Table 05290 98 Translated Variance Table for sequences in the same CONTIG 0 eee eeeeeseeeeseeeeseeeeseeeeseeasseeaeseeaeeeeas 99 The Translated consensus Variance Table oo eeeseeeeseeseseeseseeseecsenecseesesecscsesseseeseeeseeasseeaeeesaseeeas 100 Setting the Variance Table e te 101 Restricting the Comparison Ran eee A R E E A 101 Restricting the Translation Range 102 Setting the Variance Table Display Options scceim io aE E 105 Setting the Consensus Calculation for a Variance Table oo ieee eeeeeseneeseeeeseeeesessesesseeeseeeeseeeeaes 106 Mariance Table Opuons tc E E E oo a le oo le ta alee a ate 107 Working with the Variance Table i ciicccciscececesetscncnsecancctdscdaven de caceceavedseesdecnnececenaaeensecae 107 Navigating a Variance Tablette een esses ected d e 107 Sorting the Variance ablenne geesde eas codes Ae aed nde Ea 107 Removing columns from the Variance Table A 108 REVIEW Melen EE EE 108 The Review Mode and Compare Consensus to Reference 0 eee eceeesceecseeseeeeseeeeseeeeseeecsessesesseseeseeeeas 109 The Review Mode and the Translated Variance Table A 110 The Review Modeand Sister Tables est see ee ENEE Bake 111 Variance Table Reports EEN 112 Variance able Report EE 112 Individiial V atiance Report 20 113 Varianc
128. eeaeeseeaeeaeeaeeaeeaeeaeeaeeaeeaeeaeeaeeaes 71 Choosing a New Assembly Handle 0 ccc cccscesceseeseeseeseeseesesseeseeseeseeseeseeaeeseeseeseeaeeseeaeeaeeaeeaeeaeeaeeaeeaeeaeaeeas 72 Enabling Assemble by Name eidele g eieegtegegetegdk od Sege sinus dvacdvacdie sdeasivandvesdea duasdvacdiesese ctrandvagdnerdeecdveedts 72 Setting Assembly Parametersis tics cencsesdiscdeescvacdvesdie clnezevisanecevacdvarendvevaciie cduasesievesdeycdvasevazaresdna sleasevivenereren vacate 73 Performing an Assembly with Assemble by Name 73 11 THE CONTIG EDITOR sscesscetecnustes viens ietsteuscetctarsiatrstscctscetviatecetscctsentwecisies 75 COMES ee 75 EE 75 k nt OVERVIEW WINKOW asia AAEE ET EE EE E AETA E E A TA A 75 Selection UE 76 Checkins coverage UHT EE 76 Overview TSatUre Saia aaa A AREE E RA E A A aR 77 EE RPO OD RRO A EOE BPO PORTO OP ODEO CARTE DEO PE E 77 ett 77 DOM E 77 MIST DEANA BIE LOI SEARE ic A a ae E ere le urea acne le arg ae Rie et 11 Scale Diagram To Window Size 0 0 eesssecsscsecssceesseeseevsceessccacsesecsnescsavscenesecesssesesnsecsavscacsseeesneesenseeeaseaees 78 Da STAM Key EE 78 Labels CH Fragments ais ist 78 n 78 Names Of Fragments At Weft s ctscaiecossiacctisgedageaediaccleigecesszedaagescdeacds vedeasdeaadeacgeaadeacdosedesedeastecedouedsaedeecheaage 78 Positions Of Era Sm EE 79 Start ee EE 79 vii Bage Nuberg At Transitions ee 80 Base Numbers At Every X Bases tee ees 80 Condensed Base Numbers ca
129. eege EENS EENS 61 Refining the Assembly Conditions 0 ceeceessececceeeeeeeeeenneeeeeeeeeeeeeenaaeeeeeeeeeeeeeenaaaees 62 Minim m Match Percentage aanerer a T AE AA EAA vars 62 Minimum Overlap E 62 Maximum Loop Out Size tege dee deed AAT dE de idee 62 Optimization of gap placemen tiis 0c entetesni ene dean gegr nd deet ere 62 Performing the assembly ebessen artgerecht 63 AUILOMAatl GC ASSCM DL EE 63 Adding selected items to others incremental building of contigs 0 0 elec ee eeeseeeeseeeesetseeeseeetaeeeens 63 Assemble to Reference geseet eege eiiiai K Ra REA EA AAVA EEN 63 ele E E 64 Performing an interactive assembly 000 eee eteeeeeeeeseeseseeseseescseeseeeseaesesseseesesesaesesseseesesessesssseeaeeeeaseeeas 64 Changing parameters for an interactive assembly 0 eee eee eseeeeeeeeseeeeseeeeseeseseeseseeseeeseeessesaeseeseesaeeeeas 67 geegent lade hes 67 T0 ASSEMBLE BY NAME wisicssscsssoswcesscessinssterecutccansantvantbacnscetsseisactbacteuteceaites 68 Setting the Assemble by Name Conditions 200 000 eeeeeeessnccceceeeeeeeeeennaeeeeeeeeeeeeeeenaeees 69 Configuring Assembly Handles using a Single Delimiter 0 eeseesceeeseeeeseeeeseeeesesaesesseeetseneeas 69 Configuring Assembly Handles using Advanced Expressions 0 ccseessesesseeeeeseeeeseeeeseeseseeseseeaesesaeeeeas 70 What isa regular expressio neeaaea Ana ERATA OA AOO 70 Setting your Assembly Handle Names ccecesceseeseeseeseeseeseeseeseeseeseeseeseesees
130. eeseesesesseecseeeseseeseesesesaeeeeseeeeseaeaes 164 epes eegenen 165 PapeiDreak Siac decades faecal tied Eeer 165 21 CUSTOMIZING SEQUENCHER AND USER PREFERENCEG 167 VIEW E 167 AIMDISUOUS DASCS ee 167 Edited Bases gerne ee Ae ee e deeg Age CCRT TITER TCC TESTS 167 Display Color ee Ee 167 Colors a8 Backgrounds iticsi 53 45 st het seh ss eee lessees AE sade Sash at Mech ee dea dE AE EA 168 Display Base Confidences 9 20h heehee eh heeds wh ee eel ee Ad 168 Display H s anoen ei i Pace caeaisatvcca ta T ENO O AE E 168 Display MO EE 168 Setting Up CUSTOM E 168 Standard cOding Suter ee eege 168 Configuring Ambiguity Codes ccccccccsssscecsscesencsceaveceacscscensescsnseseavsecasrcsesssecssvecsevsaeassesserecscasecearteses 168 Replacing an existing character keystroke code 0 eescecseeseseeseeeseeeeseeecseesesecacseeseseeseecseeaeseeaeseeseeeeas 169 Saving and loading custom COdES 0 eee eseeeeseeseseeseseeseseeseseeseseeseacseesesecseseesesecseeaesesassesasseeseeeaeaeaes 169 Sh w and hiderambisuity belger e RA TE ee 169 Choosing a g netic code aaien a AAR E E AA IA A E R 170 Editinp a Penetic E 170 breede Eeer ege ee AE OE A E 170 Remember Window Tatta iestteedieeteediengiegeeg A T E E RAAT E A eege 171 UE nisrnsnnnsoniinnia en AR nea E OA Ata a a 172 General gerni nea a E E E T E O E N A AEN a 172 GEIER roeren e AAR A A AAR R E ees e 172 E e 172 Conhidence td stadt tt vied tlt tlhe tal tute iat tulle ta
131. eference Sequence in your contig and you have selected the Reference radio button you will be able to show translations for the Reference Sequence Click on the Reference check box at the bottom of the Summary Options dialog window Protein translations for Fragments To show protein translations for fragments click on the Fragment check box in the Summary Options dialog box Matching Proteins As Dashes To show Matching Proteins As Dashes click on the check box in the Summary Options dialog box SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 127 Using the formatting ruler You can use the formatting ruler to change the blocking for example to groups of 3s instead of 10s or to show protein translations See Chapter 8 The Sequence Editor for more information on the formatting ruler Click the Ruler button in the button bar or go to the View menu and choose Display Format Ruler You can use the smaller font options in conjunction with the landscape page format to obtain full width displays of your assembled sequences for use in posters and figures Reverse and Complement a contig You can change the orientation of the contig while displaying any of its views by going to the View menu and choosing Reverse amp Comp You can display the contig s original orientation by choosing Reverse amp Comp again SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights r
132. eferences see Chapter 21 Customizing Sequencher and User Preferences Note You can use the Next Low Confidence Base command to help direct your editing Under the Window menu click on User Preferences and set the Low Confidence range appropriately for the value range you wish to find Go to the Select menu and click on Next Low Confidence Base to move your cursor directly to the bases that require attention Finding Edited Bases You can quickly review edits already made to a contig by typing Ctrl E or by going to the Select menu and choosing Next Edited Base Note This function will not find deletions Performing edits The Edit Command To edit a base first set the Edit mode you wish to use then select the base by clicking on it see Figure 12 1 Now type the new character over the old If you accidentally type the wrong character go to the Edit menu and choose Undo or just type over the mistake Sequencher will recalculate the consensus line automatically If you resolve an ambiguity at a particular position the ambiguity marker below the consensus line disappears see Figure 12 1 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 86 Figure 12 1 A base is selected in the contig editor amp Contig 0012 DoR CATGGTCCTGATCCATTGAACTNGATTATC CATGGTCCTGATCCATTGAACTT CTTATC CATGGTCCTGATCCATTGAACTT CTTATC CATGGTCNTGATCCATTGACCTT CTTATC Ci TGGTCCTGATCGATTGAACTT CTTATC iE
133. elp vik lesc ip ccctessy E E ade ee AS 3 Navigatins Sequench r Helge eesti ee ek lal al ehh tate aac Stl Ahh eh A Sell i ee Sade 4 Context Sensililve SCreenS stat enh Ah AAR EARL A NGA Aah AAS RINT RaR 4 THe b tton EE 5 SEHR ee ee 5 SOQUCU CHEE EE 5 Pile mei EE 5 QIU CI fo este dceteeateced dee ee 5 Selectmen she susie leila eee deena etal a tel aleal a levee AA Beha 5 Contig Mens one E eet ace eee E A ea hana talent eae lL ahead aan a y 6 SEQUENCE IMM ee 6 WAC W MCI E 6 Wao E NEE 6 VSN A N EEE E A E EE N E AAEN 6 EECHER eenegen 6 Contextual MENUS orcii dE eegnen EE genee ege eege 6 Key board SHOrtCuts 2a eneen Se caceseuvanceesde cacgesuvedeven AER Ee 7 3 THE PROJECT WINDOW coviisciioncousmcucccvasneneenibonnmcuninesnnninebueenmeunminainnamonbae wns 8 Seg encher EE 8 About the Project Window eege REENEN EEN NEE 8 Creating a E EE 8 Opening an existing Proj eC eieiei EENS 9 Working with items in the Project Window 0 i eeceesceesceseseeseeeseeeseeeseeeesesseseesesecseseeseceesesasseesesesseeeeseeaeaes 9 ICON Ype Seine iopen rererere tite testes NEETER NOG OTELE ETEA EEO EENE E RER 10 Project VIEWS denu a E A E E S 10 VIEW as Large ICOS sirrimi EENS 10 View as Small Icons suoda eiiiai eee EA d e Meek eds een eh Bish ed eas cad ested enna Meh eh See ee 11 Moving E 11 Clen E 11 View a a LISU ei ceerecccevetie e 12 Project Window Columns EE 12 KRITT 13 Viewing the information for a sequence OF Con 14 Editing the inf
134. emble to Reference Parameters Dirty Data With ReAligner 3 gap placement Min Overlap 20 Min Match 85 Modified Comments AE Quality 755 BPs FutoSeq Frag Sep 27 2004 4 10 09 PM E Quality 758 BPs FutoSeq Frag Sep 27 2004 4 10 07 PM AE Quality 794 BPs FutoSeq Frag Sep 27 2004 4 10 06 PM E Quality 796 BPs FutoSeq Frag Sep 27 2004 4 10 09 PM AE Quality 798 BPs to Zeg Frag Sep 27 2004 4 10 05 PM E Quality 791 BPs go zeg Frag Sep 27 2004 4 10 08 PM AE Quality si 805 BPs to Zeg Frag Sep 27 2004 4 10 07 PM aE Quality 796 BPs FutoSeq Frag Sep 27 2004 4 10 06 PM a Quality 798 BPs futoSeq Frag Sep 27 2004 4 10 05 PM All the sequences and contigs added to this particular sequencing project are displayed in this window Note If you have so many open windows on the screen that it s difficult to find the Project Window go to the Window menu and click on Project Window This will bring the current project to the front As you work if you close an existing project and then want to start a new project go to the File menu and choose New Project Sequencher will open a new untitled project Sequencher will remember the last projects you opened You can see these as a list by going to the File menu and selecting the Open Recent command Opening an existing project To open an existing project go to the File menu and choose Open Project to sele
135. encher and User Preferences Figure 6 2 User Preferences for setting trim criteria when files are imported ER Review Trim Parameters Add Imported Sequences to Trim Window All Imported Sequences OF All That Have Less Than 1500 Bases All That Have a Chromatogram F All That Have Unknown Bases How to set the Ends Trimming criteria The amount to be trimmed is based on the criteria you set for both the 5 and 3 ends of the sequence These criteria can be set independently of each other To review or change those criteria go to the Ends Trimming window and click on the Change Trim Criteria button As you can see in Figure 6 3 you can trim off dye primer peaks set windows of acceptable reliability percentage of the highest peak height 3 end and even set an absolute number of bases For example you could specify that fragments must have SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 32 fewer than 3 N s in the first 20 and last 30 bases To activate specific trim criteria you must first select the checkbox that governs the criteria fields Figure 6 3 The Ends Trimming Criteria window Ends Trimming Criteria 5 prime end Trim ABI primer blobs where GHB consecutive bases remain off the scale Iw Trimming no more than 25 trim until the first 25 bases contain less than 3 ambiguities Iw Trimming no more than 25 trim until the first 25 bases conta
136. ene Codes Corporation Inc All rights reserved 39 7 The Reference Sequence In this chapter we explain Reference Sequences sequences or fragments used as baseline or benchmarks for subsequent comparison We will describe the special features of Reference Sequences We will then discuss how to designate a sequence as a Reference for your project how to assemble sequences to the Reference and how to edit contigs containing a Reference Sequence What is a Reference Sequence A Reference Sequence is any sequence that you have selected to act as a model for your subsequent comparisons You may have obtained this sequence from one of the public DNA databases or you may have characterized it yourself Once you have marked your sequence as a Reference Sequencher attaches certain properties to it Why use a Reference Sequence There are many situations where you might want to designate one fragment in a project as a Reference Sequence In forensics human identification depends on comparing differences with a standard reference sequence In medical genetics a lab might want to compare the same gene from family members to the specific variant that is known to be part of a disease process In a population study a lab might compare the same gene from thousands or tens of thousands of individuals to a wild type sequence In all of these circumstances using Sequencher s Assemble to Reference command with a Reference Sequence allows you to pinpoin
137. epresents a subsequence or region of a sequence which has some biological significance Assigning a feature is a method of describing and naming such a region Sequencher supports both personal features and GenBank standardized features The Feature Editor enables you to name and highlight sequence regions of special interest Note Features will not appear unless you go the View menu and select Display Features SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 147 Creating and editing features To create or edit features in a sequence click on the sequence icon Go to the Sequence menu and choose Edit Features to display the Feature Editor Figure 17 5 Figure 17 5 Feature Editor dialog box Features from rCRS Feature Key misc_feature Feature Name ui Hil Iw Display Feature in Editors Feature Location 73 Gan Which strand Complement Style Preview Add Remove To alter default styles go to the Feature Motif panel in user preferences Done To create a new feature click the Add button in the dialog box From the Feature Key menu choose Sequencher if you are creating personal annotations or choose one of the GenBank keys If you have chosen Sequencher as your Feature Key type a name in the Feature Name field Enter the starting and ending base numbers for the feature in the Feature Location boxes The default strand is 5 gt
138. er Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 125 Bullets Pluses and Dashes Clicking the Bullets Pluses boxes highlights disagreements and ambiguities in a line below the consensus If you also click on amp Dashes you are marking positions where the bases in individual fragments match so that the disagreements are more visible Note You can display Bullets Pluses without the amp Dashes but you cannot display amp Dashes without the Bullets Pluses However see Matching Bases As Dashes below Consensus Sequence You can choose to hide the consensus sequence by clicking on the Consensus Sequence box Figure 14 2 shows a summary line without the consensus line but with Bullets Pluses and amp Dashes all checked Figure 14 2 Summary report with no consensus line with bullets pluses and dashes Ha HLA HLAGGG16 301 GACCTGGGGA CCCTGCGCGG CTACTACAAC CAGAGCGAGG CCGGTTCTCA 4EE HLA HLAGGG1G 361 GACCTGGGGA CCCTGCGCGG CTACTACAAC CAGAGCGAGG CCGGTTCTCA D i Reference 361 RNCCTGGGGA CCCTGCGCGG CTACTACNAC CAGAGCGAGG MNCGGTTCTCA DS HLA HL ppo 361 GACCTGGGGA CCCTGCGCGG CTACTACAAC CAGAGCGAGG CCGGTTCTCA DS HLA HLAG G Z 361 AACCTGGGGA CCCTGCGCGG CTACTACAAC CAGAGCGAGG ACGGTTCTCA DS HLA HLAG G 4 361 AACCTGGGGA CCCTGCGCGG CTACTACAAC CAGAGCGAGG ACGGTTCTCA DS HLA HLAGGG1S 361 GACCTGGGGA CCCTGCGCGG CTACTACAAC CAGAGCGAGG CCGGTTCTCA 4E2 HLA HLAGBGG1 301 AACCTGGGGA CCCTGCGCGG CTACTACAAC CAGAGCGAGG ACGGTTCTCA
139. er case letters You can save the motifs in a file on your hard disk by clicking on the Save Motifs button Enter a suitable name for your motif file in the Save dialog window Figure 17 2 Display style pull down menu Motifs Load Motis Find Exact Ambiguous Reverse Matches Matches Allowed v None Blue Cyan Green Magenta Red Yellow v Invert Case Underline KKK ceeneeveevevere To view motifs in editors select the Display Motifs option in the Mem menu Quick motif entry Select the bases in a Sequence Editor then go to the Edit menu and click on Enter Selection As Motif If you choose this command the default style will be used see Chapter 21 Customizing Sequencher and User Preferences Displaying motifs To use the motifs you have entered go the View menu and choose Display Motifs Figure 17 3 shows how motifs are displayed in the contig overview they are the small downward facing colored blocks on the arrows representing the sequences The colors are those you set in the Motif Default Style menu see Chapter 21 Customizing Sequencher and User Preferences Figure 17 3 Overview showing motifs SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 146 C Hole in contig gt E Single fragment Bumps on ES Multiple fragments same direction fragments Ei Both strands show motifs B i Both strands plus hollow Start c
140. es and then browse to and select the file you want to import Click the Open button in the lower right area of the dialog box or press the Return key You may need to select a file format from the drop down menu called Files of Type in order to see the files of interest in the dialog window To see all the files in a particular location choose All Files You can also select from a Folder of Sequences ACE Project CAF Project GCG contig Sequencher project or Sequence from VecBase Working with specific formats is discussed below If Sequencher cannot import the file you will get a warning message to that effect Importing GenBank features When you import a sequence in GenBank format you will automatically import the features including the location the feature keys and feature qualifiers The feature key used in sequences published in GenBank EMBL and DDBJ describes the biological nature of the annotated feature or indicates information about changes to the sequence For more information on features and feature keys see Chapter 17 Motifs and Features and Appendix 28 Feature Keys and Qualifiers Where feature locations described in the GenBank file are ambiguous Sequencher will warn you that it cannot import these features and will list the features in a dialog box you can print out for your records Importing lists of sequences Sequencher s functionality has been modified to take advantage
141. es and subprojects Exporting data from Sequencher Sequencher has a rich set of export formats You can export sequence s contig s or consensus sequence s subsets of your data the Variance Table the Summary Report and even protein translations Sequencher offers you a number of options depending on the type of data you choose to export For each data type you can select a choice of format and the location for the export For some data types there are additional options Sequencher may offer a default for the export Unless you deselect the option to use default names Sequencher saves the file s in the default name The Export dialog box will default to the last location and choice of format used All of the export commands are accessible from the File menu Exporting Sequences To export a sequence or a number of sequences click on the item s you want to export Go to the File menu and click on Export and choose Sequence s from the submenu Sequencher provides a context sensitive dialog box for changing the export options See Figure 19 1 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 158 Figure 19 1 Export Options dialog box Export Options Bases should be exported as Upper Case C Lower Case Strand to export e Sequenced Reverse Complement Current Orientation en exporting extended ambiguities to formats other i than IG convert them to Bas
142. es from a contig When you have aligned several sequences from a contig and displayed the chromatograms several traces appear in a single window one above the other across the width of the window SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 177 Use the Columns For Multiple Traces buttons to tile the data into columns so you can look at more traces at once For example if you select 3 you Il see three columns of traces If your screen and window size allow you to see three rows of traces at once you will be able to view a total of up to nine traces without having to scroll the window Click the Always Scroll To Selected Column checkbox to have Sequencher automatically update the chromatogram window whenever you select a new column of data in the contig window You can have Sequencher remember your window position Sequencher can also compress SCF chromatogram displays Figure 21 13 Contig chromatogram preference settings User Preferences General Setti Barca nae EEan Futo Save OI Confidence Label amp Name Columns for Multiple Traces Men o KS 2 E we Sound New Project Display Jv Always Scroll to Selected Column Chromatogram Compress SCF Chromatogram Display Contig Chromatogram Note SCF data cannot be compressed in Narrow Width mode Contig Feature Motif Format Ruler Start Stop Variance Table Input Output File Import Report
143. eseeaesesaeseesseeeseeeeseeeeats 143 Setting the sequence selection in a Sequence Editor oo eee eeeseeseseeseeeseeeesesecseeeesesseseeaeeesseeeeseeeeaes 143 Setting the sequence selection in a contig editor ee eee eeeseeeeseeeeseeseseeseseeseecseeseseeseseesesetseeeeseeeeaes 143 Copyime the EE 144 17 MOTIFS AND FEATURES iinan praana neidin oonan eneidiaa anaana eiui aaia 145 tere E 145 Entering LCE 145 QUICK REENEN EE edel dE dE 146 Displaying e 146 Ia ET 147 Wh atiS a Teater EIERE AE aes deen nen 147 Creating and editing EE 148 Editing an existing Teature goanen ona an EAE AERO ia 149 Oial EU Te GE 149 Showing and hiding features tee eseeeecesceecssensscecsnescnsocavsceassccscsssessnsscsavscenssseacsssessneeceavseeeseseasensess 150 Listing a sequences E ences wae ee eas eens eee sree eed 150 18 FINDING ITEMS wssociscccstcctsnetndaincaicdneiiattenenctbedatiienndasedalodieaninasnneodatanns 151 Finding the Project Wand ow EE 151 Finding open windows with menu commands 0 eee esceeseeseseeseeeseeeesceeeseesesesacseeseseeseeeseeaeseeseseeaeeeeas 151 Finding open windows in the Project View 0 eseeeeseeeeseeseeeseseeseeeeseeecsecacsesacseeseeeseseeseeasseeaeseeaeeeeas 151 Finding the ctirrent selectron EE 152 Searching in Open Windows ee sed cacisectdvia Veedel 152 eet DEN UE 152 Refining a subsequence Searchh sicce 2cecacs ccceesassaciease cacevessatauunsheacectaveauiaadhasaaceavercvardueas 153 een LEE 153 Matching ambiguous
144. eseeeseeassesssseeaseeeaeeeeas 41 Working with a Reference EIERE Eed eier 42 How to mark a sequence as a Reference oo eeeesceesceseseeseseeseseeseseeseeeseeeesecscseeacsesseseeseseeseseesessssesaeeesaeeeeas 42 Assemble to Reference eniinn aina a aa ERRER REER EARRA eevee oe 42 To Reference Dy NaMe 21 42 Trim to EH 43 Contig Editing with a Reference Sequence oo eeseeseseeseseeseeeseecseeeesesseseesesesseecseeeseseesesasseeaseeaeeeeas 43 Fill Coverage Gaps with Reference ci ege Ee 44 Reference S quence Translation ee 44 8 THE SEQUENCE EDITOR E 45 Opening an existing sequente for editing seseris ieren ir e e RE E E E RE 45 Locked Edit rS seen a EE 45 Basic SGquence edi EE 46 Setting the base nUMD CHiN tee nis vase haves ee ee teeta atin 47 Set Circular Genome EE 47 e Mag Dt RU iat aise neces tis E seated E teat ete nett San et ees Sot at iti ET E Le 47 Duplicating a UE 48 Reverse and Complement ce EE 48 Abo texperime ntal data tele 48 Creating a EE EE 48 Res tting a baseline nenio EAT OAOE OTEO E A E E i 49 Viewing experimental data yz 21 22 testes secs ie aa ARARA RARER R A OARA RARR RR RARE RRE a 49 Reverting to experimental data scscnccccocicciinicirineniciii niee aiiai ia a dee 49 Viewing experimental data for Chromatograms s ssesessssssessestsrststesststststststststnenrsetstststntsrsrsrenrseeresentsent 49 Viewing summary information in the Sequence Editor ssesssessssesrsesessesestsrststststsrsrrreststs
145. eserved 128 15 Chromatograms In this chapter you will learn how to use the chromatograms from an automated sequencer to help you when editing your contigs We discuss how Sequencher displays traces and secondary peaks to find heterozygotes and how you can edit bases from traces or revert to experimental data Working with automated sequencer data When you import a trace file from an automated sequencer Sequencher imports the chromatograms and the confidence values if these are available Note If you import a text file containing just ASCH characters you will not have imported traces To import traces you must import the trace file Text files from an automated sequencer will be only a couple of kilobytes in size whereas trace files will be well over 50 kilobytes When you copy a Sequencher project file from one machine to another you don t need to copy the trace files separately because Sequencher stores the trace information along with everything else in the project file Sequencher compresses the imported traces to conserve disk space so don t be alarmed if a project file containing several sequences from an automated sequencer is smaller than any one of the trace files Viewing chromatograms from a Sequence Editor Sequencher s chromatogram display is tightly integrated with its other editors You can view the entire original trace for a sequence fragment by opening the Sequence Editor for that sequence Click the Show Chrom
146. f demonstrating the Software You may not copy any written materials accompanying the Software Other restrictions You may not rent or lease the Software but you may transfer it and the accompanying written materials on a permanent basis provided you retain no copies and the recipient agrees to the terms of this agreement You may not reverse engineer decompile or disassemble the Software Limited Warranty We warrant that the Software will perform substantially in accordance with the accompanying written materials for a period of 90 days from the date of receipt Any implied warranties on the Software are limited to 90 days Some states do not allow limitations on duration of an implied warranty so this limitation may not apply to you Remedies Our entire liability and your exclusive remedy shall be at our option either a return of the price paid or b repair or replacement of the Software that does not meet our limited warranty and that is returned to us Our limited warranty is void if failure of the Software has resulted from abuse or misapplication We warrant the replacement Software under this limited warranty for the remainder of the original warranty period or 30 days whichever is longer NO OTHER WARRANTIES WE DISCLAIM ALL OTHER EXPRESS OR IMPLIED WARRANTIES INCLUDING THE IMPLIED WARRANTIES OF THE MERCHANTIBILITY AND FITNESS FOR A PARTICULAR PURPOSE OUR LIMITED WARRANTY GIVES YOU SPECIFIC LEGAL RIGHTS YOU MAY HAVE OTHER RIGHTS
147. f the consensus line of a contig For example if a T in the Reference Sequence overlaps a G in another fragment the consensus line will show a Q SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 41 Figure 7 2 Base numbering showing decimal numbers E decimal numbering OX TTTATAAACTTGATGTBAGTACCAATAGAT AAT G TTTATAAACTTGATGTBAGTACCAATAGATAATG TTTATAAACTTGATGTBAGTACCAATAGATAATG TTTATAAACTTGATGTBAGTACCAATAGATAATG TTTATAAACTTGATGT AGTACCAATAGATAATG 5 frag bases selected at consensus position 419 1 Select Next Ambiguous Base spacebar Working with a Reference Sequence How to mark a sequence as a Reference To designate a sequence as a Reference Sequence select the sequence icon in the Project Window and under the Sequence menu select the Reference Sequence command From now on that sequence icon will include a small letter R to remind you that it has been marked as a Reference Assemble to Reference Assemble to Reference is a powerful command which allows you to assemble all the samples you select to a single Reference Sequence regardless of any inconsistencies between the individual fragments Because it is a many to one comparison instead of the normal many to many comparison Assemble to Reference is much faster than the standard Assemble Automatically mode To Assemble to Reference select the sequence fragments you want to assemble Click the Asse
148. file stored in your Sequencher folder Selecting a voice file First make sure your computer sound system is enabled and that the volume is not set on mute Then go to the Sequence menu and choose Speech Then go to the submenu Select Voice File You will not get any audio feedback until the Select Voice file is loaded Identifying a speaker You ll probably be familiar with the voices Gene Codes has persuaded to provide audio for you To hear whose voice is being used go to the Sequence menu and choose Speech and then the Identify Speaker subcommand You can only select this command if a sound file was selected previously Audible keystrokes Any meaningful keystroke you type into a Sequence Editor will be spoken aloud if you go to the Speech command in the Sequence menu and select the Say Sequence Keystrokes submenu That is if you press the A key a voice will say A but if you press the shift key you will not hear any voice Read sequence selection To check the sequence you have entered into the Sequence Editor first select the bases you want the computer to read to you Then go to the Sequence menu click on Speech and then the Read Sequence Selection submenu Note You must place the cursor somewhere in the small window that appears above the sequence as in Figure 8 15 To pause the reading just move the cursor out of the window Figure 8 15 Speak selection cursor and instruction menu p53 genomic Move spea
149. g Gel A T7 dog A 2 Gel A T7 dog Gel A T7 dog d 2 Gel A T17 dog Gel A T dog If your sequence name is complex you may need to write a regular expression that describes the delimiters and the Assembly Handles In the example below the text between the parentheses defines the Assembly Handles Anything not enclosed by parentheses will be treated as a delimiter Assembly Handle 1 Delimiter Assembly Handle 2 Delimiter Assembly Handle 3 You would use this kind of expression with the Expression is a delimiter box unchecked Regular expressions are powerful tools There are many resources on the internet which describe how to use regular expressions Here is one to help you get started http www macadamian com column regular_expressions html SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 192 25 Appendix IUPAC IUB Standard Code O e Q o Base s qa QA QA gt U AorG CorT or U Gor T or U S aK Roud oo gt A or Loi GorC Aor T or U D C G T or U G A T or U A C T or U A C orG zZz lt D A C G T or U Meaning Adenine Cytosine Guanine Thymine Uracil RNA Purine Pyrimidine Keto Amino Strong Weak not A not C not G not T Any SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 193 26 Appendi
150. g data for selected variants Each row in the table represents a variant If you need to export selected rows make your selection by using Shift click for a continuous range or Ctrl click for a discontinuous range Then click on the Reports button The Variance Table Reports dialog box appears The Selected Rows radio button is checked There are four buttons Cancel Open Report Copy as Text and Save Save as Text is the default setting The chosen rows are saved as one table The options in the Reports Format drop down menu are limited to Variance Table Report and Variance Detail Report Click the Save as Text button You will see a dialog window prompting you to assign the name and location of your export You can type a name for the table in this window Click the Save button to save your table as a tabbed text file Although the Selected Rows radio button is checked you can change your selection to include all rows by clicking the Entire Table radio button You can copy your Variance Table in to another document or application that accepts tabbed text To paste the contents of your Variance Table Report in the document of your SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 119 choice click on the Copy as Text button The data can now be pasted into its new location Translated Variance Table Report Translated Variance Table Report The Translated Variance Table Report consists of
151. g experimental data After you enter a new sequence Sequencher archives a copy that is locked not editable In the course of assembling your data you may make a great number of edits to any particular sequence This locked version enables you always to refer back to the sequence as it was originally entered To see the Experimental Data version of the sequence click the Show Experimental button in the Sequence Editor button bar Reverting to experimental data If you edit a sequence incorrectly you can delete all the changes to that sequence and go back to the archived baseline To do so open the Sequence Editor Then choose Revert To Experimental Data from the Sequence menu If you edit a contig incorrectly you can delete all the changes to an individual sequence and go back to the archived baseline To do so open the contig editor Select the sequence by clicking on its icon which can be found on the left hand side of the contig editor You can now remove the sequence from the contig by using the Remove Selected Sequences from the Contig menu Then choose Revert To Experimental Data from the Sequence menu You can then reselect the fragments and rebuild the contig Viewing experimental data for Chromatograms If your data came from an automated sequencer click the button labeled Show Chromatogram to view the experimental data of a sequence This will display the original trace data Sequencher allows you to scroll either vertical
152. g the same function over and over by simply pressing the space bar Figure 15 5 Base change generated by secondary peak Select Next Commands The Select menu provides you with several commands for navigating to bases which need further review or attention see Table 15 1 As you move your selection from each position that requires scrutiny to the next you are likely to need to repeat these commands frequently Therefore Sequencher creates a shortcut for that command in the space bar after the first time you invoke a Next command Press the space bar to move from one selected base to the next candidate To change any Next command to search in the reverse direction combine the command with the Shift key If you use the Next Met To Stop gt 0bp you can highlight the next pair of start and stop codons in one of the three forward reading frames The number of bases shown in this command depends on whether you specified a preference for a minimum length in the User Preferences SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 133 Table 15 1 Summary of Select commands Select command Contig Next Ambiguous Base Ambiguous bases Disagreements First base in large gap run Next Contig Disagree Disagreements Next Edited Base Edited bases Next Low Confidence Base Any consensus base that is derived from a low confidence base Next Met To Stop gt 0bp Any pair of Start and Stop codon
153. ge of sequences and choose the first sequence by clicking on its column header Then holding down the Shift key select the last sequence in the same fashion To select a discontinuous list of sequences hold down the Control key while clicking on the sequences Go to the Edit menu and choose the Remove From Table command Note This does not remove sequences from the underlying contig If you want to print selected samples from your table you can choose a continuous or a discontinuous range of sequences by clicking in the column header as described previously Click on the Reports button The Variance Table Reports dialog box appears see Figure 13 26 A radio button called Selected Columns will be checked Below that you will see a drop down menu called Report Format Choose either Variance Table Report Individual Variance Table Reports Variance Detail Report or Population Report Click the Open Report button The Sequencher Report Viewer opens in a new window Figure 13 26 Variance Table Reports dialog window Variance Table Reports Entire Table Report Format Population Report Cancel Open Report Use the Print Preview button from the button bar at the top of the Report Viewer to preview your report Click on the Print button to send the report to a printer If you want to print selected variants from your table you can choose a continuous or a discontinuous range of base positions by clicking the equivalen
154. gory name to expand the list and show the various preference topics within that category When a category list is expanded the triangle changes to point downwards When you click a preference topic name a Preference Pane appears on the right side of the window and enables you to specify your preferences for that topic Note Each preference setting you select will be stored when you quit the program General Settings In the File menu you will find a command called Open Recent The submenu for this command is a list of projects You can specify the number of recent projects Sequencher will remember in this submenu The maximum number is 99 Sequencher is installed with a set of default values As you work with the program it replaces the default values with your preferences However if you want to restore the original settings you will find a button at the bottom of the Settings user preferences called Reset user preferences to factory defaults This option resets all of the user preferences to their original status Auto Save Auto Save preferences control the timing of automatic saving of project files To use this preference you must have saved your data and given your project a name at least once To activate Auto Save click the Auto Save Project Files checkbox Click the Ask Before Each Auto Save checkbox if you want to confirm the save each time Use the Time Between Saves slider to set how long Sequencher should wait between ea
155. gram as you would any other information SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 162 Figure 19 3 Copy As Protein Translation options dialog box GE Selected Bases Translated Ser 1st Frame Entire Sequence C 2nd Frame Entire Sequence C 3rd Frame Entire Sequence Alternatively you can also go to the File menu Click on the Export command and choose Selected Bases as Protein from the submenu You will be presented with a window similar to that above see Figure 19 3 You will then be prompted with a Save As window Export Overviews If you are looking at the schematic view of a contig you can generate a text version map of the fragments as shown in Figure 19 4 for viewing in other programs or word processors There are two ways to do this 1 Go to the File menu and choose Export then Overview as Text from the submenu Sequencher will treat the map as any other exported file 2 Alternatively you can copy the overview as a picture and paste it into other programs Select the overview window by clicking on it then go to the Edit window and choose Copy As and Picture from the submenu Note When viewing the output you must specify a fixed width font to preserve the scale of the arrows in relation to each other and the fragment names Figure 19 4 ASCII map of sequence Overview of contig Contig 00801 from project ADARC SPF ADARC 4
156. guous Base spacebar Reference Sequence Translation This command is only available when the Reference Sequence is assembled into a contig To see a translation of the Reference Sequence in the notation line below the consensus sequence go to the View menu and choose Reference Sequence Translation The translation has a pale gray border above and below the amino acids to distinguish it from the consensus sequence translation Note As you cycle through the Consensus translation button modes you will notice one mode which translates the consensus sequence in the same frame as the Reference Sequence In this mode the button icon is marked with an r SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 44 S The Sequence Editor In this chapter we explain basic sequence editing setting base numbers and how to reverse and complement your data We then go onto discuss working with experimental data and how Sequencher enables you to find ambiguities work with codon and restriction maps and annotate features You will also learn how to customize your sequence view and use voice verification to help you check base calls Opening an existing sequence for editing To open an existing sequence select a sequence icon and then go to the File menu and choose Open Window You can also just double click the icon to open its editor window Locked Editors If an editor displays experimental data or a seq
157. her and User Preferences for details The IUPAC IUB codes also are included in the appendix to this manual The Sequence Editor works like any other text editor The insertion point can be moved using either the mouse or the arrow keys Note If you hold down the Alt key and use an arrow key the insertion point moves three bases If you hold down both the Ctrl and Alt keys the insertion point moves nine bases If you hold down the Ctrl key and the up arrow the insertion point moves to the beginning of the sequence if you hold down Ctrl key and the down arrow the insertion point moves to the end of the sequence The editor also performs typical operations including Cut Copy Paste and Undo Use the mouse to highlight a selection hold down the Shift key and click elsewhere in the sequence with the mouse to extend the selection There are also two commands for extending a current selection to the beginning or end of a sequence To Left End and To Right End both located under the Select menu in the Extend Selection submenu Once you have made a selection you can copy it by going to the Edit menu and using the Copy Selection command You can also cut the selection by using the Cut Selection command also located in the Edit menu The Paste function will remove non sequence characters You can define a sequence character by going to the Window menu and then using the Ambiguity Editor in the Ambiguity Key Codes option For instructio
158. hin Sequencher it has special properties A special folder in which to store subsets of sequences which need to remain in your project Standard Chromatogram Format A format used to store analyzed data or fragment data for a single sample A chromatogram peak whose height may be less than that of the primary peak and whose presence may indicate that a heterozygote exists at that position A small piece of DNA decoded into its component bases in order represented as text Sometimes in reverse order depending upon the vagaries of the sequencing procedure The window used for editing DNA sequences This editor looks much like a word processor and supports the standard text editing commands Cut Copy Paste and Undo An on screen control that simulates the action of a slide control that might normally be used as a volume or dimmer control on a household appliance The region at the top of a window on the computer A cloning vector sequence database prepared by Friedhelm Pfeiffer in collaboration with William Gilbert Also a file with this name in VecBase CODATA format Part of the Sequencher distribution 208
159. his Fragment 16569 Base Pairs Note Circular numbering can only be used in conjunction with a Reference Sequence You must designate your sequence as a Reference Sequence before you can enable circular numbering See Chapter 7 The Reference Sequence for more information Splitting a sequence You can split a sequence fragment into two pieces for instance at a known exon boundary Put the cursor where you want to split the sequence Go to the Sequence menu and choose Split After Selection Sequencher will ask you if you want to split the sequence after the last currently selected base Click on the Split button to proceed Sequencher will split the sequence into two pieces and label the new fragments for you If SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 47 your sequence was called MyPUC it will be divided into two sequences called MyPUC 5 end and MyPUC 3 end Duplicating a sequence You can duplicate a sequence fragment To do this highlight the icon then go to the Edit menu and choose Duplicate Seq Fragment Sequencher will use the name of the original fragment as a basis for the new fragment s name If the fragment you want to duplicate has a chromatogram associated with it Sequencher will ask whether you also want to duplicate the chromatogram or duplicate the sequence without chromatograms Click on the appropriate button to proceed If you wish to
160. ia review which bases will be trimmed and perform the trim command SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 31 Performing a trim with default settings You can specify how much dirty data should be trimmed off as a function of the number of ambiguous base calls per run of bases by altering the Ends Trimming criteria Each pane in the End Trim window shows how much sequence should be trimmed off There will be a checkbox at an end if it requires trimming Bases to be trimmed will be marked in red You can proceed with the trim by clicking on the Trim Checked Items button Once you have trimmed your data dismiss the window with the command from the File menu called Close Window Figure 6 1 The Ends Trimming button bar Trim Checked Items Change Trim Criteria Automatically selecting sequences for ends trimming You can set the User Preferences so that sequence files are automatically added into the trimming window as they are imported During Import Sequencher loads the sequences that require trimming directly into the trim window To determine which sequences are directly imported into the trim window go to the Window menu and under User Preferences click on Input Output and then select the submenu File Import Figure 6 2 shows the criteria you use to specify which sequences are candidates for direct import to the Ends Trimming window For more information see Chapter 21 Customizing Sequ
161. idence bases We discuss how to perform your edits move and delete bases and sequences insert gaps or bases and create a new sequence from a consensus You will learn how to compare sequences to highlight differences and how to create customized reports Finding bases which need attention You are likely to see a number of issues in your data Some will need to be examined and perhaps edited These issues might be indicated as an N as a disagreement as a gap or as having a low confidence rating You can use one of the Next commands from the Select menu in the consensus sequence of a contig to find any of these problem areas Once you have used any of the Next commands Sequencher will activate the space bar to execute that operation If you use either the menu command or the shortcut key combination two consecutive times Sequencher will remind you that this easier alternative is available Viewing an individual sequence from the contig To look at the data for one of the sequences in your contig double click the sample name in the sequence list Sequencher opens a locked sequence viewer containing the data for that sequence You can also select a sequence in the contig editor and then go to the File menu and choose Open Window Finding disagreeing ambiguities You can find ambiguities quickly by typing Ctrl N or by clicking in the consensus line and going to the Select menu and choosing Next Ambiguous Base This will find data that is i
162. ig menu and choosing Create New Seq From Consensus In addition to creating a new sequence you can use this feature to track the changes made to your contig over time Sequencher displays a dialog box that tells you that you are about to create a snapshot consensus of the selected contig This dialog allows you to control some basic features of the new sequence Figure 12 6 shows the options dialog box for this command Figure 12 6 Create New Sequence From Consensus options dialog box Create New Sequence From Consensus You are about to create a snapshot of the selected contigs consensus sequences Each new fragment will inherit the name of its parent contig followed by an optional time stamp Iw Remove Gaps Retain Large Gaps Iw Include Features Iw Append Time Stamp to name Cancel Check the box to indicate how you want the new sequence to appear If the default setting Remove Gaps is checked then Sequencher will remove all gaps large and small when it creates the new sequence If you want to keep large gaps independently from other gaps then select the checkbox called Retain Large Gaps In Sequencher a large gap consists of 10 or more consecutive bases Such a gap might appear if for example you have used the Large Gap algorithm to assemble genomic and cDNA The Retain Large Gaps option is not available if Remove Gaps is checked Note To see the new sequence go to the Project Window Remember this is a snapshot of
163. ights reserved 131 If you select the Contig Chromatogram section you can specify how many columns of traces you want to view at once whether Sequencher should scroll to the selected column when you make a new selection in the contig and where the window should appear Note If you hold down the Ctrl key while changing the scale the new scale will apply to all the traces in that window If you hold down the Ctrl key while clicking any of the buttons to hide a lane the lane s will be hidden for all the traces in the window See Figure 15 2 above Display secondary peak You can identify heterozygotes by identifying the second highest peak beneath the primary peak If you have a particular candidate for a heterozygote first open the chromatogram for the individual sequence then click on the base call s as shown in Figure 15 3 Figure 15 3 Trace with base selected 20 1DM m P10X2AF 102 Fragment base 48 pere 48 or Ve A TAT T GI AT T Go to the Sequence menu and choose Call Secondary Peaks A dialog box lets you specify how the secondary peak should be called Figure 15 4 Figure 15 4 Secondary peak parameters Secondary Peak Search Minimum lower peak height as percentage of upper Iw Allow Ns to be replaced Allow edited bases to be replaced Iw Only make changes that result in an ambiguity e Iw Search Selection Only Cancel The slider lets you specify how significant the second highest peak must be to ge
164. iginal color The bases from the selected site s are automatically entered into the Vector dialog box shown in Figure 6 8 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 36 Figure 6 8 Vector Dialog box displaying vector and insertion site S Vector Insertion Sites OX Minimum overlap to consider as vector contamination Approx match percentage to consider as contamination Minimum overlap allowed without exact matches Additional bases to remove from a contaminated 5 end gornogrnorigrip Additional bases to remove from a contaminated 3 end Use an asterisk to indicate insertion sites to be screened BlueKim D BamHI T amp Name Lei Polylinker GTTGT AASACGACGGCCAGT GAATT GT AAT ACGACTCACT AT AGGGCGAATTGGAGC CCACCGCGGT GGCGGCCGCTCT AGAACT AGT G GATCCCCCGGGCTGCAGGAATTC Use Vecbase File GATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTAC J H Q PstI D Name A Polylinker SCTITACACTTT Af GCTTCCGGCTCGTATGTTGTGTGGAATT GT GAGCGGAT AAC AA i TTCACACAGGAAACAGCTATGACCATGATTACGAATTCCCGGGGATCCGTCGACCT Use Vecbase File GCA GCCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG GCGTTACCCAACTTAAT putlic Q EcoRI D Name Le j Polylinker CGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGAC GTT GT ABAACGACGGCCAGT GCC AAT ET GCAGGTCGACTCTAGAGGATCCC Use Vecbase File CGGGCGAGCTCG AATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTA CCGCTCACAATTCCACACAACATAC D Name
165. iguous pieces OK Remove Items Dissolving a contig To dissolve a contig first select the contig s icon from the project Go to the Contig menu and choose Dissolve Contig You can also perform this command while you are in the contig editor Sequences from the dissolved contig are shown highlighted in the project It is important to remember that all edits made to a sequence while in the contig will be retained If you want to restore the original sequences you must go to the Sequence menu and click on Revert to Experimental Data SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 93 13 The Variance Table In this chapter we explain how to use the Variance Table an interactive display of the differences among your sequences or contigs We go on to discuss how you find differences and work with your trace and confidence data The Variance Table is useful for SNP analysis mutation detection and clone checking The Variance Table Strategy What is a Variance Table In its simplest form a Variance Table compares and displays the differences between two sequences The data in the Variance Table are dynamically linked to the data in the underlying contigs You can compare some or all of the sequences in a contig to the Consensus sequence the Reference Sequence or the Top Sequence of that contig see Figure 13 1 below This generates a Variance Table which will display the differences
166. igure 8 10 Figure 8 10 Restriction Map button selected with map and sequence shown E p53 genomic DER EIS Sequenced Strand Sequence Length 20303 Residue 1 pal BamHI 4 Bsp106 3 pa 20 Drall 22 EcoRI EcoRV CI Hindili 6 TTCCCATCAA GCCCTAGGGC TCCTCGTGGC TGCTGGGAGT TGTAGTCTGA ACGCTTCTAT CTTGGCGAGA AGCGCCTACG CTCCCCCTAC CGAGTCCCGC GGTAATTCTT AAAGCACCTG CACCGCCCCC CCGCCGCCTG CAGAGGGCGC AGCAGGTCTT GCACCTCTTC TGCATCTCAT TCTCCAGGCT TCAGACCTGT CTCCCTCATT CAAAAAATAT TTATTATCGA GCTCTTACTT GCTACCCAGC ACTGATATAG GCACTCAGGA ATACAACAAT GAATAAGATA GTAGAAAAAT TCTATATCCT CATAAGGCTT ACGTTTCCAT GTACTGAAAG CAATGAACAA ATAAATCTTA TCAGAGTGAT AAGGGTTGTG AAGGAGATTA AATAAGATGG TGTGATATAA AGTATCTGGG AGAAAACGTT AGGGTGTGAT ATTACGGAAA GCCTTCCTAA AAAATGACAT TITAACTGAT GAGAAGAAAG GATCCAGCTG AGAGCAAACG CAAAAGCTIT CTTCCTTCCA CCCTTCATAT TTGACACAAT GCAGGATTCC TCCAAAATGA TITCCACCAA TTCTGCCCTC ACAGCTCTGG CTTGCAGAAT TITCCACCCC AAAATGTTAG TATCTACGGC ACCAGGTCGG CGAGAATCCT GACTCTGCAC CCTCCTCCCC AACTCCATIT CCTITGCTTC CTCCGGCAGG CGGATTACTT GCCCTTACTT GTCATGGCGA CTGTCCAGCT TTGTGCCAGG AGCCTCGCAG GGGTTGATGG GATTGGGGTT TTCCCCTCCC Click the button a window with a multi line restriction map appears You can adjust the size of the panes by dragging the splitter bar that separates the scroll bars for each pane see Figure 8 10 You can also invoke this command by going to the View menu and choosing Display C
167. ii a a A RRRA AERAR AAAA E dii 80 Getting M re TOT AU OM sae e E E E AE E 80 ale NEE 80 Diet nt Aerer lear veces verde ccvacdvusdvacibecevacaviniva eeh A A AE 80 The Bases NICW osscsinanaissatutaest ane sua a E A EE E 80 Workin inthe Bases ME ee Eege 80 VieWINS SEQUENCE NAMeS aii ee ieee E OA ale ere ics eel alate AT 82 Before you e dE LEE 82 Setting the base UMD Sri S sonenn deka decvatends decease eelere AO EO ATERN 82 Consensus Galulatop ege ete a eh AAA A Ee ee 82 CONSENSUS INCIUSIVELY irch Zeie zelt rdbieh det gehk dech ged die fede andudedhecdedzduacdh det gchh de ged dief Zefgeddeh zelt reves 83 Consensus By Pl rality E 83 Consensus to Forensic Standarde 84 Assigning a Reference Sequence cricicccccidisiririiiniiiiiieci tinianu iini iaei 84 12 EDITING ei el AE 85 Finding bases which Melek EE 85 Viewing an individual sequence from the conpg eee ese eseeeeseeeeseeeeseeseseeaesecseseeseeeseeessesseseeaesesacseeas 85 Finding disagreeing Ambiguities 0 eee ee eeeeeseeeeseesesessesesseseesesecseeeesesseseesesesscseesesessesessesaeseeaseeaeeeeas 85 att GE 86 Findins Beet E 86 Finding Edited Bases eerste EENS 86 Pertormin a EE 86 The Edit Commian E 86 Lise 87 Wie Wine EE 87 Collect Gaps ue tea Roches Ete De ROA AERO ERROR RRM 87 Mowing Bases and Gaps sccsstudecbacisdacvapdedcta durch ecduaechesdaus E aust ek dechtetdek et deele EEOAE TRA 88 Using ReAligner to clean tp COmt gs syisstecdesidhestioreepdeavsbendenebetheebedievenesi
168. in the consensus line and enter the character that represents the edit you want to make in that column If you currently have a base selected in a sequence fragment go to the Select menu and choose Contig Column Ctrl K SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 90 Any bases in the sequences above the contig column you select that do not match the character you type will be changed to match the character you type in the consensus line Your edits will appear according to the preferences you set in the View menu Generally this will be magenta and bold text You can also delete bases from the consensus line You cannot use the Undo command to reverse this action if your contig contains a Reference Sequence Figure 12 5 The base is changed E Contig 0001 DER GTGCTTGTCT TATCTCCTA GTGCTTGTCT TATCTCCTA GTGCTTGTCT TATCTCCTA GTGCTTGTCT TATCTCCTA GTGCTTGTCT TATCTCCTA H frag bases selected d Ig TGCTTGTCTMATATCTCCTA consensus position 569 HO Select Next Ambiguous Base spacebar Note Remember that changing bases from the consensus line edits only the sequences after which the consensus is recalculated and displayed Your action does not change the consensus directly Changes in the consensus result from matching sequences with each other and evaluating them according to the type of consensus calculation you have chosen e g by plurality inclusi
169. in less than 13 bases with confidences below 25 Aways trim at least jo bases from the 5 end 3 prime end Trim chromatogram files before the first EY consecutive peaks below 25 of the highest peak Iw Starting 100 bases after 5 trim trim the first 25 bases containing more than f3 ambiguities V Trim from the 3 end until the last 25 bases contain less than 3 ambiguities V Trim from the 3 end until the last 25 bases contain less than 3 bases with confidences below 25 Post fix htaximum desired length after trimming is jo bases trim more from the 3 end if necessary Iw Remove leading and trailing ambiguous bases cancel Using Confidence to Trim Ends In addition to trimming data based on the number of ambiguities at the 5 and 3 ends you can trim sequence data based on the confidence scores assigned by your base caller Confidence scores also called quality values are numbers associated with each base call and which define the likelihood that a base call is incorrect The most common scale is from 1 60 where 60 represents a 1 10 chance of a wrong call and 20 represents a 1 10 chance Depending on the program used the confidence score may be based on peak height the presence of more than one peak and or the spacing between the peaks See Figure 6 3 the Ends Trimming Criteria window for trimming by confidence criteria Reviewing the Trim Each pane in the trimming windows shows schematically how
170. ished assembling your sequences Figure 10 7 The Assembly Completed window Assembly Completed Time Elapsed 00 00 03 Assembled by Origin amp Clone ltems Selected 212 Assembled Completely 9 Comparisons Performed 3 778 Assembled Incompletely 6 This dialog window gives a summary of the assembly process If this information is sufficient click the Close button This will dismiss the Assembly Completed window If you require more detailed information click on the Details button You will see a report that contains further information about the assembly You can save a text copy of this report by clicking on the Save As button Dismiss the dialog window by clicking the Close button Note The name of each contig formed using Assemble by Name will be based on the Assembly Handle used SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 74 II The Contig Editor In this chapter you will learn about the overview and bases view of the contig editor You will learn how to use these options to explore your contig We will discuss the steps to take before you start editing base numbering setting a consensus calculation and assigning a Reference Sequence Contig editing DNA sequencing is an error prone process and so the base calls from an automated DNA sequencer may not correctly represent the sample being sequenced This means that when working with automated DNA sequencing data it is usuall
171. iters and Assembly Handles you are nearly ready to perform your assembly In addition to the standard Auto Assemble by Name command you can use the Assemble by Name function to assemble your sequences with a Reference Sequence or to Mindlessly Join your sequences Under the Contig menu the following Assemble Contigs menu items will change if you have enabled Assemble by Name The Mindlessly Join command becomes Join by Name Similarly the Assemble to Reference button will now be labeled To Reference by Name Before you use the To Reference by Name command you will need to define a Reference Sequence You will also need to choose and set your assembly algorithm and any associated parameters For more details see Chapter 9 Sequence assembly SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 13 Starting from the Project Window go to the Select menu and click on the Select All command to select all the sequences in your project Click on the Auto Assemble by Name button or the To Reference by Name button if you have a Reference Sequence The Assembly Preview window will appear This window contains the names of the contigs that may be generated using your chosen handle and the probable number of fragments in each contig Click on the Assemble button to continue with the assembly or click on the Cancel button Sequencher displays the Assembly Completed dialog window when the assembly has fin
172. ker cursor out of this rectangle to pause DER Click the mouse button or use Command to cancel D Low Confidence 0 0 D Ambiguous 0 0 Selection Length 1 TICCCATCAA GCCCTAGGGC TCCTCGTGGC TGCTGGGAGT TGTAGTCTGA ACGCTICTAT eTrecgcaca AGCGCCTACG CTCCCCCTAC CGAGTCCCGC GGTAATTICTT AAAGCACCTG CACCGCCCCC CCGCCGCCTG CAGAGGGCGC AGCAGGTCTT GCACCTCTTC TGCATCTCAT TCTCCAGGCT TCAGACCTGT CTCCCTCATT CAAAAAATAT TTATTATCGA GCTCTTACTT GCTACCCAGC ACTGATATAG GCACTCAGGA ATACAACAAT GAATAAGATA GTAGAAAAAT TCTATATCCT CATAAGGCTT ACGTTICCAT GTACTGAAAG CAATGAACAA ATAAATCTTA TCAGAGTGAT AAGGGTTGTG AAGGAGATTA AATAAGATGG TGTGATATAA AGTATCTGGG AGAAAACGTT AGGGTGTGAT ATTACGGAAA GCCTTICCTAA AAAATGACAT TTTAACTGAT GAGAA rr SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 56 To speed up or slow down the rate at which Sequencher s audio reads your data go to the Window menu and choose User Preferences Under the General section you will find an item called Sound Click on this to display a slider bar which controls the speed of read back in bases per second To end the read back just click your cursor anywhere on the Sequence Editor window SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 57 H Sequence assembly In this chapter you will learn how to set assembly conditions by using Sequencher s rich variety of assembly algorithms and parameters You will lear
173. key you want to assign to that base code To change a color setting for a base code select the base code from the list on the left of the window Select a different color from the Color drop down menu Saving and loading custom codes You can load and save your customized ambiguity settings by going to the button bar at the top of the Ambiguity Editor and clicking on Load Ambiguities and then Save Ambiguities Show and hide ambiguity helper Sequencher can show a small quick reference window that lists the current ambiguity symbols To bring up this window go to the Window menu and click on Show Ambiguity Helper Close the window with the close box in the upper right corner SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 169 Choosing a genetic code You will find that Sequencher already has the major genetic codes built in You can choose from among these predefined coding systems by going to the Window menu and choosing Genetic Code Select the code you want from Reset Code To pull down menu The genetic code dialog box is shown in Figure 21 2 Use the buttons at the bottom of the box to choose three letter or one letter abbreviations If you chose one letter abbreviations the letter will be aligned with the first left base of the codon Figure 21 2 Genetic code editor Genetic Code oo OOS DEOC oksoe e ZLetters ResetCodeTo w 1 Letter Left Editing a genetic
174. l Output Use Ctrl 0 For File Import Report None oe Eis Use Cmd 0 For C Open Project Open Window Sound Sequencher provides audio feedback to help you maintain the quality of data input When you select the Sound icon you will see the preference pane shown in Figure 21 9 The slider controls how quickly Sequencher reads bases to you Click the Play Audible Welcome at Startup checkbox if you want Sequencher to say hello at startup Figure 21 9 Sound preference settings User Preferences General Settings El Futo Save lt D Confidence Label amp Name Reading Speed bases sec Menu New Project S Display Chromatogram Jv Play Audible Welcome at Startup Contig Chromatogram Contig Feature Motif Format Ruler Start Stop Variance Table Input Output File Import Report Note You have to select a voice file to get audio output For more details see Chapter 8 The Sequence Editor and review the section on Voice Verification New Project This User Preference determines what type of project will be opened by the New Project command SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 175 Click the Use Blank Project radio button if you want your New Project to be blank Click the Use Project Template radio button if you want the project settings to be controlled by a templa
175. le O Compare Translation to Refe TOX Description 10 sequences compared to reference sequence NC_001807a 3 end of contig GWB Comparison Range Unfiltered Base Positions 15984 16571 Amino Acid Positions 1 229 ee Re P 16 127 TAC 82 Y 16 172 ACC 97 HE 16 184 CCC 101 P 16 190 CCC 103 P 16 196 ATG 105 M 16 202 ACA 107 T 16 205 AGC 108 fz Note When Sequencher encounters a gap it skips to the next available base to include it as a component of the codon If an N is in the first or second position of the codon Sequencher displays a question mark instead of an amino acid If the N is in the third position of the codon a residue may be displayed This will depend on the genetic code redundancy SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 97 Creating a Variance Table Variance Table for sequences in the same contig When you are ready to begin creating your Variance Table either select individual sequences from within a contig or go to the Project Window and select a contig by clicking on its icon This will select all of the contig s sequences Then go to the Sequence Menu and choose Compare Bases To and either Consensus Reference Sequence or Top Sequence from the submenu The Variance Table appears in a new window Figure 13 4 Figure 13 4 Variance Table Created with Compare Bases To Reference Sequence S Compare Bases to Reference Sequen
176. le sequence using the lasso tool The selection can be a single base or gap or a number of bases or gaps Begin by making your selection by dragging the cursor across the bases or gaps you wish to move The region will be highlighted Then hold down the Alt key and your cursor will turn into a little lasso tool Hold down the Alt key and click on the highlighted selection you want to move Then drag it to its new location The selection will change to Bold Magenta text in its new position Note If you have used the Large Gap algorithm to assemble sequences you can double click anywhere within the gap region to select it Figure 12 2 The lasso tool around a base to be moved E Contig 0001 DER z CCATTTTTCTCCACTAATATAT CCATTTTTCTCCACTAAGATAT TCCATTTTTCTCCAQTATTATA CCATTTTTCTCCACTAATATAT CCATTTTTCTCCACTAATATAT 0 T540 550 CCATTTTTCTCCACTAATATAT eee cooo eeses Select Next Mwana Base pacebs Using ReAligner to clean up contigs The ReAligner button on the Contig Editor button bar lets you apply the ReAligner algorithm to optimize gap placement in your sequences without first dissolving your contig This is especially useful when you are left with gaps and unaligned bases after removing one or more sequences from a contig SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 88 Click the ReAligner button Once the ReAlignment has finished a new dialog window calle
177. le using Assemble Interactively click the Assembly Parameters button The Assembly Parameters dialog box will appear When you have changed the settings to your satisfaction click OK to return to the Assemble Interactively window Mindlessly Join Mindlessly Join allows you to put sequences together without using the conventional sets of algorithms Examples of situations where you might wish to do this include making a plasmid or constructing an artificial CDNA sequence Select the sequences you want to join by dragging a box around them or Shift clicking them Note They will be listed in the new contig in the order in which you selected them Go to the Contig menu and choose Assemble Contigs and then select Mindlessly Join from the submenu If Assemble by Name is enabled the Mindlessly Join submenu item becomes Join by Name Join by Name uses handles to group the sequences appropriately Sequencher will then ask if you want all the sequences aligned at the left of the contig All Left at the right of the contig All Right or joined End to End Click the appropriate button The selected items will be assembled and replaced by a contig icon in the Project Window Figure 9 9 Join by Name dialog box Join To Form Contig Cancel e All Left C End To End C All Right SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 67 10 Assemble by Name Many labs apply strict sample naming convention
178. licking on the Select All button You can widen your Comparison Range by typing a number into the Flanking Bases box For example by typing the number ten in this box the Comparison Range will include 10 flanking bases on either side of the chosen Feature Key SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 101 Once you have made your selection click the OK button The Variance Table will be rebuilt automatically Figure 13 8 Comparison Range dialog window Comparison Range C Unfiltered ep Feature Key misc_structure x jo Flanking Bases Fred 131 150 Ginger 291 240 mier structure 391 400 Select All Cancel Restricting the Translation Range Reference Sequences are often marked up with GenBank style features See Chapter 17 Motifs and Features for further information You can reduce the scope of your Translated Variance Table to a single feature Some features such as mRNA or CDS may be composed of several elements These elements are concatenated and treated as a single feature Translation of the DNA sequence starts in the first frame with the first base in the feature range Figure 13 9 illustrates an unfiltered Comparison Range a joined feature blue and a single feature pink Figure 13 9 Restricting the Comparison Range using Features Unfiltered Comparison Range LC TI Joined feature Single feature View your Translated Variance T
179. lifiers GenBank Feature tables GenBank Feature Tables provide a way of describing and locating features in a DNA sequence using internationally agreed upon layout and vocabulary Although these tables look complex all tables are comprised of three basic elements which are described in the table below Element Description Feature Key A single word or abbreviation which indicates a functional grouping Location The instruction for where to find the feature in the sequence Qualifier Additional information about the feature Feature tables may look simple or complex depending on the number of annotations in the table The following figure shows a typical entry Figure 28 1 A simple feature table entry Key Location Qualifiers source 1 1509 organism Mus musculus strain CD 1 In the example above the feature key is source and the location is represented by a range 1 1509 A location can be a single base a range of bases a single base within a range etc The qualifier which can be free text controlled vocabulary citation or SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 199 references numbers sequences or user defined feature labels is separated from the location by a forward slash For a more detailed discussion of table entries and their standard typography see http www ncbi nlm nih gov collab FT index html The table below cont
180. ls If you select a sequence and then click on the Trash Can button that sequence will be removed from the project Templates A template is a special type of project that can be set with your choice of parameters and preferences Templates can contain ordinary sequences or a Reference Sequence Preferences can include Feature settings enzyme sets and display settings With templates you can also set Assembly Parameters Assemble by Name handles and Trim parameters These will be discussed later in this manual A template can be used as a new project or imported into an existing project You can use templates to set up standard operating procedures and methods to reuse or distribute throughout your lab SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 15 Save Project As Template You can save any project as a template by using the Save Project As Template command Set the User Preferences and parameters that you want to use You can include a Reference Sequence or ordinary sequences Once you are satisfied with your choices go to the File menu and click on the Save Project As Template command A new dialog window called Template Name will appear Type a name for your template in the text box and then click on the OK button Your project will now be saved in a Templates folder The name of the template will appear in the New Project From Template submenu New Project From Template The New
181. ltiple items Note Unlike other Export commands which may create a number of files on your hard disk this command will create only one new project Export Selected Bases You may want to export selected bases rather than an entire sequence To do so drag the mouse to highlight your selected bases or go to the Select menu and use the Bases by Number command Then go to the File menu and choose Export and click on Selected Bases from the submenu You will then see the Save As window which allows you to choose your format options and preferred location Export Options If you click the Options button in an export dialog box Sequencher provides a context sensitive dialog box for changing the export options Select the options you want and click Export Export Formats When you export a file you may want to specify a file format so other software can access it Click the Format dropdown menu in the export dialog box The menu will display a list of the available formats The Sequencher Export menu is context sensitive which means that it varies based on whether your selection contains a sequence a contig or both For each kind of export you will be prompted to apply appropriate formats See Table below for more information SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 161 Table 19 1 Examples of Sequencher s Export formats Export format type Description Sequence amp ASCII plain U
182. ly the default or horizontally To change the scroll orientation click the appropriate button in the left bottom corner of the fragment chromatogram window See Chapter 15 Chromatograms for more information SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 49 Viewing summary information in the Sequence Editor You can bring up summary information on your data from the Sequence Editor Go to the File menu and choose Get Info The Get Info window in Figure 8 5 provides summary information on the sequence you are currently editing Figure 8 5 Sequence information window Get Info Quality eight E Quality eight Kind AutoSeq Frag ABI Size 755 BPs Mere In project window Original Macintosh HD Users naomithomson Documents Created Won Sep 27 2004 4 10 PM Modified Mon Sep 27 2004 4 10 PM Version Modifiable Comments Type your comments here Base Count 160 As 179 Ts 189 Cs 186 Gs 41 Ambigs D Edits 0 Gaps Confidence 117 Low 58 Med 580 High Show ABI Info If you want to annotate your data with more information than the comment box allows you to see go to the Edit menu and click on Edit Comments Sequencher will open a small text editing window that stores about 250 characters of text with each sequence After you have added text with Edit Comments a small T for Info will appear at the upper left corner of the icon
183. m an editor Use the buttons grouped under On Codon Maps Highlight to indicate whether you want None which gives you the plain map of start and stop codons Use Any Start to Stop gt or Any Unstopped Run gt to give you a shaded box showing open frames of a length you specify Figure 21 17 shows selections in the Start Stop preference pane that will make Sequencher highlight ORFs beginning with a MET and longer than 60 bases Figure 21 17 Start stop codon preference settings User Preferences General Settings futo Save Confidence Label amp Name On Codon Maps Highlight Menu Soe None New Project C Any Starto Stop gt 0 Bases Display C Any Unstopped Run gt fo Bases Length not including start and stop codons Chromatogram Contig Chromatogram Contig Feature Motif Format Ruler Select Next MET to Stop Start Stop The Next MET to Stop command should only Yariance Table make selections that are longer than D Input Output File Import Report Under Select Next MET To Stop you can define the minimum length of ORF selections in a Sequence Editor If you specify a minimum length here for example 30 bases the Next MET To Stop command under the Select menu in the Sequence Editor will change to read Next MET To Stop gt 30b SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 181 Variance Table The Variance Table preferences control how
184. may want to move the splitter item D in the key to the contig window Before you start to edit Setting the base numbering You have control over the base numbering of the consensus For instance you can select any base in the consensus and make it the origin base base 1 All the bases before that position will have negative numbers To set the numbering select a base then go to the Sequence menu and choose Set Base Number with an appropriate suboption Note If you have already used a Reference Sequence in your assembly this will set the base numbering Consensus calculation Under the Contig menu there are three choices for calculating the consensus of your sequences Consensus Inclusively Consensus By Plurality and Consensus to Forensic Standards The consensus is displayed in the bottom line of the contig editor SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 82 and is continuously updated as you edit Thus the consensus will alter after any change you make whether that is altering bases or adding new fragments to your contig Bullets under the consensus highlight discrepancies and pluses indicate ambiguities If you choose a consensus calculation for a project and then save and close the project the consensus choice will be set as the default calculation for that project Consensus Inclusively With Consensus Inclusively Sequencher determines the base in the consensus line
185. mble to Reference button or go to the Contig menu and choose the Assemble Contigs command then click on Assemble to Reference You will get a warning dialog box if you have not included a properly designated Reference Sequence among your selected sequences Note that you use the Assembly Parameters to change the conditions under which the assembly will take place See Chapter 9 Sequence Assembly for more information To Reference by Name To Reference by Name is a special case where the behavior of the Reference Sequence is modified to work with the Assemble by Name command The To Reference by Name button will only be displayed if Assemble by Name has been enabled For more information on Assemble by Name see Chapter 9 Sequence Assembly SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 42 When the To Reference by Name command is used each contig created will contain a Reference Sequence and will also retain the numbering of the Reference Sequence To use To Reference by Name select the sequence fragments and Reference Sequence you want to assemble Click the To Reference by Name button or go to the Contig menu and choose the Assemble Contigs command and then click onto Reference by Name from the submenu Trim to Reference The Trim to Reference Sequence command is used to remove bases in a contig that flank the Reference Sequence on both the 5 and 3 ends see Figure 7 3 T
186. mistakes made during the amplification process Select the bases you want to delete If you are at the 5 left end then click the Forward Delete key Sequencher will delete those bases without moving the entire sequence to the left Similarly if you choose bases on the 3 right end use the Backspace key and Sequencher will automatically delete those bases without realigning your sequence Note When editing from the consensus line you do not have to worry about the bases shifting to the left and right Inserting gaps or bases into a contig If you want to insert gaps go to the Sequence menu and click on Insert Gaps amp Move Bases then choose Right or Left from the submenu You can also create gaps by selecting a number of bases equivalent to the gap size you want to create Press the Tab key if you want the selected bases to move to the right To move to the left hold down the Alt key when you press Tab The space created will be filled with gap marks small colon marks that will appear without disrupting the rest of your contig Once your gaps are in place you can either type the bases you want into the gap using Overstrike When Editing mode or use the lasso and grabber tools to move existing bases into the new position Making edits from the consensus line You can simultaneously edit all the bases in the column above the position you choose in the consensus line instead of individually changing each one To do this select a base
187. mmand allows you to set the number of bases in your DNA circle Select a sequence that has already been defined as a Reference Sequence Then go to the Sequence menu and choose the Set Circular Genome Size command The dialog shown in Figure 22 3 below will appear Enable the circular number by clicking in the checkbox If you have enabled the Cambridge Reference Sequence as your Reference Sequence the number of base pairs in your fragment will automatically be set to 16 569 Dismiss the dialog window by clicking the OK button Note Circular numbering can only be used in conjunction with a Reference Sequence You must designate your sequence as a Reference Sequence before you can enable circular numbering SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 186 Figure 22 3 The Circular Genome Size dialog window Circular Genome Je Enable For This Fragment 16569 Base Pairs How to mark a sequence as a Reference Sequence To designate a sequence as a Reference Sequence select the sequence icon in the Project Window and under the Sequence menu select the Reference Sequence command From now on that sequence icon will include a small letter R to remind you that it has been marked as a Reference For more information on Reference Sequence properties and how to work with a Reference Sequence see Chapter 7 The Reference Sequence for more information New Project From Template
188. much sequence should be trimmed off Blue lines represent the acceptable sequence data The blue line is then flanked by red scissors which mark both the 5 and 3 suggested trims based on the current Trim criteria The remaining red regions of the sequence define the portion of the sequence to be trimmed Click the Show Bases button to see more information on the bases After you have clicked Show Bases the button toggles to Show Overview Sequencher also provides additional control within the Trim Ends window If you want Sequencher to ignore the SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 33 trim command for one or the other ends of the fragment s without modifying the overall specifications just click off the checkbox associated with that trim position Figure 6 4 shows a portion of the base detail for these sequences You can double click on the sequence icon and invoke a Sequence Editor to examine the data in more detail Figure 6 4 Bases view in Ends Trim window Ends Trimming DER Zeiss 9 items in list 9 items have at least 1 check d Quality eight Has Chromatogram 585 good bases 2 Ambigs Antggnnnnennnnnagganceentca COGGCCTGAGGAAGGGTGG CGTCCTCACTAGCCTCCT cgctcacggtagaccaagaccnnnnnn Trim 34 five prime bases 19 Ambigs SK iz Trim 136 three prime bases 20 Ambigs d Quality five Has Chromatogram 733 good bases 1 Ambigs Angnngnntggntngnnn TCTGCCCCCCC
189. n about automatic assembly assembling interactively assembling groups of sequences using sequence name information the large gap algorithm for assembling cDNA and genomic DNA and assembling to Reference Sequences You will learn how to set assembly conditions for each of the different algorithms The Assembly Strategy Sequencher provides you with powerful options for performing your sequence assembly In many cases the default options will perform well However experimental variation can affect your data so there will be times when you may need to change the assembly parameters The following is a basic strategy for assembling your data e Start with strict parameters to minimize the possibility of incorrect matches Select the sequences you want to assemble and use the Assemble Automatically option Automatic assembly relies on an exhaustive search and compare algorithm e If some sequences do not assemble decrease the stringency of the parameters and try Assemble Automatically again e Ifthe selected parameters become relaxed enough that the Assemble Automatically process may result in scientifically insupportable alignments you should switch to interactive alignment so you can exert more control over the process The most frequently used options Assemble Automatically Assemble Interactively and Assemble to Reference are available as prominent buttons in the Project Window In addition Auto Assemble by Name and To Reference by Name
190. name your contigs reposition sequences remove selected sequences and Fill Coverage Gaps with the Reference Sequence or Trim to Reference Sequence Sequence menu The commands in the Sequence menu facilitate most of your work in sequence editing You can set up data entry preferences such as trimming poor quality data or vector contamination edit features create and rename sequences set up a Reference Sequence set up base numbering and Revert To Experimental Data View menu The commands in the View menu let you control how data is displayed as you work on it You can add extra information to the display specify the format and marking of the data and organize project files from the View menu Some of the functions in the View menu have options which you can change by going to User Preferences see Chapter 21 Customizing Sequencher and User Preferences for more information Window menu The commands in the Window menu offer access to different kinds of user help to reference information on various aspects of your data to different windows you have opened and to User Preferences Help menu The command in this menu offers access to user help Context Sensitive menus and buttons Sequencher has a number of menus and buttons that may change depending on the context Some items will become enabled The labels of other items will change This feature is designed so that Sequencher can offer you extensive options within the same eas
191. ncher assumes you have started typing a different name and starts looking for the new one instead Selecting multiple items with a marquee You can select multiple sequences by drawing a box around the icons or list items you want Position the mouse so it is not touching any icons or names The cursor should be approximately where one corner of the box should be Hold the mouse button down and drag diagonally across to where you would expect the opposite corner of the box As you drag the marquee appears as shown in Figure 5 1 As you move the mouse any icons or names touched by the marquee will be selected SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 26 Figure 5 1 Selecting with the marquee Variance Table SPF fel Assembly Parameters AbN Assemble Automatically Assemble Interactively Assemble to Reference Parameters Dirty Data With ReAligner 3 gap placement Min Overlap 20 Min Match 85 Quality Modified P Fri a 663 BPs Dec 16 2005 4 06 10 PM 821 BPs i Dec 16 2005 4 06 10 PM 664 BPs i Dec 16 2005 4 06 10 PM 824 BPs RN i Dec 16 2005 4 06 10 PM 661 BPs i Dec 16 2005 4 06 10 PM 842 BPs i Dec 16 2005 4 06 10 PM 665 BPs i Dec 16 2005 4 06 10 PM 673 BPs i Dec 16 2005 4 06 10 PM 664 BPs i Dec 16 2005 4 06 10 PM JUVE Wt 668 BPs i Dec 16 2005 4 06 10 PM A J12_15095_0045E1SNP88F_P1 663 BPs i Dec 16 2005 4 06 10 PM J12_150
192. nderline all ambiguous bases in the sequence or contig editors Go to the View menu and choose Base Ambiguities As Go to the submenu and choose Underlined to mark ambiguities or Not Highlighted for unmarked ambiguities Edited Bases Sequencher can highlight bases that have been edited which helps you audit the integrity of your data Go to the View menu and choose Base Edits As Select Not Highlighted for unmarked edits Bold Magenta for colored edits and bOLD amp cASE cHANGE for bold and a changed case Display Color Bases Sequencher can display bases in color To turn on this feature for either a sequence or contig editor display choose Display Color Bases from the View menu For information on how to change the color assignments see the section Ambiguity Codes in this chapter SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 167 Colors as Backgrounds Sometimes displaying bases in color does not differentiate them enough You can further enhance the colored bases by going to the View menu and choosing Colors As Backgrounds Sequencher then displays the base as a colored rectangle with the base character printed over it Display Base Confidences Sequencher can represent imported confidence scores as a colored background In order to view base confidence values as colored backgrounds go to the View menu and click on Display Base Confidences Sequencher will only display these backgro
193. ndicated as an N or as a disagreement or gap The Next Ambiguous Base command will also find positions in the contig where the only contribution to the SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 85 consensus is from a base with a low confidence score This type of base will be marked with a plus or a bullet below the consensus line Each time you press Ctrl N Sequencher moves the cursor to the next ambiguity in the consensus starting after the currently selected character After establishing this function you can move to the next ambiguous base by hitting the spacebar or going to the Select menu and using the Repeat Select command If you use the Shift key in conjunction with a Next Ambiguous Base key combination the cursor will move in the reverse direction Finding Disagreeing Bases You can find disagreeing bases quickly by typing Ctrl D or clicking in the contig line going to the Select menu and choosing Next Contig Disagree This type of base will be marked with a e bullet below the consensus line Sequencher moves the cursor to the next disagreement in the consensus starting after the currently selected character and ignoring ambiguities Finding Low Confidence Bases You can quickly locate low confidence bases by typing CtrI L or by going to the Select menu and choosing Select Next Low Confidence Base You can set the ranges for Low Medium and High confidence in the User Pr
194. nerate a change In Figure 15 4 above the slider is set so the secondary peak has to be at least 75 as high as the highest peak If you want Ns to be replaced then select the Allow Ns to be replaced checkbox SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 132 If vou ve already edited bases by hand and don t want them changed you must deselect the checkbox called Allow edited bases to be replaced If you select Only make changes that result in an ambiguity Sequencher may change an ambiguous base call to an A C G or T if it does not meet the secondary peak criteria If you prefer it to remain ambiguous do not select this option If you wish to search just a range of bases highlight them and check the Search Selection Only checkbox When you click OK to make the changes a dialog box notes how many bases will be changed you can choose to Cancel or Continue at that point If you continue the changes take effect Once they have taken effect unlike normal edits to a base they cannot be undone Once you have pressed the Continue button you can find all the changes made during the session by selecting the first base in the sequence you can click on it right on the chromatogram and going to the Select menu and clicking on Next Edited Base After you execute any Select Next command Sequencher creates a shortcut for that command in the spacebar so you can continue to search for your edits usin
195. nformatted Plain text Consensus formats AFDIL Fitch Genentech Specialist and legacy formats IG Strider GenBank NBRF EMBL Database formats FASTA FASTA Commonly used formats concatenated GCG Nexus PAUP interleaved Phylogenetic program format Nexus PAUP sequential Phylip Phylip 3 Phylip4 SCF 2 0 SCF 3 0 Standard Chromatogram Format Contig formats CAF Common Assembly Format MSF Multiple Sequence Format FASTA aligned Phylogenetic program format Nexus Paup Phylogenetic program format Subproject formats CAF Common Assembly Format FASTA Commonly used formats Sequencher Older project file formats Note SCF Standard Chromatogram File format is a file format for exchanging data between different sequencing systems that use four color chromatograms to show sequencing data Most current sequencing hardware supports this file standard Exporting protein translations Sequencher can automatically translate bases into proteins as it copies items to the clipboard These protein sequences can then be exported to another file or program To perform this select a portion or all of the sequence and then go to the Edit menu and choose Copy As and Protein Translation from the submenu Sequencher asks you whether you want to translate only the selected bases or whether you want the entire sequence but in a specific frame The default setting is to translate only the bases you selected You can then take this copy and paste it into another pro
196. nge sequence data Just type as you would with a standard word processor When you are finished entering and or editing a sequence click the close button in the top left corner of the window at the left end of the title bar or go to the File menu and choose Close Window Sequencher asks if you have finished editing At this point you can record your data as experimental data or you can tell Sequencher you have not yet finished editing by selecting the appropriate button Sequencher then removes the Sequence Editor window from the screen The sequence is now represented by a sequencing icon in the Project Window Figure 4 3 Create New Sequence dialog box Set Name New sequence s name Frag 0001 Cancel Double clicking a project icon When you double click on a sequence project icon this launches Sequencher and opens the project If a Project Window is already open when you double click on a project icon Sequencher will ask whether you want to save changes to your current project before closing it Click the Cancel button if you do not want to proceed If you want to close the project and save any changes you have made click the Yes button If you want close the project without saving your changes click the No button SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 21 Importing Confidence Scores Many base callers generate confidence values associated with each base call Sequencher
197. ns on trimming ambiguous data and vectors at the time you load your fragments see the chapters Importing Data Preparing Your Data for Assembly and Customizing Sequencher and User Preferences elsewhere in this manual SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 46 Setting the base numbering Open the Sequence Editor and highlight a base Go to the Sequence menu and choose Set Base Number From the submenu choose either As Base 1 or As Base Number If you choose As Base Number you will see a dialog box and can then enter a new number for the selected base Click OK to dismiss the dialog box Note If you set a base to be base 1 and this is not the first base in your sequence every base before it will have a negative number Set Circular Genome Size Sometimes you will be working with circular DNA such as plasmids or even small genomes The Set Circular Genome Size command allows you to set the number of bases in your DNA circle Select a sequence that has already been defined as a Reference Sequence Then go to the Sequence menu and choose the Set Circular Genome Size command The dialog in Figure 8 3 below will appear Enable the circular number by clicking the checkbox Then enter the number of base pairs in your fragment Dismiss the dialog window by clicking the OK button Figure 8 3 The Circular Genome Size dialog window Circular Genome x je Enable For T
198. ntamination The default is zero bases Extra material if any to be dropped off the 3 end of the remaining DNA sequence along with the vector contamination The default is zero bases Once you have finished choosing vectors and setting recognition criteria close the Vector Insertion Sites window SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 38 How Sequencher screens sequences When you execute the Trim Vector command Sequencher screens the selected sequences for vector contaminants using the vector sequences you specified Sequencher starts at the designated insertion site the bullet and then scans outwards Any sequences that are found to contain vector bases are collected in the Vector Contamination window See Figure 6 9 Please note that any contigs you have selected will be ignored as will any sequences containing fewer than 21 bases Figure 6 9 The Vector Contamination window Vector Contamination Trim Checked Items H Sort Items 10 items in list 10 items have at least 1 check AE trev BlueKSm 240 good bases 0 Ambigs BlueKSm Trim 170 five prime bases 0 Ambigs Sh iz Trim 247 three prime bases 0 Ambigs BlueKSm 448 good bases 0 Ambigs BlueKSm Trim 232 five prime bases 0 Ambigs Sh Hz Trim 20 three prime bases 0 Ambigs BlueKSm 245 good bases 0 Ambigs BlueKSm Trim 92 five prime bases 0 Ambigs 5 Ke Trim 304 three prim
199. ntral to Sequencher Users work within the framework of a project A Sequencher project comprises a collection of DNA sequences and contigs contiguous alignments of overlapping sequences that are built from those sequences A project can be as large or as small as you want Sequencher stores the sequences you enter the information on how these sequences fit together to create any contigs you have formed from them and information on user specified parameters that control the alignment operations all combined into a single data file The Project Window displays all of your sequences and contigs Creating a new project When you launch Sequencher by double clicking the program icon a new empty project is created see Figure 3 1 Figure 3 1 An empty Sequencher Project Window Untitled Project DER D Assembly Parameters Assemble Automatically Assemble Interactively Assemble to Reference Parameters Dirty Data With ReAligner 3 gap placement Min Overlap 20 Min Match 85 Guaity Kind Label Modified SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 8 Until you create or import sequence fragments the new project will remain empty As you add sequences to your project and build contigs from them the Project Window begins to look more like Figure 3 2 Figure 3 2 A new project S Untitled Project Assembly Parameters Assemble Automatically Assemble Interactively Ass
200. nts any digit 0 9 Represents any digit A character or special character which is followed by matches zero or more instances of the character A character or special character which is followed by matches one or more instances of the character A character or special character which is followed by matches zero or one instances of the character N A character or special character followed by N where N a whole number matches that number of instances of the preceding character The contents of square brackets describe a list of matching items regardless of order A Use this in square brackets to exclude the other items contained within the brackets The is known as the escape character and it allows the character to be interpreted literally It can also give a standard character a special meaning as in d Matches whatever you type within the parentheses The acts as an or SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 191 You may require a more complex delimiter then those provided in the Name Delimiters drop down menu You can use regular expressions to define these more complex delimiters Table 24 1 Examples of delimiter expressions Delimiter Sequence Name Handle Handle2 Handle3 Handle4 Handle5 Handle Expression Gel A T dog Gel A 17 dog 2 Gel2 A T72 do
201. o create a Translated Variance Table that summarizes the differences between the translations of selected contig consensus sequences in your project and the translation of a common Reference Sequence Translated consensus Variance Table When you are working with multiple samples from multiple sources and have used Assemble by Name with a Reference Sequence you should use this form of the Translated Variance Table Figure 13 1 Variance Table Menu Commands Sope Sequence View Window Saach View Window Help Assembly Parameters Create New Sequence le to Reference Assemble Contigs Consensus 2 aed Compare Bases To Compare Translation To Consensus Inclusively v Consensus By Plurality Top Sequence Consensus to Forensic Standards Fill Coverage Gaps with Reference Call Secondary Peaks Compare Con us to Reference A Compare Translation to Reference Revert To Experimental Data validate Mitotypes Trim to Reference Sequence Trim Ends Create New Seq From Consensus Trim Vector Rename Contig Dissolve Contig Speech r The Structure of the Variance Table Each row in a Variance Table summarizes the variation among all of the selected sequences at a given base position relative to the exemplar see Figure 13 2 The exemplar can be a Reference Sequence a consensus sequence or any other sequence you choose In the consensus Variance Table the exemplar is limited to the Reference Sequence SEQ
202. o use this command go to the Contig menu and choose Trim to Reference Sequence This command is only available when you are in a contig that contains a Reference Sequence Note You cannot undo this action If there are any sequences which do not overlap the Reference Sequence they will be removed from the contig Sequencher will warn you which fragments have been removed in a window which you can print for your records Figure 7 3 Contig with Reference Sequence flanked by overhanging sequence before and after E Before trim to Reference TOX B After trim to Reference TOX D Pa Pr f canen WR Espen p Era f Sunmay ff camen WR Peer AE Quality three ATGGCAAAAAATGAGGTTTT AE Quality one aE Quality two afi Reference aE Quality one E Quality two dei Reference AE Quality seven ES ES 5 frag bases isee Next selected at Ambiguous Base spacebar consensus position 1 Select Next Ambiguous Base spacebar Contig Editing with a Reference Sequence If you try to edit a Reference Sequence which has been assembled into a contig using either the standard Assemble Automatically or Assemble to Reference a warning dialog will be displayed asking if you are sure this is what you want to do You can proceed with the edit by clicking the Yes button You can cancel the warning and continue to edit by clicking the No button The Reference Sequence is protected from any changes you make while you are editing
203. odon frame 1 rectangles i Stop codon frame 2 show features Diagram Key In the Bases view of a sequence motifs will appear highlighted in the manner you specified You may need to deselect Display Color Bases Colors As Backgrounds or Display Base Confidences to see the Motifs more clearly In Figure 17 4 for example all start codons are in lower case type and blue with only Colors as Backgrounds on Figure 17 4 Sequence Editor showing motifs E felc CGTAGACAGGGAGGGAAAGAAGTGTGCAGAAGGCAAGCCCGGAGGCACTTTC 1981 RAGABERIAG CATATCTCATCTTCCCGGAGARARARARARAAGABEIGTACGTCTG koss AGABRRIAAATTTTGAAAGAGTGCZE GGTCGTTTGATAATTTGTCGGGAAA 2091 AACAATCTACCTGTTATCTAGCTTTGGGCTAGGCCATTCCAGTTCCAGACGCAGG CTGAACGTCGTGAAGCGGAAGGGGCGGGCCCGCAGGCGTCCGTGTGGTCCTCCGT GCAGCCCTCGGCCCGAGCCGGTTCTTCCTGGTAGGAGGCGGAACTCGAATTCATT TCTCCCGCTGCCCCATCTCTTAGCTCGCGGTTGTTTCATTCCGCAGTTTCTTCCC Eame ACCTGCCGCGTACCGGCCACTTTGTGCCGTACTTACGTCATCTTTTTCCTA AATCGAGGTGGCATTTACACACAGCGCCAGTGCACACAGCAAGTGCACAG caac GTTTTGGCCCCTAACCGCTCCGTG CCTACCAAGTCACAGACCCTTTTCA If you have a certain set of motifs you want to use for several projects for example if you use motif definitions to highlight certain restriction sites you can save your definitions to a file To do so click Save Motifs at the top of the motifs window and follow the instructions Then click the Load Motifs button to use those definitions in other projects Features What is a feature A feature r
204. of the MacOS X file system If you use the Import menu item with the suboption Sequences OSX allows you to select multiple files for a single import command To select a continuous list of sequences choose the first sequence in the list and then holding down the Shift key select the last sequence in the list The import window selects the two sequences and all of the files in between Click the Open button to import all of the selected sequences in to your project To select a discontinuous list of sequences hold down the Control key while clicking on the file Click the Open button to import all of the selected sequences into your project The Files of Type drop down menu allows you to filter the files that are displayed in the file browser The filters are With Chromatogram Sequences Without Chromatogram SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 18 Sequences Supported File Formats and All Files You may see some files becoming grayed out with different file filters because these files do not meet the import criterion of the current filter see Figure 4 1 where With Chromatogram Sequences is set but some of the files are text only files Figure 4 1 File import Enable option set to With Chromatogram Sequences Look in 9 Sample Data EI ch ES E ADARCI E ADARC E ADARCZ E aDARCS E aparc3 E ADARC4 E aparcs E ADARCE File name Open Files of type
205. oiety gene primer binding site STS locus_tag bound_moiety protein binding site primer Misc recombination gene map gene iDNA misc structure note SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 204 Feature Key Default Feature Qualifier a stem_loop gene stem loop b D loop gene D loop 10 gap gap of estimated_length 11 operon operon operon Source organism Unrecognized x Sequencher Feature Key is for personal annotation ae Legacy keys Se This is used for Feature Keys which are unknown to Sequencher so that they can be imported in to a project SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 205 30 Glossary Name Administrator Agent ASCII Assemble by Name Base caller Button bar CAF Checkbox Click Confidence score SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved Definition Also known as Admin or admin user A user account that typically has privileges which allow the user to change system settings and install software A region in some dialog boxes and also in the contig editor that contains information in text form American Standard Code for Information Interchange the most widely accepted coding system that permits letters numbers and punctuation to be represented in binary computer code A feature
206. oject Window any icons that already have open editors are dimmed To move an open editor to the front just double click the dimmed icon for example the icon for Contig 0002 shown in Figure 18 1 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 151 Figure 18 1 A dimmed icon Sample Data SPF DEAR D Assembly Parameters Assemble Automatically Assemble Interactively Assemble to Reference 3 items _ Contig 0001 Contig 0002 Contig 0003 Finding the current selection In a sequence or contig editor you can always scroll to the currently selected bases by using the Enter key on the number keypad Searching in Open Windows Finding a subsequence You can search for a specific subsequence in an open sequence or contig editor Go to the Select menu and choose Find Bases Sequencher displays the Find dialog box shown in Figure 18 2 In the Find What field type the string of bases you want to find Use the drop down menu to specify the recognition sequence of one of a subset of restriction enzymes available Use the Other option in the drop down menu to type in the name of your enzyme of interest If it is in the database the recognition sequence will be placed in the Find What box Figure 18 2 Find Bases dialog box Find Bases C Exact Matches Specified Bases C Any Ambiguous Base FindwWhat oO SSSS Find Reverse amp Comp Done Find locates
207. olumn chromatograms E Contig Editor LG Overview f Summary cut man po _ show Chromatograms Goes TTACACAGGCCTGTCCAAAGGTATC TTTGAACCAATTCCCATACATTATTS TTACACAGGCCTGTCCAAAGGTATCETTTGAACCAATTCCCATACATTATTS TTACACAGGCCTGTCCAAAGGTATC TTTGAACCAATTCCCATACATTATTS TTACACAGGCCTGTCCAAAGGTATC TTTGAACCAATTCCCATACATTATTS 4 frag bases selected at consensus position 1 003 Select Next Ambiguous Base spacebar B Chromatograms from Contig Editor ment base 635 Base 635 of 727 T T T CB TI T T G Bai ADARCS Fragment base 573 Base 5 3 of 714 A T Ce TT G AT Cc G ZS ADARC4 Fragment base 282 Base 282 of 739 TAT CC Tf T TG A 8 a aa n en ADARCS Fragment base 227 Base 22 A T CHT T T Ad d AA SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 130 When you click the Show Chromatograms button in a region without trace data you will see a No Chromatogram Data message in the Contig Chromatogram window When you move the cursor back into a region where there are fragments with chromatogram data the traces will reappear Understanding the Trace Display Above the traces are two lines of bases The upper line displays the sequence as it currently appears in the editor including any edits you may have made The lower line displays the base calls as originally imported including the trimmed data The arrows to the left show the orientation and relative lengths of
208. om of map Cancel Setting the map caption Use the checkbox List enzymes names at bottom of map to toggle the caption at the bottom of the restriction map It lists all of the enzymes used to make the map see Figure 16 5 above The caption also lists as Non Cutters enzymes that were not mapped For SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 139 example if you were displaying only unique cutters then enzymes that cut more than once would be excluded They would be listed as Cutters that are not mapped Enzymes that did not cut at all would be listed as Non Cutters Getting more information about an enzyme You can get more information on the enzymes in your restriction map or edit the enzymes included in the map In Figure 16 6 where the Multiple Lines style is being used the SacI enzyme is selected Figure 16 6 SacI enzyme selected E Epal 1 c 7 631 800 PstI 2 a o_O O _ 781 1 029 SacI 2 123 234 425 496 Bac 4 i i i i i If you click on an enzyme label in the map and go the File menu and then choose Get Info you can bring up the Restriction Enzymes dialog box You can also use the keyboard shortcut Ctrl I Available enzymes appear in the scrolling list on the left side of the window Sequencher highlights the enzyme you have selected and puts the appropriate information in the Enzyme Name and Recognition Sequence
209. on is now enabled Click on the Define button The Advanced Expression for Name Parsing window appears At the top of the window is a text box where you can type in a regular expression Assemble by Name uses regular expressions in two ways When the Expression is a delimiter box is checked the regular expression you type in lets you define a delimiter option other than one available from the drop down menu SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 70 If the Expression is a delimiter box is not checked your regular expression must completely define each Assembly Handle and Name Delimiter in your sequence name The regular expression you write will not work unless it describes the entire name of your sequences When you type the regular expression into the text field it should be in the form Assembly Handle1 Name Delimiter Assembly Handle2 In the example in Figure 10 3 below a regular expression is used to combine the first two parts of the sequence name Origin and Clone to create a new Assembly Handle Origin amp Clone The Preview button displays the results of your regular expression If you are satisfied click on the OK button Figure 10 3 Advanced Expression for Name Parsing dialog window Advanced Expression for Name Parsing AACA Preview Expression is a delimiter 01301882 01301882 01301882 01301882 01301882 01301882 01301882 1933 45 Or A A A A A
210. on the button changes to reflect which of these choices is active Figure 9 4 Assemble Interactively dialog box Assemble Interactively Candidates Matches Watch Overlap Mismatch Gaps Hew Contig Len HLA HLAO001 Assembly Parameters HLAcHLAO0002 HL amp HLAO0004 HLAcHLAODD0S HLH oppe HLA HL ng HL amp HLAOO010 HL HLA00011 HLA HLAOOD12 disagreements s highlight ambiguities Candidate Match To have Sequencher compare any single sequence or contig with the other items in the Candidates list click on the name of that sequence or the contig in the Candidates list When the comparison is complete the possible matches appear in the Matches list to the right of the Candidates list as shown in Figure 9 5 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 64 Figure 9 5 Interactive assembly showing a candidate and its matches Assemble Interactively Candidates Overlap Mismatch Gaps Rew Contig Len al HLA HLAOODO4 Assembly Parameters HLA HLAODDO2 HLA HLAO0002 HLA HLAO0004 HL amp HLAO0009 HLA HLAOO00S HLA HLAO0018 HLA HLAO000S HLA HLAO0017 HLA HLAO0009 HS HL p HL amp HLA00010 HL HL op HLA HLAO0011 HLA HLA00016 HLAHLAODD12 HLA HLAODD12 ATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTACTCTCGGGGGCCCTGGCCCTGACCY 46 Candidate EE EES 1 10 20 30 40 50 6 If Sequencher fails to find a match as in Figure 9 6 the agent panel displays a message to that effect Figure 9 6 Match not
211. one letter abbreviations for amino acids Base grouping To the right of the translation display icons are the icons that let you choose blocking the number of bases to be displayed in a single group The available settings are 3 5 10 20 and Fill to margin In Figure 8 14 above the icon for a grouping of 10 is selected Line spacing You can choose single double or triple line spacing The three small icons that let you control the line spacing are located to the right of the base grouping icons Figure 8 14 above shows the icon for single spacing selected Case and Font To the right of the line spacing icons is a pair of icons that let you choose upper or lower case for the display In Figure 8 14 above the icon for upper case is selected To the right of the upper and lower case icons is a pull down menu which lets you choose a font and size Only fixed width fonts are displayed ensuring that the rows of bases will line up vertically SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 55 Voice verification Sequencher provides two forms of audio feedback to help you maintain the quality of data input when you are entering information manually from the keyboard You can have Sequencher announce each base as you type it in You can have the computer read the sequence aloud back to you while you look at the original source of the data Sequencher stores the sounds that it uses in a sound
212. ontain Items With Names Containing Sequencher will select the contig s that match your selection criteria You can also use the Select and then Item Named menu option to locate which contig contains a particular fragment With this command you must type the full name in to the Find What box and then press the Find button The contig containing the fragment will be highlighted SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 27 Renaming a sequence or contig Renaming using the mouse To rename a sequence fragment or contig with the mouse click twice on the name of the item This selects the icon and puts a text box around the name Just type in the new name and when you are done click elsewhere in the Project Window If you only want to change part of the name drag the cursor over what you want to replace and then type the replacement text in the highlighted area You can also use the Copy and Paste functions to rename sequences Renaming using the menu If you wish to rename a sequence you can go to the Sequence menu and choose the Rename Sequence command To rename a contig go to the Contig menu and click on the Rename Contig command Sequencher displays a dialog box Figure 5 2 with a field for you to enter the new name Click the OK button when you have finished Figure 5 2 Renaming a sequence Set Name New name My New Name Cancel Labeling items in
213. ontig menu s Compare Consensus to Reference command creates a Variance Table that reports differences from multiple contigs see Figure 13 16 The Review mode lets you navigate efficiently between a difference in one contig and the equivalent position in the next Each column in the Variance Table contains the differences from separate contigs As you change your selection across the Variance Table rows Sequencher closes the Contig Editor and the Contig Chromatogram Editor from your previous selection It will then open the editors corresponding to your current selection Just as you can edit contigs from the consensus line in a contig editor you can also edit contigs from a selection in the Variance Table Review mode Your selection in the Variance Table corresponds to a selection in the consensus of the underlying contig Note Remember that when you type over a base in the Variance Table the underlying data in your contig will also change SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 109 Figure 13 16 Comparing Contigs in Review Mode Compare Consensus to Reference oOx B GWB ey ET Description 5 consensus sequences compared to reference E NC_001807a 7 end ACC AT Aa We sequence NC_001807a 3 end 3 A_GVWB_2001 05_Primer1R CGGTACQCCAT AA A Comparison Range Unfiltered 3 A_GVWB_07061948_Primer1 pl CGOGTACCAT AAA Base Positions 15884 16571 3 A_G
214. ontrols the position of the cursor on the screen and is used to enter some kinds of information See Click Double click Drag Multiple Sequence Format A format used by multiple sequence 207 Name NEXUS Paup Project Project Window Quality score Radio button Reference sequence Refrigerator SCF Secondary peak Sequence Sequence Editor Slider Title bar VecBase SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved Definition alignment programs Format used by phylogentic and cladistic software A project contains sequences information on how these sequences fit together to form larger pieces and parameter information specified by the user that controls alignment operations The window in which Sequencher displays the contigs and unincorporated Sequences of a project Items in the Project Window are can be shown as icons small icons or as a sorted list A number associated with each base call and which defines the likelihood that a base call is incorrect See also Confidence score A control that lets you choose among alternate possibilities Radio buttons always appear in sets of at least two Click one of the buttons to select it A button that is selected is shown with a filled circle buttons that are not selected are shown with open circles A sequence used as a prototype or benchmark sequences If a sequence has been designated as Reference wit
215. ormation for a sequence OF contig eeesceseeseeseeseeseeseeseeseeseeseeseeaeeseeseeseeaeeaeeaeeaeeaseaseaeeaeeas 15 Fhe Project Window bution Dari 29istesidugeteegi eiis geseid siadated a aa geseid saatuaen 15 Template ET 15 Save Project AS Templit nni e e EE AE ANE Th 16 New Project From Templite 2 ees 16 Iipott fromi Template erte SEENEN AE AE 16 A IMPORTING DATA wisi onc cccccscicsiniesinsiccuideninieeiiabinedddaiiieinestauabisecdiueiessneminnaud 17 Quick and easy importing of CAA ee ege E E 17 Dragging and dropping Tiles iii eeiege eene EENS 17 COpy and EE 17 How to import using menu COMMANGS2 eivediesecsnneedecswckestcamnasvecsnneneedamaenvon meee iaamennces 18 NMPOrtin S SEQUENCES mrena EE 18 Importing GenBank features nanena cdhagebagensadve ctnardbecesogehe avagisazesacdes cabazevaeabereee cfhareravenar east eitg 18 Importing lists Of seg entes ee SEENEN EENEG 18 Folder OF sequences mon ranra EE cedkacde EE EE 19 Projects inspecitic KON N a 0E 1 EAA AAN ech EE sav ancusets A R tees 20 Segue cher EE 20 Files froni Near nanan eE ORAE OTO OROORO AEA 20 Creatine EE 21 Double clicking a project 1COM sireroncrnencitiuiicniiiinin niii iiaii iiaii iiia 21 Importing Confidence Serres Aude 22 Importing PHRED called daf renin ear O ORO R RRRA OR AARAA 22 Importing PHRAP Fee ee AAA re eee oe 22 Removing sequences and contigs from a Project sess ssetesseeeeseneeseeseseeseseesesecscseeseeeseeeesesaeseeaeeeaceeeas 23 Clos itis ant Git
216. ove the icons and below the parameter information Viewing constituent sequences When you have contigs in list format click the plus sign to the left of the contig icon Figure 3 9 to see a sublist of the sequences incorporated into that contig That plus sign will turn in to a dash sign and the sequence list will expand see Figure 3 9 To hide a sublist of sequences click the dash sign again it turns to a plus and the sequence list will collapse SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 13 Go to the View menu and click on the Expand All and Collapse All commands to either display or hide all of the contents of the project s contigs Figure 3 9 Viewing a sublist of a contig s constituents E Variance Table SPF SEE D Assembly Parameters Assemble Automatically Assemble Interactively Assemble to Reference bt Parameters Dirty Data With ReAligner 3 gap placement Min TE 20 Min Match 85 1011MARa 705 BPs Sun Mar 12 2006 4 58 37 PM a EN E 13806 913 BPs Sun Mar 12 2006 4 58 37 PM E Si 14210 912 BPs Sun Mar 12 2006 4 58 37 PM J04_14270_0045E7 SMPS8R_ Pt 824 BPs o Fri Dc 16 2005 4 06 10 PM Fererence 550 BPs Tue Dc 73 2005 4 39 43 PM J04_14270_0045E7 SMPS8E_ Pt 665 BPs i Fri ec 16 2005 4 06 70 PM ES B 14667 930 BPs Sun Mar 12 2006 4 58 37 PM ES IS 14839 763 BPs Sun Mar 12 2006 4 58 37 PM E E 14969 758 BPs Sun Mar 12 2006 4 5
217. own menu in the Assemble By Name pane under the Assembly Parameters window now contains the names of your handles Next to each handle is a number enclosed in square brackets This indicates the probable number of contigs you can generate using that handle If you want to use a more complex delimiter you must select Advanced Expression from the Name Delimiters drop down menu Clicking the Define button will take you to the Advanced Expression for Name Parsing window In this window you write and preview the regular expression you want to use You can find more information on regular expressions by going to Appendix 24 Advanced Expressions or for more detail consult the tutorial in the Sequencher Tutorials folder You can find more information on Assemble by Name in Chapter 10 Assemble by Name For information on regular expressions see Appendix 24 Advanced Expressions or for more detail consult the tutorial in the Sequencher Tutorials folder SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 61 Refining the Assembly conditions Minimum Match Percentage The Minimum Match Percentage can be used with all three assembly algorithms It is used to set the proportion of bases which must match in candidate sequences before Sequencher accepts the sequences as actually overlapping The default value of 85 can be changed by moving a slider If this value does not give you any ove
218. owse button opens a window called Browse For Folder From this window you can choose where to store the new text file s You may create a new folder in which to store your sequences by clicking on the Make New Folder button at the bottom left of the window Click on the OK button to record your chosen location If you execute the Export command with the Sequence suboption while a contig is selected Sequencher will create a folder with the name of the contig The folder contains all of the sequences in the contig Exporting Selection as subproject If you wish to share your data with colleagues who may have older versions of Sequencher or another program choose Export from the file menu and then Selection As Subproject then select the appropriate version or type from the Format dropdown menu In certain cases you may want to move some but not all items from one Sequencher project into another Working in the Project Window select the sequence fragments and contigs you want to export Go to the File menu and choose Export and then choose Selection As Subproject Sequencher creates a new project containing only the items you selected Now you can import the newly created sub project into the chosen Sequencher project SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 160 You should remember to provide a relevant name to define the new project because you have derived it from a selection of mu
219. prove this product please contact us You can telephone us at 734 769 7249 fax us at 734 769 7074 or write to us at Gene Codes Corporation 775 Technology Drive Suite 100A Ann Arbor Michigan 48108 http www genecodes com SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved We welcome your comments or support questions by electronic mail at support genecodes com We welcome your general inquiries by electronic mail at gcinfo genecodes com SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 2 Using this manual This chapter will introduce you to the conventions we will be using in this manual and how to get help We will then introduce you to the button bar and Sequencher s menus which offer you a rich range of options while maintaining a scientist friendly interface Conventions used in this manual This manual follows certain conventions for displaying text and pictures and for alerting you to special information Installing Sequencher Sequencher is easy to install Your installation package will include a CD a Sequencher key dongle and an installation guide Follow the instructions in the installation guide to install your software You must have Administrator privileges in order to install Sequencher Sequencher Help Sequencher offers help through a Help viewer To display Help go to the Help menu and choose Seq
220. quences are no longer of interest The Edit menu s Remove From Table command allows you to delete sequences selectively from your Variance Table To select a continuous range of sequences choose the first sequence by clicking on its column header and then holding down the Shift key select the last sequence in the same fashion To select a discontinuous list of sequences hold down the Control key while clicking on the sequences Go to the Edit menu and choose the Remove From Table command Note The Remove From Table command does not remove sequences from the underlying contig Review Mode In Review mode the Variance Table lets you view the data supporting each cell see Figure 13 15 You can access the Review Mode by clicking on the Review button in the Variance Table button bar or by double clicking on any cell in the table Sequencher will open both the Contig and Chromatogram editors with the associated base or column of bases selected You can specify the layout of these three Review windows the Variance Table the Contig Editor and the Contig Chromatogram Editor and then set the new organization as your default layout After you have arranged your windows go to the Window menu and choose the Remember Window Layout command then select Single Variance Table Review from the submenu SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 108 You can edit your data directly in the Variance Ta
221. rands show motifs i B hollow i Start codon frame 1 rectangles SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 79 Base Numbers At Transitions Clicking Base Numbers at Transitions displays or hides the numbers showing approximate positions of the coverage transitions Base Numbers At Every x Bases Selecting Base Numbers Every x Bases shows the base numbers at constant intervals Condensed Base Numbers Selecting the Condensed Base Numbers option changes the font of the base numbers to a compressed version This option can be used with either Base Numbers at Transitions or Base Numbers at Every x Bases Getting more information Find You can search for a specific subsequence in your contig Fragments which contain the subsequence will appear with a heavier line in the Overview You can choose to find the first occurrence by clicking the Find button You can search for subsequent occurrences using the Find Next button Three radio buttons allow you to control the specificity of the search by choosing Exact Matches Specified Bases which would allow you to use ambiguity codes such as W to find T or A You can use the Any Ambiguous Base command which will find any degenerate DNA that may match There is also a drop down menu from which you may choose restriction enzyme sequences If you have used a Reference Sequence and want to include it in the search select the Include Reference Seq
222. references Switch between large icons small icons and list view Names at Left Sequence editor Contig Insertion point moves one base to the editor ummary view right Insertion point moves one base to the left Insertion point moves 3 bases to the right Insertion point moves 3 bases to the left Insertion point moves to 3 end of sequence Insertion point moves to 5 end of sequence Display Formatting Ruler Frame 1 Frame 2 Frame 3 Windows Ctrl L Ctrl M Ctrl Ctrl R Ctrl 4 Ctri 5 Ctrl 1 Ctrl 2 Ctrl 3 Ctri Ctrl Ctrl T Ctrl U Alt click in Title line Ctrl Shift lt Right arrow key Left arrow key Alt right arrow key Alt left arrow key Ctrl right key Ctrl left arrow key Ctri Alt R Ctri Alt 1 Ctrl Alt 2 Ctri Alt 3 Ctri 6 Ctrl 7 Ctri 8 Ctri 9 Ctrl 0 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 190 24 Appendix Advanced Exprssions A regular expression is a special way of describing a search pattern using text strings according to certain syntax rules Sequencher uses regular expressions to help you break down your sequence naming schema in order to define your Assembly Handles Table of Regular expression special characters Represents any character A Za z Represents any letter A Z Represents any capital letter a z Represents any lowercase letter d Represe
223. replace Assemble Automatically and Assemble to Reference when Assemble by Name is enabled see SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 58 Chapter 9 Sequence Assembly for more information There are numerous other options under the Assembly Parameters and the Contig menu Setting the Assembly Conditions Setting assembly parameters To change the parameter settings select the Project Window Then either click the Assembly Parameters button in the Project Window or go to the Contig menu and choose the Assembly Parameters command Sequencher displays the dialog box shown in Figure 9 1 Figure 9 1 Assembly parameters dialog box Assembly Parameters Assembly Algorithm e Dirty Data C Clean Data C Large Gap The dirty data algorithm is SLOWER and more rigorous than the clean data algorithm Ambiguous base calls are considered poor matches to exact base calls Optimize Gap placement Iw Use ReAligner Use ReAligner Anson amp Myers 97 a ggatc to optimize gaps for small inserts and double called bases Manu remove hand entered gaps Iw Prefer 2 Gap Placement Minimum Match Percentage 60 Minimum Overlap Assemble By Name Enabled Handle1 0 7 Handle2 0 Name Settings Handle3 0 Set as Defaults Cancel Sequencher uses the values set in this window to control the way it assembles sequences Once you have set the options you require click the OK
224. reserved 179 If you are making changes to the way Feature Keys are currently displayed you can click on the Update Project button to update your project You can decide whether to apply the current styles name or both to All features in your project If you do not want to do so just limit your choices to Selected features in your project by clicking the appropriate button When you are finished click on the Done button to return to User Preferences Use one or more of the three Display Feature Numbering For check boxes to indicate which of the second line features Complement Bases RNA Bases or Amino Acids should have its own numbering Use the Motif Default Style pull down menu to set color case and underlining style for new motifs You can see a preview of the motif style in a box on the right hand side of the Motif Default Style preference pane Figure 21 15 Features and motif preference settings User Preferences General Settings futo Save Define Feature Key Default Styles Confidence SE SS Display Feature Numbering For Sound Complement Bases New Project E Display RNA Bases Chromatogram Contig Chromatogram a Amino Acids Contig Feature Matt Format Ruler Motif Default Style Start Stop Variance Table Input Output File Import Report Format Ruler The Format Ruler preferences controls the display defaults for any view which has a format ruler These are just defaults you
225. rested in enzymes with special characteristics such as blunt ends or 3 overhangs explore the commands in the Select menu within the dialog Start by choosing Select None to clear all selections Each menu item you choose after that will add all of the enzymes with the specified characteristic Selections are cumulative no command except Select None removes any enzymes from the list If for example you want all the enzymes that recognize sequences either 4 or 5 bases in length choose Select None followed by 4 base and then 5 base When you are finished selecting enzymes click OK in the lower right corner of the dialog box or press the Return key Sequencher redraws your restriction map with the newly selected enzymes Changing the default enzymes To change the default enzyme selections for items in a project select the fragments or contigs you want to change Go to the Window menu and choose Specify Restriction Enzymes while viewing the Project Window Sequencher will warn you if no sequences are chosen The enzymes you choose at this time are now the default set for any selected sequences or contigs in your project Adding and editing enzymes Sequencher lets you add new enzymes to the list Go to the top of the enzyme editor and select Allow Changes All the sliders will now change from gray to blue Click on New Enzyme to open a blank entry in the enzyme editor Note that the OK button changes to Done You can now enter inform
226. rlaps you may need to decrease the Minimum Match Percentage by moving the slider to the left to lower the percentage If you have an incorrect or unexpected overlap you may need to increase the Minimum Match Percentage by moving the slider to the right higher percentage Minimum Overlap The Minimum Overlap can be used with all three assembly algorithms It is used to set the minimum number of bases that must overlap before Sequencher accepts the sequences as actually overlapping The default value of 20 can be changed by moving a slider If this value does not give you any overlaps you can decrease the Minimum Overlap by moving the slider to the left to indicate a smaller number of bases that must overlap If you have an incorrect or unexpected overlap you may need to increase the Minimum Overlap by moving the slider to the right larger number of bases that must overlap Maximum Loop Out Size The Maximum Loop Out Size is the largest number of consecutively mismatched bases in this instance a gap also counts as a mismatch that are acceptable in a potential overlap The number of mismatching bases is set by moving an elevator button up or down The maximum value that can be set manually is 6 Remember that this option can be used only with the Clean Data algorithm Optimization of gap placement ReAligner is an optional step which can be used with the Clean Data and Dirty Data algorithms It evaluates the disposition of gaps within a con
227. roject from the File menu Sequencher will ask if you want to save the changes to your project Click Yes to save your changes and close the project Click No to close the project without saving your changes Click Cancel if you wish to continue working with the project You can then start working with another project by going to the File menu and choosing New Project or Open Project SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 23 If you have finished working with Sequencher go to the Sequencher menu and choose Quit Sequencher SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 24 5 Organizing project views In this chapter on organizing project views you will learn more about the structure of a Sequencher project as you begin to work with your data We will discuss how to select individual and multiple sequences using various techniques renaming items and saving your work Working with icons and lists Changing between project views Sequencher provides you with a variety of ways to view and organize the contigs and unincorporated data in your Project Window You can view your data as large or small icons or in list form for more information see Chapter 3 The Project Window You can toggle quickly between types of views by holding down the Alt key and clicking in the header title area just above the icons and below the parameter information Yo
228. rporation Inc All rights reserved 105 indicate that there is an associated confidence or quality score range for the variant Variants that require additional checking because they have a low confidence or quality score will be highlighted with dark blue Those with medium or high confidence scores will be highlighted with a medium or pale blue background If you click on Display Color Bases and Display Colors as Backgrounds it can help you to see patterns in your data see Figure 13 14 You can use Base Ambiguities As to distinguish ambiguous or edited bases You can also toggle the display of features from the View menu You can use the Label command to mark sequences in the table Set your preferences using the Label amp Name preferences pane Use the boxes grouped under Available Labels in the preference pane to choose label colors and descriptions for marking individual sequences Select the sequence you want to label by clicking its column header Go to the Edit menu and choose the Label submenu The display name of the sequence will change to match the color of the Label See Figure 13 14 Notice how the tool tip provides the name of the sample its label and other attributes Refer to Chapter 21 Customizing Sequencher and User Preferences for more detailed information Figure 13 14 The Variance Table Display Options O Compare Bases to Reference Sequence K e r Description 15 sequences compared to reference sequence N
229. s checkbox if you do not want them to appear in your chromatogram windows SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 176 Figure 21 11 Chromatogram preference settings User Preferences General B Settings Es futo Save H Cal Confidence Label amp Name Height of Chromatograms Menu C Tiny C Short Sound Standard C Tall New Project Display Lane Identification By Chromatogram me Color C Pattern Contig Chromatogram Contig Options Feature Motif Je Colors Match Current Bases Format Ruler Hide Original Base Calls Start Stop Print Scale Factor Variance Table Rev amp Comp Displayed as Lower Case Input Output File Import Width Peak to Peak Report Narrow Wide If you click the Print Scale Factor checkbox and you used the slider shown at the left in Figure 21 12 the scale factor will appear on any printout of that chromatogram If you click the Rev amp Comp Displayed as Lower Case checkbox the original base calls for a reversed and complemented sequence are shown in lower case as opposed to backwards as the second of two lines of bases above the traces as in Figure 21 12 Figure 21 12 Reversed and complemented sequence Under Width Peak to Peak you can stretch your traces horizontally by selecting the Wide button Contig Chromatogram The Contig Chromatogram preferences control the display of chromatograms of sequenc
230. s in one of forward ORFs Editing bases from traces Now that you can easily locate the bases that need attention you can edit your data in either the contig editor window or the chromatogram display As you edit both windows update automatically Refer to Chapter 12 Editing Contigs for more information on editing To edit a base while viewing a chromatogram click on the current base call upper line of text you want to edit then type the new base call Figure 15 6 You can also select multiple bases for deletion by dragging the cursor across them Figure 15 6 Clicking on a base displayed in a trace Experimental Data chromatogram sequence SEE a rot e E Tac co e om Au aw d Reverting to experimental data If you have deleted too much of a sequence or have made edits you want to remove you can copy the original base calls back into the current sequence From within the chromatogram select the original bases lower line of text you want to restore Figure 15 7 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 134 Figure 15 7 Original base calls selected Go to the Sequence menu and choose Revert To Experimental Data Figure 15 8 shows the original bases restored Figure 15 8 Bases restored Revert To Experimental Data is a powerful feature It allows you to recover original data very precisely as described above or it can be used to globally revert an en
231. s to their sequences with the name indicating something about the data Assemble by Name harnesses the information from your sequence names to automate the process of selecting and naming your contigs In this chapter you will learn how to use Assemble by Name a powerful tool that lets you separately assemble and automatically name multiple contigs from a single selection and assembly command For example in just a few clicks of the mouse Assemble by Name will create ninety six appropriately named contigs from ninety six forward and reverse sequences The Assemble by Name Strategy The names of your samples frequently contain information such as your primer template clone name or sample source Sequencher provides you with tools to separate the descriptive parts of your sequence name and use these to manage the assembly These tools are the Assembly Handles and the Name Delimiters An Assembly Handle is any set of characters from your sequence name that provides information about that sequence such as the primer or clone name A Name Delimiter separates each Assembly Handle from the following one Sequence names frequently have several Assembly Handles and Name Delimiters In its simplest form a Name Delimiter may be a character such as a dash or an underscore When you use a Name Delimiter it will look like this SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 68 handle1 handle2 handle3
232. so sorted by position a faint blue line will connect the name with its fragment arrow SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 78 Figure 11 3 Names of fragments at left E Contig Overview DOR gt oam F ADARC1 ADARC2 i ADARC4 ADARCS ADARCE ADARCS ADARC T ES 1 436 Positions Of Fragments Clicking Positions of Fragments displays the numerical range positions of the sequences in the Overview If you do not wish to see this information leave the box unchecked Start amp Stop Codons You can display a start and stop codon map showing all the start and stop codons in the three reading frames of one strand Start codons are indicated by green flags and stop codons are denoted by vertical red lines To display this map check the Start amp Stop Codons box The map will be positioned at the bottom in the Overview In Figure 11 4 the three frame map of start and stop codons is located just above the diagram key To see start and stop codons in the other strand go the View menu and choose Reverse amp Comp This will reverse and complement your fragments Choosing Reverse amp Comp again will restore your contigs original orientation Figure 11 4 Start and stop codon map E Contig Overview OX oa Ip Onions Fa ADARC1 i C Hole in contig i EH Single fragment Bumps on ES Multiple fragments same direction fragments Diagram Key ES Both st
233. t CMF button A new window called Export CMF will open Choose the Export Sample and Specimen Category from the relevant drop down menus The Fragment Owner Date the Fragment Owner Time and Specimen ID fields are filled in automatically You will need to enter information into the remaining text fields There are a number of optional fields The Source Identified field is a drop down menu There are two text fields for the NCIC ID and ViCAP ID There is also a free text Comment field When you are finished click on the Export button If you have made an error you can click on the Clear All button to reset the form or you can click the Cancel button to return to the Validate MtDNA window Note If you move your cursor to pause over a field you will see a brief description summarizing the information required for that field SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 185 Figure 22 2 Export CMF report Export CMF 4 1 Export Sample mDNA Profe sl Destination ORI Ae ONE Source Lab Name LABONE Submit by User ID Done Fragment Owner User ID Inmn o Fragment Owner Date 20070307 Fragment Owner Time heen 0 Specimen Lab ORI Lem Specimen ID ABY Specimen Category Missing Person r Optional Source Identified NCIC ID ViCAP ID Comment emm Clear All Cancel Further Commands of Interest Set Circular Genome Size The Set Circular Genome Size co
234. t exemplar base position as described previously Click on the Reports button The Variance Table Reports dialog box appears see Figure 13 26 A radio button called Selected Rows will be checked Below that you will see a drop down menu called Report Format Choose either Variance Table Report or Variance Detail Report Click the Open Report button The Sequencher Report Viewer opens in a new window Use the Print Preview button from the button bar at the top of the Report Viewer to preview your report Click on the Print button to send the report to a printer SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 117 Note Not all reports are available when you print selected rows Exporting a Variance Table Report You can export the data from an entire table selected columns or selected rows The type of report you can generate will depend on this selection see Table 13 3 Table 13 3 Variance Table Report export options Variance Individual Variance Population Table Report Variance Table Detail Report Report Reports Entire Table Yes Yes No No Selected Yes Yes No No Columns Selected Yes n a No n a Rows You can remove sample sequences from your table before you export your data Select a continuous range of sequences choose the first sequence by clicking on its column header Then holding down the Shift key select the last sequence in the same fashion
235. t mutations and variants rapidly Reference Sequence properties Before you start work with the Reference Sequence you should be aware of a number of important properties SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 40 Basic Reference Sequence properties When you assemble sequences which include a Reference Sequence the base numbering of a contig will be the same as the base numbering of the Reference Sequence see Figure 7 1 Figure 7 1 Contig showing base numbering set by Reference Sequence E Numbering by Reference Sequence OX ATTCGCCCTTGTGGGTCACCGTCTATTATAGGG EE E ATTCGCCCTTGTGGGTCACCGTCTATTATQGGG GGG 4 frag bases selected at consensus position 1 Select Next Ambiguous Base spacebar When a contig is built that includes a Reference Sequence the contig will always remain in the same orientation relative to that Reference This way you can keep the contig from flipping as more fragments are added Because of this there can only be one Reference Sequence in a contig You can easily spot the Reference Sequence in a contig editor because it is highlighted along its entire length with a gray border When you assemble sequences that include a Reference Sequence you will notice that gaps in the Reference Sequence are given decimal numbers thereby preserving the absolute numbering of base positions The Reference Sequence does not contribute to the calculation o
236. t with a single unsupported sequence Then a second fragment starts to overlap with the first Next there is an area with full coverage both strands are sequenced with additional confirming fragments At the extreme right end of the contig there are just two fragments in opposite directions Overview features Bases To get from the Overview to the view used for editing click the Bases button You can also go to the View menu and choose Bases from the Bases Map Overview submenu Sequencher displays the contig editing window Summary You can press the Summary button to view a compact report of the contig You can also see this report by going to the View menu then choose the Bases Map Overview submenu and click the Summary Report option The features of the Summary Report will be dealt with in more detail later see Chapter 12 Editing Contigs for more information Sort You can sort the sequences in a contig vertically Click the Sort button to display a dialog window of options Choose an option by clicking on its radio button and then pressing OK You may also use the sorting options in the View menu under the Sort Cleanup submenu Overview options To choose the display options click the Options button or go to the View menu and click on View Options An Overview Options dialog box will appear where you can set your choices SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved
237. ta as it can find The auxiliary files must be in the same folder as the ACE file or arranged in the traditional PHRAP assembly hierarchy chromatogram files in a chromat_dir folder and PHD files in a phd_dir folder If the singlets file the qual file the PHD files and the chromatogram files all exist and are available Sequencher will import them Alternatively you can import parts of the PHRAP project by going to the File menu and choosing Import and then Sequences or by going to the File menu and clicking on Import and then Folder of Sequences e If you import the chromatogram files from the chromat_dir these fragments will have PHRED base calls and chromatogram data but no base qualities e Ifthe _ phd files are loaded and _ fasta qual files are available you will have imported all of the fragments from the PHRAP project They will have base quality and chromatogram data e The qual files alone will not load your sequences e Ifyou import PHD files from the phd_dir and the corresponding chromatogram files are available these files will import with PHRED base calls chromatogram data and base qualities SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 22 Note When using ftp to transfer your data to your local computer it is ALWAYS important to transfer these files in binary mode If you are not familiar with ftp speak with your network administrator Removing sequences and con
238. tart and stop map Notice the diagram key at the base of the window Figure 11 1 Contig overview E Contig Overview OX GI ES Set Info ADARC1 cic Deeg EJ Single fragment Diagram Key Bumps on PZ Multiple fragments same direction fragments ES Both strands show motifs 7 E Both strands plus hollow Start codon frame 1 rectangles E Stop codon frame 2 show features Selection marquee In the Overview you will notice a dashed rectangle This animated marquee sometimes called the marching ants highlights the section of the contig displayed when you switch to the Bases View You can change the location you want to view by dragging the marquee to a new location As you move the cursor over the marquee you will see it change to a hand icon You can now hold down the mouse button and drag the marquee to the desired location Checking coverage in the Overview The bar across the bottom of the overview shows various levels of sequence coverage indicated by different graphic patterns For instance a wide solid green line indicates that the sequence coverage comprises both strands A region with no color or pattern indicates a hole in the coverage The full array of patterns indicating coverage are shown at the bottom of the Overview in the figure above SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 76 In the example in the figure above the overview shows the contig starting ou
239. te Specify the template you want by clicking on a name in the drop down menu Templates are stored in a folder on your system If you click the Open Templates Folder button Sequencher will open a window displaying the templates You can store up to 1 000 templates on your system For more information about templates see Chapter 3 The Project Window Figure 21 10 New Project User Preferences User Preferences General B Settings futo Save fis Confidence Label amp Name New Project Menu Sound C Use Blank Project New Project Display Chromatogram Contig Chromatogram Contig e Use Project Template Feature Motif My Template Project sl Format Ruler My Template Project v Start St Caransa Th Open Templates Folder Input Output File Import Report Display Chromatogram Chromatogram preferences control the display of chromatograms You can specify the Height Of Chromatograms by clicking one of the buttons from Tiny to Tall If you use a black and white monitor click the Pattern button for Lane Identification By You can set lanes to be identified by color or pattern by selecting the appropriate radio button When viewing multiple sequences you will notice that a reversed and complemented sequence displays the lane colors according to the original data Click the Colors Match Current Bases checkbox to display all current base calls in the same color Click the Hide Original Base Call
240. teria For example you can choose sequences that have chromatograms or that include a particular annotation in the comments field The menus are context sensitive so not all options may be available for a particular view Most options will have a dialog box containing a number of important buttons which control the results of your search The Select All Matches button will select matches based on your search criteria If you change your criteria and search again these results will be added to your initial search If you don t want this information added you must choose Select None SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 154 A status line will indicate how many items matched out of the total number of items available You can dismiss the window by clicking on Done or by simply clicking on the Project Window or performing another action If you want to select all the items that do not contain the specified string go to Select All Items That click on All Items That command and click the Done button Then go to the Select menu and choose Invert Selection Contain a subsequence To select all the sequences and contigs in the Project Window that contain a specific string of bases you can use the Contain Subsequence command Go to the Select menu click on the All Items That command and then choose the Contain Subsequence menu item to display a dialog box Figure 18 4 Note You can do a
241. tersrsrsrsreeresestsest 50 Selecting Bases neen anena nanan a a a a a a a a 51 Finding Ambiguous Bases ss eege ENEE E EERE AE RERE R E E 51 Finding Open Reading Frames ORFE aaa A A R R E EAE RER ts 51 e EE 52 ET ae codon Maps EE 52 Looking at Restriction Mapsen esses sdvace ea casde ceased T T EET T T E TA 52 Ammotating Sequences EIERE AER 53 Customizing your SEQUENCE VIEW 253 cc25i sacddeains ataiesiecddedauenaiatspeddvarvendanaetedeanneeetaennade 54 Formatting Klerus ee ee EE 54 Mano in EE 54 DADS LAC OMe ses eRe ced ee ee OEE a es de ae ed Edel E 55 BaSe e geirinn ot iE EE EER tas stage EEE cl dear ane reg ad ureutesv RAE EE ER 55 IEN ET 33 Case and EOS E E E E E AETA EE EEEE EEEE E EEEE 55 Voice Verification EE 56 Selecting a voice Bled 56 Identifying a sp akersiciirniicciiriisiiii NEEN ai 56 Audible Keystrokes vii Arie geg ieii enia a ORAE ed aad an Me AA AA cea EE eld Reed 56 Read sequence selection EE 56 9 SEQUENCE ASSEMBLY tiseiccntisndsctacuticandivtisebisesscuuiduhddesteutddundeuedduhddeuaace 58 Th Assembly S trates ET 58 Setting the Assembly Conditions sssseeeseeessssssseereeesssssserrreeesssssstreereesssssserreeeesssssseee 59 Setting assembly parameters insonini AAE TAEAE TARR 59 Assembly EL EE 59 Assembling with Dirty Data scsssssssesesceesecencsceesescoesesosenescseveceaesccacsscessnsecsnesesevecensrssessseeeseveceavsesarecess 60 Assembling with Clean Data 60 vi Assembling with Large Gap
242. that affect the sequence fragments and those that affect the display of protein translations You can change the consensus calculation while in this view Any change you make will be reflected immediately in the report Sequencher displays the window shown in Figure 14 1 Figure 14 1 Summary report options Summary Options Compare To Consensus Reference Cancel Display Iw Icons Iw Bullets Pluses amp Dashes Reference Sequence I Matching Bases As Dashes Iw Fragment Sequences When viewing proteins show translations for V Reference Matching Proteins As Dashes Fragment Compare To Consensus or Reference Sequence If you have a Reference Sequence in your contig you can choose whether to display a Summary Report compared to the consensus sequence or to the assembled Reference Sequence The default setting is Compare To Consensus but you can change this by clicking on the Reference radio button Some of the Display options are context sensitive and will change to reflect your choice The Reference radio button will be grayed out when the selected contig does not contain a Reference Sequence Icons If you check the box for the Icons display you will see the sequence fragment icons positioned to the left of the fragment name Unchecking this option will hide the icons Note When you have a Reference Sequence in your contig its icon is distinguished by the addition of an R SEQUENCHER Us
243. the Project Window You can organize items visually in the Project Window by applying Labels to the icons Before using Labels for the first time you should customize the list of labels under the General section of User Preferences You will see a list of Label amp Name options You can also select from the default labels available under the Edit menu and Label submenu See Chapter 21 Customizing Sequencher and User Preferences for more information When viewing your project as a list you will see the name of the label in the list Labeling your icons allows you to sort or find your information easily For instance you might define red labels as cDNA data and blue labels as genomic data Clicking on the label heading in the Project Window will sort your project items by label see Figure 5 3 You can also find sequences bearing a particular label by going to the Select menu and choosing the All Items That command with the Have Labels Containing suboption SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 28 Figure 5 3 Viewing labels as a list S labels SPF S o D Assembly Parameters Auto Assemble by Name Assemble Interactively Parameters Assemble by Handle3 Dirty Data With ReAligner 3 gap placement Min Overlap 20 Hande size quality kind Tree i 4 AA 123_for 337 BPs FutoSeq Frag Interesting a DS G _123_rev 335 BPs FutoSeq Frag Interesting PS G 456_for 600
244. the column Note When comparing multiple consensus sequences the View menu s Display Base Confidences option is not relevant because confidence values exist only in fragments and not in consensus sequences Figure 13 5 Compare Consensus to Reference Variance Table D Compare Consensus to Reference K DOK Fre Description 5 consensus sequences compared to reference sequence NC_001807a 3 end Comparison Range Unfiltered Base Positions 15884 16571 of See Ce oa Ce E For more information about Assemble by Name and Reference Sequences see Chapter 10 Assemble by Name and Chapter 7 The Reference Sequence Translated Variance Table for sequences in the same contig When you are ready to begin creating your Translated Variance Table either select individual sequences from within a contig or go to the Project Window and select a contig by clicking on its icon This will select all of the contig s sequences Then go to the Sequence menu and choose Compare Translation To and either Consensus Reference Sequence or Top Sequence from the submenu The Translated Variance Table appears in a new window see Figure 13 6 The Translated Variance Table header summarizes the table s contents including a Description the Base Positions and the Amino Acid Positions If a sequence in the Table does not extend the full length of the Comparison Range its column header will be shaded in pink The pink X s mark cells th
245. the consensus at the time of its creation Future edits will not be marked SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 92 Removing sequences from a contig To remove sequences from a contig click on the name of the sequence you wish to remove from the list at the left side of the Contig Editor window or in the Overview window To remove more than one sequence at a time hold down the Shift key while you click the names Next go to the Contig menu and choose Remove Selected Sequences Sequencher will ask you if you are sure you wish to remove the sequence s Click on the Remove Fragments button to delete the sequences from the contig The sequences you just removed from the contig are moved out of the contig and back into the Project Window They will also stay selected Note This action may break a contig into multiple pieces If this is about to happen Sequencher will display a dialog box Figure 12 7 to ask if this is really what you intend to do Press the Cancel button if you do not wish to proceed Any new contigs generated in this way are named by appending an alphabetic character to the name of the original contig Figure 12 7 Warning dialog when about to make a hole in a contig Sequencher in a contig that has a hole in the middle If you proceed with this A Removing the sequence fragments that you have selected will result action the contig will be seperated into smaller cont
246. the report if the sequence has associated chromatogram data Figure 13 21 Extract from a Variance Detail Report 128 Variant 1 of 9 e Position 15 576 G T Sequence Orientation Confidence Base Primary Secondary Secondary as Call Peak Peak of Primary Gene4A_09 Reverse 47 T T n a lt 5 Gene_128 R Gene4A_09 Forward 31 T T A 18 Gene_128 F Gene4A_09 Gene_128 R Fragment base 15 576 Base 184 of 216 Y TTG AGA A C GG CG TV TT T TA TG CTA A AAD TIT TFT d A3 DADA A AA AAT AD U AT Gene4A_09 Gene_128 F Fragment base 15 576 Base 111 of 197 TE TT TG AGA AC GCG GE WG TE TT T TAT CC TA FETTO 2G KR AO OG SG SG EG EST EH UDF Uh AT SKS TS Note If the Detail Table displays a gap for a specific base position this will still be given a confidence value The confidence value will be equal to the average confidence ratings of the bases flanking the gap Sequencher will append an asterisk to the confidence value and a footnote will explain how the value was derived Population Report The Population Report is a special report which groups together all sequences sharing the same set of variants This report contains the Common Header and a report specific header The report specific header lists the number of population groups and the how many samples this consists of This header also indicates whether any samples have been dropped from the report This will only happen if a sample does not have complete SEQUENCHER
247. the trimmed and untrimmed data Below the arrows is a slider for changing the height of the trace Below the slider are four buttons that let you hide the lanes for any or all of the traces Click on the button to hide any lane Click it again to display the lane Figure 15 2 shows a contig with adjusted scales and hidden lanes Scrolling through a single chromatogram is simple Position your cursor on the small rectangular slider button to the right of the trace With the mouse button held down you can move the slider down or up depending on your current position within the sequence Alternately you can use the left arrow and right arrow keys to step through the sequence trace base by base When you are working in a contig if you highlight a base in the consensus line you can use the arrow keys to move through the consensus sequence Note that as you do so all the contig chromatograms will move left or right in step with the highlighted base Figure 15 2 Trace with hidden lanes and adjusted scales You can specify the settings for trace display by going to the Window menu and choosing User Preferences and selecting Chromatogram You can specify the height of the trace the width from peak to peak the way the lanes are identified and various screen display attributes See Chapter 21 on Customizing Sequencher and User Preferences for more information SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All r
248. three parts the header information the Comparison Range Coverage and the Translated Variance Table The Translated Variance Table contains the name of the sample sequence the variant codon the amino acid residue and the type of coverage whether the coverage is complete or incomplete for each variant in the table The Comparison Range Coverage table lists the name of each sequence and the range of bases in the comparison Working with a Translated Variance Table Report There are a number of ways to present the data from a Translated Variance Table You can export the data from an entire table selected columns or selected rows You can also remove data from the table before you export it Exporting a Translated Variance Table Report To export all the data in the table click on the Reports button The Translated Variance Table Reports dialog box appears see Figure 13 28 A radio button called Entire Table will be checked Figure 13 28 Translated Variance Table Reports dialog window Translated Variance Table Report Entire Table C C Cancel Copy as Text You will see three enabled buttons in the Translate Variance Table Reports dialog window Cancel Copy as Text and Save as Text Save as Text is the default setting If you click on the Save as Text button Sequencher presents you with a dialog to assign the name and location of your export The report is saved in a tabbed text format SEQUENCHER User
249. tig and optimizes their placement ReAligner facilitates editing in the consensus sequence and clearly displays the effect of insertions and deletions To use ReAligner select the checkbox in the Assembly Parameters dialog box In some areas of DNA analysis the standard is to gather the gaps to the right If you require this select Prefer 3 Gap Placement Note This option cannot be used with the Large Gap algorithm SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 62 Performing the assembly Automatic assembly Bring the Project Window to the front and select the sequence fragments you want to assemble Click the Assemble Automatically button or go to the Contig menu choose the Assemble Contigs command and Automatically from the submenu Sequencher compares all the selected sequences including reverse complements and assembles the best matches that fall within the chosen assembly parameters When assembly is done the advisory window appears See Figure 9 3 Click Close to go back to the Project Window Figure 9 3 Assembly done alert Assembly Completed Time Elapsed 00 00 00 Assemble by Name Off Items Selected 8 Number of Contigs 1 Comparisons Performed 82 Number of Fragments 0 Close Adding selected items to others incremental building of contigs The assembly option Add Selected Items To Others which is a special case of automatic assembly is very useful when you h
250. tigs from a project To remove items from the project select the items you want to remove Go to the Edit menu and choose Remove From Project or click the Trash Can button in the button bar Removing an item from a project is permanent so Sequencher asks whether you really want to do it Note Remember you cannot back out of this action with a simple Undo command but if you close the project without saving all changes including removed items will be forgotten The Revert to Saved Project command has the same effect Closing an editor window When you have finished entering and or editing a sequence click the close button in the top right corner of the window at the right end of the title bar see Figure 4 4 or choose Close Window from the File menu Sequencher then removes the Sequence Editor window from the screen Once you have closed the window a sequencing icon will represent your sequence Figure 4 4 Figure 4 4 Clicking the close box i Frag 0001 KPP E Dis Residue 275 Sequenced Strand Sequence Length 274 AAACTGATTA TATCCNCATG CATCTGTTCT ACCATGTTAT TTTTCCACAT GTTAAAATTT TCTGTCACAT TITCCAATAC TATTTCTTGT GGGTTAGGGT CTGTGGGTAC ACAGGCATGT GTGGCCCAGA CATTATGTAC CTCTGTGTCA TAGGCTTTAG CATCTGATGC ACAAAATAGA GTGGTGGTTG CTTCTTTCCA CACAGGTACC CCATAATAGA CGGTGACCCA CAAGGGCGAA TICTGCAGAT ATCCATCACA CTGGCGGCCG cTcq Closing a project If you have finished working with the project but not with Sequencher choose Close P
251. tion Inc All rights reserved 144 17 Motifs and Features In this chapter we describe Sequencher s ability to locate and highlight subsequences that you specify as motifs You will learn how to create edit and display features and list a sequence s features Motifs Sequencher lets you define up to 12 patterns of 50 or fewer bases as motifs Entering motifs You define new motifs by going to the Window menu and clicking on the Motif Definitions command Figure 17 1 Motif entry window Motifs Load Motifs Find Exact Ambiguous Reverse Vetchez Matches Com Only Allowed Display Style w plement MUM EU GK 399999999990 To view motifs in editors select the Display Motifs option in the dew menu The default setting shows exact matches only To show the reverse complement for a motif click the Find Reverse Complement checkbox Use the radio buttons to specify SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 145 whether you want to highlight the motif using the exact bases you entered or using ambiguous matches To specify how you would like the motif you are entering to be highlighted click on the Display Style pull down menu Figure 17 2 to choose color case and underlining while the cursor is still blinking in the entry field In the example Figure 17 2 every instance of AAAAA will be underlined and every start codon ATG will be shown in low
252. tion with No Coverage The first column of the Variance Table displays the position and the second column displays the base call of the exemplar sequence but only at positions that differ The additional columns in the Variance Table are created by the sequences or contigs you select for comparison You can view or edit the data in any version of the Variance Table by double clicking on any of the cells in that table In Review mode when you type a new base in the Variance Table you edit the underlying sequence or contig automatically SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 96 Structure of the Translated Variance Table The structure of the Translated Variance Table follows the format of the Variance Table but its display consists of an amino acid and its codon in each cell see Figure 13 3 When you see a cell in the table with an amino acid and its codon written in black typeface this indicates a difference between your exemplar and your sample You may also see some cells in the table where the amino acid and codon are displayed in light gray Amino acids in these cells match the exemplar but use either an identical or synonymous codon The numbers which appear in the first column of the Translated Variance Table refer to the position of the first base of the codon in the upper location and the position of the amino acid in the lower one Figure 13 3 The Translated Variance Tab
253. tire sequence or selection of sequences You can revert unassembled sequences to original data by selecting the sequences in the Project Window and executing the Revert To Experimental Data command Reverting assembled sequences back to experimental data If you need to revert a sequence that has been assembled in a contig select its icon from the left hand side of the Contig Editor Go to the Contig menu and use the Remove Selected Sequence command Now you can use the Revert To Experimental Data command as described above If your sequence has trace data select all of the original bases Go to the Sequence menu and choose Revert To Experimental Data Note The Extend Selection command allows you to select all of the bases in a chromatogram without scrolling SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 135 Adjusting trace positions As the four dyes migrate in different lanes on certain automated sequencers the synchronization among the four traces can deteriorate in output files Sequencher allows for adjusting or re tracking the position of one trace relative to the others When you are looking at a chromatogram specify which of the four traces you want to shift by selecting a base in the original data line the lower of the two lines of sequence characters Go to the Edit menu and choose Shift to display a submenu that lets you shift the base s line left or right by a fe
254. ton and the button bar will hide behind the title bar When the button bar is hidden you can still see the bottom of the left hand button under the title bar It will show a down pointing arrowhead Click on the arrowhead and the button bar will reappear Sequencher s menus Sequencher The Sequencher menu gives you information on the version of Sequencher you have contact information for Gene Codes Corporation and Sequencher technical support access to the User Preferences and the Quit Sequencher command File menu The commands in the File menu let you open close and save projects as well as import and export data You can also open and close windows specify page setups and print from the File menu Edit menu The commands in the Edit menu let you cut copy and paste selected data You can also duplicate fragments mark motifs reposition sequences and choose your editing mode from the Edit menu Select menu The commands in the Select menu cover a variety of items you might want to find and or highlight to help you in your analysis These commands use a wide variety of criteria to help you locate items from sequence fragments subsequences and individual bases SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 5 Contig menu The commands in the Contig menu facilitate most of your work in contig editing You can set assembly parameters and consensus mode assemble dissolve and re
255. tures go to the Sequence menu and choose Feature Listing This will display a text list of each feature giving its name Feature Key range style and any Feature Qualifiers You can print out this listing for your records Note If you have imported a GenBank sequence and Sequencher does not recognize any Feature Keys this list may differ SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 150 18 Finding items In this chapter you will learn how to find items according to specific criteria It also discusses how to refine your subsequence search and search for and find particular items in the Project Window This chapter also discusses how to find open windows and editors Finding the Project Window You can always bring the Project Window to the front by going to the Window menu and choosing Project Window Finding open windows with menu commands Sequencher has a number of commands in the Window menu for finding open windows hidden behind other windows Project Window Variance Table Translated Variance Table Chromatograms Contig Editors and Sequence Editors Choose the appropriate command to bring the window you want to the front of your screen If one or another of the commands is dimmed you do not currently have that editor open If you have several windows of a type open these will be listed as submenus of that type Finding open windows in the Project View If you are looking at a Pr
256. u save the new project a new project icon appears on your disk Reverting to the saved version of the project If you are working in a project and want to cancel all the changes you have made since you last saved it go to the File menu and choose Revert To Saved Project Sequencher displays a dialog box that tells you when your project was last saved If you click the Yes Revert to Saved Version button you will lose the most recent changes Click on the Cancel button to cancel the command Note Remember if you click the Yes Revert to Saved Version button you cannot undo this action SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 29 Closing the Project Window When you have finished working on an open project and want to work on another you must first close the open project You can either close the project by going to the File menu and clicking on Close Project or you can close the Project Window by clicking on the close box In either case Sequencher will prompt you to save your work if you have made any changes since your last save To continue working in Sequencher either go to the File menu to create a new project by choosing New Project or click on Open Project to work on a previously saved file Note If you want to save the data you have entered you must save the project Saving a project is different from recording a sequence as experimental data Only saving the project actuall
257. u can display a list of sequences in a single contig in the list view by clicking on the plus sign to left of the contig icon You can see a list of sequences in all your contigs by going to the View menu and choosing Expand All Collecting sequences in refrigerators Sequencher lets you create refrigerators in the Project Window to hold certain subsets of your project Refrigerators hold only raw sequences not contigs or other refrigerators To put away a few sequences in cold storage select the sequences and then go to the Edit menu and choose Refrigerate Sequencher collects the sequences and puts them in the refrigerator To remove sequences from the refrigerator open the refrigerator by double clicking on it You will see a list of items Select the items you want to remove and then click the button called Move Selected Items To Project Window to execute the command SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 25 Selecting sequences Selecting sequences and contigs To select sequences you can go to the Select menu and use the Select All Select None and Invert Selection commands Invert Selection will give you the opposite of your previous selection There are also selection functions that are increasingly specific You can choose data based on All Items That and then further specify the data by choosing narrower classes such as Contain Subsequence Contain Items N
258. u want to assign a GenBank feature key make a selection from the drop down menu called Feature Key To give the feature a name type your text into the Feature Name box You can use the default display style or you can assign a Feature Color and Feature Style such as inverted case or underlined from the dialog box You can also use the Display radio buttons to determine whether single stranded DNA is displayed or RNA protein translation or the complement will be shown For more information see Chapter 17 Motifs and Features Customizing your sequence view Formatting Ruler Formatting can be controlled with a ruler shown in Figure 8 12 that lets you adjust several display parameters Click the Ruler button in the Sequence Editor or contig Summary Window Alternately you can go the View menu and choose Display Format Ruler Figure 8 12 The formatting ruler imal SIC E BIE N IIE Font DI Uri Li gp 25 E SG 1 13 15 Margins You can drag the margin triangles on this ruler to set the width of your sequence Figure 8 13 shows margins that are limited to 42 bases per line Figure 8 13 Sequence Editor with ruler and translations E p53 genomic SEE Residue 9424 Sequenced Strand Sequence Length 20303 lbs ID lS EIEN a WIG Font DI Mra woo 13 A LS IB i KE CAA ACA CTT ACA GTA GGC ATG TTT CTT AGC AAA TCT GAT GAC AAA TTT GGC ATA AAG AAA GAG AGC ATC CCT GAA AAA AAA AAA AAG AAA F G I K K E 5 I P E K K K K
259. ual Variance Reports Variance Detail Report Use the Print Preview button from the button bar at the top of the Report Viewer to preview your report see Figure 13 24 Figure 13 24 Reports Viewer button bar Print Print Preview Save as PDF Page Setup Close The Report View is replaced by the Preview View Note the Zoom In and Zoom Out buttons in the button bar see Figure 13 25 Click the Report View button to return to the previous view Figure 13 25 Print Preview button bar Print Report view Save as PDF Page Setup Zoom In Zoom Out Close Use the Page Setup button to choose paper size Click on the Print button to send the report to a printer You can also save the report in PDF format by clicking the Save as PDF button If you wish to dismiss the window without performing any of these actions click on the Close button Printing selected data from a Variance Table You can print selected data from your table You have several options You can remove sample sequences from the table using the Remove from Table command You can print selected variants by choosing selected rows and you can print selected samples by choosing selected columns You may already have restricted the data in the table by using the Comparison Range command SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 116 If you want to remove sample sequences from your table select a continuous ran
260. uence in Find checkbox Close the dialog box by pressing Done Get Info Summary information about the open contig can be obtained by pressing the Get Info button or go to the File menu and click on the Get Info command The Bases View Working in the Bases View To get from the Overview to the view used for editing a contig click the Bases button Alternatively you can go to the View menu and then go to the Bases Map Overview submenu and choose Bases Sequencher displays the contig editing window shown in Figure 11 5 SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 80 Figure 11 5 The contig editing window E Contig Editor D Ga Sumas f cuwan WR Stow Cronstoganelf Reale Bor highlight base call disagreements Gu highlight ambiguities Select Next Ambiguous Base spacebar To return to the overview click the Overview button or go to the Bases Map Overview submenu and choose Overview The labels in Figure 11 6 identify the different parts of the contig editor Figure 11 6 Identifying parts of the contig editor E Contig Editor D Pa Ern Cutan RR Fatze Den D Ee ATATAATCAGTTTATGGGATCAAAGTCTAAAG Hee highligh base call spacebar Table 11 1 Key to the Contig Editor Label Name Function A Button Bar Contains several buttons you click to perform frequently used functions B Sequence Shows which sequences make up the contig you are editing list c
261. uence that has been incorporated into a contig it is locked A padlock icon shown to the left of the word Residue in the information bar above the sequence in Figure 8 1 shows that the file is locked Figure 8 1 A locked editor E p53 genomic Eek es fa Residue 1 Sequenced Strand Sequence Length 20303 ITTCCCATCAA GCCCTAGGGC TCCTCGTGGC TGCTGGGAGT TGTAGTCTGA ACGCTTCTAT CTTGGCGAGA AGCGCCTACG CTCCCCCTAC CGAGTCCCGC GGTAATTCTT AAAGCACCTG CACCGCCCCC CCGCCGCCTG CAGAGGGCGC AGCAGGTCTT GCACCTCTTC TGCATCTCAT TCTCCAGGCT TCAGACCTGT CTCCCTCATT CAAAAAATAT TTATTATCGA GCTCTTACTT GCTACCCAGC ACTGATATAG GCACTCAGGA ATACAACAAT GAATAAGATA SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 45 A locked editor is read only You cannot directly edit data you can only view it However if the sequence fragment has been incorporated into a contig you can use the contig editor to make changes See Chapter 12 Editing Contigs Basic sequence editing The Sequence Editor shown in Figure 8 2 is a text processor that is specially optimized to work with DNA sequences Figure 8 2 The Sequence Editor Frag 0001 DER E De Residue 40 Sequenced Strand Sequence Length 39 CTGACTGACT GCTGACTGAC TGCGCGTACG TACGTAGC The default system for coding in Sequencher is the UPAC IUB coding system You can define your own coding system for bases and ambiguities See Chapter 21 Customizing Sequenc
262. uencher Help or press F1 Sequencher Help is organized into two main areas application screens and the Sequencher User Manual The Sequencher application screens contain context sensitive links to relevant sections of Sequencher Help Note You can leave the Help window open and return to Sequencher by clicking on an open window SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 3 Navigating Sequencher Help The Sequencher Help window consists of three main parts There is a button bar at the top of the window There is also a navigation pane on the left side of the window and a content pane on the right side of the window The button bar has Back and Forward icons which function like a web browser s Back and Forward buttons If you click the Home button you will return to the Welcome screen You can also type keywords into the Search entry text box The navigation pane displays a Table of Contents Click on the relevant icon to display any subtopics Click on a page link icon in the navigation pane to display the Sequencher Help article in the content pane Some of these pages contain underlined hyperlinks to related topics in the manual and a hyperlink to the following topic in the Table of Contents You can also get information on specific topics such as Assembly Parameters or the Sequence Editor from context sensitive screens To search for a specific topic type the topic name into the se
263. uity Sequencher may change an ambiguous base call to an A C G or T if it does not meet the secondary peak criteria If you prefer it to remain ambiguous do not select this option If you wish to search just a range of bases highlight them and check the Search Selection Only checkbox For more information see Chapter 15 Chromatograms SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 188 23 Appendix Keyboard shortcuts Menu Window Command Windows Help F1 Open window or Open project set in Ctri O User Preferences Close window Ctri W Get Info Ctrl Save Project Ctr S Print Ctrl P Exit Ctri Q Undo Ctrl Z Cut Selection Ctrl X Copy Selection Ctrl C Paste Ctrl V Edit Comments Ctrl Select menu Select All Ctri A Select None Ctri Find bases Ctrl F Find bases again Ctrl G Contig column Ctrl K Select Next Ambiguous base Ctri N Select Next Contig Disagree Ctrl D Select Next Edited Base Ctrl E SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 189 Menu Window iew submenu Overview Options Command Select Next Low Confidence Base Select Next Met to Stop Mark Selection As Feature Display Format Ruler Reverse amp Comp Sequenced Strand Display 1 frame translation Display 2 frame translation Display 3 frame translation Single stranded Double stranded Chromatogram User P
264. unds if the original data included base quality scores For information on how to change the threshold values see the section User Preferences in this chapter You may need to turn off Colors As Backgrounds Display Features Sequencher can display features you have entered Go to the View menu and click on Display Features to toggle this view on and off For each individual feature you must also enable or disable its display in User Preferences See also Chapter 17 Motifs and Features for more information Display Motifs Sequencher can display motifs you have entered Go to the View menu and click on Display Motifs to toggle this view on and off See Chapter 17 Motifs and Features for more information Setting up custom codes Standard coding system The IUPAC IUB ambiguity set is the most common coding system for representing DNA Some commercial and academic software packages also use the Stanford Extended System codes which include one character representations for maybe A probably G etc Sequencher defaults to the UPAC IUB system but includes a copy of the Stanford extended set See Appendix 25 and Appendix 0 for tables of the IUPAC IUB and Stanford Extended code systems Configuring Ambiguity Codes If you wish to configure Sequencher s ambiguity coding system yourself go to the Window menu and choose Ambiguity Key Codes Sequencher displays the dialog box shown in Figure 21 1 SEQUENCH
265. uppercase to lowercase text To see the options for displaying edits go to the View menu and click on the Base Edits As submenu to choose from Not Highlighted Bold Magenta or bOLD and cASE cHANGE Collect Gaps The Collect Gaps command allows you to select a range in a fragment or contig consensus and move all of the gaps within this selection to either the 5 or the 3 end of the selection If you wish to collect the gaps within a single fragment you must select the range within that fragment Go to the Sequence menu and choose the Collect Gaps command To SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 87 move the gaps to the 5 end select Left from the submenu To move gaps to the 3 end of the selection choose Right from the submenu If you wish to collect the gaps within a region of a single contig you must select the range from the consensus line Go to the Sequence menu and choose the Collect Gaps command To move the gaps to the 5 end select Left from the submenu To move gaps to the 3 end of the selection choose Right from the submenu Note The Collect Gaps command may have the effect of increasing the number of ambiguities Check the consensus line to see if the number of ambiguities has increased or decreased You can go to the Edit menu and use the Undo command to reverse the Collect Gaps command Moving Bases and Gaps You can move a selection within a sing
266. ut Map Inset Like the full page cut map the window restriction map is linked to the Sequence Editor If you click between two cut sites Sequencher highlights the resulting restriction fragment as shown in Figure 8 11 If you click on the name of an enzyme Sequencher highlights the recognition sites Figure 8 11 Marking restriction and recognition sites E p53 genomic DER g Residue 10382 to 10943 D Low Confidence 0 0 0 Ambiguous 0 0 Selection Length 562 Bsp106 GO Bert 20 Drall 22 Annotating Sequences You can assign a standardized GenBank Feature Key in addition to personal feature annotations to describe subsequences Select the range of bases you wish to annotate then choose Mark Selection As Feature from the Sequence menu SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 53 If you want to assign a personal annotation select Sequencher from the drop down menu called Feature Key To give the feature a name type your text into the Feature Name box You can use the default display style or you can assign a Feature Color and Feature Style such as inverted case or underlined from the dialog box You can also use the Display radio buttons to determine whether single stranded DNA is displayed or RNA protein translation or the complement will be shown For more information see Chapter 17 Motifs and Features If yo
267. utton A dialog window to assign the name and location of your export appears You can type a name for the table in this window Click the Save button to save your table as a tabbed text file Although the Selected Rows radio button is checked you can change your selection to include all rows by clicking the Entire Table radio button see Figure 13 31 Figure 13 31 Translated Variance Table Reports dialog window Selected Rows Translated Yariance Table Report C Entire Table ei Selected Rows Cancel Copy as Tex SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 122 You can copy your Translated Variance Table into another document or application that accepts tabbed text To paste the contents of your Translated Variance Table Report click on the Copy as Text button Removing data from a table before export If you need to reduce the amount of data in your table you can remove selected sample sequences Make your selection by using Shift click for a continuous range or Ctrl click for a discontinuous range Go to the Edit menu and choose the Remove From Table command Your selection will be removed You can then export the remaining data as usual Note This command does not remove sequences from the underlying contig SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 123 14 The Summary Report In this chapter we explain how to us
268. vely forensic Further note that this type of editing does not change Reference Sequences Split After Selection You can split a sequence fragment into two pieces Put the cursor where you want to split the sequence Go to the Sequence menu and choose Split After Selection Sequencher will ask you if you want to split the sequence after the last currently selected base Click on the Split button to proceed Sequencher will then split the sequence in two and label the new fragments for you You can also apply the Split After Selection command to an entire contig by simply making your selection in the consensus sequence and then choosing Split After Selection from the Sequence menu Auto Match Sometimes you may wish to edit a number of sequences simultaneously perhaps to match a high quality segment of sequence Sequencher allows you to perform this type of mass edit on a range of bases using the Auto Match command SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 91 First select the base or range of bases to which the other sequences should match then go to the Edit menu and choose Auto Match This command will edit and highlight every overlapping base so that it will agree with the selected sequence To reverse this procedure go to the Edit menu and click on Undo Create new sequence from a consensus You can create a new sequence from the consensus sequence by going to the Cont
269. very time you select the Show Chromatograms button Sequencher will open the windows in your layout positions Figure 21 4 Remember Window Layout Show Ambiguity Helper Chromatogram Ctrl T Ambiguity Key Codes Genetic Code Motif Definitions Specify Restriction Enzymes Specify Vector Insertion Sites Project Window Bases Variance Table Remember Window Layout User Preferences Ctrl U You can also use the Remember Window Layout command to define default positions for the Contig Editor and Contig Chromatogram and Variance Table or Translated Variance Table when you are in the Review mode First you must organize the windows Then go to the Window menu and choose the command called Remember Window Layout Select the submenu option called Single Variance Table Review if you have one Variance Table open and Double Variance Table Review if both are open Every SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 171 time you select the Review button from the Variance Table Sequencher will open the windows in your layout positions User Preferences You can specify your preferences for many program settings in Sequencher To set these go to the Window menu and choose User Preferences The User Preferences window contains a hierarchical list of preference settings The main categories of settings are General Display and Input Output Click the triangle sign next to a cate
270. w Feature Jv Display Feature in Editors Feature Location Fag km Which strand Complement Single Strand Only Complement g Add Remove RNA v Protein Translation To alter default styles go to the Featur None Blue v cyan Green Magenta Red Yellow Invert Case Underline Editing an existing feature To edit an existing feature go to the Sequence menu and choose Edit Features To display the Feature Editor click on the name of the feature in the feature list Use the Display Style pull down menu to specify new display attributes You can also change the Feature Key edit the Feature Name and the Feature Location For example you could change a Sequencher annotation into a GenBank feature If you want to remove a feature select its name from the list and click on the Remove button When you have finished entering or editing your features click Done The features will appear in the Sequence Editor if you have checked the Display Features in Editors checkbox and Display Features in the View menu Quick feature creation To create a feature quickly select a region in the sequence or contig editor and then go to the Sequence menu and choose Mark Selection As Feature Sequencher displays a dialog box called Mark Selection As Feature that lets you assign a Feature Key name the feature and specify display attributes Figure 17 7 When you have finished assigning the feature attributes
271. w pixels The adjustments made are to aid you in reviewing the original data they will not be saved to the file when you save the project SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 136 16 Restriction Maps In this chapter we discuss restriction maps and how to work with them We discuss choosing Restriction Map display options selecting and changing selected enzymes saving new or modified enzymes and copying the map Displaying a Restriction Map You can view a Restriction Map for a sequence or a contig by selecting its icon in the Project Window and opening an editor Go to the button bar of the editor and click on the Cut Map button Alternately from the editor go the View menu and choose Bases Map Overview then choose Restriction Map from the submenu Figure 16 1 shows a restriction map display The number in parentheses shows the cut location Figure 16 1 A single line restriction map ae 425 Drall 44 K pal 431 Drall 704 S 45 Gaattt 117 Drall 476 b 781 Apal 48 k 123 Es 234 We 328 me 496 fe 631 Apal 707 fe 800 fe 1 029 Mapping all cutsites In this type of restriction map clicking the name of an enzyme highlights all the locations where that enzyme cuts Restriction Map display options How to select enzymes To change the restriction map display click the Options button in the button bar or go the View menu
272. which uses portions of sequences s name to determine against which other sequences it will be compared against to construct a contig Program that analyses fluorescent trace intensities from automated sequencer and assigns bases together with a probability of error The tool region in a Sequencher window The button bar is located just below the title bar A format for describing sequence assemblies A control that lets you toggle a parameter Click the box to turn it on or off When a checkbox is active it is displayed with an X in the box Press and immediately release the mouse button A number associated with each base call and which defines the likelihood that a base call is incorrect The most common scale is from 1 60 where 60 represents a 1 10 chance of a wrong call and 20 represents a 1 10 chance See also Quality score 206 Name Contig Cursor Dialog box Delimiter Double click Drag Elevator button Enzyme Exemplar Field Handle Hierarchical menu Modal dialog box Motif Mouse MSF SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved Definition Contiguous alignment of a set of sequences to make up the sequence of bases from a longer piece of DNA The indicator on a computer screen that shows the currently active location Cursors have various shapes indicating different purposes and capabilities Any of several sp
273. x Stanford Extended Code Code Base s Meaning A A Adenine C C Cytosine G G Guanine T T Thymine U U Uracil RNA P AorG Purine Q CorT or U Pyrimidine K Gor T or U Keto J AorC M GorC L Aor T or U B C G T or U not A D G A T or U not C H A C T or U not G V A C orG not T SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 194 Code Base s Meaning 5 A or Another Base Probably A 3 C or Another Base Probably C 6 G or Another Base Probably G 4 T or Another Base Probably T 9 A or Nothing Maybe A 7 C or Nothing Maybe C 0 G or Nothing Maybe G 8 T or Nothing Maybe T N A C G T or U Any SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 195 27 Appendix Default Feature Styles The following table displays the defaults settings for the colors and styles of new features New features are those you create in an existing sequence or those described in an imported sequences with a GenBank style Feature Table You can change the default settings in the Feature Motif preference pane For more information refer to Chapter 21 Customizing Sequencher and User Preferences Feature Display Color Style Second Strand A misc_feature 1 misc_difference y Red a conflict y Red b unsure y Red c old_sequence y Red d variation y Red Underlined e modified_base y Red f mutation y Red g allele y
274. y clicking anywhere in the Comments box and typing the information To store more information than the Comments box allows go to the Edit menu and choose Edit Comments Sequencher opens a small text editing window that stores about 250 characters of text for each sequence After you have added text with Edits Comments a small I for Info appears in the upper left corner of the icon If you want to remove the information in the Comments box select the text and then go to the Edit menu and choose Contents from the Clear option The Project Window button bar The button bar contains buttons for frequently used commands It appears just below the top of the Project Window You can use the smaller left hand button which has an up arrow on it to hide the button bar Click on the button and the button bar will hide behind the title bar When the button bar is hidden you can still see the bottom of the left hand button under the title bar It will show a down pointing arrowhead Click on the arrowhead and the button bar will reappear If you click on the Assembly Parameters button this will display the Assembly Parameters window Clicking on the AbN button will enable the Assemble by Name function Assemble Automatically Assemble Interactively and Assemble to Reference are used to assemble sequences you have selected If AbN is enabled then the Assemble Automatically and Assemble to Reference buttons will have different labe
275. y necessary to check and edit your contigs Sequencher provides a powerful interface between the user and the data so that you can analyze and edit sequences and contigs according to your own specifications You can move directly from one ambiguity or disagreement to the next to analyze and override base calling errors eliminating discrepancies and ambiguities Sequencher allows you to choose from a number of consensus calculations and continually recalculates the consensus of the contig as you edit the sequences Overview of the contig The contig overview window When you first open a contig by double clicking on it you will see an overview that shows how the sequences have been assembled Figure 11 1 There is also a button bar at the top of the overview window The schematic provides you with a wealth of useful information enabling you to assess and manage your data A horizontal line represents each fragment in the contig The line will be green and solid if the fragment is in the forward orientation and red and dotted if SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 75 it is in the reverse orientation These orientations may change as more data is added to the contig unless you have used a Reference Sequence in your assembly In this case the Reference Sequence determines the contig orientation Below the fragments you will see the coverage map and below the coverage map you will see the s
276. y of related genes with alternative splicing Assembling with Dirty Data Go to the Assembly Parameters dialog box and select the Dirty Data radio button There are two sliders for changing minimum match values To set the proportion of bases that have to match use the Minimum Match Percentage slider To set the minimum number of bases that must overlap use the Minimum Overlap slider Change the settings by positioning your cursor on the slider holding the mouse button down and dragging the slider left or right The value set will automatically update as you move the slider For example if you attempt to assemble a 17 base sequence that matches perfectly to a selected 1000 base sequence with the minimum overlap set at 20 bases Sequencher s default minimum overlap the two fragments will not assemble You must first reduce minimum overlap to 17 bases or lower and then assemble the fragments Assembling with Clean Data When you select the Clean Data algorithm an additional option called Maximum Loop Out Size is available This has an elevator button for adjusting size value Figure 9 2 below This parameter is the largest number of consecutively mismatched bases that are acceptable in a potential overlap Change the setting by positioning your cursor on the appropriate arrowhead and holding the mouse button down The maximum value which can be set is 6 To set the proportion of bases that have to match use the Minimum Match Percentage
277. y stores data on the disk Exporting data You can save your work in a file format other than Sequencher You can export the entire file or a subset of the project Click on the File menu and choose an Export submenu option A dialog box will allow you to specify the file format in which you want to export your selection Figure 5 4 For example if you choose Selection as Subproject you can specify CAF format for which you can set a number of options Fasta concatenated and older versions of Sequencher This is especially helpful if you want to share data with colleagues working with older versions of Sequencher Note It is important to remember that any version specific features you may have used will be lost if you save to an earlier version of Sequencher See Chapter 19 Exporting Data for more information Figure 5 4 Export sequences format menu Export Sequences Export Location C Documents and Browse Settings Administrator Desktop _Browse Forma gesi v Options Iw Use default names Cancel Exiting the program When you have finished working with Sequencher make sure you have saved your project Then go to the Sequencher menu and choose Quit Sequencher SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 30 6 Preparing Your Data for Assembly In this chapter we introduce you to Sequencher s powerful tools for trimming poor quality data or vector contamination from
278. y to use interface Contextual menus Most windows in Sequencher offer contextual menus You can invoke these by clicking within the window you are reading while holding down the right hand mouse button If you select one or more items and then click the right hand mouse button you will see other menus Note If you have a mouse with only one button you may be able to mimic the effect of a right hand button with the use of a modifier key SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 6 Keyboard shortcuts Sequencher has a number of keyboard shortcuts for major menu items and other important features and allows you to define some of your own See Appendix 23 Keyboard Shortcuts for a complete listing See the Chapter 21 on Customizing Sequencher and User Preferences for more information about how to define your keyboard shortcuts SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 3 The Project Window In this chapter we will introduce you to Sequencher s Project Window We will also show you how to get started with Sequencher by creating a new project or opening an existing one This chapter also describes how you view the constituent sequences or contigs in your project and how to annotate information in your project for later editing and record keeping Sequencher concepts About the Project Window The concept of the project is ce
279. your desktop you will open a new Project Window containing your sequences If Sequencher is already open the sequences will be imported into the open project Note Sequencher always shows a newly imported file as selected so if you do not want to use it right away de select it by clicking elsewhere in the project Copy and paste One of the easiest ways to move data between Sequencher and other programs is to use the clipboard s Copy and Paste commands First launch both Sequencher and the other program Then select and copy the bases of interest in the other program Go to the Sequence menu and choose Create New Sequence Type a name for your sequence into the Sequence s name box and then click the OK button Now go to the Edit menu and choose Paste When you close the window you will see a dialog box with two buttons If you have finished entering your data click the button Record As Experimental Data Otherwise click the button Not Yet Finished Sequencher then removes the window SEQUENCHER User Manual 1991 2011 Gene Codes Corporation Inc All rights reserved 17 How to import using menu commands Importing sequences Sequencher imports sequences in a variety of text and chromatogram formats Some of the most popular are ABI MegaBase CEQ SCF GenBank EMBL DDBJ and plain text files To import a sequence first bring the Project Window to the front by clicking on it Under File menu choose Import Choose Sequenc

Download Pdf Manuals

Related Search

Related Contents

Ksix B0713SC01 screen protector  SQL Query for PostgreSQL  STRIPE OVERNIGHT  Advanced satellite SP - SA series Manual de servicio  医政研発第03 300 ー 8号" 平成ー 9年3月 3 0 日  Samsung SyncMaster 460MX-2  Tenda D301 router  Optimus SYSTEM 748 User's Manual  タバコは女性の天敵!!  労働安全衛生 マネジメントシステムにおける 産業保健スタッフの役割  

Copyright © All rights reserved. Failed to retrieve file