General Laboratory Equipment
Contents
1. Shakers amp rotators 4 PSU 2T Mini shaker for immunology MR 1 Mini rocker Shaker 3D Sunflower Mini Shaker RS 24 Mini rotator with timer for test tubes RS 60 Rotator with mechanical timer for test tubes OS 20 Orbital Shaker OS 10 Orbital Shaker Multi Shakers Combined movement type Shakers Orbital Multi Shaker Multi PSU 20 Multi Bio RS 24 Programmable rotator mixer Multi RS 60 Programmable rotator mixer Multi Bio 3D Programmable 3D Ballet Dancer Shaker Shakers Incubators Thermo Shakers for tubes and plates ES 20 Orbital Shaker Incubator TS 100 Thermo Shaker for microtubes PST 60HL Plate Shaker Thermostat Centrifuges amp vortexes Multispin 9 MSC 3000 Centrifuge Vortex Multi Spin F S 16 Multi tube mixing Vortex for microtubes V 1 plus Single tube mixing Personal Vortex FVL 2400N Mini centrifuge vortex Combispin FV 2400 Mini centrifuge vortex Microspin Thermostats Water Dry block Cooling or heating BWT U Universal water thermostat WB 4 amp WB 4MS Water thermostat bath SC 2M Sample cooler for molecular biology TDB 120 Dry block thermostat TDB U 400 Dry block type thermostat CH 100 Heating Cooling dry block 1 Magnetic stirrers 13 MS 3000 Mini Magnetic Stirrer MMS 3000 Magnetic Stirrer with a stand MSH 300 Magnetic Stirrer with Hot plate Biosafety devices Boxes for DNA RNA inactivation UVR M UV air flow Cleaner Recirculator UVC T UVC T AR D2. Overall dimensions 170x220x120 mm Power supply 220 240 V 50 60Hz crospin Specially designed for genetic engineering research e Mixing and sedimentation on one spin module Rotation speed constant 2400 RPM Rotors R 1 5 and R 0 5 0 2 included Continuous and impulse working modes e Max Rcf 700 x g Overall dimensions 120x170x120 mm Power supply 220 240 V 50 60Hz Available rotor types for FVL 2400N and FV 2400 Standard e R 1 5 rotor for 12 x 1 5 ml microtest tubes e R 0 5 0 2 rotor for 12 x 0 5 and12 x 0 2 ml microtest tubes Optional e R 2 0 5 rotor for 8 x 2 0 ml 8 x 0 5 ml microtest tubes e R 2 0 5 0 2 rotor for 6x2 0 ml 6x0 5 ml 6x0 2 ml microtest tubes e SR 16 rotor for 2 x 8 section 0 2 ml microtube strips 10 High quality bath provides heating with 0 1 C stability For use in medical ecological monitoring and food control laboratories as well as in scientific research and microbiology laboratories Constant mixing for temperature stabilisation Temperature range up to 100 C e 8 stainless steel bath other on request Digital temperature control Can be equipped with a flowing water cooler Optional lifting platform with adjustable height LP 1 Overall dimensions 280x390x270 mm Power supply 220 240 V 50 60 Hz max 1 kW Designed for chemical pharmaceutical medical and biological laboratory research Temperature range 30
3. UVC T AR DNA RNA UV cleaner box For DNA RNA decontamination at the laboratory working place for maximum aseptic conditions UVC T Bench top model e Two 15W UV lamp decrease contamination levels during 15 30 min of UV exposure White 1x15W lamp provides local illumination of the working area and guarantees good conditions for visual control of operations Long living UV lamps 7000 hr e UV exposition digital control e Walls made of 10 mm plexiglass the frame and working area of painted stainless steel e Can be equipped with a flowing bactericidal air recirculator model UVC T AR which provides constant decontamination inside the box see below General characteristics Overall dimensions 690x515x555 mm Power supply 220 240 V 50 60 Hz UVC T M UVC T M AR DNA RNA UV cleaner box UVC T M AR For DNA RNA decontamination at the laboratory working place for maximum aseptic conditions Bench top model Two 15W UV lamp decrease contamination levels during 15 30 min of UV exposure White 1x15W lamp provides local illumination of the working area and guarantees good conditions for visual control of operations Long living UV lamps 7000 hr UV exposition digital control Walls made of 10 mm glass covered with UV protected film the frame and working area made of stainless steel Can be equipped with a flowing bactericidal air recirculator model UVC T M AR which provides constant decontamination inside the bo
4. manual external power supply adapter communication cable RS 232 temperature probes DEN 1 McFarland Densitometer This product is used in laboratories routine work for the detection of susceptibility of microorganisms against antibiotics or for identification of microorganisms with various test systems etc The instrument can perform measurement of solution s turbidity at wide range 0 3 15 0 McFarland units Instrument is precalibrated and keeps calibration without any power supply Operating with instrument simply install tube with unknown solution and read McFarland value on the instrument s indicator Customer can recalibrate instrument by its requirements with E coli solutions by two or six points between McFarland 0 5 5 0 The instrument s microprocessor controls all ofthe operating steps The bio design and extremely easy handling makes it a pleasure to use this product Technical specifications A Light source Light diode Wavelenght 565 nm Tube type diameter 16 mm Reaction volume 2 10ml Data presentation digital indicator Power consumption 1 5 W 12 V DC TO 16 N MM 1000 Laboratory programmable mechanical stirrer Multi Mixer Laboratory programmable stirrer bioforma design for stirring quantities up to 20 litres with digital display and possibility to realize three types of motion Rotational Reciprocal and Vibration Display shows simultaneously two values of speed set and a
5. temperature control in laboratory premises deep freezers refrigerators and incubators In standard version probes are intended for work in extreme conditions from 50 C to 125 C It is possible to purchase probes that will work in 200 500 temperature range Data recording rate can be programmed in the range 1 sec 24 hr Data storage on the hard disk of a PC allows accumulating data for a long period of time for example for 1 5 years The operation of the system can be described as follows the probes installed in the controlled objects continuously scan the temperature and transfer it to DataLogger via cables Further the information is transferred to a computer where it is processed by the appropriate software saved in the memory and displayed on the monitor in a graphic table format Graphing of temperature against time and textual reports can be printed out or saved for the client s convenience Program Features simultaneous display of data from all probes and timed data recording into the database copying produced graphs to clipboard or saving in jpg format setting maximum and minimum alarm temperatures for each probe display of maximum minimum and average temperature in the graphs and textual reports real time readings for each probe System requirements Pentium 166 or better Windows 95 98 2000 XP ME VGA SVGA card 32 Mb RAM 128 Mb recommended The Datalogger set includes software user
6. to 100 files 220 240 V 50 60 Hz 110 120 V 50 60 Hz 100W 240 x 260 x 165 mm 4 2 kg ite Figure 1 PCR products separated on the 0 8 agarose gel 12x6 cm 0 5xTAE On the gel was loaded 5 ul of PCR products Lanes 1 15 Biocycler TC S PCR products 1 15 respectively Lane 16 100 bp DNA Ladder Plus MBI Fermentas 0 2 ug loaded only bands 3 000 500 are visible 1 2 34 5 6 78 9 10 1112 13 ww s Figure 2 PCR products separated on the 0 8 agarose gel 12x6 cm 0 5xTAE On the gel was loaded 5 ul of PCR products Lanes 1 12 Biocycler TC S PCR products 14 25 respectively Lanes 14 16 a reference cycler PCR products 26 28 respectively 28 negative control tube 27 has a reduced volume 10 ul instead 20 ul Lane 13 100 bp DNA Ladder Plus MBI Fermentas 0 2 ug loaded only bands 3000 1031 are visible BOCK IC Ret CE en E Z a 3 a 8 KR B amp 19 2 TEETH EG EKLE eee eSee EL LILLE AE Figure 3 Comparison of temperature ramping between a reference thermocycler one of the most wide spread thermocyclers and BioCycler TC S BioSan acquired by Temperature Datalogger BioSan DL 12 Portable Temperature Datalogger pa Using the latest technology in the field of electronic data transmission BioSan has developed a range of multi channel Temperature Data Loggers The system can be easily adapted for the conditions required by the client and offers an elegant solution for continuous
7. 1 5ml 2ml 15ml tubes Optional combined platform PRS 4 12 for 4 tubes up to 30 mm diameter 50ml tubes and 12 tubes up to 15 mm diameter 1 5ml 2ml 15ml tubes x l gt iW oe Overall dimensions 310x110x175 mm gt vuoto LA i tx Multi rotation Power supply External power supply 12 V 500 mA Multi RS 60 Programmabl Intelligent bio Rotator for soft amp hard mixing microtubes and vacutainers Several options in 1 instrument 1 Rotation 2 Reciprocal rotation 3 Vortexing e Microprocessor controlled time shaking speed turning angle and pause Speed range of vertical and reciprocal rotation mode 5 60 rpm e Timer of vertical and reciprocal rotation mode 0 250 sec Turning angle of reciprocal rotation mode 15 90 increment 15 e Turning angle of vortexing mode 0 5 increment 1 Pause Vortex timer 0 1 2 5 S General timer of device operation 0 24 hours e Standard platform 48 tubes up to 15mm diameter 1 5ml 2ml 15ml tubes Optional platforms combined PRS 8 22 for 8 tubes up to 30 mm diameter 50ml tubes and 22 tubes up to 15 mm diameter 1 5ml 2ml 15ml tubes Overall dimensions 430x230x230 mm Multi rotation a gt B 3 7 kg tx i lic Power supply External power supply 12 V 4 16 A Consecutive mixing stages with programmable time and movement types rotation reciprocation and vortexing Speed range 5 30 RPM Orb
8. 100 C Temperature stability 0 1 C WB 4MS 1 C WB 4 e 4 stainless steel bath Magnetic stirring WB 4MS for temperature stabilisation 300 1000 RPM e Temperature setting digital e Temperature display LED Overall dimensions 340x170x170 mm 340x170x200 mm Power supply 220 240 V 50 60 Hz max 600W The simple block construction combined with the powerfull Peltier module produces rapid cooling Cool down time from room temperature to 5 C is less than15 min Cooling temperature 5 C room temperature Temperature stability 0 5 C e Aluminium block for 20 x 0 5 ml and 12 x 1 5 ml microtubes e Temperature setting analog e Temperature display LED Overall dimensions 190x 190x150 mm Power supply 220 240 V 50 60 Hz 11 TDB 120 Dry bl TDB 120 can be used for variety of applications in different areas of molecular biology research Temperature range 25 120 C Temperature stability 0 1 C e Temperature setting digital Digital timer 1 min 96 hr for sample thermostating control Simultaneous indication of set and actual temperature and time Two models are available offering a choice of tube configurations to meet the needs of many standard laboratory procedures with A 53 block for 21x 0 5 ml 32 x 1 5 ml microtubes with A 103 block for 21x 0 5 ml 32 x 1 5 ml 50 x 0 2 ml microtubes Overall dimensions 200x210x100 mm Power supply 220 240 V 50 60 Hz max 100 W Universal
9. 500 mA Platforms for OS 20 OS 10 and ES 20 Shakers e UP 12 Universal platform with adjustable bars for different types of flasks bottles and beakers dimensions w d 270x195 mm e PP 4 Flat platform with non slip rubber mat for Petri dishes culture flasks agglutinatin cards dimensions w d 220x220 mm e P 12 100 Platform with clamps for flasks 100 150 ml 12 places dimensions wid 250x190 mm P 6 250 Platform with clamps for flasks 250 300 ml 6 places dimensions w d 250x190 mm Multi PSU 20 is the new model of PSU 20 Shaker e Powerful and extremely quite shaker with 3 types of motion e The platform UP 400 can hold a different type of flasks Available two levels for holding e Electrically safe powered by external AC AC power supply e User friendly interface real time program correction indication of set and actual speed angle and time operation timer e Several shaking motions in one instrument which can be used separately and consecutively in a cycle e Orbital motion Simple orbital motion with an option of shifting direction clockwise anti clockwise after set time Adjustable speed from 0 to 250 RPM Time from 0 till 250 sec e Reciprocating Rotating motion Orbital motion with shifting direction of rotation Adjustable turning angle from 0 to 360 increment 30 Speed the same as in Orbital motion Time from 0 till 250 sec e Vibration mode C cu High speed low amplitude motion CD gt 3 20 m
10. Applications DNA analysis extraction of lipids and other cell components DNA library creation e Microprocessor controlled time speed and temperature e 2 mm orbit Speed range 250 1400 RPM Digital timer 1 min 96 hr Temperature range 25 100 C Simultaneous display of set and actual temperature time and speed e Two standard interchangeable blocks for Eppendorf microtubes SC 18 20x0 5 ml microtubes 12x1 5 ml microtubes SC 20 20x1 5 ml microtubes Other non standard block are available upon request for 20x0 2 ml microtubes 12x1 5 ml microtubes amp for 20x2 ml microtubes Overall dimensions 205x230x130 mm Power supply External power supply 12 V 4 A Thermoshaker PST 60HL provides several functions in one instrument 1 microplate thermoshaker 2 incubator for two microplates without shaking 3 microplate shaker without temperature control The main features Good temperature transfer to samples due to the simultaneous heating both of the platform and upper lid The two directional heating provides a very good temperature stability prevents condensation which is critical when handling microvolume samples at high temperature Application Elisa immunodiagnostics microorganism cultivation DNA analysis matrix analysis in molecular chemistry e Microprocessor controlled time speed and temperature e 2 mm orbit Speed range 250 1200 RPM e Nominal r
11. NA RNA UV cleaner box UVC T M UVC T M AR DNA RNA UV cleaner box Announcement 15 Thermal cycler BioCycler TC S DL 12 Portable Temperature Datalogger DEN 1 McFarland Densitometer MM 1000 Laboratory programmable mechanical stirrer Multi Mixer UVT S AR DNA RNA UV cleaner box PCR workstation Bio TDB 100 r immunology Shaker PSU 2T provides regulated shaking for two or four 96 well y microtest plates PSU2T It is a compact instrument with low profile and small footprint for personal application including immunoassays and colouration tests Shaker can be used in a cold room or incubator operating ambient temperature range 4 C to 45 C Speed range 150 1000 RPM Digital timer from 1 min to 24 hours with automatic switch off e 2 mm orbit e Capacity 2 microtest plates standard platform IPP 2 4 microtest plates optional platform IPP 4 Overall dimensions 220x205x90 mm 1 8 kg Power supply External power supply 12 V 500 mA D Horizontal uni rotation Mini Rocker Shaker MR 1 provides gentle rocking motion It is perfect for soft mixing of biological components Its small size and low profile saves bench space in laboratory room Shaker can be used for minigel staining and destaining for Northern Southern and Western blots mixing test tubes washes rocking agglutination cards Shaker can be used in a cold room or incubator operating ambient temperature range 4 C to 45 C Speed ran
12. ature deviation at the borders of the thermoblock from the set temperature in the range from 0 C to 40 C 0 5 Temperature deviation at the borders of the thermoblock from the set temperature in the range from 40 C to 80 C 2 0 C Setting resolution 0 1 C e Working room temperature range 15 C 27 C e Independent timer with sound signal 1 min 96 hrs Tra e Two models available Ba A ni 1 with CH 1 block for 20 x 0 5 ml microtubes Overall dimensions 240x260x165 mm 2 with CH 2 block for 20 x 1 5 ml microtubes NA TOKE Power supply 220 240 V 50 60 Hz max 100 W 12 ic Stirrer Small and convenient instrument for routine procedure in general type laboratory work Powerful stirring allows dispergating different chemical and biological multi component mixtures Speed range 150 3000 RPM Stirs without undesirable heat and noise Stirring volume up to 2 Stainless steel working plate e Working plate size 110x110 mm Overall dimensions 120x150x65 mm Power supply External power supply 12 V 300 mA MMS 3000 Ma Compact and convenient instrument for routine procedure in general type laboratory work Powerful stirring allows dispergating different chemical and biological multi component mixtures An attachable stand allows fixation of different laboratory accessories such as titration birettes temperature sensors etc Speed range 0 3000 RPM St
13. ctual speed Speed of stirring is under control by microprocessor Multi mixer can be used up to the medium viscosity range Ideal instrument for biotechnology organic synthesis analytical preparation laboratories The innovative combination of three types of motion helps reaching high homogeneity Accessories 1 Propeller stirrer 2 3 4 bladed N 2 Centrifugical stirrer N N 3 Paddle stirrer N N 5 4 Anchor stirrer Pi 5 Screw type stirrer Speed regulation range 4 1000 RPM Timer for Rotational and Reciprocal motion 0 250 sec Turning angle for Reciprocal motion 0 360 increment 30 Turning angle for Vibro motion 0 5 increment 1 Timer for Vibro motion 0 5 sec General timer of device operation 0 24 hrs increment 1 min Power External AC AC adapter 12 V 830 mA Dimensions 135x400x250 mm Weight 2 3 kg Soe Multi rotation UVT S AR DNA RNA UV cleaner box PCR workstation This new model is designed for placement of large instruments on the base work area The length of the box was increased twice in comparison with our traditional model UVC T M DNA RNA cleaning box Extended workspace allows more comfortable operation UVT S AR box includes the installed UV air recirculator as standard equipment This option additionally prevents unwanted amplification of contaminant DNA and protects the user from direct UV light during manipulation Specifications Resistant stainless st
14. eel work surface 1200x520 mm Triplex electrical outlet mounted in the backside panel UV exposure digital control by electronic timer White lamp for local illumination low 60mm midi 125mm high 190 mm Overall dimensions 1240x540x550 mm o Weight 55 kg Three positions adjustable opening of front door work space clearance 17 Bio TDB 100 Dry block thermostat Specifications e Temperature regulation range 25 C 100 C Setting resolution 0 1 C e Nominal regulation accuracy 0 5 C e Independent timer with sound signal 1 min 96 hrs e Display LCD e Simultaneous display of set and actual temperature and time e Block capacity 24 x 2 1 5 ml 15 x 0 5 ml 10 x 0 2 ml microtubes e Block diameter depth 130 45 mm e Power 220 240 V 50 60 Hz 200 W e Dimensions 210x230x110 mm 18 PI I Al PUPUN Environmental Research Microbiology _ i xd Immunology LKB Vertriebs GmbH Wurzbachgasse 18 A 1150 Vienna Austria Phone 43 I 982 9527 Fax 43 1 984 3714 E mail Ikbolkb at http www Ikb at
15. egulation accuracy 0 1 C Digital timer 1 min 96 hr e Loading heating platform for 2 x 96 well microtest plates amp heating lid 8 za x Multi Spin Centrifuge vortex Multi Spin is a next step of evolution of the centrifuge vortex CombiSpin A must have efective instrument for PCR analysis Multi Spin is four devices combined in one 1 multitube centrifuge till 1000 g speed and time setting 2 multitube vortex 3 modes soft medium hard time setting 3 multitube centrifuge vortex 4 centrifuge vortex centrifuge cycler for realization of the SMS Spin Mix Spin algorithm Multi Spin allows considerable time saving compared to Combi Spin by automatically performing cycling program of micro sample mixing and spin according to the set SMS cycle for 12 pcs of micro tubes simultaneously SMS cycle is needed for collecting micro quantity of sample distributed on a cover and walls of micro tubes after mixing which give a reproducibility in micro sampling total volume of samples smaller than 100 mkl Spin regulation 1000 3500 RPM increment 100 RPM Spin timer 1 sec 99 min e Mixing strength soft medium hard e Mixing time 0 20 sec increment 1 sec SMS cycle regulation 1 999 cycles e Two rotors included RC 1 5 rotor for 12 x 1 5 ml microtubes microtubes e SRC 16 rotor for 2 x 8 section 0 2 ml microtube Weight 1 8 kg strips is available as optional extra Power sup
16. er 1 5 ml 2 ml 15 ml tubes Overall dimensions 395x245x185 mm Vertical uni rotation 6 0 kg Power supply 220 240 V 50 60 Hz rl al Shaker OS 20 is a powerful variable speed shaker which provides efficient orbital motion OS 20 is a familiar instrument for many general purpose shaking applications in chemical biomedical microbiological and life science laboratories Shaker can be used in a cold room or incubator operating ambient temperature range 4 C to 45 C Speed range 50 250 RPM e 20 mm orbit Digital speed control Digital timer 1 999 min e Interchangeable platforms see page 5 UP 12 P 12 100 P 6 250 PP 4 Maximum load capacity 2 5 kg Overall dimensions 220x190x70 mm Power supply External power supply 12 V 800 mA OS 10 is a powerful quiet microprocessor controlled orbital shaker It is an ideal instrument for many general purpose shaking applications in microbiology chemical and life science laboratories Shaker can be used in a cold room or incubator operating ambient temperature range 4 C to 45 C Speed range 50 350 RPM increment 10 RPM e Universal platform flat platform or platforms with clamps see below Digital speed control Digital timer for 1 min 96 hr Simultaneous indication of set and actual time and speed e 10 mm orbit Overall dimensions 270x260x85 mm Ss soka Horizontal uni rotation Power supply External power supply 12 V
17. ge 7 5 30 RPM Digital timer 1 min to 24 hours with automatic switch off Rocking motion Fixed tilt angle 7 e Non slip mat supplied as standard for load up to 0 5 kg Platform working size 200x200 mm Overall dimensions 220x205x120 mm Rocking uni rotation Power supply External power supply 12 V 500 mA ee ni Shaker Mini 3D Shaker provides regulated shaking 3D type for mixing reagents in a wide spectrum of test tubes agglutination cards Petri dishes and other laboratory vessels It is a compact personal use instrument with low energy consumption Shaker can be used for mixing blood samples for minigel staining and destaining washes blotthybridization Shaker can be used in a cold room or incubator operating ambient temperature range 4 C to 45 C Speed range 10 30 RPM Fixed tilt angle 7 e non slip mat supplied as standard Platform working size 200x200 mm For load up to 0 5 kg Optional adapter TP 26 for 26 tubes up to 11 mm diameter Overall dimensions 85x150x80 mm Power supply External power supply 12 V 300 mA 3D uni rotation or with timer for test tubes RS 24 minirotator is an ideal instrument for laboratory procedures which require changeable time of mixing from 1 min till 24 hours Its variable speed adjusts mixing from a soft action to intensive agitation RS 24 is compact with low profile and small footprint It is an ideal inst
18. instrument for constant temperature maintenance of tubes or other vessels Thermostat can be used in ecological monitoring food quality analysis biochemistry for evaporation sand bath option etc Temperature range 25 250 C e Sand bath regime up to 400 C e Temperature setting digital PLL e Temperature adjusting accuracy 0 1 C miT Digital temperature control Te e Aluminium blocks for tubes of different size Accessories for TDB U 400 SL 1 Aluminium block for 100 ml glasses 2 T 18 Aluminium block for tubes 18 sockets Cin diameter upto 18 mm MT 6 4 Aluminium block for tubes 6 4 sockets diameter upto 13 5 25 5 mm CH 100 Heating Cooling dry block ii Product is the result of the combination of two popular BioSan instruments 1 Heating dry Block and 2 Cooling Dry block thermostat CH 100 The unique block construction combined with the powerful Peltier module produces very rapid cooling and heating for change of application CH 100 is a very effective instrument for DNA analysis sample preparation including storing frozen enzymes restriction denaturing electrophoresis for hybridization reaction e Microprocessor controlled time and temperature Simultaneous indication of set and actual temperature and time e Temperature regulation range 10 C 100 C e Temperature deviation in the centre of the thermoblock from the set temperature in the range from 0 C to 80 C 036 Temper
19. irring volume up to 5 Stainless steel working plate e Working plate size 150x150 mm Stand height 320 mm Overall dimensions 165x200x65 mm Power supply External power supply 12 V 300 mA Convenient and easy to use magnetic stirrer with heating for routine procedures in organic synthesis environmental laboratories and general type laboratory work Speed range 250 1250 RPM Stirring volume up to 2 Temperature range 30 330 C e Working plate heating till 330 C in 20 min e Aluminium working plate provides uniform heating over the whole surface Attention Alkali can damage aluminium surfaces e Working plate size 150x150 mm Consumed power mixing mode 8 5 W Consumed power heating mode 600 W Overall dimensions 170x210x95 mm Power supply 220 240 V 50 60 Hz 13 UVR M UV air flow Cleaner Recirculator UV cleaner is applicable for disinfecting different type premises including biomedical research laboratory rooms operating rooms in clinics waiting rooms in outpatients departments veterinary stations in the production premises of food industry Designed specially for biosafety DNA RNA microbe decontamination while user is protected from direct UV light e Cleaning effectivity 90 constant work e 1x 15 W UV lamps e Productivity 25 m hr Convenient placement on walls High anti bacterial activity UVR M Overall dimensions 82x92x600 mm Power supply 220 240 V 50 60 Hz UVC T
20. ital and reciprocating motion e Turning angle Reciprocating motion 0 360 increment 30 e Turning angle Vortexing motion 0 6 increment 1 e Platform tilt angle 7 Orbit diameter 22 mm Timer for Orbital and reciprocating motion 0 250 sec Timer for Vortex motion 0 5 sec e Number of cycles 0 125 times e Maximum load 1 kg Overall dimensions 170x220x150 mm Power supply External power supply 12 V 500 mA tx Multi rotation ES 20 is a bench top lower capacity shaking incubator Built in temperature controller provides maintaining of the set temperature inside demountable plexiglass incubator chamber Forced air circulation provides excellent heat transfer This instrument has been designed to provide controlled and uniform conditions for biological growth e 10 mm orbit Electronic speed control with soft start Speed range 50 250 RPM Digital timer 1 999 min Temperature range 25 42 C Temperature stability 0 1 C e Maximum load capacity 2 5 kg Plexiglass chamber 7 mm thick walls e Universal platform platform with clamps or flat platform available see page 7 Overall dimensions 330x340x425 mm Power supply 220 240 V 50 60 Hz 100 W External power supply 12 V 800 mA Thermoshaker TS 100 is a space saving compact and cost efficient solution for shaking and temperature control of small samples in 0 5 ml and 1 5 ml microtubes
21. m Adjustable turning angle from 0 to 6 increment 1 Time from 0 till 5 sec Multi rotation e General operation timer from 0 till 24 hrs increment 1 min non stop e CITE operation time up to 72 hours Gialli 485x520x140 mm e Maximalload upto 15 kg e Dimensions of UP 400 460x400 mm 18 35 kg Power supply External power supply AC 12 V 830 mA Multi Shakers and Multi Rotators provide several motion types in one instrument substantially increasing the options for mixing the examined materials Our Multi Shaker and Multi Rotator range can be used for variety of applications including the following embedding blood cell suspensions tissue culture specimens washing of presipitates homogenizing blood solid with plasma blot hybridization 4 Programmable rotator mixer Intelligent bio Rotator for soft amp hard mixing microtubes and vacutainers Multi Bio RS 24 Several options in 1 instrument 1 Rotation 2 Reciprocal rotation 3 Vortexing e Microprocessor controlled time shaking speed turning angle and pause Speed range of vertical and reciprocal rotation mode 5 30 rpm Timer of vertical and reciprocal rotation mode 0 250 sec e Turning angle of reciprocal rotation mode 15 90 increment 15 e Turning angle of vortexing mode 0 5 increment 1 Pause Vortex timer 0 1 2 5 S General timer of device operation 0 24 hours e Standard platform 22 tubes up to 15mm diameter
22. of PCR product entrez access Nr AF180145 833 bp Primers NADH1c 5 CCAGAACCATGATTGCTC 3 NADH1d 5 ACGAAGCTTTAGGGCGTAACATGC 3 with 5 extension PCR conditions Each reaction 20 ul contains 1x PCR buffer 2 mM MgCL 0 2 mM each of dNTP 0 75 U recombinant Tag Pol MBI Fermentas 12 pmol of each primer BMC 100 ng 2 ul of genomic DNA laboratory extraction All reactions were fully premixed together Before adding of genomic DNA for negative control 18 ul of mix was taken to a new tube and 2 pl of water was added Amplification performed in 0 2 ml tubes without mineral oil hot lid approach Thermal profile Initial heating 1 min for 94 C 40 cycles of steps 40 sec for 95 C 40 sec for 60 C 60 sec for T2 C final extension 5 min for 72 C Results Duration Duration of PCR with BioCycler TC S BioSan 2 hrs 10 min Duration of PCR with a reference thermocycler one of the most wide spread thermocyclers 2 hrs 15 min 15 Programmable file number Voltage siii Temperature control range 4 99 9 C Temperature increment 0 1 C Uniformity ino Up to 0 3 C Heating hood temperature 50 105 C Ramping speed Up to 3 C sec File settings Number of steps in a file 1 9 Number of steps in a cycle 1 7 Number of cycles 1 99 Step time n 1 sec 99 min Step time increment 1 sec iena Up
23. ply External AC AC adapter 12V 830 mA F S 16 Multi tube n For intensive stirring of bacterial and yeast cells when washing them from culture medium and for metabolite extraction from cells In DNA technology for deproteinisation of DNA protein complexes and purification of low molecular weight DNA RNA fragments in PCR diagnostics Shaking speed constant 2400 RPM Platform for 16 x 0 5 2 0 ml microtubes Continuous and impulse mixing modes Orbit 2 5 mm Overall dimensions 120x155x140 mm Power supply 220 240 V 50 60 Hz E Personal Vortex Ideal instrument for gentle mixing to vigorous resuspension of cells V 41 plus and biological and chemical liquid components Vortex can be used in a cold room or incubator operating ambient temperature range 4 C to 45 C e Speed range 250 3000 RPM e Mixing module for tubes from 1 5 to 50 ml e Eccentric mixing principle e Continuous andimpulse activated with touching the cap operation Overall dimensons 90x150x80 mm Power supply External power supply 12 V 500 mA FVL 2400N Min Specially designed for PCR diagnostics research and other studies in genetic engineering e The new open design of popular CombiSpin FVL 2400 Mixing and sedimentation on one spin module Rotation speed constant 2400 RPM Rotors R 1 5 and R 0 5 0 2 included Autostop when the lid open e Max Rcf 700 xg Continuous and impulse working modes
24. rument for small private clinics Rotator is applicable for mixing diffusion dialysing etc biological liquids in test tubes Rotator can be used in a cold room or incubator operating ambient temperature range 4 C to 45 C Vertical orbital motion Speed range 5 30 RPM Digital timer for 24 hour work Standard platform for 24 microtubes up to 14 mm diameter 1 5 ml 2 ml 15 ml tubes Optional platform P RS 8 50 for 8 tubes up to 30 mm diameter 50 ml tubes Universal rubber clamps for tubes Overall dimensions 255x145x130 mm 2 0 kg Vertical uni rotation Power supply External power supply 12 V 500 mA RS 60 Rotator with mechai Rotator RS 60 is an ideal intrument for laboratory procedures which requires continuous mixing Its variable speed adjsts mixing action from a gentle motion to rapid agitation Some of the procedures it can be used for are embedding blood cell suspensions tissue culture specimens washing of presipitates homogenizing blood solid with plasma Rotator can be used in a cold room or incubator operating ambient temperature range 4 C to 45 C Vertical orbital motion Speed range 5 60 RPM Timer range 0 60 min Timer has two modes continuous up to 24 hrs and timed up to 60 min Standard platform for 48 microtubes up to 14 mm diameter 1 5 ml 2 ml 15 ml tubes Optional platform P RS 10 18 for 10 tubes up to 30 mm diameter 50 ml tubes and 18 tubes up to 14 mm diamet
25. x see below General characteristics Overall dimensions 690x515x555 mm Power supply 220 240 V 50 60 Hz Both models of DNA RNA UV cleaner box can be equipped with an additional UV air flow cleaner UV recirculator for biosafety DNA decontamination to protect the user from direct UV light during operation UV recirculator consists of a UV lamp fan and dust filters organized in a special box for maximum increasing 1000 x fold the density of UV light leading sufficiently to effective DNA RNA inactivation UV recirculator generates 100 Volumes of the PCR box per 1 hour air flow exchange giving a maximum aseptic conditions inside the Box DNA RNA UV cleaner box with UV recirculator models UVC T AR and UVC T M AR correspondingly is recommended for labs working in the field of DNA RNA and proteins analysis genetic engineering molecular biology 14 Eu Thermal cycler BioCycler TC S Thermal cycler BioCycler TC S for DNA probes multiplication Specifications Combined Block for 25 pcs x 0 2 ml tubes 16 pcs x 0 5 ml tubes Power MaX SITZE een Comparison of two thermal cyclers BioCycler TC S BioSan and a reference thermocycler one of the most wide spread thermocyclers Kindly presented by PhD Maris Lazdinjsh Latvian University Settings Target for amplification NADH dehydrogenase Gene of Zymomonas mobilis PCR product contains 3 part of NADH dehydrogenase Gene Predicted length
Download Pdf Manuals
Related Search