Quick & Easy Conditional Knockout Kit (loxP/Cre)
Contents
1. e gt A THE RECOMBINEERING COMPANY GENE BRIDGES BRaeeerRERE aa I II u o Lecihnical Prnatnrn s s e Y Y Y Uo TU i lad INI UH L T EE il fiim AAA l 7 um d nn le Ge t Ba Zee zn UR diam E Zu E E m P o nal tm iw Gino EEE cw P AA A DX O ea lt I p j i Version 1 3 May 2014 TI II TITTT ee iene III 4 IL IN CONTENTS 1 Conditional Knockout Kit loxP GCre 111 1111s ee eeee eee eee renean enne ananas 3 2 Experimental UN NR E ia ipod 6 3 How Red ET Recombination works ia 8 4 Oligonucleotide Design for Red ET Recombination eee 10 5 Media for Antibiotic Selection iic comode a 12 56 Technical retorno ai E a E S 13 6 1 Generation of a functional cassette flanked by homology arms 2220222220022220 nenn 13 6 2 Transformation with Red ET expression plasmid pRedET cccccccccsseccsseeccsneeeesnsesesneeeaes 14 6 3 Insertion of the loxP flanked PGK gb2 neo cassette into a plasmid 16 6 4 Verification of successfully modified plasmid by restriction analysis 19 6 5 Deletion of2. Electroporator 2510 using a 1 mm electroporation cuvette Other devices can be used but 1350 V and a 5 ms pulse are recommended Resuspend the electroporated cells in 1 ml LB medium without antibiotics and return them to the microfuge tube Incubate at 30 C for 70 min shaking at 1000 rpm The expression plasmid 706 Cre will be lost at 37 C Using a small loop plate 100 ul cells on LB agar plates containing tetracycline 3 ug ml plus kanamycin 50 ug ml and the appropriate antibiotics for the plasmid e g ampicillin 100 pg ml for the control Incubate the plates at 30 C overnight or for at least 15 h Protect the plate from light by wrapping it up because tetracycline is sensitive to light Make sure the cells stay at 30 C otherwise the plasmid will be lost 10 Pick a single colony and grow the cells in 1 ml of LB medium plus the appropriate antibiotics for the targeting plasmid ampicillin 100 ug ml for the control experiment at 30 C for 2 3 h 11 Change the temperature to 37 C and incubate overnight Cre protein will be expressed at this temperature and the loxP sites will be recombined At the same time the plasmid 706 Cre cannot replicate any more and will get lost 12 Prepare plasmid DNA and analyze the obtained clones by restriction digestion About 60 80 of the floxed fragments will be recombined An additional re transformation step is therefore necessary to remove the non recombined p
3. functional cassette offered by Gene Bridges e g FRT PGK gb2 neo FRT loxP The loxP PGK gb2 neo loxP cassette supplied with the kit is designed to allow kanamycin neomycin selection in prokaryotic and eukaryotic cells respectively It combines a prokaryotic promoter gb2 for expression of kanamycin resistance in E coli with a eukaryotic promoter PGK for expression of neomycin resistance in mammalian cells The prokaryotic promoter gb2 is a slightly modified version of the Em promoter it mediates higher transcription efficiency than the generally used Tn5 promoter The promoter of the mouse Phospho glucokinase gene PGK is used as the eukaryotic promoter A synthetic polyadenylation signal terminates kanamycin neomycin expression The cassette is flanked by loxP sites for later excision by Cre recombinase Cre causes recombination recombinase of the bacteriophage P1 directs recombination between loxP locus of crossover sites Its function is to maintain phage encoding plasmids as monomers loxP sites are 34 bp DNA sequences comprised of two 13 bp palindromes separated by an asymmetric 8 bp core The recombinase catalyzes DNA strand exchange between two aligned recombination sites resulting in deletion duplication integration inversion or translocation of sequences according to the orientation of the recombination sites and the number of molecules involved The only requirements for DNA rearrangement are the enzyme and the recom
4. maps and sequences K003 BAC Subcloning Kit Description 34 This kit is optimized for subcloning of DNA fragments from BACs and cosmids No restriction sites necessary Fragments up to 20 kb can easily be subcloned in one step High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET after recombination Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 Contents Red ET Recombination protein expression plasmid pRedET Any E coli strain can be made Red ET proficient by transformation with this plasmid Linear vector carrying a ColE1 origin of replication plus ampicillin resistance gene to be used for the subcloning experiment Positive controls to subclone a 15 kb fragment from a control BAC into the vector delivered with the kit Detailed protocols descriptions of plasmids maps and sequences K004 Quick and Easy Conditional Knockout Kit FRT FLPe and K005 Quick and Easy Conditional Knockout Kit loxP Cre Description Contents This kit is designed to integrate FRT or loxP sites into large vectors at any position within 2 weeks Single FRT or loxP sites are inserted by Red ET recombination of FRT or loxP flanked functional cassettes into any designated locus with subsequent removal of the selection marker by FLPe or Cre recombinases Conditional targeting constructs can be generated either by a repetitive inserti
5. pCAGGS FLPe Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 37 11 DNA Engineering Services Available from Gene Bridges Instead of performing your own DNA manipulations let the Gene Bridges DNA Engineering Service Team do the work for you We work for many commercial and research organizations across the world to provide DNA modifications in low or high copy plasmids cosmids BACs and the E coli chromosome The available DNA modifications are e Insertion of a selectable or non selectable marker cassette e Deletion of sequences of any size ranging from 1 bp up to more than 100 kb with or without leaving a selectable marker e Replacement of genes on the E coli chromosome e Point mutations e Fusions e Introduction of site specific targeting sites loxP FRT etc e Insertion of restriction enzyme recognition sites e Subcloning of DNA sequences up to 60 kb e Transferring DNA fragments into multiple destination vectors e BAC and cosmid stitching e Substitutions Contact our DNA Engineering Service by email at contact genebridges com or go to www genebridges com for details and prices 38 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 This page intentionally left blank Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 39 Gene Bridges GmbH Commercial Centre Im Neuenheimer Feld 584 691
6. 1 3 May 2014 2 The plasmid or BAC may be instable and may have rearranged Digest the BAC and run on a gel preferably PFGE to confirm the approximate size may contain some repeats in the region you are targeting Re check sequence could be wrong make sure that you have the right plasmid BAC by isolating DNA and checking the region of the homology arms by PCR and or sequencing If necessary sequence the PCR product to verify the region of homology Some BACs are wrongly annotated inherently instable or a mixture of more than one BAC 3 The Red ET reaction did not take place because there was no expression plasmid present in the cells e g the cells were grown at 37 C instead of 30 C check for tet resistance no or the wrong type of arabinose was used for induction please make sure you use L arabinose some strains e g JM109 DH5alpha are less efficient in Red ET Recombination than others DH10B HS996 GeneHogs or TOP10 are our preferred strains in very rare cases an elongation of the reaction time for the recombination from 70 min incubation of electroporation to up to four hours is necessary for successful recombination 4 Problems with and after the electroporation cells are not competent enough to take up the linear DNA fragment Please make sure that the cells were kept on ice and that the water or 10 glycerol is sufficiently cold Linear DNA has been shown to be about 10 fold less ac
7. 400 200 Figure 5 Restriction analysis Bg l digestion of four colonies obtained in the control experiment after re transformation M Hyperladder Bioline While clone 1 still contains both plasmids in the cell as indicated by the 7759 bp fragment all the three other clones show only the pattern expected for pSub Hoxa1 1 loxPneo 20 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 6 5 Deletion of the kanamycin neomycin selection marker by Cre expression In the next step the kanamycin neomycin selection marker will be removed by expression of Cre recombinase Prepare electro competent cells from a clone harboring the plasmid with the loxP flanked kanamycin neomycin cassette and electroporate the plasmid 706 Cre which expresses the recombinase Take tube 6 to perform a control experiment in parallel The plasmid 706 Cre has a pSC101 origin of replication which maintains low copy and replicates at 30 C The plasmid will not propagate and will get lost when incubated at 37 C The expression of Cre recombinase is driven by the thermo sensitive promoter cl578 Apr promoter Therefore the expression is repressed at 30 C and induced at 37 C The plasmid carries a tetracycline resistance gene Day 1 1 To start overnight cultures pick one colony carrying the plasmid or 10ul from glycerol stock and inoculate one microfuge tube in 1 0 ml LB medium containing kanamycin 50 ug ml and
8. Add 50 ul 10 L arabinose to half one of the tubes for your own experiment and to one of the control tubes giving a final concentration of 0 3 0 4 This will induce the expression of the Red ET Recombination proteins Do not use D arabinose Leave the other tubes without induction as negative controls Incubate all at 37 C shaking for 45 min to 1 h Note It is important that cells are incubated at 37 C the temperature at which all proteins necessary for the subsequent recombination are expressed There are about 5 copies of this temperature sensitive plasmid per cell and during one hour there is approximately 1 doubling step meaning any daughter cell will still have on average 2 3 copies left and will also go on expressing the recombination proteins The plasmid is actually lost after electroporation and recombination when cells are incubated at 37 C overnight Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 4 Prepare the cells for electroporation Centrifuge for 30 sec at 11 000 rpm in a cooled microfuge benchtop centrifuge at 2 C Discard the supernatant by quickly tipping it out twice and place the pellet on ice Resuspend the pellet with 1 ml chilled ddH2O or 10 glycerol pipetting up and down three times to mix the suspension Repeat the centrifugation and resuspend the cells again Centrifuge and tip out the supernatant once more 20 to 30 ul will be left in the tube with the pell
9. Red ET Recombination protein expression plasmid pRedET tube 1 Add 1 yl to your cell pellet Mix briefly Keep the tube on ice Transfer the cell suspension from the tube to the chilled electroporation cuvette Electroporate at 1350 V 10uF 600 Ohms This setting applies to an Eppendorf Electroporator 2510 using a 1 mm electroporation cuvette Other devices can be used but 1350 V and a 5 ms pulse are recommended Resuspend the electroporated cells in 1 ml LB medium without antibiotics and return them to the microfuge tube Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 f Incubate at 30 C for 70 min shaking at 1000 rpm The Red ET expression plasmid pRedET will be lost at 37 C Using a small loop plate 100 ul cells on LB agar plates containing tetracycline 3 ug ml plus the appropriate antibiotics for the plasmid Use a loop to streak the control culture tube 4 pSub Hoxa11 pRedET on an LB agar plate with tetracycline 3 ug ml and ampicillin 100 ug ml Incubate the plates at 30 C overnight or for at least 15 h Protect the plates from light by wrapping them up because tetracycline is sensitive to light Make sure the cells stay at 30 C otherwise the plasmid will be lost Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 6 3 Insertion of the loxP flanked PGK gb2 neo cassette into a plasmid In the next step prepare electro c
10. 14 7 3 How Red ET Recombination works In Red ET Recombination also referred to as A mediated recombination target DNA molecules are precisely altered by homologous recombination in E coli which express the phage derived protein pairs either RecE RecT from the Rac prophage or Reda Red from X phage These protein pairs are functionally and operationally equivalent RecE and Reda are 5 3 exonucleases and RecT and Redf are DNA annealing proteins A functional interaction between RecE and RecT or between Reda and Red is also required in order to catalyze the homologous recombination reaction Recombination occurs through homology regions which are stretches of DNA shared by the two molecules that recombine Figure 2 The recombination is further assisted by A encoded Gam protein which inhibits the RecBCD exonuclease activity of E coll Double stranded break 3 5 RecE i 1 5 3 2 or Reda exonuclease 5c 3 S ILLIS i OOOOO ied Single strand orfssop binding proteins 5 CHOHCHOHOMO 3 DCIITEDIIIIIIAS Sew Joint molecule formation DNA replication Figure 2 Mechanism of Red ET Recombination 8 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 Double stranded break repair DSBR is initiated by the recombinase protein pairs RecE RecT or Redo Redp First Reda or RecE digests one strand of the DNA from the DSB leaving the other strand as a 3 en
11. 1995 e Hill F Benes V Thomasova D Stewart A F Kafatos F C Ansorge W BAC trimming minimizing clone overlaps Genomics 64 111 113 2000 e Kilby N J Snaith M R and Murray J A Site specific recombinases tools for genome engineering Trends Genet 9 413 421 1993 e Miller C A Ingmer H and Cohen SN Boundaries of the pSC101 Minimal Replicon are Conditional J Bacteriol 177 4865 4871 1995 e Muyrers J P P Zhang Y Testa G Stewart A F Rapid modification of bacterial artificial chromosomes by ET recombination Nucleic Acids Res 27 1555 155 1999 e Muyrers J P P Zhang Y Buchholz F Stewart A F RecE RecT and Redo Redp initiate double stranded break repair by specifically interacting with their respective partners Genes Dev 14 1971 1982 2000 e Muyrers J P P Zhang Y Benes V Testa G Ansorge W Stewart A F Point mutation of bacterial artificial chromosomes by ET recombination EMBO Reports 1 239 243 2000 e Muyrers J P P Zhang Y Stewart A F ET cloning Think recombination first Genetic Engineering Principles and Methods Ed J K Setlow 22 77 98 Kluwer Academic Plenum Publishers NY 2000 e Muyrers J P P Zhang Y and Stewart A F Recombinogenic engineering new options for cloning and manipulating DNA Trends in Bioch Sci 26 325 31 2001 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 29 30 Narayana
12. 20 Heidelberg Tel 4 49 0 6221 13 70811 Fax 49 0 6221 13 70 829 contact genebridges com www genebridges com
13. Ala lle Glu Gin Asp Gly Leu His Ala Gly 691 TCT COG GCC GCT TGG GTG GAG AGG CTA TTC GGC TAT GAC TGG GCA CAA CAG ACG ATC 14 Ser Pro Ala Ala Trp Val Glu Arg Leu Phe Gly Tyr Asp Trp Ala Gin Gin Thr Ile 748 GGC TGC TCT GAT GCC GCC GIG TTC CGG CTG TCA GCG CAG GGG CGC CCG GTT CIT TIT 33kGly Cys Ser Asp Ala Ala Val Phe Arg Leu Ser Ala Gin Gly Arg Pro Val Leu Phe 805 GTC AAG ACC GAC CTG TCC GGT GCC CTG AAT GAA CTG CAG GAC GAG GCA GCG CGG CTA 52b Val Lys Thr Asp Leu Ser Gly Ala Leu Asn Glu Leu Gin Asp Glu Ala Ala Arg Leu 862 TCG TGG CTG GCC ACG ACG GGC GTT CCT TGC GCA GCT GTG CTC GAC GTT GTC ACT GAA 71 Ser Trp Leu Ala Thr Thr Gly Val Pro Cys Ala Ala Val Leu Asp Val Val Thr Glu 919 GCG GGA AGG GAC TGG CTG CTA TTG GGC GAA GTG COG GGG CAG GAT CTC CTG TCA TCT 90h Ala Gly Arg Asp Trp Leu Leu Leu Gly Glu Val Pro Gly Gln Asp Leu Leu Ser Ser 976 CAC CIT GCT CCT GCC GAG AAA GTA TCC ATC ATG GCT GAT GCA ATG CGG CGG CTG CAT 109 His Leu Ala Pro Ala Glu Lys Val Ser Ile Met Ala Asp Ala Met Arg Arg Leu His 1033 ACG CTT GAT CCG GCT ACC TGC CCA TTC GAC CAC CAA GCG AAA CAT CGC ATC GAG CGA 128 Thr Leu Asp Pro Ala Thr Cys Pro Phe Asp His Gin Ala Lys His Arg Ile Glu Arg 1090 GCA CGT ACT CGG ATG GAA GCC GGT CTT GTC GAT CAG GAT GAT CTG GAC GAA GAG CAT 147 Ala Arg Thr Arg Met Glu Ala Gly Leu Val Asp Gin Asp Asp Leu Asp Glu Glu His 1147 CAG GGG CTC GCG CCA GCC GAA CTG TTC GCC AGG CTC AAG GCG CGC ATG CCC GAC GGC 166 Gln Gly Leu Ala Pro Ala Glu Leu Phe Ala Arg Leu Lys Ala Arg Met Pro A
14. Selection All antibiotics are available from Sigma Stock solutions should be stored at 20 C For selective LB medium the antibiotic is dissolved in LB medium to the indicated working concentration 1 Chloramphenicol stock solution c 30 mg ml dissolved in ethanol Working concentration 15 ug ml for BACs low copy plasmids and 50 ug ml for high copy plasmids Ampicillin stock solution c 100 mg ml dissolved in 50 ethanol Working concentration 50 ug ml for BACs low copy plasmids and 100ug ml for high copy plasmids Tetracycline stock solution c 10 mg ml dissolved in 75 ethanol Working concentration for pRedET 3 ug ml for high copy plasmids 10 wg nil Tetracycline is light sensitive Kanamycin stock solution c 30 mg ml dissolved in ddH20 Working concentration 15 ug ml for BACs low copy plasmids and 50 ug ml for high copy plasmids Hygromycin stock solution c 50 mg ml dissolved in ddH20 Working concentration 20 ug ml for BACs low copy plasmids and 50 ug ml for high copy plasmids oelective LB plates are made by adding 15 g agar to 1 L LB medium After boiling cool to approx 50 C add the required antibiotics to yield the appropriate working concentrations and pour into petri dishes L arabinose stock solution Use 10 L arabinose Sigma A 3256 in ddH20 fresh or frozen in small aliquots at 20 C Use 50 ul stock solution per 1 4 ml LB for induction of recombination protein expression from pRedET Frozen aliq
15. and 7 at 80 C Please note All materials necessary for the control experiment are provided with this kit You must order your oligonucleotides PCR primer according to your experimental design before starting High quality oligos yield highest recombination efficiencies Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 5 2 Experimental Outline pSub Hoxa11 18 kb pRedET plasmid loxP loxP PGK gb2 neo pSub Hoxa11 3 loxPneo 19 5 kb Cre plasmid pSub Hoxa11 loxP repetition T amp 2 loxP loxP PGK gb2 neo Conditional knockout 19 5 kb Figure 1 Flowchart shows the experimental outline for the generation of a conditional Knockout construct based on loxP sites 6 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 Figure 1 1 Transform E coli cells harboring your plasmid with the expression plasmid pRedET Figure 7 tube 1 For your convenience this step has already been performed for the control experiment control experiment tube 4 Prepare your PCR product using the loxP PGK gb2 neo loxP template DNA Figure 9 tube 2 as template Plate and grow at 30 C Red ET Recombination step The expression of genes mediating Red ET is induced by the addition of L arabinose and a temperature shift from 30 C to 37 C After induction the cells are prepared for electroporation
16. and the PCR product control experiment tube 3 loxP PGK gb2 neo loxP PCR product which includes the homology arms is electroporated Selection for colonies carrying the modified plasmid Only colonies carrying successfully modified plasmids will survive kanamycin selection on the agar plates Subsequent DNA mini preparation and check PCR are used to confirm the successful integration of the functional cassette In most cases an additional re transformation step is required to separate the modified plasmid from all copies of the original plasmid Cre Recombination step The Cre expression plasmid 706 Cre Figure 8 tube 5 is transformed into the cells harboring the plasmid with the inserted loxP PGK gb2 neo loxP cassette control experiment tube 6 Plate and grow at 30 C Expression of Cre recombinase is induced by a temperature shift to 37 C DNA mini preparation and check PCR are used to confirm the successful recombination step An additional re transformation step is required to separate the modified plasmid from all copies of the original plasmid Take pSub Hoxa11 loxP tube 7 as control for the final product of the control reaction Repetition of steps 1 amp 2 can be performed to integrate the loxP PGK gb2 neo loxP cassette at a second location e g into another intron The result will be a loxP based conditional targeting construct Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 20
17. bination sites no additional cellular factors are necessary 4 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 Contents of the kit pRedET tet Red ET expression plasmid 20 ng ul 20 ul 2 loxP PGK gb2 neo loxP template DNA PCR template plasmid DNA for generating a loxP flanked PGK gb2 neo cassette 50 ng ul 20 ul 3 loxP PGK gb2 neo loxP PCR product PGK gb2 neo cassette flanked by loxP sites and 50 bp long homology arms for the control experiment 100 ng ul 10 Hl 4 pSub Hoxa11 pRedET tet Glycerol stock of E coli strain DH10B harboring the expression plasmid pRedET tet as well as a high copy plasmid containing 15 kb of the mouse Hoxa11 gene for the control experiment 500 ul 25 glycerol o 706 Cre expression plasmid for Cre recombinase 20 ng ul 20 ul Oo pSub Hoxa11 loxPneo Glycerol stock of E coli strain HS996 harboring a high copy plasmid containing 15 kb of the mouse Hoxa11 gene and a loxP flanked cassette inserted into the second intron of the Hoxa11 gene control experiment 500 ul 25 glycerol 7 pSub Hoxa11 loxP Glycerol stock of E coli strain HS996 harboring a high copy plasmid containing 15 kb of the mouse Hoxa11 gene and a single loxP site inserted into the second intron of the Hoxa11 gene control experiment 500 ul 25 glycerol 8 This manual with protocols maps and sequences Please store tubes 1 3 and 5 at 20 C store tubes 4 6
18. d kanamycin resistance marker cassette is supplied with the kit and can be used to replace a gene on the E coli chromosome Red ET recombination can replace fragments as large as 30kb from the chromosome The use of a FRT flanked resistance cassette for the replacement of the targeted gene allows the subsequent removal of the selection marker by a FLP recombinase step if required FLP expression plasmids can be purchased from Gene Bridges Multiple knock outs can be generated either by repetitive insertion of the functional cassette supplied with the kit or by combination with other functional cassettes offered by Gene Bridges Strictly controlled recombination process due to an optimized design of the pRedET expression plasmid The genes for the recombination proteins are under the control of an inducible promoter and the plasmid carries a temperature sensitive origin of replication for the convenient removal of the plasmid after recombination Two Red ET Recombination protein expression plasmids pRedET tet and pRedET amp Any E coli strain can be made Red ET proficient by transformation with these plasmids FRT flanked kanamycin resistance template FRT PGK gb2 neo FRT to be used for your own experiments Positive controls to replace the gene for the mannose transporter manX on the E coli chromosome Detailed protocols descriptions of plasmids maps and sequences Gene Bridges Quick and Easy Conditional Knockout Kit lo
19. ded single stranded DNA overhang Then Redp or RecT binds and coats the single strand The protein nucleic acid filament aligns with homologous DNA Once aligned the 3 end becomes a primer for DNA replication The X recombination proteins can be expressed from a plasmid Figure 5 and are therefore transferable to any E coli strain pRedET Figure 7 carries the A phage redyBa operon expressed under the control of the arabinose inducible pBAD promoter Guzman et al 1995 and confers tetracycline resistance The pBAD promoter is both positively and negatively regulated by the product of the araC gene Schleif 1992 AraC is a transcriptional regulator that forms a complex with L arabinose Arabinose binds to AraC and allows transcription to begin In the presence of glucose or the absence of arabinose transcription is blocked by the AraC dimer The plasmid carries the redo p y genes of the X phage together with the recA gene in a polycistronic operon under the control of an inducible promoter The recombination window is therefore limited by the transient expression of Red proteins Thus the risk of unwanted intra molecular rearrangement is minimized While constitutive expression of the red y gene has a toxic effect in DH10B recA cells under some conditions thus limiting the efficiency of recombination tightly regulated expression of the y gene together with simultaneous expression of the reda and 6 genes allows efficient homolo
20. enesis in Escherichia coli and mouse ES cells BMC Molecular Biology 4 1 14 2003 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 8 2 Patents Red ET recombination is covered by one or several of the following patents and patent applications e Stewart A F Zhang Y and Buchholz F 1998 Novel DNA cloning method European Patent No 1034260 issued on 12 of March 2003 United States Patent No 6 509 150 e Stewart A F Zhang Y and Muyrers J P P 1999 Methods and compositions for directed cloning and subcloning using homologous recombination United States Patent No 6 355 412 issued on 12 of March 2002 e Youming Zhang A Francis Stewart and Joep P P Muijrers 2001 Improved RecT or RecET cloning and subcloning method European Patent Application No 01 117 529 6 e Stewart A F Zhang Y and Muyrers J P P 2001 Recombination method European Patent Application No 0103276 2 These patents and patent applications are owned by Gene Bridges or owned by the EMBL and exclusively licensed to Gene Bridges Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 31 9 Purchaser Notification Warranty This product is the subject of European Patent No 1034260 issued on 12 3 2003 or PCT EP98 07945 and United States Patent No 6 355 412 issued on 12 of March 2002 The purchase of this product conveys to the purchaser the non tran
21. et Keep the tube on ice 5 Add 1 2 ul 0 2 0 3 ug of your prepared linear loxP PGK gb2 neo loxP fragment with homology arms to each of the two microfuge tubes induced and uninduced and pipette the mixture into the chilled electroporation cuvette In parallel pipette 2 ul from tube 3 into each of the two tubes of the control 6 Electroporate at 1350 V 10 uF 600 Ohms This setting applies to an Eppendorf Electroporator 2510 using an electroporation cuvette with a slit of 1mm Other devices can be used but 1350 V and a 5 ms pulse are recommended 7 Add 1 ml LB medium without antibiotics to the cuvette Mix the cells carefully by pipetting up and down and pipette back into the microfuge tube Incubate the cultures at 37 C with shaking for 70 min Recombination will now occur 8 Streak the cultures with a loop 100 ul is sufficient if necessary plate all onto LB agar plates containing kanamycin 50 ug ml and the appropriate antibiotics for the plasmid e g ampicillin 100 pg ml for the control The plates should not contain tetracycline otherwise the Red ET Recombination protein expression plasmid pRedET will either persist or the cells will die Incubate the plates at 3 C overnight The Red ET Recombination protein expression plasmid pRedET will disappear at 37 C You should obtain gt 100 colonies and the ratio of induced uninduced bacterial colonies should exceed 10 1 More than 95 of all colonies growing on the aga
22. ether loxP or FRT sites and various other DNA fragments such as homology arms and a positive selection marker such as PGKneo The problem with this approach is that restriction sites are often not available or inconveniently located thus severely limiting where loxP or FRT sites can be placed Red ET Recombination makes it possible to introduce loxP or FRT sites and selectable markers anywhere in a gene and greatly reduces the amount of time it takes to make a targeting vector Red ET Recombination relies on homologous recombination in vivo in E coli and allows a wide range of modifications with DNA molecules of any size and at any chosen position Homologous recombination is the exchange of genetic material between two DNA molecules in a precise specific and accurate manner These qualities are optimal for engineering a DNA molecule regardless of its size Homologous recombination occurs through homology regions which are stretches of DNA shared by the two molecules that recombine Because the sequence of the homology regions can be chosen freely any position on a target molecule can be specifically altered Red ET recombination allows you to choose homology arms as short as 50 bp for homologous recombination which can easily be added to a functional cassette by long PCR primers Zhang and coworkers demonstrated in 1998 for the first time that a pair of phage coded proteins RecE and RecT only need 42bp long homology arms to mediate the homologo
23. gous recombination between linear DNA fragments and plasmids resident in cells such as DH10B pRedET is a derivative of a thermo sensitive pSC101 replicon which is a low copy number plasmid depending on the oriR101 The RepA protein encoded by plasmid p9C101 is required for plasmid DNA replication and the partitioning of plasmids to daughter cells at division Miller Ingmer and Cohen 1995 Because the RepA protein is temperature sensitive Ts cells have to be cultured at 30 C to maintain the plasmid pSC101 derivatives are easily curable at 37 C to 43 C Experiments have shown that the copy number of the plasmid decreases by about 80 during four generations of bacterial cell growth at 42 C After return of the cultures to 30 C approximately the same number of generations of bacterial cell growth is required for the copy number of the plasmid to return to the level observed before Miller Ingmer and Cohen 1995 Since the plasmid is based on oriR101 it can be propagated in E coli together with most ColE1 derived plasmids Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 9 4 Oligonucleotide Design for Red ET Recombination To target your plasmid at the site s of choice you will need to attach short homology regions to the functional cassette carrying the selectable marker This is most conveniently done by ordering two oligonucleotides for use in PCR amplification Figure 3 Each oligonuc
24. ick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 13 6 2 Transformation with Red ET expression plasmid pRedET Before starting with the experiment please streak out the glycerol stock of the clone carrying you plasmid on LB plates conditioned with the appropriate antibiotics 14 Day 1 1 oet up an overnight culture Pick one or two colonies and inoculate them in microfuge tubes containing 1 0 ml LB medium with appropriate antibiotics to select for your endogenous plasmid Puncture a hole in the lid for air Incubate at 3 C overnight with shaking Day 2 Before starting e Chill ddH2O or 1096 glycerol on ice for at least 2 h e Chill electroporation cuvettes 1 mm gap e Cool benchtop centrifuge to 2 C Set up a microfuge tube containing fresh 1 4 ml LB medium and inoculate with 30 ul of fresh overnight culture Culture for 2 3 h at 37 C shaking at 1000 rpm Prepare the cells for electroporation Centrifuge for 30 sec at 11 000 rpm in a cooled microfuge benchtop centrifuge at 2 C Discard the supernatant by quickly tipping out the supernatant twice and place the pellet on ice Resuspend the pellet with 1 ml chilled ddH2O pipetting up and down three times to mix the suspension Repeat the centrifugation and resuspend the cells again Centrifuge and tip out the supernatant once more 20 to 30 yl will be left in the tube with the pellet Resuspend cells and keep the tube on ice Take the
25. lasmid Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 6 6 Verification of successfully modified plasmid by restriction analysis For the control experiment the restriction pattern for pSub Hoxa11 loxP after Bgll digest is 422 bp 692 bp 1730 bp 1836 bp 1959 bp 3485 bp and 7846 bp Removal of the loxP PGK gb2 neo loxP cassette results in the loss of two fragments 4162 bp and 5234 bp and gain of one fragment 7846bp see figure 6 BAND SIZE bp n 10 000 8 000 6 000 5 000 4 000 3 000 2 500 2 000 1500 1000 800 600 400 200 Figure 6 Restriction analysis of pSub Hoxa11 loxP after Bgll digest Six colonies lanes 1 6 were analyzed directly after the recombination step and three colonies after the re transformation lanes 7 9 M Hyperladder Bioline Directly after Cre recombination nearly all clones analyzed still contain some copies of the pSub Hoxa1 1 loxPneo plasmid as indicated by the presence of weak fragments at 4162 bp and 5234 bp lanes 1 6 After the re transformation step lanes 7 9 no traces of the non recombined pSub Hoxa11 loxPneo plasmid are visible any more Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 23 6 7 Maps and sequences pi pRedET 9270 bp alpha recA repA pSC101 ori Figure 7 Map of the Red ET expression plasmid pRedET Transformation of E coli hosts with this p
26. lasmid is selected for by acquisition of tetracycline resistance at 30 C Expression of the Red ET Recombination proteins is induced by L arabinose activation of the pBAD promoter at 37 C 706 Cre 11090 bp pSC101 ori Figure 8 Map of the plasmid 706 Cre Transformation of E coli hosts with this plasmid is selected for by acquisition of tetracycline resistance at 30 C Expression of the Cre recombination proteins is induced by a temperature shift to 3 C 24 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 Notl Xhol pGB2 kanamycin neomycin loxP loxP Notl 1 AATTAACCCTCACTAAAGG GCGGCCGC ATAACTTCGTATAGCATACATTATACGAAGTTAT ATTCTACCGG 72 GTAGGGGAGG CGCTTTTCCC AAGGCAGTCT GGAGCATGCG CTTTAGCAGC CCCGCTGGGC ACTTGGOGCT 142 ACACAAGTGG CCTCTGGCCT CGCACACATT CCACATCCAC CGGTAGGCGC CAACCGGCTC CGTTCTTTGG 212 TGGCCCCTTC GCGCCACCTT CCACTCCTCC CCTAGTCAGG AAGTTCCCCC CCGCCCCGCA GCTCGCGTCG 282 TGCAGGACGT GACAAATGGA AGTAGCACGT CTCACTAGTC TCGTGCAGAT GGACAGCACC GCTGAGCAAT 352 GGAAGCGGGT AGGCCTTTGG GGCAGCGGCC AATAGCAGCT TTGCTCCTTC GCTTTCTGGG CTCAGAGGCT 422 GGGAAGGGGT GGGTCOGGGG GCGGGCTCAG GGGCGGGCTC AGGGGCGGGG CGGGCGCCCG AAGGTCCTCC 492 GGAGGCCCGG CATTCTGCAC GCTTCAAAAG CGCACGTCTG COGCGCTGTT CTCCTCTTCC TCATCTCCGG 562 GCCTTTCGAC C TGCAGC AGCACGTGTT GACAATTAAT CATCGGCATA GTATATCGGC ATAGTATAAT 629 ACGACAAGGT GAGGAACTAA ACC ATG GGA TCG GCC ATT GAA CAA GAT GGA TTG CAC GCA GGT ihMet Gly Ser
27. leotide consists of two or if desired three parts 1 Required Part A A for the second oligonucleotide is the homology region shared by the target molecule and the linear molecule The homology regions are the 50 bp directly adjacent to either side of the insertion site The exact sequences of the homology regions can be chosen freely depending on the position on the target molecule to be modified Optional Part B B for the second oligonucleotide This part of the oligonucleotide allows the incorporation of useful sequences such as restriction sites If the introduction of such operational sequences is not needed this part can simply be omitted from the oligonucleotide design Required Part C C for the second oligonucleotide This sequence usually 18 to 24 nucleotides long primes the PCR amplification of the selectable marker from the provided template PCR template with annealed oligos PCR product amp Vector Targeting construct 3 A A 3 C A A B Ns 4 N A A oa a Vector Figure 3 Practical steps involved to insert a fragment by Red ET recombination 10 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 The two oligos below were used to add the 50 bp homology regions italics for Red ET Recombination to the loxP PGK gb2 neo loxP cassette Figure 9 used in the control reaction The parts of the oligos which serve as PCR primers for amplification of the ca
28. mum speed for 10 min 8 Discard the supernatant and add 0 7 ml of 70 ethanol to rinse the pellet 9 Spin down the DNA at maximum speed for 5 min and carefully discard the supernatant 10 Dry the pellet under the speed vacuum for 2 min or leave the tube open on the bench for 5 to 10 min until the DNA pellet is completely dry Do not overdry the pellet otherwise the DNA will become difficult to re dissolve 11 Carefully resuspend the dry DNA pellet in 50 ul ddH20 or 10 mM Tris HCl Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 6 4 Verification of successfully modified plasmid by restriction analysis Analyze an aliquot of your plasmid DNA by restriction digestion For the control experiment the restriction pattern for the original plasmid pSub Hoxa11 after Bgll digest is 422 bp 692 bp 1730 bp 1836 bp 1959 bp 3485 bp and 7759 bp The integration of the loxP PGK gb2 neo loxP cassette leaves the smaller fragments intact but results in a cleavage of the 7759 bp fragment into two smaller ones with 4162 bp and 5234 bp respectively BAND SIZE bp n 10 000 8 000 6 000 5 000 4 000 3 000 2 500 2 000 1500 1 000 800 600 400 200 Figure 4 Restriction analysis of pSub Hoxa11 lanes 1 2 and 4 clones after insertion of the loxP PGK gb2 neo loxP cassette lanes 3 6 after Bgll digestion M Hyperladder Bioline Although nearly all clones will show the expected restriction
29. n K Williamson R Zhang Y Stewart A F loannou P A Efficient and precise engineering of a 200 kb beta globin human bacterial artificial chromosome in E coli DH10B using an inducible homologous recombination system Gene Ther 6 442 447 1999 Rodriguez C l Buchholz F Galloway J Sequerra J K Ramses A Stewart A F and Dymecki S M High efficiency deleter mice show that FLPe is an alternative to Cre loxP Nature Genetics 25 139 140 2000 schleif R S DNA Looping Annu Rev Biochem 61 199 223 1992 Testa G Zhang Y Vintersten K Benes V Pijnappel P Chambers l Smith A J H Smith A G and Stewart A F Engineering of mouse genome with bacterial artificial chromosomes to create multipurpose alleles Nature Biotechnology 21 443 7 2003 Testa G Schaft J van der Hoeven F Glaser S Anastassiadis K Zhang Y Hermann T Stremmel W and Stewart A F A reliable lacZ expression reporter cassette for multipurpose knockout first alleles Genesis 38 151 158 2004 Zhang Y Buchholz F Muyrers J P P and Stewart A F A new logic for DNA engineering using recombination in Escherichia coli Nature Genetics 20 123 128 1998 Zhang Y Muyrers J P P Testa G and Stewart A F DNA cloning by homologous recombination in Escherichia coli Nature Biotech 18 1314 1317 2000 Zhang Y Muyrers P P J Rientjes J and Stewart A F Phage annealing proteins promote oligonucleotide directed mutag
30. nd electroporation apparatus Follow the manufacturers safety recommendations 2 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 1 Conditional Knockout Kit loxP Cre Introduction The ability to introduce virtually any mutation into the genome followed by gene targeting in embryonic stem ES cells provides a powerful approach for elucidating gene function in the whole animal In many cases however the complete deficiency of a gene leads to embryonic lethality precluding the analysis of gene function in later developmental stages or in the adult This problem can be overcome by creating conditional knockout animals allowing a gene to be inactivated in a tissue or temporal specific fashion Typically a conditional knockout allele is made by inserting loxP or FRT sites into two introns of a gene Expression of Cre or FLP recombinase in the animal carrying the conditional knockout allele catalyzes recombination between the loxP and the FRT sites respectively and inactivates the gene By expressing Cre or FLP recombinase from a tissue specific promoter the gene can be inactivated in a tissue specific fashion A major limitation for generating conditional knockout animals is the difficulty and time it takes to make the appropriate targeting vector The conventional approach is to find appropriate restriction enzyme sites that are located in or near the gene These sites are then used to ligate tog
31. ntity Several wrong nucleotides in the homology region can completely abolish recombination Since oligonucleotides are used to add the homology regions they have to be synthesized properly and be of excellent quality Take into account that long oligonucleotides especially if they are longer than 80bp require additional purification steps such as HPLC Also note that the electronic sequences provided for BACs may not be 100 correct If you are trying to target a repeated sequence in your BAC or plasmid you may experience problems because the homology region at the end of the linear fragment can go to more than one site It is therefore best not to target repeats directly Observation No colonies on your plate after Red ET Recombination If you do not obtain any colonies after recombination the following parameters should be checked 1 The PCR product could be wrong check it by restriction digest or sequencing could be degraded check an aliquot on an agarose gel could have incorrect homology arms Please double check the oligonucleotides used to generate the PCR product for quality and correctness If necessary verify the sequence by sequencing the PCR product may not be enough increase the amount of PCR product from approximately 100 ng to up to 500 ng Please take into consideration that you may also increase non unspecific background 26 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version
32. ombined plasmid from the non recombined one after recombination even after re transformation high co lasmid In very rare cases we have observed that after recombination it is difficult to separate the original plasmid from the recombined one If you cannot separate them by dilution of the plasmid and re transformation you can choose a single cutting restriction enzyme and digest the plasmid for a few minutes After re transformation the two plasmids should be separated even when they were tangled before Special Note for loxP Cre Kit Please keep in mind that most BACs have an intact loxP sequence on the BAC backbone This site may also actively participate in recombination events when performing a Cre recombination step using the BAC 28 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 8 References and Patents 8 1 References e Angrand P O Daigle N van der Hoeven F Scholer H R and Stewart A F Simplified generation of targeting constructs using ET recombination Nucleic Acids Res 27 e16 1999 e Buchholz F Angrand P O and Stewart A F A simple assay to determine the functionality of Cre or FLP recombination targets in genomic manipulation constructs Nucleic Acids Res 24 3118 3119 1996 e Guzman L M Belin D Carson M J Beckwith J Tight regulation modulation and high level expression by vectors containing the arabinose pBAD promoter J Bacteriol 177 4121 4130
33. ompetent cells from the plasmid hosts that contain the Red ET expression plasmid shortly after inducing the expression of the recombination proteins In advance prepare the linear DNA fragment the loxP PGK gb2 neo loxP cassette with homology arms that you will insert into your plasmid Use tube 3 loxP PGK gb2 neo loxP PCR product and tube 4 pSub Hoxa11 pRedET to perform a control experiment in parallel Day 3 1 To start overnight cultures pick one colony from the plate you obtained in 6 2 step 8 and inoculate one microfuge tube containing 1 0 ml LB medium plus Tetracycline 3 ug ml and the appropriate antibiotics for the plasmid e g ampicillin 100 pg ml for the control Also pick one colony from the control plate Puncture a hole in the lid of the tubes for air Incubate the cultures while shaking at 30 C overnight Day 4 Before starting e Chill ddH2O or 1096 glycerol on ice for at least 2 h e Chill electroporation cuvettes 1 mm gap e Cool benchtop centrifuge to 2 C 2 The next day set up 4 lid punctured microfuge tubes 2 for your own 16 experiment and 2 for control experiment containing 1 4 ml each of fresh LB medium conditioned with the same antibiotics as in step 1 Inoculate two of them with 30 ul fresh overnight culture for your experiment the other two with 30 ul of the overnight culture from the control experiment Incubate the tubes at 30 C for 2 h shaking at 1100 rpm until OD600 0 3
34. on of the functional cassette supplied with the kit or by combination with other functional cassettes offered by Gene Bridges The functional cassette supplied with the kit FRT PGK gb2 neo FRT or loxP PGK gb2 neo loxP combines a prokaryotic promoter gb2 for expression of kanamycin resistance in E coli with an eukaryotic promoter PGK for expression of neomycin resistance in mammalian cells High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET after recombination Red ET Recombination protein expression plasmid pRedET Any E coli strain can be made Red ET proficient by transformation with this plasmid FRT or loxP flanked kanamycin neomycin resistance template FRT PGK gb2 neo FRT or loxP PGK gb2 neo loxP to be used for your own experiments Expression plasmid for FLPe or Cre site specific recombinase in E coli cells Positive controls to introduce a single FRT or loxP site into a 15 kb high copy plasmid Detailed protocols descriptions of plasmids maps and sequences Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 35 K006 Quick and Easy E coli Gene Deletion Kit Description Contents 36 This kit is designed to knock out or alter genes on the E coli chromosome in less than one week Red ET recombination allows the exchange of genetic information in a base pair precise specific and reliable manner A FRT flanke
35. pattern for a successful integration of the loxP PGK gb2 neo loxP cassette the mother plasmid usually still persists in the cell High copy plasmids like pBluescript or pSub11 Hoxa which is used for the control experiment replicate to up to several hundred copies per cell Due to this high copy number not all plasmid copies will be recombined at the same time resulting in a mixed phenotype where both plasmids are detectable side by side in the cell see also Figure 4 for the control experiment To separate the modified plasmid from its unmodified mother plasmid take a small amount of the isolated plasmid DNA from step 6 3 about 1 ng and re transform it into a fresh aliquot of competent E coli cells Pick several colonies the next day perform plasmid mini prep plasmid DNA isolation following the protocol of your choice and check these DNA preparations by restriction digestion Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 19 After the re transformation the majority of the analyzed clones should show the restriction pattern for the modified plasmid only For the control experiment the restriction pattern for the plasmid pSub Hoxa11 loxPneo after Bgll digest is 422 bp 692 bp 1730 bp 1836 bp 1959 bp 3485 bp 4162 bp and 5234 bp Figure 5 Take one purified colony to perform step 6 5 BAND SIZE bp n 10 000 8 000 6 000 5 000 4 000 3 000 2 500 2 000 1 500 1 000 BOO 600
36. r plates conditioned with the appropriate antibiotics will have successfully recombined copies of the plasmid Please note that although most kanamycin resistant colonies will contain the correct plasmid recombinant in rare cases it is possible that secondary recombination usually deletions between internal repeats in the plasmid can also occur To confirm the correct recombination event pick 10 20 colonies from your experiment and 2 from the control to isolate plasmid DNA Also pick colonies from the original unmodified plasmid plates for DNA preparation and comparison Perform mini prep plasmid DNA isolation following the protocol of your choice and check these DNA preparations by restriction digestion Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 17 A simple plasmid DNA isolation protocol is given below 18 1 Spin down the 1 5 ml overnight cultures for 1 min at 13 000 rpm 2 Discard the supernatant and resuspend the cell pellet in 200 ul buffer P1 with RNase Qiagen 3 Add 200 ul of buffer P2 Qiagen and mix by inverting the tube several times 4 Add 200 ul of buffer P3 Qiagen and mix by inverting the tube several times Leave the sample on ice for 10 min 5 Spin down the white lysate at maximum speed for 10 min 6 Transfer the clear supernatant into a new 1 5 ml microfuge tube and add 0 50 ml of 2 propanol 7 Mix by inverting the tube and spin down the DNA at maxi
37. roduce a Tn5 neo cassette in a 150 kb BAC Detailed protocols descriptions of plasmids maps and sequences Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 33 K002 Counter Selection BAC Modification Kit Description Contents This kit is designed to modify any type of bacterial artificial chromosomes BACs within 2 3 weeks by using a counter selection cassette The kit is designed for advanced BAC modification such as introducing short sequences e g point mutations loxP sites restriction sites etc insertion or deletion of non selectable marker genes fragment exchange without leaving a selection marker or any unwanted sequences The included counter selection cassette pRpsL neo is based on streptomycin selection which shows a much higher efficiency than pSacB neo or comparable systems This kit can also be used to work on bacterial chromosomes and common ColE1 origin plasmids High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET after recombination Red ET Recombination protein expression plasmid pRedET Any E coli strain can be made Red ET proficient by transformation with this plasmid BAC host E coli strain HS996 already carrying the Red ET plasmid pRpsL neomycin template to be used for your own experiments Positive controls to introduce a point mutation in a 150 kb BAC Detailed protocols descriptions of plasmids
38. sferable right to use this product for research purposes only The purchaser can not sell or otherwise transfer this product or its components to a third party No rights are conveyed to the purchaser to use this product or its components for a commercial purpose Commercial purposes shall include any activity for which a party receives consideration of any kind These may include but are not limited to use of the product or its components in manufacturing to provide a service information or data use of the product for diagnostic purposes or re sale of the product or its components for any purpose commercial or otherwise The use of homologous recombination for commercial purposes may infringe the intellectual property covered by the EP 419 621 patent family Products containing the araB promoter are sold under patent license for research purposes only and are non transferable Inquiries for any commercial use including production of material to be sold commercially or used in production or in product development efforts which includes efforts toward regulatory approval should be made directly to Xoma Corporation Berkeley California Xoma Corporation 2910 Seventh Street Berkeley CA 94710 Limited Warranty Gene Bridges is committed to providing customers with high quality goods and services Gene Bridges assumes no responsibility or liability for any special indirect incidental or consequential loss or damage whatsoever This warrant
39. sp Gly 1204 GAG GAT CTC GTC GTG ACC CAT GGC GAT GCC TGC TTG CCG AAT ATC ATG GTG GAA AAT 185hGlu Asp Leu Val Val Thr His Gly Asp Ala Cys Leu Pro Asn Ile Met Val Glu Asn 1261 GGC CGC TTT TCT GGA TTC ATC GAC TGT GGC CGG CTG GGT GIG GCG GAC CGC TAT CAG 204 Gly Arg Phe Ser Gly Phe Ile Asp Cys Gly Arg Leu Gly Val Ala Asp Arg Tyr Gin 1318 GAC ATA GCG TTG GCT ACC CGT GAT ATT GCT GAA GAG CTT GGC GGC GAA TGG GCT GAC 223 Asp lle Ala Leu Ala Thr Arg Asp lle Ala Glu Glu Leu Gly Gly Glu Trp Ala Asp 1375 CGC TTC CTC GTG CTT TAC GGT ATC GCC GCT CCC GAT TCG CAG CGC ATC GCC TTC TAT 242b Arg Phe Leu Val Leu Tyr Gly Ile Ala Ala Pro Asp Ser Gin Arg Ile Ala Phe Tyr 1432 CGC CTT CTT GAC GAG TTC TTC TGA GCGGGACTCTGGGGTTCGAATAAAGACCGACCAAGOGAC GTC 261 Arg Leu Leu Asp Glu Phe Phe 1498 TGA GAGCTCCCTG GOGAATTOGG TACCAATAAA AGAGCTTTAT TTTCATGATC TGTGTGTTGG Xhol 1561 TTTTTGTGTG CGGCGCG ATAACTTCGTATAGCATACATTATACGAAGTTAT C TCGAGCCCTATAGTGAGTCGT 1634 ATTA Figure 9 Map of the loxP PGK gb2 neo loxP cassette Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 25 7 Troubleshooting Problems with the recombination reaction can be caused by a number of different factors Please review the information below to troubleshoot your experiments We highly recommend performing a positive control experiment using the components provided in the kit For homologous recombination the two DNA molecules must share two regions of perfect sequence ide
40. ssette are underlined These two oligos are not supplied with the kit but the resulting PCR product is supplied tube 3 Oligo 1 o IGATCAGAAGTCAGGCTGACAAAGACCCCTCAGCCGCCCCAGA TGTTAAGAA TTAACCCTCACTAAAGGGCG 3 Oligo 2 o CATGCATCCTGGCCCCAGGCTTTCCTGCTTGCCGCCATGATTTAGCCCTCTA ATACGACTCACTATAGGGCTC 3 Oligonucleotide Design for your target sequence I Choose 50 nucleotides N so directly adjacent upstream 5 to the intended insertion site Order an oligonucleotide with this sequence at the 5 end At the 3 end of this oligo include the PCR primer sequence for amplification of the loxP PGK gb2 neo loxP cassette given in italics below Upper oligonucleotide oligo 1 5 N so AATTAACCCTCACTAAAGGGCOG 3 Il Choose 50 nucleotides N so directly adjacent downstream 3 to the intended insertion site and transfer them into the reverse complement orientation Order an oligonucleotide with this sequence at the 5 end At the 3 end of this oligo include the 3 PCR primer sequence also in reverse complement orientation for the loxP PGK gb2 neo loxP cassette given in italics below Lower oligonucleotide oligo 2 5 N so TAATACGACTCACTATAGGGCTGC 3 If desired include restriction sites or other short sequences in the ordered oligo s between the 5 homology regions and the 3 PCR primer sequences Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 1 1 5 Media for Antibiotic
41. the appropriate antibiotics for the plasmid e g ampicillin 100 ug ml for the control Puncture a hole in the lid for air Incubate at 37 C overnight with shaking Day 2 Before starting e Chill ddH2O or 10 glycerol on ice for at least 2 h e Chill electroporation cuvettes 1 mm gap e Cool benchtop centrifuge to 2 C 2 Set up a microfuge tube containing fresh 1 4 ml LB medium conditioned with the same antibiotics as in step 1 and inoculate with 30 ul of fresh overnight culture Culture for 2 3 h at 37 C shaking at 1000 rpm Prepare the cells for electroporation Centrifuge for 30 sec at 11 000 rpm in a cooled microfuge benchtop centrifuge at 2 C Discard the supernatant by quickly tipping out the supernatant twice and place the pellet on ice Resuspend the pellet with 1 ml chilled ddH2O or 10 glycerol pipetting up and down three times to mix the suspension Repeat the centrifugation and resuspend the cells again Centrifuge and tip out the supernatant once more 20 to 30 ul will be left in the tube with the pellet Keep the tube on ice Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 21 22 Add 1 ul of the expression plasmid 706 Cre tube 5 to your cell pellet Mix briefly and keep the tube on ice Transfer the cell suspension from the tube to the chilled electroporation cuvette Electroporate at 1350 V 10 uF 600 Ohms This setting applies to an Eppendorf
42. the kanamycin neomycin selection marker by Cre expression 21 6 6 Verification of successfully modified plasmid by restriction analysis 23 6 7 Maps and sequences eissssissesieses sese sanu sanus haa aA 3 RR BER R RN E RENE SERA R REA NR SE NR SR TR IRR a Ia Ra sd daa sana 2a 24 aUe SIO OU RE PP s 26 8 Hel renoes and Patents cone 29 8 1 aii m E 29 8 2 cil 31 9 Purchaser NOUUTICAMON War NVidia 32 10 Other products available from Gene Bridges eeceeeeeeeeeeeeese 33 11 DNA Engineering Services Available from Gene Bridges 38 Please read The products listed in this manual are for research purposes only They are not designed for diagnostic or therapeutic use in humans animals or plants Success depends on following the protocols exactly as they are described Do read the trouble shooting guide before beginning your experiments Red ET Recombination is the intellectual property of Gene Bridges GmbH Safety Some chemical reagents used with this system are dangerous if handled carelessly Take care when using chemical reagents such as isopropanol and ethidium bromide and electrical apparatus high voltage power supplies gel electrophoresis a
43. tive than DNA transformed in circular form Eppendorf Operation Manual Electroporator 2510 version 1 0 Make sure that the time constant is around 5 ms please make sure that there is no arching during the electroporation process please make sure that after electroporation the cells are plated on the appropriate concentration of antibiotics depending on the copy number of the plasmid or BAC Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 27 Similar number of colonies on both plates the induced and the uninduced one If you obtain a high number of colonies on both plates it indicates that there are still traces of the circular or supercoiled plasmid used for preparing the linear fragment left in the sample Since the transformation efficiency of linear fragments is 10 fold less than that of circular DNA molecules you may obtain a background even if no traces were visible on an agarose gel If the linear DNA fragment was obtained by restriction digestion use less DNA and gel purify the fragment If the linear cassette was obtained by PCR set up a Dpnl digest for your PCR product and gel purify it at the end If you obtain a very low number of colonies on both plates it indicates that the overall efficiency of Red ET Recombination is very low In this case please check all parameters mentioned in the section entitled no colonies after Red ET Recombination You cannot separate the rec
44. uots should not undergo more than three freeze thaw cycles 12 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 6 Technical protocol 6 1 Generation of a functional cassette flanked by homology arms PCR The oligonucleotides are suspended in ddH2O at a final concentration of 10 uM We present as an example a standard PCR protocol for the use of Phusion DNA Polymerase Finnzyme However any other DNA Polymerase together with the corresponding PCR protocol according to the instructions of the manufacturer should yield satisfactory results PCR reaction in 50 ul 34 5 ul 10 0 ul 2 0 pl 1 0 pl 1 0 pl 1 0 pl 0 5 ul dH2O 5 x HF PCR reaction buffer 5 mM dNTP Oligo 1 Oligo 2 loxP PGK gb2 neo loxP PCR template tube 2 Phusion polymerase 5 U ul e An annealing temperature of 57 62 C is optimal e PCR Profile Initial denaturation step 30 sec 98 C thirty cycles 10 sec 98 C 30 sec 55 C 90 sec 72 C final elongation step 10 min 72 C e Check a 5 ul aliquot of the PCR product on a gel to ensure the PCR was successful The size of the PCR product for the loxP PGK gb2 neo loxP cassette is 1737 bp e Purify the PCR product either by running the whole PCR sample on an agarose gel and subsequent gel extraction or directly by Spin Column Purification e g Min Elute Gel Extraction Kit or Qiagen Adjust the DNA concentration to 100 ng ul Gene Bridges Qu
45. us recombination between a linear DNA molecule e g a PCR product and circular DNA plasmid BAC or E coli chromosome This method was used to disrupt the endogenous acZ gene of E coli strain JC9604 Zhang et al 1998 One year later the system was extended by the same group in replacing recE and recT by their respective functional counterparts of phage lambda reda and red Muyrers et al 1999 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 3 The recombination process is strictly controlled since the necessary genes are located on an expression plasmid which carries a temperature sensitive origin of replication and can therefore only be propagated at 30 C Increasing the temperature to 37 C for a period of time results in a loss of the expression plasmid after recombination In addition the expression of the proteins is tightly controlled by an inducible promoter opening just a short time window for the recombination process The Quick and Easy Conditional Knockout Kits from Gene Bridges comprising a FRT FLPe and a loxP Cre Kit are specifically designed to integrate FRT or loxP sites in large vector plasmids at any intended position without the need to use restriction enzymes within 2 weeks Conditional targeting constructs can be generated either by a repetitive insertion of the functional cassette supplied with the kit FRT PGK gb2 neo FRT or loxP PGK gb2 neo loxP or by insertion of any other
46. xP Cre Version 1 3 May 2014 Additional functional cassettes e A001 Pro and Eukaryotic Neomycin Selection Cassette PGK gb2 neo e A002 FRT flanked Pro and Eukaryotic Neomycin Selection Cassette FRT PGK gb2 neo FRT e A003 loxP flanked Pro and Eukaryotic Neomycin Selection Cassette loxP PGK gb2 neo loxP e A004 FRI flanked Pro and Eukaryotic Neomycin Selection Cassette plus loxP site FRT PGK gb2 neo FRT loxP e A005 FRT flanked Pro and Eukaryotic Neomycin Selection Cassette plus loxP site 2 version loxP FRT PGK gb2 neo FRT e A006 FRT flanked Chloramphenicol Selection Cassette FRT cm FRT e A007 loxP flanked Chloramphenicol Selection Cassette loxP cm loxP e A008 FRT flanked Ampicillin Selection Cassette FRT amp FRT e A009 loxP flanked Ampicillin Selection Cassette loxP amp loxP e AQ10 FRI flanked Pro and Eukaryotic Hygromycin Selection Cassette FRT PGK gb2 hygro FRT e A011 loxP flanked Pro and Eukaryotic Hygromycin Selection Cassette loxP PGK gb2 hygro loxP Additional strains and plasmids e A104 Enhanced FLP Expression Plasmid 707 FLPe with tetracycline resistance marker for use in E coli only e A105 Enhanced FLP Expression Plasmid 708 FLPe with chloramphenicol resistance marker for use in E coli only e A112 Cre Expression Plasmid 705 Cre cm resistance marker e A113 Cre Expression Plasmid 706 Cre tet resistance marker e A201 Enhanced Eukaryotic FLP Expression Plasmid
47. y limits Gene Bridges GmbH s liability only to the cost of the product 32 Gene Bridges Quick and Easy Conditional Knockout Kit loxP Cre Version 1 3 May 2014 10 Other products available from Gene Bridges General information e Kits are available for non commercial research organizations Commercial companies or for profit organizations require a sub license to use Red ET Recombination The complete product list as well as all information about how to order kits in your country is given on our website www genebridges com K001 Quick and Easy BAC Modification Kit Description Contents This kit is designed to modify any type of bacterial artificial chromosomes BACs within 1 2 weeks by using a kanamycin neomycin cassette This kit is optimized for basic modifications such as insertions or deletions of fragments in any type of bacterial artificial chromosomes BACs leaving a selectable marker gene This kit can also be used to work on bacterial chromosomes and common ColE1 origin plasmids High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET after recombination Red ET Recombination protein expression plasmid pRedET Any E coli strain can be made Red ET proficient by transformation with this plasmid BAC host E coli strain HS996 already carrying the Red ET plasmid Tn5 neomycin resistance template to be used for your own experiments Positive controls to int
Download Pdf Manuals
Related Search