SMART PCR cDNA Synthesis Kit User Manual - Gene X
Contents
1. SMART PCR cDNA Synthesis Kit User Manual IV General Considerations PLEASE READ ENTIRE PROTOCOL BEFORE STARTING This kit is designed for the construction of high quality SMART cDNA for a variety of applications This User Manual provides two protocols for cDNA synthesis one for cDNA library construction Sections V and VI and one for other applications including Clontech PCR Select cDNA Subtraction Sections VII and VIII Be sure to follow the appropriate protocol for your application see Figure 2 Proper template switching which is essential to the SMART technology requires the use of an MMLV RNase H point mutant not deletion mutant reverse transcriptase such as PowerScript Reverse Transcriptase included with each SMART Kit The protocols have been optimized for both total and poly A RNA The minimum amount of starting material for cDNA synthesis is 50 ng of total RNA or 25 ng of poly A RNA However if your RNA sample is not limiting we recommend that you start from 1 ug of total RNA or 0 5 ug of poly A RNA for cDNA synthesis Whatever your application may be the success of your experiment depends on the guality of your starting sample of total or poly A RNA There are several procedures available for RNA isolation Chomczynski amp Sacchi 1987 Farrell 1993 Sambrook et al 2001 In addition Clontech offers several kits for the isolation of total RNA and subsequent isolation of poly A RNA Alternativel2. cDNA subtraction WLAN Figure 5 Protocol guide for SMART cDNA synthesis for PCR Select cDNA subtraction and other applications Clontech Laboratories Inc www clontech com Protocol No PT3041 1 18 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual Vil SMART cDNA Synthesis Protocol continued Important If you are planning to proceed with the Clontech PCR Select cDNA Subtraction protocol we recommend reading the User Manual for cDNA Subtraction before proceeding with first strand cDNA synthesis using the SMART method The cDNA Subtraction Kit supplies a different RNA control that should be used to synthesize cDNA according to the PCR Select User Manual which describes a non SMART method In addition use the control provided in this kit to troubleshoot any problems using the SMART protocol For more information about using these controls see Section VIII D of this User Manual A First Strand cDNA Synthesis 1 For each sample and the Control Human Placental Total RNA combine the following reagents in a sterile 0 5 ml reaction tube 1 3 ul RNA sample 0 025 1 ug of poly A or 0 05 1 ug of total RNA 1 ul 3 SMART CDS Primer ll A 12 uM 1 ul SMART II A Oligonucleotide 12 uM x ul Deionized H2O 5 ul Total volume For the control synthesis add 1 ul 1 pg pl of Control Human Placental Total RNA 2 Mix contents and spin the tube briefly in a microcentrifuge Incubate the tube at 709C in a thermal cycler
3. cont D Purification of Digested cDNA Section VIII C To analyze the yield of purified SMART cDNA electrophorese 10 ul of Rsa l digested cDNA before purification Sample E from Step VIII B 6 alongside 10 ul of purified diluted cDNA before ethanol precipitation Sample F Step VIII C 14 and 1 8 ul of purified diluted cDNA after ethanol precipitation Sample G from Step VIII C 22 on a 1 5 agarose EtBr gel Compare the intensities of the samples and estimate what percentage of Rsa l digested PCR product remains after purification and ethanol precipitation The yield of cDNA after purification using the NucleoTrap PCR Kit and ethanol pre cipitation is typically 70 percent If your yield is lt 30 percent troubleshoot your purification protocol or consult the troubleshooting guide of the User Manual for that particular purification kit Clontech Laboratories Inc www clontech com Protocol No PT3041 1 30 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual X Troubleshooting Guide A First Strand cDNA Synthesis and SMART PCR Amplification Sections V A B amp VII A B 1 Low molecular weight size distribution lt 3 kb poor yield or no PCR product observed for the Control Human Placental Total RNA a Proper template switching which is essential to the SMART technology requires the use of an MMLV RNase H point mutant reverse transcriptase such as PowerScript Reverse Transcriptase included with each SMA
4. mRNA Mini Purification Kit e NucleoSpin RNA II Kit Premium Total RNAs Premium Poly A RNAs e TaqStart Antibody e Amplimer Sets e Marathon Ready cDNAs e MTN Multiple Tissue Northern Blots Protocol No PT3041 1 www clontech com Version No PR6Z2173 Cat No 637401 637403 634901 634914 639206 639207 639201 639202 639553 639554 639556 639550 639500 639501 636022 635990 many many 639250 many many many Clontech Laboratories Inc 35 SMART PCR cDNA Synthesis Kit User Manual Appendix Virtual Northern Blots After cloning your subtracted cDNA fragments you should confirm that they represent differentially expressed genes Typically this is accomplished by hybridization to Northern blots of the same RNA samples used as driver and tester for subtraction If however you have limited sample material you may wish to use Virtual Northern blots for analysis By using the same SMART PCR amplified tester and driver cDNA used for subtraction you can obtain information that is similar to that provided by standard Northern analysis Even if a cDNA does not give a single band when hybridized to a Virtual Northern blot you can still detect whether or not it is differentially expressed Multiple bands on a Virtual Northern blot may result from different causes The CDNA may belong to a multi gene family or may contain a nucleotide repeat Alternatively a truncated copy of the gene may be
5. 4 kb then too few thermal cycles i e PCR undercycling may be the problem see Troubleshooting Guide Section X B 2 Several bright bands corresponding to abundant transcripts The pattern of bright bands shown in Figure 4 is characteristic of the ds cDNA synthesized from the Control Human Placental Total RNA using the protocol outlined in Section V As indicated by the arrow in Figure 5 you should observe a strong distinct band at 900 bp A very strong smear of cDNA in the control reaction without the characteristic bright bands may be indicative of PCR overcycling see Troubleshooting Guide Section X B If the characteristic bands are present but weak this may be indicative of PCR undercycling see Troubleshooting Guide Section X B The number and position of the bands you obtain with your experimental RNA may differ from those shown for the control reaction Furthermore CDNA prepared from some mammalian tissue sources e g human brain spleen and thymus may not display any bright bands due to the very high complexity of the poly A RNA Clontech Laboratories Inc www clontech com Protocol No PT3041 1 16 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual VI Analysis of Results for Library Construction continued M ds cDNA Figure 4 Analysis of ds cDNA synthesized for library construction 1 pl 1 0 pg of the Control Human Placental Total RNA provided in the kit was used as starting material in a
6. 5 ul of each aliquot of each PCR reaction alongside 0 1 ug of 1 kb DNA size marker on a 1 2 agarose EtBr gel in 1X Clontech Laboratories Inc www clontech com Protocol No PT3041 1 22 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual Vil SMART cDNA Synthesis Protocol continued 12 13 TAE buffer Determine the optimal number of cycles required for each experimental and control sample see Figure 7 Section IX Retrieve the 15 cycle PCR tubes from 4 C return them to the thermal cycler and subject them to additional cycles if necessary until you reach the optimal number When the cycling is completed analyze a 5 ul sample of each PCR product alongside 0 1 ug of 1 kb DNA size marker on a 1 2 agarose EtBr gel in 1X TAE buffer Compare your results to Figure 7 to confirm that your reactions were successful Add 2 ul of 0 5 M EDTA to each tube to terminate the reaction Transfer 7 ul of your raw PCR product to a clean microcentrifuge tube and label this tube Sample A Store at 20 C You will use Sample A for analysis of column chromatography as described in Section IX B You now have SMART ds cDNA ready to use for applications such as Virtual Northern blotting or generation of cDNA probes For PCR Select cDNA subtraction proceed with the following protocol Step VIII A below VIII Protocol for Clontech PCR Select cDNA Subtraction A Column Chromatography PCR Select
7. For Profit purchasers of SMART Products are entitled to use the reagents for internal research However the following uses are expressly prohibited 1 performing services for third parties 2 identifying nucleic acid sequences to be included on nucleic acid arrays blots or in libraries or other cDNA collections which are then sold to third parties Reproduction modifica tion reformulation or resale of the reagents provided in SMART Products is not permitted For information on licensing SMART Technology for commercial purposes please contact a licensing representative by phone at 650 919 7320 or by e mail at licensing clontech com TurboBlotter is a trademark of the Whatman Group NucleoTrap and NucleoSpin are registered trademarks of MACHEREY NAGEL GmbH amp Co KG Clontech Clontech logo and all other trademarks are the property of Clontech Laboratories Inc Clontech is a Takara Bio Company 2006 Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173
8. M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Chenchik A Mogadam F amp Siebert P January 1995 Marathon cDNA amplification A new method for cloning full length cDNAs Clontechniques X 1 5 8 Chenchik A Mogadam F amp Siebert P 1996 A new method for full length cDNA cloning by PCR In A Laboratory Guide to RNA Isolation Analysis and Synthesis Ed Krieg P A Wiley Liss Inc pp 273 321 Chenchik A Zhu Y Y Diatchenko L Li R Hill J amp Siebert P D 1998 Generation and use of high quality cDNA from small amounts of total RNA by SMART PCR In Gene Cloning and Analysis by RT PCR BioTechniques Books MA pp 305 319 Chomczynski P amp Sacchi N 1987 Single step method of RNA isolation by acid guanidinium thio cyanate phenol chloroform extraction Anal Biochem 162 156 159 Diatchenko L Lau Y F C Campbell A P Chenchik A Mogadam F Huang B Lukyanov S Lukyanov K Gurskaya N Sverdlov E D amp Siebert P D 1996 Suppression subtractive hybridiza tion A method for generating differentially regulated or tissue specific CDNA probes and libraries Proc Natl Acad Sci USA 93 6025 6030 Endege W O Steinmann K E Boardman L A Thibodeau S N amp Schlegel R 1999 Represen tative cDNA libraries and their utility in gene expression pro
9. Users only 1 N For every experimental sample and control combine the two reaction tubes of PCR product from Section VII B into a 1 5 ml microcentrifuge tube Add an equal volume of phenol choloroform isoamyl alcohol 25 24 1 Vortex thoroughly Centrifuge the tubes at 14 000 rpm for 10 min to separate the phases Remove the top aqueous layer and place it in a clean 1 5 ml tube Add 700 ul of n butanol and vortex the mixture thoroughly Butanol extraction allows you to concentrate your PCR product to a volume of 40 70 ul Note Addition of too much n butanol may remove all the water and precipitate the nucleic acid If this happens add water to the tube and vortex until an agueous phase reappears Centrifuge the solution at room temperature at 14 000 rpm for 1 min Remove and discard the upper n butanol organic phase If you do not end up with a volume of 40 70 ul repeat steps 5 7 Note If your volume is lt 40 ul add H O to the aqueous phase to adjust volume to 40 70 ul Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 23 SMART PCR cDNA Synthesis Kit User Manual VIII Protocol for Clontech PCR Select continued 9 14 15 18 19 20 21 Invert a CHROMA SPIN 1000 Column several times to completely resuspend the gel matrix Note Check for air bubbles in the column matrix If bubbles are visible resuspend the matrix in
10. not supplied First strand cDNA synthesis and SMART PCR cDNA amplification e Advantage 2 PCR Kit Cat Nos 639206 amp 639207 e Optional Mineral oil Sigma Cat No M3516 e Phenol chloroform isoamyl alcohol 25 24 1 Prepare as follows 1 Melt phenol 2 Equilibrate with an equal volume of sterile buffer 50 mM Tris pH 7 5 150 mM NaCl 1 mM EDTA 3 Incubate the mixture at room temperature for 2 3 hr 4 Remove and discard the top layer 5 Add an equal volume of chloroform isoamyl alcohol to the remaining layer Mix thoroughly Remove and discard the top layer 6 Store the bottom layer of phenol chloroform isoamyl alcohol 24 1 at 4 C away from light for a maximum of two weeks e TE buffer 10 mM Tris pH 7 6 1 mM EDTA e Ethanol e 4M Ammonium acetate pH 7 0 e DNA size markers 1 kb DNA ladder e 50X TAE electrophoresis buffer 242 0g Tris base 57 1 ml glacial acetic acid 372g _ Na EDTA e2H O Add H O to 1 L ds cDNA polishing for library construction e Proteinase K 20 pg ul Roche Applied Science Cat No 0161519 e T4 DNA Polymerase New England Biolabs Cat No M0203S Purification for Clontech PCR Select cDNA Subtraction e 1X TNE buffer 10 mM Tris HCl pH 8 10 mM NaCl 0 1 mM EDTA e NucleoTrap Purification Kit Cat No 636020 NucleoTrap Suspension 80 ml Buffer NT2 16 ml Buffer NT3 Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 9
11. not with your experimental RNA then there may be a problem with your RNA The easiest way to check the quality of the first strand cDNA is by using a small sample of it as a PCR template with 3 and 5 gene specific primers such as Human B Actin Control Amplimers Cat No 639001 Cat No 639002 If the first strand synthesis Clontech Laboratories Inc www clontech com Protocol No PT3041 1 32 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual X Troubleshooting Guide continued has been successful a PCR product of the expected size will be generated 2 No bright bands distinguishable in the PCR product For most mammalian RNA sources there should be several bright bands distinguishable against the background smear when a sample of the PCR product is run on a gel If bright bands are expected but are not visible and the background smear is very intense you may have overcycled your PCR If you suspect that your problem is due to overcycling then the PCR step Section V B must be repeated with a fresh 2 ul sample of first strand cDNA using 2 3 fewer cycles C Preparation for Clontech PCR Select cDNA Subtraction Sections VII IX For troubleshooting the actual PCR Select subtraction procedure please refer to the User Manual for the Clontech PCR Select cDNA Subtraction Kit Here we provide a troubleshooting guide for preparing SMART cDNA for subtraction described in Section VII and VIII 1 Low
12. present To distinguish between these possibilities analysis should also include other methods such as genomic DNA seguencing or RACE To prepare a Virtual Northern blot electrophorese your SMART PCR amplified cDNA before purification on an agarose EtBr gel and use a Southern transfer onto a nylon membrane see Sambrook et al 1989 At Clontech we use the TurboBlotter equipment and protocol from Schleicher amp Schuell Figure 8 shows how Virtual Northern blots can be used to confirm differential expression of subtracted cDNAs y 1 y 2 y 3 y 4 G3PDH kb vy B kb y B ko y B kb y B kb y B 4 0 4 0 4 0 4 0 4 0 3 0 3 0 e 3 0 3 0 3 0 20 20 2 0 2 0 20 1 6 1 6 1 6 1 6 1 6 1 0 1 0 10 oe gt e 0 5 0 5 0 5 0 5 0 5 Figure 8 Virtual Northern blot analysis of cDNA fragments expressed in cells producing y globin Clontech PCR Select cDNA subtraction was performed to isolate cDNAs that were preferentially expressed in cells producing y globin 1 ug of total RNA from cells producing y globin was used as the tester 1 ug of total RNA from cells producing p globin was used as the driver Tester and driver cDNAs were synthesized using the SMART PCR cDNA Synthesis Kit and were subjected to PCR Select subtraction 84 subtracted cDNA clones were arrayed on a nylon membrane for differential screening 13 of these subtracted cDNAs showed differential signals and were therefore candidates for further analysis by Virtual Northern blots Differential expression
13. rigorous purification method also ensures that each PowerScript preparation is not contaminated with RNase and DNase Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 7 SMART PCR cDNA Synthesis Kit User Manual ll List of Components Store CHROMA SPIN and Microfiltration columns at room temperature Store RNA and SMART II A Oligo at 70 C Store all other reagents at 209C For important information about the use of SMART technology please read the Notice to Purchaser at the end of this User Manual Box 1 TA 7 7 200 100 70 e 200 5 1 Box 2 7 7 Clontech Laboratories Inc 8 ul ul ul ul ul ul ml SMART II A Oligonucleotide 12 uM 5 AAGCAGTGGTATCAACGCAGAGTACGCGGG 3 Rsa l 3 SMART CDS Primer ll A 12 uM 5 AAGCAGTGGTATCAACGCAGAGTACT go V N 3 N A C G or T V A G or C Rsa PowerScript Reverse Transcriptase 5X First Strand Buffer 250mM Tris HCI pH 8 3 375mM KCI 30mM MgCl 5 PCR Primer ll A 12 uM 5 AAGCAGTGGTATCAACGCAGAGT 3 dNTP Mix 10 mM of each dNTP Dithiothreitol DTT 20 mM Control Human Placental Total RNA 1 pg ul Deionized H O CHROMA SPIN 1000 Columns Microfiltration Columns 0 45 um www clontech com Protocol No PT3041 1 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual lll Additional Materials Required The following reagents are required but
14. the column buffer by inverting the column again Remove the top cap from the column and then remove the bottom cap Place the column into a 1 5 ml centrifuge tube or a 17 x 100 mm tube Discard any column buffer that immediately collects in the tube and add 1 5 ml of 1X TNE buffer to the column Let the buffer drain through the column by gravity flow until you can see the surface of the gel beads in the column matrix The top of the column matrix should be at the 0 75 ml mark on the wall of the column If your column contains much less matrix discard it and use another column Discard the collected buffer and proceed with purification Carefully and slowly apply the sample to the center of the gel bed s flat surface Do not allow any sample to flow along the inner wall of the column Apply 25 ul of 1X TNE buffer and allow the buffer to completely drain out of the column Apply 150 pl of 1X TNE buffer and allow the buffer to completely drain out of the column Transfer column to a clean 1 5 ml microcentrifuge tube Apply 320 ul of 1X TNE buffer and collect the eluate as your purified ds cDNA fraction Transfer 10 ul of this fraction to a clean microcentrifuge tube and label this tube Sample B Store at 20 C Use this aliquot for agarose EtBr gel analysis Step 21 below Apply 75 ul of 1X TNE buffer and collect the eluate in a clean micro centrifuge tube Label this tube Sample C and st
15. to facilitate removal of these identical sequences from the PCR amplified cDNA molecules This User Manual includes two protocols for cDNA synthesis These protocols have been designed to strike a balance between maintaining gene representation and reducing nonspecific background amplification In the first protocol Sections V and VI undiluted first strand ss cDNA is subjected to the fewest possible number of PCR cycles This protocol is ideal for cDNA library construction where high representation is most important Zhu et al 2001 In the second protocol Sections VII and VIII the first strand ss CDNA template is diluted and more PCR cycles are performed This greatly reduces nonspecific amplification which is crucial for PCR Select cDNA subtraction and other non library applications Be sure to choose the appropriate protocol for your application The SMART cDNA synthesis method is now optimized for rapid amplification of cDNA ends RACE Matz et al 1999 The SMART RACE cDNA Amplification Kit Cat No 63491 4 integrates our Marathon cDNA Amplification Kit Chenchik et al 1995 1996 with our SMART cDNA synthesis technology and allows you to perform both 5 and 3 RACE using either poly At or total RNA Clontech has rigorously tested our new SMART RACE Kit to verify that it performs even better than the Marathon Kit January 1999 Clontechniques Clontech Laboratories Inc www clontech com Protocol No PT3041 1 6 Version No
16. with one drop of mineral oil before you close the tube This will prevent loss of volume due to evaporation 9 Place the tube on ice to terminate first strand synthesis 10 If you plan to proceed directly to the PCR step Section V B transfer a 2 ul aliquot from the first strand synthesis to a clean prechilled 0 5 ml reaction tube Place tube on ice If you used mineral oil in your first strand reaction tube be careful to take the aliquot from the bottom of the tube to avoid the oil 11 Any first strand reaction mixture that is not used right away should be placed at 209C First strand cDNA can be stored at 209C for up to three months aR WwW PP Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 13 SMART PCR cDNA Synthesis Kit User Manual V SMART cDNA Synthesis for Library continued B cDNA Amplification by LD PCR Table provides guidelines for the optimal number of thermal cycles for a given amount of total or poly A RNA used in the first strand synthesis These guidelines were developed using the Control Human Placental Total RNA and an authorized hot lid thermal cycler optimal parameters may vary with different templates and thermal cyclers Use the fewest cycles possible overcycling may yield nonspecific PCR products If necessary undercycling can be easily rectified by placing the reaction back in the thermal cycler for a few more cycles see Troubleshooting Guid
17. 41 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 25 SMART PCR cDNA Synthesis Kit User Manual VIII Protocol for Clontech PCR Select continued 6 17 18 19 20 21 Add 680 ul of Buffer NT2 to the pellet Mix gently to resuspend Centrifuge at 10 000 x g for 1 min at room temperature Remove the supernatant completely and discard Add 680 ul of Buffer NT3 to the pellet Mix gently to resuspend Centri fuge the sample at 10 000 x g for 1 min at room temperature Remove the supernatant completely and discard Repeat Step 7 Centrifuge the pellet again at 10 000 x g for 1 min at room temperature Air dry the pellet for 15 min at room temperature or at 37 C to speed up evaporation Note Do not use a speed vac to dry the pellet speed vacs tend to overdry the beads which leads to lower recovery rates Add 50 ul of TE buffer pH 8 0 to the pellet Resuspend the pellet by mixing gently Combine the resuspended pellets into one tube Mix gently Elute the DNA by incubating the sample at 50 C for 5 min Gently mix the suspension 2 3 times during this incubation step Centrifuge the sample at 10 000 x g for 30 sec at room temperature Transfer the supernatant containing the pure DNA fragment to a clean 1 5 ml microcentrifuge tube Note Repeating Steps 10 12 can increase yields approximately 10 15 Apply the supernatant to a microfiltration column that has been in
18. CR Buffer 2 ul 50X dNTP 10 mM of each dNTP 2 ul 5 PCR Primer ll A 12 uM __2 ul 50X Advantage 2 Polymerase Mix 90 ul Total volume Mix well by vortexing and spin the tube briefly in a microcentrifuge Aliquot 90 ul of the PCR Master Mix into each tube from Step 2 Cap the tube and place it in the preheated thermal cycler If necessary overlay the reaction mixture with two drops of mineral oil Commence thermal cycling using the following program e 95 C 1 min e x cycles 95 C 15sec 65 C 30sec 68 C 6 min Consult Table II for guidelines Subject all tubes to 15 cycles Then use the extra tube for each reaction to determine the optimal number of PCR cycles as described in Step 8 below Store the other tubes at 4 C For each extra PCR tube determine the optimal number of PCR cycles see Figure 6 a Transfer 15 ul from the 15 cycle PCR to a clean microcentrifuge tube for agarose EtBr gel analysis b Run three additional cycles for a total of 18 with the remaining 85 ul of the PCR mixture c Transfer 15 ul from the 18 cycle PCR to a clean microcentrifuge tube for agarose EtBr gel analysis d Run three additional cycles for a total of 21 with the remaining 70 ul of PCR mixture e Transfer 15 ul from the 21 cycle PCR to a clean microcentrifuge tube for agarose EtBr gel analysis f Run three additional cycles for a total of 24 with the remaining 55 ul of PCR mixture Electrophorese
19. MART cDNA after purification For two tubes you should obtain a total of 2 6 ug of cDNA If your yield is lower than this perform the agarose EtBr gel analysis described in Section IX D If your DNA concentration is gt 300 ng ul dilute your cDNA to a final con centration of 300 ng ul in 1X TNE buffer and follow the adaptor ligation step in accordance with the Clontech PCR Select cDNA subtraction protocol Your digested ds cDNA is now ready for adaptor ligation as described in Section IV F of the User Manual for the Clontech PCR Select cDNA Subtraction Kit Cat No 637401 Be sure to read Section VIII D below for important cDNA subtraction control procedures D Controls for Clontech PCR Select cDNA Subtraction We strongly recommend that you perform the following control subtractions Please refer to Section IV of the PCR Select User Manual 1 Control subtraction using the human skeletal muscle poly A RNA included in the PCR Select Kit Use the conventional method as described in the PCR Select User Manual to synthesize ds cDNA from the control human skeletal muscle poly At RNA provided in the PCR Select Kit Then set up a mock subtraction use a portion of the human skeletal muscle cDNA as the driver and mix another portion with a small amount of the control Hae lll digested X174 DNA from the PCR Select Kit as the tester This control subtraction which is described in detail in the PCR Select User Manual is t
20. PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual l Introduction continued SMART cDNA synthesis for cDNA subtraction The Clontech PCR Select cDNA Subtraction Kit Cat No 637401 provides a powerful method for identifying differentially expressed genes Diatchenko et al 1996 Gurskaya et al 1996 When total RNA is used for cDNA synthesis by con ventional methods ribosomal RNA is transcribed along with the poly A fraction even if synthesis is oligo dT primed If this cDNA is used with the PCR Select Kit the excess of ribosomal RNA and low concentration of cDNA corresponding to the poly A fraction results in inefficient subtractive hybridization However cDNA generated using the SMART PCR cDNA Synthesis Kit can be directly used for PCR Select subtraction even if total RNA was used as starting material Virtual Northern blots and probes The SMART PCR cDNA Synthesis Kit may also be useful for researchers who wish to analyze transcript size and expression patterns by hybridization but lack sufficient poly A or total RNA for Northern blots This is especially important for researchers who have isolated clones using the Clontech PCR Select Kit and who also need to confirm the differential expression of corresponding mRNAs Virtual Northern blots can be generated using SMART cDNA instead of total or poly A RNA Endege et al 1999 and can give information similar to that provided by standard Northern blots For m
21. RNA isolation kits see Related Products for ordering information B Special Considerations for Library Construction Sections V amp VI 1 Low yield of PCR product a Too few thermal cycles were used in the PCR step Another in dication of PCR undercycling is a cDNA size distribution lt 3 kb if the MRNA source was mammalian For some sources such as many insect species the normal mRNA size distribution may be lt 2 3 kb If you suspect that undercycling is the problem incubate the PCR mixture for two more cycles and recheck the product If you already used the maximum recommended number of cycles indicated in Table I increase by three more cycles If increasing the number of cycles does not improve the yield of PCR product repeat the PCR using a fresh 2 jl aliquot of the first strand product b If you still obtain a low yield of PCR product it may be due to a low yield of first strand cDNA Possible problems with the first strand reaction include a mistake in the procedure such as using a subop timal incubation temperature or omitting a component or not using enough RNA in the reaction It is also possible that the RNA has been partially degraded by contaminating RNases before or during the first strand synthesis Reminder problems with the first strand cDNA synthesis can be more easily diagnosed if you perform parallel reactions using the Control RNA provided in the kit If good results were obtained with the Control RNA but
22. RT Kit b RNAs may have degraded during storage and or first strand synthesis Poor quality RNA starting material will reduce the ability to obtain full length cDNAs RNA must be stored at 70 C Your working area equipment and solutions must be free of contamination by RNase A c You may have made an error during the procedure such as using a suboptimal incubation temperature or omitting an essential component Carefully check the protocol and repeat the first strand synthesis and PCR d The conditions and parameters for PCR may have been suboptimal The optimal number of PCR cycles may vary with different PCR machines polymerase mixes or RNA samples If your PCR reaches its plateau after 24 cycles or more the conditions of your PCR may not be optimal Check the protocol and repeat the PCR using a fresh 2 ul aliquot of the first strand product 2 Poor yield or truncated PCR product from your experimental RNA Ifthe reaction with the Control Human Placental Total RNA was successful but your experiment failed your experimental RNA sample may be too dilute or degraded or may contain impurities that inhibit first strand synthesis If your RNA sample was prepared from a nonmammalian species the apparently truncated PCR product may actually have the normal size distribution for that species For example for insects the normal RNA size distribution may be lt 2 3 kb If you have not already done so electrophorese a sample of y
23. SMART PCR cDNA Synthesis Kit User Manual Cat No 634902 PT3041 1 PR6Z2173 Published 22 December 2006 SMART PCR cDNA Synthesis Kit User Manual Table of Contents l Introduction ll List of Components Ill Additional Materials Required IV General Considerations V SMART cDNA Synthesis for Library Construction A First Strand cDNA Synthesis B cDNA Amplification by LD PCR C ds cDNA Polishing Analysis of Results for Library Construction SMART cDNA Synthesis Protocol A First Strand cDNA Synthesis B cDNA Amplification by LD PCR VIII Protocol for Clontech PCR Select cDNA Subtraction A Column Chromatography Vi VI B Rsa I Digestion C Purification of Digested CDNA D Controls for Clontech PCR Select cDNA Subtraction IX Analysis for Clontech PCR Select Subtraction A Determining the Optimal Number of PCR Cycles B Column Chromatography C Rsa Digestion D Purification of Digested cDNA X Troubleshooting Guide A First Strand cDNA Synthesis and SMART PCR Amplification B Special Considerations for Library Construction C Preparation for Clontech PCR Select cDNA Subtraction XI References XII Related Products Appendix Virtual Northern Blots Clontech Laboratories Inc www clontech com Protocol No PT3041 1 2 10 12 13 14 15 16 18 19 20 23 23 24 25 27 28 28 29 29 30 31 31 32 33 34 35 36 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit Use
24. age Sampson R Houl gatte R Soularue P amp Auffray C 1996 Novel gene transcripts preferentially expressed in hu man muscles revealed by quantitative hybridization of a high density cDNA array Genome Res 6 492 503 Sambrook J amp Russell D W 2001 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Siebert P D Chenchik A Kellogg D E Lukyanov K A amp Lukyanov S A 1995 An improved method for walking in uncloned genomic DNA Nucleic Acids Res 23 1087 1088 SMART RACE cDNA Amplification Kit January 1999 Clontechnigues XIV 1 4 6 Zhu Y Y Machleder E M Chenchik A Li R amp Siebert P M 2001 Reverse transcriptase tem plate switching A SMART approach for full length cDNA library construction BioTechnigues 30 892 897 Clontech Laboratories Inc www clontech com Protocol No PT3041 1 34 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual XII Related Products For a complete listing of all Clontech products please visit www clontech com e Clontech PCR Select cDNA Subtraction Kit e Clontech PCR Select Differential Screening Kit e SMART cDNA Library Construction Kit e SMART RACE cDNA Amplification Kit e Advantage 2 PCR Kit e Advantage 2 Polymerase Mix e Sprint Advantage Single Shots e Sprint Advantage 96 Plate e PowerScript Reverse Transcriptase e NucleoTrap
25. e Section X B Total RNA Poly A RNA ug ug Number of Cycles 1 0 2 0 0 5 1 0 13 15 0 5 1 0 0 25 0 5 15 18 0 25 0 5 0 125 0 25 18 21 0 05 0 25 0 025 0 125 21 24 1 Preheat a thermal cycler to 95 C 2 Prepare a Master Mix for all reaction tubes plus one additional tube Combine the following components in the order shown per rxn 80 ul Deionized H O 10 ul 10X Advantage 2 PCR Buffer 2ul 50X dNTP Mix 10 mM of each dNTP 4ul 5 PCR Primer ll A 12 uM 2Mul 50X Advantage 2 Polymerase Mix 98 ul Total volume 3 Mix well by vortexing and centrifuge the tube briefly in a microcentrifuge 4 Aliquot 98 ul of the Master Mix into each reaction tube from Step A 10 5 Mix contents by gently flicking the tubes Centrifuge tubes briefly in a microcentrifuge 6 Cap the tube and place it in the preheated thermal cycler If necessary overlay the reaction mixture with 2 drops of mineral oil Clontech Laboratories Inc www clontech com Protocol No PT3041 1 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual V SMART cDNA Synthesis for Library continued 7 8 Commence thermal cycling using the following program e 95 C 1 min e x cycles 95 C 15sec 65 C 30sec 68 C 6 min Consult Table I for guidelines When the cycling is completed electrophorese 5 ul of each sample on a 1 1 agarose EtBr gel in 1X TAE buffer For comparison Figure 4 shows the characteristic gel profile
26. e guidelines were determined using the Control Human Placental Total RNA and an authorized hot lid thermal cycler optimal parameters may vary with different templates and thermal cyclers To determine the optimal number of cycles for your sample and conditions we strongly recommend that you perform a range of cycles 15 18 21 and 24 cycles Figure 6 First strand ss cDNA from Section VII A P two tubes for PCR Select samples extra tube 15 PCR cycles Y Y store at 4 C remove aliguot w PCR cycles v remove aliquot 3 PCR cycles y remove aliquot w PCR cycles y remove aliquot Run aliquots on a y 1 2 agarose EtBr gel Run additional PCR cycles Determine optimal to achieve optimal number number of PCR cycles Section VIII Figure 7 Figure 6 Optimizing PCR parameters for SMART cDNA synthesis Note that for samples not used for cDNA subtraction you will only have two tubes per sample or control one experimental sample tube and one extra tube Clontech Laboratories Inc www clontech com Protocol No PT3041 1 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual Vil SMART cDNA Synthesis Protocol continued For each sample and control set up an extra reaction tube to determine the optimal number of PCR cycles If you plan to use your SMART cDNA for Clontech PCR Select cDNA subtraction you should set up a total of three tubes for each tester and d
27. ed cDNA to a clean microcentrifuge tube label this tube Sample E and store at 20 C You will compare this sample to the PCR product after final purification as described in Sec tion IX D C Purification of Digested cDNA PCR Select Users only You may purify your digested cDNA using any silica matrix based PCR pu rification system such as those offered by Clontech see Related Products Section XII Alternatively a phenol chloroform extraction may be performed however this may decrease the efficiency of the cDNA subtraction The fol lowing purification procedure has been optimized using SMART ds cDNA and the NucleoTrap PCR Kit Cat No 636020 not included with PCR Select Kit Before you start Add 64 ml of 95 ethanol to the Buffer NT3 for a final concentration of approximately 85 The appropriate volume is also listed on the Buffer NT3 bottle 1 2 Aliquotthe Rsal digested cDNA Section VIII B 6 above into two clean 1 5 ml microcentrifuge tubes approximately 170 ul in each tube Vortex the NucleoTrap Suspension thoroughly until the beads are com pletely resuspended Add 680 ul of Buffer NT2 and 17 ul of NucleoTrap Suspension to each tube of digestion mixture Incubate the sample at room temperature for 10 min Mix gently every 2 3 min during the incubation period Centrifuge the sample at 10 000 x g for 1 min at room temperature Discard the supernatant Protocol No PT30
28. filing BioTechniques 26 542 550 Farrell Jr R E 1993 RNA Methodologies A Lab Guide for Isolation and Characterization Aca demic Press San Diego CA Gurskaya N G Diatchenko L Chenchik A Siebert P D Khaspekov G L Lukyanov K A Vagner L L Ermolaeva O D Lukyanov S A amp Sverdlov E D 1996 Equalizing cDNA subtraction based on selective suppression of polymerase chain reaction Cloning of Jurkat cell transcripts induced by phytohemaglutinin and phorbol 12 myristate 13 acetate Anal Biochem 240 90 97 Kellogg D E Rybalkin l Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TaqStart Antibody Hotstart PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase BioTechniques 16 1134 1137 Lukyanov S A Gurskaya N G Tarabykin V S amp Sverdlov E D 1994 Highly efficient subtractive hybridization of cDNA Biorganic Chem Russian 20 701 704 Matz M Lukyanov S Bogdanova E Diatchenko L amp Chenchik A 1999 Amplification of CDNA ends based on template switching effect and step out PCR Nucleic Acids Res 27 1558 1560 Morgan J G Dolganov G M Robbins S E Hinton L M amp Lovett M 1992 Selective isolation of novel cDNAs encoded by the region surrounding the human IL 4 and 5 genes Nucleic Acids Res 20 5173 5179 Pietu G Alibert O Guichard V Lamy B Bois F Leroy E Mari
29. first strand cDNA synthesis 2 ul of the ss cDNA then served as template for LD PCR based second strand synthesis using 15 thermal cycles according to the protocol in Section V A 5 ul sample of the PCR product i e ds cDNA was electrophoresed on a 1 1 agarose EtBr gel Lane M 1 kb DNA ladder size markers 0 1 ug loaded The arrow indicates the strong band at 900 bp typically seen for human placental total RNA Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 17 SMART PCR cDNA Synthesis Kit User Manual VII SMART cDNA Synthesis Protocol Important This protocol is designed for synthesizing SMART cDNA for applications other than library construction such as Clontech PCR Select cDNA Subtraction or Virtual Northern Blots See Appendix To synthesize SMART cDNA for library construction use the protocol in Sections V and VI Total or poly A RNA First strand ss cDNA Section VII A Optimization of PCR cycles gt y Agarose EtBr gel analysis el SMART ds cDNA Compare to Figure 7 Section VII B Troubleshooting Section X C Column chromatography Virtual Northerns Section VIII A Appendix and probes Rsa I digestion Section VIII B Reagents for these procedures are atincluded in the SMART PCR cDNA Synthesis Kit Purification t Reagents for these procedures are included in the Section VIII C Clontech PCR Select cDNA Subtraction Kit Clontech PCR Select
30. for 2 min 4 Spin the tube briefly in a microcentrifuge to collect contents at the bottom Keep tube at room temperature 5 Add the following to each reaction tube 2 ul 5X First Strand Buffer 1 ul DTT 20 mM 1 ul dNTP Mix 10 mM of each dNTP 1 ul PowerScript Reverse Transcriptase 6 Gently vortex and spin the tubes briefly in a microcentrifuge 7 Incubate the tubes at 42 C for 1 hr in an air incubator Note If you use a water bath or thermal cycler for this incubation cover the reaction mixture with one drop of mineral oil before you close the tube This will prevent loss of volume due to evaporation 8 Dilute the first strand reaction product by adding the appropriate volume of TE buffer 10 mM Tris pH 7 6 1 mM EDTA e Add 40 ul of TE buffer if you used total RNA as starting material Add 450 ul of TE buffer if you used more than 0 2 ug of poly A RNA as starting material e Add 90 ul of TE buffer if you used less than 0 2 ug of poly A RNA as starting material o Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 19 SMART PCR cDNA Synthesis Kit User Manual Vil SMART cDNA Synthesis Protocol continued 9 Heat tubes at 72 C for 7 min 10 Samples can be stored at 209C for up to three months B cDNA Amplification by LD PCR Table Il provides guidelines for optimizing your PCR depending on the amount of total or poly A RNA used in the first strand synthesis Thes
31. he best way to confirm that the multistep subtraction procedure works in your hands Control subtraction using the human placental total RNA included in the SMART kit Use the SMART kit to amplify the Control Human Placental Total RNA then perform a mock subtraction as described for Control No 1 use a portion of the human placental cDNA as the driver and mix another por tion with a small amount of the control Hae lll digested pX174 DNA from the PCR Select Kit as the tester If Control No 1 works but Control No 2 does not you may assume that the SMART cDNA amplification and or purification failed In this case try reducing the number of PCR cycles for the cDNA amplification and troubleshoot your purification protocol Section VIII C Protocol No PT3041 1 www clontech com Clontech Laboratories Inc 27 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual IX Analysis for Clontech PCR Select Subtraction Figure 7 shows a typical gel profile of ds cDNA synthesized using the Control Human Placental Total RNA and the SMART protocol outlined in Section VII As indicated by the arrow you should observe a strong distinct band at 900 bp In general cDNA synthesized from mammalian total RNA should appear on a 1 2 agarose EtBr gel as a moderately strong smear from 0 5 6 kb with some distinct bands The number and position of the bands you obtain will be different for each particular total RNA used Furthermo
32. l RNA Clontech Laboratories Inc www clontech com Protocol No PT3041 1 28 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual IX Analysis for Clontech PCR Select Subtraction cont We have optimized the PCR cycling parameters presented in this User Manual using an authorized hot lid thermal cycler and the Advantage 2 PCR Kit Cat Nos 639206 amp 639207 These parameters may vary with different polymerase mixes templates and thermal cyclers We strongly recommend that you optimize the number of PCR cycles with your experimental sample s and the Control Human Placental Total RNA Try different numbers of cycles then analyze your results by electrophoresing 5 ul of each product on a 1 2 agarose EtBr gel in 1X TAE buffer Figure 7 provides an example of how your analysis should proceed In this experiment the PCR reached its plateau after 18 cycles that is the yield of PCR products stopped increasing After 21 and 24 cycles a smear ap peared in the high molecular weight region of the gel indicating that the reaction was overcycled Because the plateau was reached after 18 cycles the optimal number of cycles for this experiment would be 17 B Column Chromatography Section VIII A To analyze the ds cDNA after column chromatography electrophorese 3 ul of the unpurified PCR product Sample A from Section VII B 13 alongside 10 ul of the PCR product purified by column chromatography Sample B from Secti
33. mplify cDNA by LD PCR with PCR primer mm Double stranded cDNA r rr hu Figure 1 Flow chart of SMART technology The SMART II A Oligonucleotide 3 SMART CDS Primer II A and 5 PCR Primer II A all contain a stretch of identical sequence see Section II for complete sequence information cDNA Subtraction Cat No 637401 Virtual Northern blots and probe generation Please note that the SMART II A Oligonucleotide is specially engineered for use with the PCR Select method cDNA generated using the SMART cDNA Library Construction Kit cannot be used for PCR Select cDNA subtraction In the SMART library construction protocol each PCR amplified cDNA molecule has an extra SMART sequence on each end which decreases the efficiency of subtraction of amplified cDNA Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 5 SMART PCR cDNA Synthesis Kit User Manual l Introduction continued Total or poly At RNA SMART cDNA synthesis SMART cDNA synthesis Sections V amp VI K wyw Sections VII amp VIII SMART ds cDNA SMART ds cDNA Y K y x cDNA library era Virtual Other construction subtraction Northern blots applications Figure 2 Guide to SMART cDNA synthesis protocols Be sure to follow the appropriate protocol for your application The SMART II A Oligonucleotide and 3 SMART CDS Primer II A provided in the SMART PCR cDNA Synthesis Kit each have an Rsa site
34. of all 13 clones was confirmed four examples are shown in this figure Virtual Northern blots were prepared using the same SMART PCR amplified cDNA that was used for subtraction Each lane contains 0 5 ug of SMART cDNA Subtracted cDNA fragments y 1 y 2 y 3 and y 4 were labeled with P dCTP and hybridized to the Virtual Northern blots Hybridization with G3PDH serves as a control for loading Lane y Cells producing y globin Lane p Cells producing p globin Clontech Laboratories Inc www clontech com Protocol No PT3041 1 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual Notes Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 37 SMART PCR cDNA Synthesis Kit User Manual Notes Clontech Laboratories Inc www clontech com Protocol No PT3041 1 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual Notes Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeu tics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories Inc SMART Technology is covered by U S Patent Nos 5 962 271 and 5 962 272 For Profit and Not
35. of ds CDNA synthesized from the Control Human Placental Total RNA Section VI C ds cDNA Polishing We recommend the following procedure for polishing the ends of SMART cDNAs for constructing libraries 1 ANoa hr WP 13 14 15 16 Combine 50 ul 2 5 ug of the amplified ds cDNA with 2 ul of Proteinase K 20 ug ul in a sterile 0 5 ml microcentrifuge tube Store the remainder of the PCR mixture at 209C Note Proteinase K treatment is necessary to inactivate the DNA polymerase activity before proceeding with the ligation steps Mix contents and spin the tube briefly Incubate at 45 C for 1 hr Spin the tube briefly Heat the tube at 90 C for 8 10 min to inactivate the Proteinase K Chill the tube in ice water for 2 min Add 3 ul 15 units of T4 DNA Polymerase Incubate the tube at 16 C for 30 min Heat the tube at 729C for 10 min Add 27 5 ul of 4 M ammonium acetate Add 210 ul of room temperature 95 ethanol 11 12 Mix thoroughly by inverting the tube Spin the tube immediately at 14 000 rpm for 20 min at room temperature Note Do not chill the tube at 20 C or on ice before centrifuging Chilling the sample will result in coprecipitation of impurities Carefully remove the supernatant Wash pellet with 80 ethanol Air dry the pellet 10 min to evaporate residual ethanol Add deionized H O to resuspend the pellet The amount added will depend on your cDNA library construc
36. on VIII A 19 and 10 ul of the second fraction Sample C from Section VIII A 20 on a 1 2 agarose EtBr gel Compare the intensities of Sample A and Sample B and estimate the percentage of PCR product that remains after column chromatography The yield of cDNA after column chromatography is typically 50 percent If your yield is lt 30 percent check to see if it is present in the second fraction Sample C If this second frac tion has a higher yield of cDNA than the first combine the fractions and proceed with Section VIII B Otherwise if the cDNA is not present in Sample C repeat the PCR and column chromatography steps C Rsal Digestion Section VIII B To confirm that Rsa digestion was successful electrophorese 10 ul of uncut ds cDNA Sample D from Section VIII B alongside 10 ul of Rsa l digested cDNA from Section VIII B 4 on a 1 2 agarose EtBr gel Compare the profiles of both samples Before Rsa digestion ds cDNA should appear as a smear from 0 5 10 kb with bright bands corresponding to abundant mRNAs For some RNA samples from nonmammalian species the size distribution may be only 0 5 3 kb After Rsa I digestion the smear should range from 0 1 2 kb This result will be similar to that shown in the User Manual for the PCR Select Kit Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 29 SMART PCR cDNA Synthesis Kit User Manual IX Analysis for Clontech PCR Select Subtraction
37. ore at 20 C Save this fraction until after you perform agarose EtBr gel analysis Step 21 below To confirm that your PCR product is present in the purified ds cDNA fraction perform the agarose EtBr gel analysis as described in Section IX B B Rsal Digestion PCR Select Users only This step generates shorter blunt ended ds cDNA fragments which are necessary for both adaptor ligation and subtraction Before proceeding with Rsa I digestion set aside another 10 ul of purified Clontech Laboratories Inc www clontech com Protocol No PT3041 1 24 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual VIII Protocol for Clontech PCR Select continued ds cDNA for agarose EtBr gel analysis to estimate the size range of the ds cDNA products Step 4 below Label this tube Sample D i w Add the following reagents to the purified cDNA fraction collected from the CHROMA SPIN Column Step VIII A 21 10X Rsa I restriction buffer 36 ul Rsa 10 units 1 5 ul Mix by vortexing and spin briefly in a microcentrifuge Incubate at 37 C for 3 hr To confirm that Rsa digestion was successful electrophorese 10 ul of uncut ds cDNA Sample D and 10 ul of Rsa I digested cDNA on a 1 2 agarose EtBr gel in 1X TAE buffer see Section IX C in this User Manual and Section V B in the Clontech PCR Select User Manual Add 8 ul of 0 5 M EDTA to terminate the reaction Transfer 10 ul of the digest
38. ore information on Virtual Northern blots please see the Appendix Other applications for SMART cDNA include preparing probes for hybridization to high density cDNA or genomic DNA arrays Pietu et al 1996 or for the cDNA selection based positional cloning method Morgan et al 1992 Please see these references for more information about these applications Advantage 2 PCR Kit and PowerScript Reverse Transcriptase We strongly recommend the use of the Advantage 2 PCR Kits Cat Nos 639206 amp 639207 for PCR amplification These kits include the Advantage 2 Polymerase Mix which has been specially formulated for efficient accurate and convenient amplification of cDNA templates by long distance PCR LD PCR Barnes 1994 The Polymerase Mix is comprised of TITANIUM Taq DNA Polymerase a nuclease deficient N terminal deletion of Taq DNA polymerase plus TaqStart Antibody to provide automatic hot start PCR Kellogg et a 1994 and a minor amount of a proofreading polymerase This combination allows you to efficiently amplify full length cDNAs with a significantly lower error rate than that of con ventional PCR Barnes 1994 Each SMART kit also includes PowerScript Reverse Transcriptase a point mutant of Moloney murine leukemia virus MMLV reverse transcrip tase RT PowerScript RT lacks RNase H activity but retains wild type polymerase activity so it can synthesize longer cDNA fragments than wild type MMLV RT Our
39. our RNA on a formaldehyde agarose EtBr gel to determine its concentration and analyze its quality see Section IV for more details a The concentration of your experimental RNA is low but the quality is good Repeat the experiment using more RNA and or more PCR cycles b Yourexperimental RNA has been partially degraded by contaminating RNases before or during first strand synthesis Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 31 SMART PCR cDNA Synthesis Kit User Manual X Troubleshooting Guide continued Repeat the experiment using a fresh lot or preparation of RNA Check the stability of your RNA by incubating a small sample for 2 hrat 42 C Then electrophorese it on a formaldehyde agarose EtBr gel alongside an unincubated sample If the RNA is degraded during incubation it will not yield good results in the first strand synthesis In this case re isolate the RNA using a different technique such as one employed by our RNA isolation kits see Related Products for ordering information Several additional rounds of phenol chloroform extraction may dramatically increase RNA stability c Yourexperimental RNA sample contains impurities that inhibit cDNA synthesis In some cases ethanol precipitation of your existing total RNA followed by washing twice in 80 EtOH may remove impurities If this fails reisolate the RNA using a different technique such as one employed by our
40. quence serve as universal priming sites for end to end cDNA amplification Therefore cDNA without these sequences due to prematurely terminated cDNAs caused by incomplete RT activity contaminating genomic DNA or cDNA transcribed from poly A7 RNA will not be exponentially amplified However truncated RNAs that are present in poor quality RNA starting material will be amplified which will contaminate the final cDNA library Synthesize SMART cDNA for a wide variety of applications The first kitto feature SMART technology is the SMART cDNA Library Construction Kit Cat No 634901 This kit includes the components for directional cloning of full length cDNA To expand the range of applications the SMART PCR cDNA Synthesis Kit Cat No 634902 Figure 2 was introduced shortly after This kit allows you to synthesize high quality cDNA for library construction using your own vector and ligation reagents Other applications include Clontech PCR Select Clontech Laboratories Inc www clontech com Protocol No PT3041 1 4 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual l Introduction continued Poly A RNA 5 WU FYLG M VAVA VAVA r polyA 3 GG oo 5 x SMART II A CDS primer oligonucleotide First strand synthesis by RT SADADNADDDDADYLY polyA G GG rrr Single dC tailing by RT step 5 ANDDDDNDADNDDY polyA 5 O cta Template switching and extension by RT ceS WM VVAA polyA seil S SLl A
41. r Manual List of Figures Figure 1 Flow chart of SMART technology Figure 2 Guide to SMART cDNA synthesis protocols Figure 3 Protocol guide for SMART cDNA synthesis for library construction 12 Figure 4 Analysis of ds cDNA synthesized for library construction 17 Figure 5 Protocol guide for SMART cDNA synthesis for PCR Select cDNA subtraction and other applications 18 Figure 6 Optimizing PCR parameters for SMART cDNA synthesis 20 Figure 7 Analysis for optimizing PCR parameters 28 Figure 8 Virtual Northern blot analysis of cDNA fragments expressed in cells producing y globin 36 List of Tables Table I PCR cycling parameters library construction 14 Table Il Guidelines for setting up PCR 21 Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 3 SMART PCR cDNA Synthesis Kit User Manual l Introduction The SMART PCR cDNA Synthesis Kit provides a novel PCR based method for producing high quality cDNA from nanograms of total or poly A RNA SMART technology is especially useful for researchers who have limited starting material such as total RNA from a small sample SMART cDNA synthesis technology All commonly used cDNA synthesis methods rely on the ability of reverse transcriptase RT to transcribe mRNA into single stranded ss cDNA in the first strand reaction However because RT cannot always transcribe the entire mRNA sequence the 5 ends of genes tend to be under repre
42. re cDNA prepared from some mammalian tissue sources e g human brain spleen and thymus may not display bright bands due to the very high complexity of the poly A RNA For nonmammalian species the size distribution may be smaller see Section X A 2 for more details A Determining the Optimal Number of PCR Cycles Step VII B 8 For best results you must optimize the PCR cycling parameters for your experiment as described in Section VII B Figure 6 Choosing the optimal number of PCR cycles ensures that the ds CDNA will remain in the exponential phase of amplification When the yield of PCR products stops increasing with more cycles the reaction has reached its plateau Overcycled cDNA is a very poor template for cDNA subtraction Undercycling on the other hand results in a lower yield of your PCR product The optimal number of cycles for your experiment is one cycle fewer than is needed to reach the plateau Be conservative when in doubt it is better to use fewer cycles than too many Total RNA Poly A RNA Kb M 15 18 21 24 15 18 21 24 cycles Figure 7 Analysis for optimizing PCR parameters 5 ul of each PCR product was electrophoresed on a 1 2 agarose EtBr gel in 1X TAE buffer following the indicated number of PCR cycles The optimum number of cycles determined in this experiment was 17 Lane M 1 kb DNA ladder size markers 0 1 ug loaded The arrow indicates the strong band at 900 bp typically seen for human placental tota
43. river sample Figure 6 In our experience each 100 ul reaction typically yields 1 3 ug of ds cDNA after the PCR and purification steps Section VIII Subtraction usually requires 2 ug of driver cDNA so two tubes of SMART cDNA should be sufficient two tubes will also be ample for the tester To ensure that you have sufficient CDNA you should estimate the yield of SMART cDNA by UV spectrophotometry 1 Preheat a thermal cycler to 95 C 2 For each reaction aliquot the appropriate volume see Table II below of each diluted cDNA into a labeled 0 5 ml reaction tube If necessary add deionized H O to adjust the volume to 10 ul TABLE Il GUIDELINES FOR SETTING UP PCR Total RNA Volume of diluted Typical optimal ug ss CDNA for PCR pl No of PCR cycles 1 0 1 ul 17 19 0 5 2 ul 17 19 0 25 4 ul 17 19 0 1 10 ul 17 19 0 05 10 ul 19 21 Poly A RNA Volume of diluted Typical optimal ug ss CDNA for PCR pl No of PCR cycles 1 0 1 ul 16 18 0 5 2 ul 16 18 0 1 0 25 4 ul 16 18 0 05 8 ul 16 18 0 025 10 ul 17 19 From Step VII A 10 Protocol No PT3041 1 www clontech com Version No PR6Z2173 Clontech Laboratories Inc 21 SMART PCR cDNA Synthesis Kit User Manual Vil SMART cDNA Synthesis Protocol continued 3 oi Prepare a Master Mix for all reaction tubes plus one additional tube Combine the following components in the order shown per rxn 74 ul Deionized H O 10 ul 10X Advantage 2 P
44. se The cycling parameters in this protocol have been optimized using an authorized hot lid thermal cycler Optimal parameters may vary with different thermal cyclers and templates To resuspend pellets and mix reactions gently pipet them up and down and centrifuge the tube briefly to deposit contents at the bottom Vortex phenol chloroform extractions to mix Add enzymes to reaction mixtures last and thoroughly incorporate the enzyme by gently pipetting the reaction mixture up and down Do not increase the amount of enzyme added or concentration of DNA in the reactions The amounts and concentrations have been carefully optimized Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual V SMART cDNA Synthesis for Library Construction Important This protocol is designed for synthesizing SMART cDNA for library construction For other applications including Clontech PCR Select cDNA sub traction consult the protocol in Sections VII and VIII Total or poly A RNA First strand ss cDNA Section V A SMART ds cDNA Section V B ds cDNA polishing Section V C cDNA library construction Reagents for these procedures are not included in the SMART PCR cDNA Synthesis Kit Agarose EtBr gel analysis Figure 4 Section VI Troubleshooting Section X A amp B Figure 3 Protocol guide for SMART cDNA
45. sented in cDNA populations This is often the case for long mRNAs especially if the first strand synthesis is primed only with oligo dT primers or if the mRNA has a persistent secondary structure In the absence of RNA degradation truncated cDNA molecules present in libraries are often due to RT pausing before transcription is complete Regardless the SMART method is able to preferentially enrich for full length cDNAs SMART cDNA synthesis starts with either total or poly At RNA A modified oligo dT primer the 3 SMART CDS Primer Il A primes the first strand synthesis reaction Figure 1 When RT reaches the 5 end of the mRNA the enzyme s terminal transferase activity adds a few additional nucleotides primarily deoxycytidine to the 3 end of the cDNA The SMART II A Oligonucleotide which has an oligo G sequence at its 3 end base pairs with the deoxycytidine stretch creating an extended template RT then switches templates and continues replicating to the end of the oligonucleotide Chenchik et al 1998 The resulting full length single stranded ss cDNA contains the complete 5 end of the mRNA as well as sequences that are complementary to the SMART Oligonucleotide In cases where RT pauses before the end of the template the addition of deoxycytidine nucleotides is much less efficient than with full length CDNA RNA hybrids thus preventing base pairing with the SMART Oligonucleotide The SMART anchor sequence and the poly A se
46. serted into a 1 5 ml tube Centrifuge for 5 min and discard the column Transfer 6 ul of the filtered DNA solution to a clean 1 5 ml micro centrifuge tube containing 14 ul of deionized H O Label this tube Sample F and store at 209C You will use this sample to analyze the SMART cDNA after purification as described in Section IX D To precipitate the DNA add 1 2 volume of 4 M ammonium acetate e g 50 ul for a 100 ul sample then add 2 5 volumes of 95 ethanol e g 375 ul for 150 pl sample ammonium acetate to the remaining sample from Step 14 Vortex the mix thoroughly and centrifuge the tubes at 14 000 rpm for 20 min at room temperature Carefully remove and discard the supernatant Overlay the pellet with 500 ul of 80 ethanol Centrifuge the tube at 14 000 rpm for 10 min Carefully remove the supernatant and discard Air dry the pellets for 5 10 min Dissolve the pellet in 6 7 pl of 1X TNE buffer Clontech Laboratories Inc www clontech com Protocol No PT3041 1 26 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual VIII Protocol for Clontech PCR Select continued 22 23 24 Transfer 1 2 ul to a clean 1 5 ml microcentrifuge tube containing 11 ul of deionized H O label this tube Sample G and store the re maining sample at 20 C Use 10 ul of the diluted DNA to assess the yield of DNA by UV spectrophotometry For each reaction we usually obtain 1 3 ug of S
47. synthesis for library construction If agarose EtBr gel analysis of the ds cDNA indicates that more cycles are needed simply return the reaction to the thermal cycler for a few more cycles as described in the Troubleshooting Guide Section X B Clontech Laboratories Inc www clontech com Protocol No PT3041 1 12 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual V SMART cDNA Synthesis for Library continued A First Strand cDNA Synthesis 1 For each sample and control combine the following reagents in a sterile 0 5 ml reaction tube 1 3 pl RNA sample 0 025 0 5 ug of poly At or 0 05 1 yg of total RNA 1 ul 3 SMART CDS Primer ll A 12 uM 1 ul SMART II A Oligonucleotide 12 uM x pl Deionized H O 5 ul Total volume For the control synthesis add 1 ul 1 yg pl of Control Human Placental Total RNA Mix contents and spin the tube briefly in a microcentrifuge Incubate the tube at 72 C for 2 min Cool the tube on ice for 2 min Centrifuge the tube briefly in a microcentrifuge to collect contents at the bottom 6 Add the following to each reaction tube 2 ul 5X First Strand Buffer 1 ul DTT 20 mM 1 ul dNTP Mix 10 mM of each dNTP 1 ul PowerScript Reverse Transcriptase 7 Mix by gently pipetting and spin the tubes briefly in a microcentrifuge 8 Incubate the tubes at 42 C for 1 hr in an air incubator Note If you use a water bath or thermal cycler for this incubation cover the reaction mixture
48. tion protocol Note This preparation of blunt ended cDNA may now be ligated to any adaptor you choose Consult your protocol for cDNA library construction Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual VI Analysis of Results for Library Construction Figure 4 shows a typical gel profile of ds CDNA synthesized using the Control Human Placental Total RNA and the SMART protocol outlined in Section V The sample shown was taken after Step V B 8 and represents raw cDNA before polishing Typical results indicative of a successful PCR should have the following characteristics 1 A moderately strong smear of cDNA from 0 5 to 6 kb Compare the intensity of the banding pattern of your PCR product to the 1 kb DNA ladder size marker 0 1 ug run on the same gel For cDNA made from all mammalian RNA sources the overall signal intensity relative to the marker DNA should be roughly similar to that shown for the control experiment in Figure 4 If the intensity of the cDNA smear is much stronger than that shown for the control relative to 0 1 ug of size marker especially if no bright bands are distinguishable this may indicate that too many thermal cycles were used that is you have overcycled your PCR see Troubleshooting Guide Section X B If the smear is much fainter relative to 0 1 ug of size marker and the size distribution generally less than
49. y you may wish to use one of our Premium Poly A RNAs For more information visit our web site at www clontech com Before you begin first strand synthesis we strongly recommend that you check the integrity of your RNA by electrophoresing a sample on a formaldehyde agarose EtBr gel For mammalian total RNA you should observe two bright bands at approximately 4 5 and 1 9 kb these bands represent 28S and 18S ribosomal RNA respectively The ratio of intensities of these bands should be 1 5 2 5 1 Intact mammalian poly A RNA should appear as a smear usually 0 5 12 kb with faint 28S and 18S rRNA bands The size distribution may be considerably smaller 0 5 3 kb for nonmammalian species e g plants insects yeast and amphibians For more information see Sambrook et al 2001 Wear gloves throughout the procedure to protect your RNA and cDNA samples from degradation by nucleases Clontech Laboratories Inc www clontech com Protocol No PT3041 1 10 Version No PR6Z2173 SMART PCR cDNA Synthesis Kit User Manual IV General Considerations continued The first time you use this kit you should perform cDNA synthesis with the Control Human Placental Total RNA provided in the kit in parallel with your experimental sample Performing this control synthesis at least once will verify that all components especially the reverse transcriptase are working properly and will also help you troubleshoot any problems that may ari
50. yield of cDNA after column chromatography Section VIII A Possible reasons for low yield include the following a You may have applied the wrong volume of buffer to the CHROMA SPIN column or collected the wrong volume of buffer from the column Carefully check the protocol and repeat column chromatography b Yourcolumn may have leaked during shipping If your column contains less than 750 ul of matrix discard it and use another column 2 Failure of Rsa I digestion Section VIII B If the size distribution of your sample and or control cDNA is not reduced after Rsa I digestion check the recipe for TNE buffer If you used the correct recipe for TNE buffer perform phenol chloroform extraction and ethanol precipitation then repeat the Rsa digestion 3 Low yield of cDNA after purification of digested cDNA Section VIII C Possible reasons for low yield include the following a Loss of cDNA during purification Troubleshoot your purification procedure b Loss of cDNA during ethanol precipitation Check the volumes of the ammonium acetate and ethanol Repeat purification and ethanol precipitation c Your PCR did not reach the plateau i e the reaction was under cycled Perform more PCR cycles Optimize the number of cycles as described in Section IX Protocol No PT3041 1 www clontech com Clontech Laboratories Inc Version No PR6Z2173 33 SMART PCR cDNA Synthesis Kit User Manual XI References Barnes W
Download Pdf Manuals
Related Search