SOLiD™ SAGE Software Guide
Contents
1. ACTGGTG gt gi 169212695 ref XM 001716884 1 PREDICTED Homo sapiens hypothetical protein LOC100132679 LOC100132679 mRNA ATGTGTGTATATATATATACACATATATATG bases follow ATGGATGTAT Comparison input file Same as standard output file see next page with a file name of the format solidsageread csfasta taglength mismatch output tab sample file solidsageSampleRead csfasta 27 0 output tab SOLID SAGE Analysis Software v1 10 Guide 15 Output File Names Mapping Output File Format Output file File name format solidsageread csfasta taglength mismatch output tab sample file solidsageSampleRead csfasta 27 0 output tab Results file File name format solidsageread csfasta taglength mismatch results tab sample file solidsageSampleRead csfasta 27 0 results tab Comparison file File name comparison tab Tag Count GI Description CATGAAAAAACTCCAAATAAGAGAATC 1 GI33413399 gi 33413399 ref NM 001984 1 Homo sapiens esterase D formylglutathione hydrolase ESD mRNA CATGAAAGGGTCACTTCTGTAATAGTG 1 GI81158221 GI81158223 GI81158225 gt gi 81158221 ref NM 001037133 1 Homo sapiens neuronal cell adhesion molecule NRCAM transcript variant 3 mRNA gi 81158223 ref NM_005010 3 Homo sapiens neuronal cell adhesion molecule NRCAM transcript variant 2 mRNA gi 81158225 ref NM_001037132 1 Homo sapiens neuronal cell adhesion molecule NRCAM transcript variant 1 mRNA2. applied Biosystems vy Life technologies Applied Biosystems SOLID 4 System SOLID SAGE Analysis Software v1 10 Guide TemplatedBead Instrument Preparation d Operation P For Research Use Only Not intended for any animal or human therapeutic or diagnostic use This user guide is the proprietary material of Applied Biosystems LLC or its affiliates and is protected by laws of copyright The customer of the SOLID System is hereby granted limited non exclusive rights to use this user guide solely for the purpose of operating the SOLID System Unauthorized copying renting modifying or creating derivatives of this user guide is prohibited Information in this document is subject to change without notice APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT EXPRESSED OR IMPLIED INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE OR NON INFRINGEMENT OF INTELLECTUAL PROPERTY TO THE FULLEST EXTENT ALLOWED BY LAW IN NO EVENT SHALL APPLIED BIOSYSTEMS BE LIABLE WHETHER IN CONTRACT TORT WARRANTY OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL INCIDENTAL INDIRECT PUNITIVE MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT INCLUDING BUT NOT LIMITED TO THE USE THEREOF WHETHER OR NOT FORESEEABLE AND WHETHER OR NOT APPLIED BIOSYSTEMS IS ADVISED OF THE POSSIBILITY OF SUCH DAMAGES TRADEMARKS The trademarks
3. appropriate license from the third party vendor for use of such products NOTWITHSTANDING ANYTHING TO THE CONTRARY IN THIS AGREEMENT ALL THIRD PARTY SOFTWARE DATABASES AND OTHER PROGRAMS AND SOFTWARE COMPONENTS ARE PROVIDED AS IS WITHOUT ANY WARRANTY WHATSOEVER FROM LICENSOR ANY DATABASES OR OTHER INFORMATION PROVIDED BY LICENSOR ARE DESIGNED TO SUPPLEMENT OTHER SOURCES OF INFORMATION ARE NOT INTENDED TO REPLACE YOUR PROFESSIONAL DISCRETION AND JUDGMENT AND LICENSOR MAKES NO REPRESENTATIONS OR WARRANTIES REGARDING SUCH DATABASES OR INFORMATION THEIR ACCURACY COMPLETENESS OR OTHERWISE Licensor agrees upon request and as Licensor s sole liability and obligation to have passed through to you to the extent it may reasonably do so any warranties and indemnifications provided by the applicable third party vendor of any third party products provided to you To the extent any problem or liability arises from a third party product you agree to seek recourse solely from the applicable third party vendor and not Licensor 10 INDEMNIFICATION BY YOU You agree to indemnify and defend Licensor its licensors and its affiliates against any third party claims arising from or related to your use or misuse of the Software or any breach of the terms and conditions of this Agreement and you agree to pay all costs losses damages and attorneys fees that a court finally awards and all associated settlements 11 LIMITATION OF LIABILITY EXCEPT TO THE
4. reads are used in mapping output files are in tab delimited text format The output files for the individual barcoded libraries in a multiplex SOLiD sequencing run are stored in subdirectories of the main project directory The output files are e Amapping output file that lists each tag its frequency of occurrence its GenBank Identifier GI number and a description of the identified gene e A mapping results file that provides more detailed information including SOLiD sequencing read IDs and mismatches e A file comparing the tags in two different samples e A file calculating the abundances of repeat reads To transfer the files to a Windows based computer for analysis e g by Microsoft Excel you can use WinSCP or equivalent SOLID SAGE Analysis Software v1 10 Guide Download and Installation System Requirements Downloading and Installing SOLID SAGE Software applied biosystems SOLID SAGE Analysis Software Summary Reporting Search Farums Docs and Data Files s SOLIDSage Completing the Installation Downloading Sample Data SOLiD SAGE Analysis Software v1 10 has the following system requirements Linux operating system Perl Tk Reference sequences in NCBI fasta format e g RefSeq files gt 8 gigabytes of memory varies depending on the size of the reference genome selected tag length and selected number of allowed mismatches To download the software
5. 11111011111011111111111111111 13111111111011111111111111111 10000000000000000000000000000 11111011111111111111111111111 13111111011011111111111111111 150 140 138 73 37 49 36 SOLID SAGE Analysis Software v1 10 Guide Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQS formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com SOLID SAGE Analysis Software v1 10 Guide End User License Agreement This is a legal agreement between you the person or entity receiving software products and Life Technologie
6. CATGAACAACCGGCTGGCCGAGACCAG 1 GI11545760 gt gi 11545760 ref NM 022055 1 Homo sapiens potassium channel subfamily K member 12 KCNK12 mRNA CATGAACTTGATACGTCCGTGTGTCCC 1 GI53759150 gi 53759150 ref NM 005063 4 Homo sapiens stearoyl CoA desaturase delta 9 desaturase SCD mRNA CATGAAGATGATATGAGGCCGGGGCGG 1 GI52145308 gt gi 52145308 ref NM 032808 5 Homo sapiens leucine rich repeat and Ig domain containing 1 LINGO1 mRNA CATGAAGGAAGATCCCACAGTCTCAGC 1 GIA758483 gi 4758483 ref NM 004832 1 Homo sapiens glutathione S transferase omega 1 GSTO1 mRNA CATGACAGCCCTCTGCTCTIGAGTACC 1 CG139812204 gi 39812204 ref NM 025164 3 Homo sapiens KIAA0999 protein KIAA0999 mRNA CATGACGGAACAATAGGACTCCCCAGG 2 CGI38505192 gi 38505192 ref NM 000954 5 Homo sapiens prostaglandin D2 synthase 21kDa brain PIGDS mRNA CATGACGTGTCTATGTCAAAAGTTCTT 1 GI115583669 gt gi 115583669 ref NM 003253 2 Homo sapiens T cell lymphoma invasion and metastasis 1 TIAM1 mRNA SOLID SAGE Analysis Software v1 10 Guide Mapping Results Tag Seq GI num GI Pos Read ID Mismatch File Format CATGTGCAAATAAATGTGGCTTAGACT 133908618 3298 2665 1155 42 P30 CATGGTAATAAAATATGAATGATAAAA 189083841 2125 665 817 382 F30 CATGGTAATAAAATATGAATGATAAAA 189083835 2280 665 817 382 F30 CATGGTAATAAAATATGAATGATAAAA 189083837 2146 665 817 382 F30 CATGGTAATAAAATATGAATGATAAAA 189083839 2128 665 817 382
7. F30 CATGGTAATAAAATATGAATGATAAAA 51593094 2283 665 817 382 F30 CATGGTAATAAAATATGAATGATAAAA 132814488 2268 665 817 382 F30 CATGTGATGGGCATTGAGCCACACCTC 34147410 1140 2665 1807 1132 F3 0 CATGAGGAGCTCGGCTTAAAATGTCTT 40254847 2324 2665 1994 720 F3 0 Comparison File Tag Sequence Filel File2 Format CATGAAGACAGTGGCTGGCGGTGCCTG 4715 5430 Based on non truncated tag gi 78214519 ref NM 000998 4 Homo sapiens ribosomal protein L37a RPL37A mRNA CATGCACAAACGGTAGTTTTGTGTGTT 2361 2604 Based on non truncated tag gi 169202035 ref XM 001726056 1 PREDICTED Homo sapiens similar to hCG2027326 LOC100129905 mRNA gt gi 169203086 ref XM_001725509 1 PREDICTED Homo sapiens similar to hCG2027326 LOC100129905 mRNA gi 169203606 ref XM 001726007 1 PREDICTED Homo sapiens similar to hCG2027326 LOC100129905 mRNA gi 68160923 ref NM 001030 3 Homo sapiens ribosomal protein 527 metallopanstimulin 1 RPS27 mRNA CATGACAACAAAGAAAAAGACCTTGTA 1736 1606 Based on non truncated tag gi 56550064 ref NM 001008220 1 Homo sapiens complexin 2 CPLX2 transcript variant 2 mRNA gt gi 56550103 ref 006650 3 Homo sapiens complexin 2 CPLX2 transcript variant 1 mRNA CATGAATATGTGGGCTAAGAAATAGTT 1659 1980 Based on non truncated tag gi 17999531 ref NM 004374 2 Homo sapiens cytochrome c oxidase subunit VIc COX6C mRNA SOLID SAGE Analysis Software v1 10 Guide
8. NL Directory mnt disk annex Tony projec ts solid sage barco de v 110 H sapiens mRNA 2ref include EcoP1 5 P2 in virtual refe rence samples schema screen shots sapiens mRNA a em E Next Steps With the project name and location created you can now proceed to Sequence Files and starting on the next page Comparing Two Mapped Samples page 11 Generating Repeat Reads Statistics page Error Bookmark not defined SOLID SAGE Analysis Software v1 10 Guide Mapping Sequence Files Sequence Files from the SOLID System parameters Sequences files generated by the SOLiD System are in the color space fasta format csfasta SOLID SAGE Analysis Software v1 10 can analyze a single csfasta results file or multiple files e g from different barcoded libraries in a single run This section describes mapping sequence files using a single set of mapping Dos Note All csfasta files to be analyzed must be located in the same directory Besides read definition lines beginning with a gt sign and the actual read sequence beginning with T followed by the digit 0 1 2 3 there may be some commenting lines which begin with a sign at the beginning of the file The first read definition line should appear within the first 100 lines of the input reads If it appears later than 100 lines you will need to trim the preceding comment lines Mapping a S
9. go to http solidsoftwaretools com ef project solid sage 2 Clickon the Files link in the left navigation bar and then select the scripts tgz file e g solid sage v110 scripts tgz to begin the software download Logged in swarrick Log out Home My Stuff Search Snippets Home Projects SOLID SAGE Analysis Software Files Browse Releases FileSize Downloads Package Name Latest Release Maturity zalid sa 114 4 Bat a amp OLiDSage solid sage Beta 10 18 OFORGE Advanced Server 1 Extract the downloaded tgz file into the directory where you want to install the software 2 Open bash profile in your home directory with a text editor program 3 Add the following line substituting the actual directory name from Step 1 PATH PATH solid_sage_directory 4 Add the line export PATH Save bash_profile and exit the text editor 6 Logout and re login 1 To download sample data go to http solidsoftwaretools com gf project solid sage 2 Click on the Docs and Data link in the left navigation bar and then select Sample Data 3 Select the samples tgz file e g solid sage v110 samples tgz to begin the data file download 4 The tgz file contains sample data for each mapping and comparison option and results are provided in a corresponding directory An example Description File for mapping multiple sequence files with different parameters is provided as w
10. mentioned herein are the property of Life Technologies Corporation or their respective owners Windows and Excel are registered trademarks of Microsoft Corporation Copyright 2010 Life Technologies Corporation All rights reserved Part no MAN0001685 Rev date 29 June 2010 Table of Contents Descriptuonof the D To oom 4 Dowtntoad anghsteliatiODims iei D Using the Sonwane seniorren 6 Getting pertinuit M 6 Mapping oeguence 7 Mapping Multiple Sequence Files with Different Parameters cccccccccsssseeeeeeeeseseeseaaeeeeeeeeaaeees 11 Comparing wo Mappedi5alipl8sS curie vatur n tit i Qi pt et SE EP d et hex E Dex Expense 12 Resetting dE xig uie Progra bebta Fegrkt fav rtv m bobo omens 13 PUD DIST cm eee 14 Freguently Asked QUESHIONS uestras teintes a a Eaa i Eai 14 Examples OF Fites and Formats attire isicn irrien ena eor eli Ua esta DU ps aute serial ke EE EA A EA 15 Tecnrucab a e a 19 End User License Agreement 3 2 x deat a E RE 20 SOLID SAGE Analysis Software v1 10 Guide Description of the Software Overview How Tags are Processed Output Files SOLiD SAGE Analysis Software v1 10 is a Linux based program tha
11. on the pulldown arrow to change each selection then click on OK Set mapping parameters defaults are displaye Basic mapping para meters Select mapping tag length Select mapping mismatches Advanced mapping parameters see user manual for c Select virtual reference tag length Select restrictive enzyme digestion site Mapping tag length 2 The number of bases after the restriction enzyme site CATG in each tag used for mapping Mapping mismatches 1 The number of base mismatches allowed during mapping Empirical data have shown that 1 mismatch provides the optimal balance of mapping accuracy and robustness Increasing the number of mismatches 2 allowed will decrease accuracy and increase processing time 2 Virtual reference tag length 8 The length of each reference sequence following a restriction anchor site that is analyzed for mapping purposes 10 Number of million reads The number of tags in millions processed at one time processed per round by the software If this number is less than the total number of tags in a run the software will process the tags in multiple rounds of processing and then combine the data into a single result This enables slower computers to process large numbers of tags without crashing but also increases processing time Restriction enzyme digestion CATG Nla III The default restriction enzyme used by the SOLiD site SAGE System is Nla III Alternative work
12. to select the files to compare These will be Output files from previous mapping runs output tab format see page 10 Do not compare results files 3 The software will find common tags between the libraries and identify the corresponding tag counts and genes When the comparison is complete you will receive an alert M Note If the lengths of the tags in the two libraries are different all tags will be truncated to the shortest length before comparison Note that the gene description may not match the truncated tags as well as the non truncated ones Be careful when comparing libraries with different tag lengths X SOLID SAGE version 1 1 0 v Your project been created Now click Map or Compare button mnt disk annex Tony projects solid sage barcode v110 Testone has Same tag length 0 Are the length of the mapped tags in the files to be compared the same Comparison File The Comparison file generated by the analysis comparison tab lists each tag its frequency of occurrence in each sample and its GenBank identification B C Tag Sequence CATGAAGACAGTGGCTGGCGGTGCCTG CATGCACAAACGGTAGTTTTGTGTGTT CATGACAACAAAGAAAAAGACCTTGTA CATGAATATGTGGGCTAAGAAATAGTT CATGAAGCTGAGGTCTTGAAGCAGCTG CATGAACTAATACTACAATAAAGGATG CATGATCGCTTTCTACACTGTATTACA 12 4715 2361 1736 1659 1558 1533 1442 5430 Based on non truncated tag gi 78214519 ref NM 000998 4 H
13. 17 Repeat Reads File Format 18 Total reads for SOLID SAGE SampleRead csfasta Total unique reads for SOLiD SAGE SampleRead csfasta 49999 46630 Top 100 abundant reads for SOLID SAGE SampleRead csfasta 1T11111111111111111111111111111111 1 T1T11111111110111111111111111111111 1 T11110111110111111111111111111111 1 131111111110111111111111111111111 1 T1T11110111111111111111111111111111 1 100000000000000000000000000000010 0 148 135 127 70 46 39 Total unique reads for SOLID SAGE SampleRead csfasta at tag 26 48102 Top 100 abundant reads for SOLID SAGE SampleRead csfasta at tag 26 111110111110111111111111111 111111111110111111111111111 111111111111111111111111111 131111111110111111111111111 100000000000000000000000000 131111110110111111111111111 111110111111111111111111111 172 157 156 90 57 55 55 Total unique reads for SOLID SAGE SampleRead csfasta at tag 27 48363 Top 100 abundant reads for SOLiD SAGE SampleRead csfasta at tag 27 1111111111111111111111111111 1111111111101111111111111111 1111101111101111111111111111 1311111111101111111111111111 1000000000000000000000000000 1111101111111111111111111111 1111101110101111111111111111 1311111101101111111111111111 150 140 139 73 57 50 37 36 Total unique reads for SOLiD SAGE SampleRead csfasta at tag 28 48412 Top 100 abundant reads for SOLID SAGE SampleRead csfasta at tag 28 11111111111111111111111111111 11111111111011111111111111111
14. CATGGTAATAAAATATGAATGATAAAA 189083835 2280 gt 665_817_382_F3 0 _5 CATGGTAATAAAATATGAATGATAAAA 189083837 2146 gt 665_817_382_F3 0 _6 CATGGTAATAAAATATGAATGATAAAA 189083839 2128 gt 665_817_382_F3 0 _T CATGGTAATAAAATATGAATGATAAAA 51593094 2283 665 817 382 F3 0 8 CATGGTAATAAAATATGAATGATAAAA 132814488 2268 665 817 382 F3 0 9 CATGTGATGGGCATTGAGCCACACCTC 34147410 1140 3665 1807 1132 F3 0 109 CATGAGGAGCTCGGCTTAAAATGTCTT 40254847 2324 665 1994 720 F3 0 44 IC ATCAACATCATATCACCCCCClCCCeCe E20144r2n9 1200 fE2 Q AAT F n Transferring Files To transfer the output files to a Windows based computer for analysis using a spreadsheet program such as Microsoft Excel you can use WinSCP or equivalent 10 SOLID SAGE Analysis Software v1 10 Guide Mapping Multiple Sequence Files with Different Parameters Description File You can map multiple sequence files in csfasta format with different mapping parameters using a Description File that contains all the details about each sequence file the parameters to apply and the reference directories to use An example Description File is available as part of the sample data download See Downloading Sample Data on page 5 The example Description File is shown below The comment lines at the top describe the different elements and an example format is shown in the circled area with a single space between each element sample barcode mapping description txt Notepad n x File Edi
15. EXTENT PROHIBITED BY APPLICABLE LAW IN NO EVENT WILL LICENSOR S OR ITS AFFILIATES TOTAL AGGREGATE LIABILITY ARISING FROM OR RELATED TO THIS AGREEMENT OR THE SOFTWARE INCLUDING FOR NEGLIGENCE STRICT LIABILITY BREACH OF CONTRACT MISREPRESENTATION AND OTHER CONTRACT OR TORT CLAIMS EXCEED THE AMOUNT OF YOUR DIRECT DAMAGES ACTUALLY INCURRED UP TO THE AMOUNT OF FEES PAID TO LICENSOR UNDER THIS AGREEMENT FOR THE SOFTWARE PRODUCT THAT IS THE SUBJECT OF THE CLAIM UNDERLYING THE DAMAGES Some jurisdictions do not allow the exclusion or limitation of liability for certain damages so the above limitation may not apply to you to the extent prohibited by such local laws if so then Licensor s liability for damages hereunder shall not exceed an amount equal to the amounts paid by you hereunder or one hundred dollars 100 00 whichever is less 12 EXCLUSION OF DAMAGES EXCEPT TO THE EXTENT PROHIBITED BY APPLICABLE LAW UNDER NO CIRCUMSTANCES SHALL LICENSOR ITS AFFILIATES OR ANY OF THEIR SUPPLIERS OR LICENSORS BE LIABLE HEREUNDER FOR ANY OF THE FOLLOWING I THIRD PARTY CLAIMS II LOSS OR DAMAGE TO ANY SYSTEMS RECORDS OR DATA AND OR III INDIRECT INCIDENTAL SPECIAL CONSEQUENTIAL PUNITIVE RELIANCE OR COVER DAMAGES INCLUDING WITHOUT LIMITATION FOR LOST PROFITS LOST SAVINGS AND DAMAGE TO ANY DATA OR SYSTEMS EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGES AND EVEN IF A LIMITED REMEDY SET FORTH HEREIN FAILS OF ITS ESSENTIAL PURPOSE YOU ARE SO
16. LE NON INFRINGEMENT OR NON MISAPPROPRIATION OF INTELLECTUAL PROPERTY RIGHTS OF A THIRD PARTY CUSTOM TRADE QUIET ENJOYMENT ACCURACY OF INFORMATIONAL CONTENT OR SYSTEM INTEGRATION NO WARRANTY IS MADE THAT ANY SOFTWARE WILL OPERATE IN AN ERROR FREE UNINTERRUPTED OR COMPLETELY SECURE MANNER OR IN COMBINATION WITH THIRD PARTY HARDWARE OR SOFTWARE PRODUCTS YOU ACKNOWLEDGE THAT LICENSOR HAS NO CONTROL OVER THE SPECIFIC CONDITIONS UNDER WHICH YOU USE THE SOFTWARE ACCORDINGLY EXCEPT FOR THE FOREGOING EXPRESS WARRANTY LICENSOR CANNOT AND DOES NOT WARRANT THE PERFORMANCE OF THE SOFTWARE OR ANY PARTICULAR RESULTS THAT MAY BE OBTAINED BY THE USE OF THE SOFTWARE THE SOFTWARE DOES NOT REPLACE YOUR OBLIGATION TO EXERCISE YOUR INDEPENDENT JUDGMENT IN USING THE SOFTWARE The warranty made by Licensor may be voided by abuse or misuse Licensor has no obligation to provide any support error corrections updates or any other services related to the Software 9 THIRD PARTY SOFTWARE AND DATABASES You understand that third party products integrated into the Software or provided for use with the Software may be subject to additional terms and conditions and or license agreements from the applicable third party vendor which shall govern over conflicting terms of this Agreement for purposes of your relationship with the third party vendor You agree not to use any such third party product on a stand alone basis independent of the Software unless you have purchased the
17. LELY RESPONSIBLE AND LIABLE FOR VERIFYING THE ACCURACY AND ADEQUACY OF ANY OUTPUT FROM THE SOFIWARE AND FOR ANY RELIANCE THEREON THE FEE FOR THE SOFTWARE THE REMEDIES SET FORTH IN THIS AGREEMENT THE LIMITS ON LIABILITY SET FORTH IN PARAGRAPHS 11 AND 12 AND THE OTHER PROVISIONS IN THIS AGREEMENT REFLECT THE ALLOCATION OF RISKS BETWEEN THE PARTIES THIS PARAGRAPH IS AN ESSENTIAL ELEMENT OF THE BASIS OF THE BARGAIN BETWEEN THE PARTIES 13 VERIFICATION Licensor shall have the right to have on site audits periodically conducted of your use of the Software These audits will generally be conducted during regular business hours and Licensor will use its reasonable efforts not to interfere unduly with your regular business activities Licensor may also require you to accurately complete a self audit questionnaire in a form Licensor may have SOLID SAGE Analysis Software v1 10 Guide 21 provided If an audit reveals unauthorized use you must promptly order sufficient licenses to permit all usage disclosed If material unlicensed use is found you also shall reimburse Licensor for all costs incurred in connection with the verification including without limitation reasonable attorneys fees 14 LEGAL COMPLIANCE RESTRICTED RIGHTS Software is provided solely for lawful purposes and use You shall be solely responsible for and agree to comply with all applicable laws statutes ordinances and other governmental authority however designated Without
18. an as expressly set forth herein and your receipt of a license to the Software does not by itself convey or imply the right to use the Software in combination with any other product s You agree and acknowledge that you have been provided sufficient information such that you do not need to reverse engineer the Software in any way to permit other products to interoperate with the Software 5 NO SEPARATION OF COMPONENTS The Software is licensed as a single product Some Licensor software products combine separately available components into a single product e g a software suite product may be comprised of multiple component products When licensed as a combination product the component parts may not be separated for use independently of the combination product You must first purchase a license to each component of the combination product before you may use it independently of the combination product 6 TERM AND TERMINATION Unless otherwise agreed the term of this Agreement shall continue until it is terminated Licensor may terminate this Agreement or any License upon 15 days written notice if you breach this Agreement and do not cure the breach within 15 days following receipt of written notice of breach Immediately upon any termination or expiration of this Agreement you agree to a pay all amounts owed to Licensor b un install and cease use of the Software for which your rights have been terminated c upon request return to Licensor
19. andom 1M csfasta 27 0 mnt disk annex Tony database RefSeq H sapiens mRNA mRNA 28 1000000 CATG edgFolder BCO05 random 1M csfasta 27 0 mnt disk annex Tony database RefSeg H sapiens mRNA mRNA 28 1000000 GAT Creating and 1 Create the Description File using the example provided with the software and Selecting the shown above Description File 2 Launch the program and create a project then click on the Map button 3 Select Mapping multiple sequencing files using different mapping parameters 4 Click on OK The Open mapping description file dialog will open 5 Select the Description File you created and click on Open 6 Thesoftware will proceed to mapping as described in Running the Analysis X SOLID SAGE version 1 10 vs x NS i x Mappinga single sequencing file Mapping multiple sequencing files using ihe same mapping parameters apping multiple sequencing files using different mapping parameters imm 2 _ foc pe mrt disk annex Tony pr zojects solid sage barcoce vll Testone has been reated How click Hap or Compars button SOLID SAGE Analysis Software v1 10 Guide 11 Comparing Two Mapped Samples Introduction You can compare two previously mapped libraries as described in this section Selecting the 1 Launch the program and create a project as described in Getting Started Sequencing Reads 2 Click on the Compare button in the program screen and follow the on screen to Compare steps
20. eference Type 2 For messenger RNA Map to sense strand only mRNA i e the provided sequence x Map to antisense strand only aRNA ie the reverse complementary of provided sequence For genomic DNA x Map to both strands gDNA i e the provided and its reverse complementary sequences The program generates a virtual reference sequence that is much shorter than the actual reference sequence so that the analysis will run faster The virtual reference sequence consists of fragments of a pre set length either the default 28 base pairs that follow the Nia III anchor site CATG or a user selected tag length as selected under Select mapping parameters For mRNA or aRNA mapping only the anchor site CATG and the following bases on the sense or antisense strand will be used as the virtual reference If genomic DNA mapping CATG and the following bases on both strands the provided sequence and its reverse complementary sequence will be used as the virtual reference SOLID SAGE Analysis Software v1 10 Guide 7 Running the After you select the reference type and click on OK you will be prompted to proceed to mapping Click on Yes After a short processing delay a progress bar will appear Analysis i i at the bottom of the main software window The length of time required for mapping will vary depending on the size of the reference database the selected tag length and the number of mismatches allowed Complex ana
21. ell see page 11 SOLID SAGE Analysis Software v1 10 Guide 5 Using the Software Getting Started Launching the To launch the software type solid sage v110 pl The software should be in your Program working path so you can launch it from anywhere If you have a problem launching the software try entering the full path of the directory where you extracted the package followed by the program name Example launch commands solid sage v110 pl solid sage v110 pl amp solid sage directory solid sage v110 pl The program screen will open Creating a Project 1 To begin enter a project name in the top left field using only alphanumeric characters with no spaces 2 Next click on Choose where to create your project to specify the file path to the project directory A directory with the project name you entered will be created containing temporary analysis files and final output files Make sure a directory with that project name does not already exist in that location Note You must have write permission to the location of the project directory 3 When you have made your selection the full path will be displayed in the top left box and the Map and Compare buttons will become available SOLID SAGE version1 1 0 a nter_project_name_here Choose where to create your project Lowe _ compare w i i First step type your project name into the field above llo Project directory A
22. files themselves only the directory The 2 software will use every fasta file in that directory for its analysis See Reference File Format below Select directory containing the reference sequences 4 3 Directory imnt disk anne x Tony projects solid sage barcode v 1710 28bp tags of human Refseq mRNA dir 3 csfa bin fasdfads command line v1 10 H sapiens mRNA dddd H sapiens mRNA 2ref dir 1 csfa include EcoP15 P2 in virtual reference dir 2 csfa C package Nio gt mamme Sm Cancel In general the reference files should have the same format as the fasta files from an NCBI RefSeq database You can simply download the appropriate gDNA mRNA database from NCBI RefSeq and use it as your reference The reference files must be in the fasta format fasta The definition lines of the reference sequences should have an NCBI RefSeq sequence format or have the following structure gi xxx ref yyy where xxx is the GI number and yyy is the gene name There is no length restriction on the GI number or gene name The fasta file can have multiple sequences but each definition line should follow the structure defined above No comment lines are allowed After selecting the reference library choose whether to map tags to the sense strand for mRNA antisense strand for aRNA or both strands for genomic DNA Choose R
23. flows may use a different restriction enzyme Selecting the After you select the mapping parameters you will be prompted to select either a single Sequencing File s csfasta file or the directory containing multiple files depending on your selection in the Mapping option dialog box Multiple files must be located in the same directory and all the files in that directory will be analyzed Choose sequencing file x Select directory containing sequencing csfastafiles Directory H_sapiens_mRNA 2ref c outpu 28bp tags of human Refseq mRNA dir 3 csfa include EcoP15 P2 in virtual reference myread bin fasdfads samples myread command line v110 H sapiens mRNA schema dddd H sapiens mRNA 2ref C screen shots dir 1 csfa include EcoP15 P2 in virtual reference sapiens mRNA TestOne dir 2 csfa C package LSE AMEN ur Ree de mme ew Files of type Fasta Files csfa csfasta Cancel m Cancel 8 SOLID SAGE Analysis Software v1 10 Guide Selecting the Reference Directory Reference File Format Selecting the Reference Type Note on Virtual Reference Sequences After you have selected a sequence file or directory and specified the mapping parameters you will be prompted to select the directory containing the reference sequences Note You do not select the reference
24. ingle Click on the Map button File or Multiple 2 Select either Mapping a single sequencing file or Mapping multiple Files with the Same sequencing files using the same parameters Parameters 3 Click on OK The Set mapping parameters dialog will open M SOLID SAGE version 1 1 0 wo A x TOLE E SnuLfdieh auen Tony poo jecle feel 111 saye baru v1l1LoyTesloue las Been 2rcat 2d Ww lick Map nr mi tem Selecting Mapping Parameters Set mapping parameters defaults are displaye Basic mapping parameters Select mapping tag length Select mapping mismatches Advanced mapping parameters see user manual for details Select virtual reterence tag length Select number of million reads processed per round fio 3 Select restrictive enzyma digestion site SOLID SAGE Analysis Software v1 10 Guide Mapping option apping a single sequencing file apping multiple sequencing files uing th same mapping parameters x Mapping multiple sequencing files using different mapping parameters Basic mapping parameters Select mapping tac length 2 2 3 Advanced mapping parameters see user manual for details Select virtual reference tag length 2 B Select number of million reads processed per round 1U Select mapping mismatches Select restrictive enzyme digestion site In the Set mapping parameters dialog the default parameters are preselected Click
25. ion molecule NRCAM transcript variant 3 mRNA gi 81158223 ref NM 005010 31 Homo sapiens neuronal cell adhesion molecule NRCAM transcript variant 2 mRNA gi 81158225 refl NM 001037132 1 Homo sapiens neuronal cell adhesion molecule NRCAM transcript variant 1 mRNA 3 CATGAACAACCGGCTGGCCGAGACCAG 1 6111545760 7gi 11545760 ref NM 022055 1 Homo sapiens potassium channel subfamily K 4 member 12 KCNK12 mRNA CATGAACTTGATACGTCCGTGTGTCCC 1 GI53759150 7gi 53759150 reflNM 005063 4 Homo sapiens stearoyl CoA desaturase delta 9 5 desaturase SCD mRNA CATGAAGATGATATGAGGCCGGGGCGG 1 GI52145308 7gi 52145308 reflNM 032808 5 Homo sapiens leucine rich repeat and lg domain 6 containing 1 LINGO1 mRNA CATGAAGGAAGATCCCACAGTCTCAGC 1 4758483 gi 4758483 reflNM 004832 1 Homo sapiens glutathione S transferase omega 1 T GSTO1 mRNA CATGACAGCCCTCTGCTCTTGAGTACC 1 GI39812204 9gi 39812204 refl NM 025164 3 Homo sapiens KIAA0999 protein KIAA0999 8 mRNA CATGACGGAACAATAGGACTCCCCAGG 2 0138505192 3213850518 2 000854 5 Homo sapiens prostaglandin D2 synthase 21kDa 9 brain PTGDS mRNA CATGACGTGTCTATGTCAAAAQGTTCTT 1 GI115583669 2nil1155836R98lreflNM 003253 2 Hamn saniens T cell lyvmnhama invasion and Results file example A 8B c D E 1 Tag Seq GI num GI Pos Read ID Mismatch EE CATGTGCAAATAAATGTGGCTTAGACT 133908618 3298 3665 1155 42 F3 ol _3 CATGGTAATAAAATATGAATGATAAAA 189083841 2125 gt 665_817_382_F3 0 _4
26. its you to use a non Licensor purchase order or other form to order Software Licensor does so solely for your convenience Any terms in any such forms that purport to vary or are in addition to or inconsistent with any terms in this Agreement shall be deemed to be void and of no effect Amendments or changes to this Agreement must be in mutually executed writings to be effective Paragraphs 4 and 6 through 16 inclusive shall survive the termination or expiration of this Agreement The parties are independent contractors for all purposes under this Agreement Neither party shall be liable for any delay or failure due to force majeure and other causes beyond its reasonable control provided that the foregoing shall not apply to any of your payment obligations Any notices under this Agreement to Licensor must be personally delivered or sent by certified or registered mail return receipt requested or by nationally recognized overnight express courier to the address specified herein or such other address as Licensor may specify in writing Such notices will be effective upon receipt which may be shown by confirmation of delivery All such notices shall be sent to the attention of General Counsel of Life Technologies Corporation unless otherwise specified by Licensor You may not assign or otherwise transfer this Agreement or any License without Licensor s prior written consent This Agreement shall be binding upon and inure to the benefit of the parties
27. limiting the foregoing this Agreement is expressly made subject to any United States government laws regulations orders or other restrictions regarding export from the United States and re export from other jurisdictions of equipment computer hardware software technical data and information or derivatives of such equipment hardware software or technical data and information You agree to comply with all applicable export and reexport control laws and regulations in regard to products including computer hardware software deliverables technical data source code or any other technology equipment and or derivatives of such hardware software deliverables technical data source code equipment or any other technology received from Licensor You further certify that you will not directly or indirectly without obtaining prior authorization from the competent government authorities as required by those laws and regulations 1 sell export reexport transfer divert or disclose technical data or dispose of any product or technology received from Licensor to any prohibited person entity or destination or 2 use the product or technology for any use prohibited by the laws or regulations of the United States You will reasonably cooperate with Licensor and will provide to Licensor promptly upon request any certificates or documents as are reasonably requested to obtain approvals consents licenses and or permits required for any payment or any exp
28. lyses may take several hours SOLID SAGE version 1 1 0 Mapping parameters Sequencing file gt Proceed mnt disk annex Tony projects solid sage barcode w110 myreadl1 csfa Tag length 22 Mismatches 0 Reference folder mnt disk annex Tony projects solid sage barcode v110 H sapiens A 2ref Reference type gDNA Virtual reference size 28 Read number per mapping round 1000000 Digestion site CATG Results will be stored in mnt disk annex Tony projects solid sage barcode w110 TestOne 1 Output and Results For each fasta file in the reference directory the SOLiD SAGE Analysis Software Files generates a corresponding subdirectory in the selected project directory In each subdirectory two files are generated by the mapping program A mapping Output file output tab that lists each tag its frequency of occurrence its associated GenBank Identifier GI number and a brief description of the identified gene A mapping Results file results tab that provides additional information including SOLID sequencing read IDs and mismatches Output file example 1 Tag Count GI Description CATGAAAAAACTCCAAATAAGAGAATC 1 GI33413399 7gi 33413399 ref l NM 001984 1 Homo sapiens esterase D formylglutathione 2 hydrolase ESD mRNA CATGAAAGGGTCACTTCTGTAATAGTG 1 Gl81158221 Gl81158223 Gl81158225 gi 81158221 reffI NM 001037133 1 Homo sapiens neuronal cell adhes
29. mation which you can demonstrate by credible evidence i is as of the time of its disclosure or thereafter becomes part of the public domain through no fault of yours ii was rightfully known to you prior to the time of its disclosure or to have been independently developed by you without use of Confidential Information and or iii is subsequently learned from a third party not under a confidentiality obligation with respect to such Confidential Information Confidential Information that is required to be disclosed by you pursuant to a duly authorized subpoena court order or government authority shall continue to be Confidential Information for all other purposes and you agree prior to disclosing pursuant to a subpoena court order or government authority to provide prompt written notice and assistance to Licensor prior to such disclosure so that Licensor may seek a protective order or other appropriate remedy to protect against disclosure 8 WARRANTY AND DISCLAIMER Your use of the Software and its results is entirely at your own risk Should the Software prove defective you assume the entire cost of all service repair or correction The Software is made available to you AS IS AND LICENSOR MAKES NO REPRESENTATION OR WARRANTY REGARDING THE SOFTWARE AND HEREBY DISCLAIMS ALL WARRANTIES WHETHER EXPRESS IMPLIED OR STATUTORY INCLUDING BUT NOT LIMITED TO ANY IMPLIED OR OTHER WARRANTIES OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE TIT
30. omo sapiens ribosomal protein 378 RPL37A mRNA 2604 Based on non truncated tag 4 169202035 6 001726056 1 PREDICTED Homo sapiens similar to hCG2027326 LOC100129905 mRNA gi 169203086 ref XM 001725509 1 PREDICTED Homo sapiens similar to hCG2027326 LOC100129905 mRNA gi 169203606 reflXM 001726007 1 PREDICTED Homo sapiens similar to hCG2027326 LOC100129905 mRNA gi 68160923 refl NM 001030 3 Homo sapiens ribosomal protein S27 metallopanstimulin 1 RPS27 mRNA 1606 Based on non truncated tag gi 56550064 ref NM 001008220 1 Homo sapiens complexin 2 CPLX2 transcript variant 2 mRNA gi 56550103 reflNM 006650 3 Homo sapiens complexin 2 CPLX2 transcript variant 1 mRNA 1980 Based on non truncated tag gi 17999531 ref NM 004374 2 Homo sapiens cytochrome c oxidase subunit Vic COX6C mRNA 715 Based on non truncated tag gt gil44689961 ref NM_005563 3 Homo sapiens stathmin 1 oncoprotein 18 STMN1 transcript variant 3 mRNA gi 44890049 refl NM 203399 1 Homo sapiens stathmin 1 oncoprotein 18 STMN1 transcript variant 2 mRNA gi 44890051 reflNM 203401 1 Homo sapiens stathmin 1 oncoprotein 18 STMN1 transcript variant 1 mRNA 2163 Based on non truncated tag gi 142358075 reflNM 152350 2 Homo sapiens chromosome 17 open reading frame 45 C170rf45 mRNA 1496 Based on non truncated tag gi j41406053 ref NM 000484 2 Homo sapiens amyloid beta A4 precursor protein APP transcript
31. or destroy all copies of the Software and any other Confidential Information or proprietary materials in your possession for which your rights have been terminated and d upon request certify in writing your compliance with b and c above 20 SOLID SAGE Analysis Software v1 10 Guide fa CONFIDENTIALITY You agree to protect Licensor s Confidential Information with the same degree of care used to protect your own confidential information but in no event less than a reasonable standard of care and not to use or disclose any portion of such Confidential Information to third parties except as expressly authorized in this Agreement You acknowledge that the Software including its content structure organization and design constitute proprietary and valuable trade secrets and other intellectual property rights of Licensor and or its licensors The term Confidential Information means collectively non public information that Licensor and its licensors provide and reasonably consider to be of a confidential proprietary or trade secret nature including but not limited to Software prices and confidential elements of the Software and Licensor s and its licensors technology and know how whether in tangible or intangible form whether designated as confidential or not and whether or not stored compiled or memorialized physically electronically graphically photographically or in writing Confidential Information does not include any infor
32. ort or import of products or services under this Agreement at Licensor s expense Your breach of this provision shall constitute cause for immediate termination of this Agreement You agree to indemnify and hold harmless Licensor its affiliates and their respective officers directors employees and agents for your noncompliance with this Paragraph Products acquired for use within or for any United States federal agency are provided with LIMITED RIGHTS and RESTRICTED RIGHTS as defined in DFARS 252 227 7013 and FAR 52 227 19 15 GOVERNING LAW SEVERABILITY This Agreement shall be governed in all respects by the laws of the State of California USA without regard to its conflicts of law rules or principles Any dispute arising out of or related to this Agreement shall be resolved only in the state or federal courts having subject matter jurisdiction in California Each party hereby consents to the exclusive jurisdiction and venue of such courts If any provision of this Agreement is held to be illegal or unenforceable for any reason then such provision shall be deemed to be restated so as to be enforceable to the maximum extent permissible under law the remainder of this Agreement shall remain in full force and effect GENERAL This Agreement is the parties complete agreement regarding its subject matter superseding any prior oral or written communications representations or agreements You understand and agree that to the extent Licensor perm
33. r any of the Software or any rights in any of the Software including without limitation through charge back or any other selling reselling distributing or redistribution within your organization of any usage capacity you have licensed without the prior express written approval of Licensor ii modify translate reverse engineer except to the limited extent permitted by law decompile disassemble attempt to discover the source code for create derivative works based on or sublicense any of the Software iii use any Software for the benefit of any third parties e g in an ASP outsourcing or service bureau relationship or in any way other than in its intended manner iv remove any proprietary notice labels or marks on or in Software or v disable or circumvent any access control or related device process or procedure established with respect to the Software including the license key or any other part thereof If the Software design permits modification then you may only use such modifications or new software programs for your internal purposes and otherwise consistent with the License You are responsible for all use of the Software and for compliance with this Agreement any breach by you or any user of the Software shall be deemed to have been a breach by you Licensor reserves all rights not expressly granted no right or license is granted hereunder express or implied or by way of estoppel to any intellectual property rights other th
34. s Corporation through its Invitrogen business unit having offices at 5791 Van Allen Way Carlsbad California 92008 USA Licensor This agreement is part of a package that includes one or more software products and certain electronic and or written materials This agreement covers your licensing of such software BY CLICKING YOUR ACCEPTANCE OF THIS END USER LICENSE AGREEMENT Agreement OR BY INSTALLING OR USING THE SOFIWARE defined below OR ANY OTHER COMPONENT OF THE PACKAGE YOU ACKNOWLEDGE THAT YOU HAVE READ ALL OF THE TERMS AND CONDITIONS OF THIS AGREEMENT UNDERSTAND THEM AND AGREE TO BE LEGALLY BOUND BY THEM If you do not agree to the terms of this Agreement you may not install or use the Software and may return it to Licensor In addition to the restrictions imposed under this Agreement the Software installation instructions or release notes shall apply to your use of the Software As used in this Agreement Authorized Users means collectively the personnel authorized by you to use the Software for your benefit Unless otherwise expressly allowed by this Agreement Authorized Users may include only your employees and agents having a need to know and Authorized Users may not be entities or persons in the business of licensing or otherwise providing products or services competitive with the Software Array means any Licensor product which is a microarray Designated Site means your facilities or offices located at the postal addres
35. s provided to Licensor for your billing and invoicing purposes unless otherwise indicated in a license key provided to you Software means the software product s accompanying this Agreement and the content therein including the associated user manuals user documentation and application program interfaces and license key s provided and any patches updates upgrades improvements enhancements fixes and revised versions of any of the foregoing that may be provided to you from time to time and any combination of the foregoing affiliate means any entity Controlling Controlled by or under common Control with the referenced entity where the term Control means the possession direct or indirect of the power to direct or cause the direction of the management and policies of an entity whether through the ownership of voting securities by contract or otherwise 1 TAX OBLIGATIONS SHIPMENT If any authority imposes a duty tax or similar amount other than taxes based on Licensor s income you agree to pay or to promptly reimburse Licensor for all such amounts You are responsible for paying all shipping charges All shipments by Licensor or its designee are FCA point of shipment Incoterms 2000 2 ACCEPTANCE You will be deemed to have accepted the Software unless you provide written notice of rejection within ten 10 days after receipt of the Software or the applicable license key whichever event occurs first Any such notice must state
36. successors and permitted assigns You agree at Licensor s request and reasonable expense to provide reasonable assistance and cooperation to Licensor and its designees and to give testimony and execute documents and to take such further acts reasonably requested by the other to acquire transfer maintain perfect and enforce Licensor s intellectual property rights as described in this Agreement To the extent you fail to do so you appoint Licensor s or its affiliates officers as your attorney in fact to execute documents on your and your personnel s successors and assigns behalf for this limited purpose 22 SOLID SAGE Analysis Software v1 10 Guide Part Number MANO001685 Rev date 29 June 2010 Y applied Applied Biosystems Technical Resources and Support bi t 850 Lincoln Centre Drive Foster City CA 94404 USA For the latest technical resources and support information h losystems Phone 650 638 5800 Toll Free 800 345 5224 for all locations please refer to our Web site at www appliedbiosystems com www appliedbiosystems com support by kife technologies
37. t Format View Help This is a sample description file for barcode multiple mapping a 1f a line begins with pound sign the program treats it as a comment line The file is supposed to have eight columns separated by spaces 1 csfa file the input SAGE sequencing read file 2 mapping tag length should be an integer between 21 and 28 inclusive Default 23 3 mapping mismatches allowed should be 0 1 2 or 3 Default 0 4 reference directory the directory where reference sequences are located 5 reference type should be gDNA mRNA or aRNA Default mRNA 6 virtual reference tag length should be an integer between 27 and 35 inclusive Default 28 7 split number defines how many reads to be processed for one round mapping Should be a positive integer or All reads Default All reads 8 restrictive enzyme digestion site Should be CATG for NlalII or GATC for DpnII Default CATG An examplary line with default values myreadl csfa 23 0 myrefl fa mRNA 28 All reads CATG Other examplary lines myread2 csfa 21 0 myrefdir mRNA 25 1000000 CATG myread2 csfa 23 0 myrefdir mRNA 28 All reads GAIC myreadl csfa 28 0 myrefdir2 mRNA 35 10000000 CATG Please refer to manual and other supporting documents for details on ese arguments Following OE De read into and used by the program Eqrolder BC001 random 1M csfasta 22 1 mnt disk annex Tony database RefSeq H sapiens mRNA mRNA 28 All reads CA CI SegFolder BC005 r
38. t takes the raw data files from SOLiD SAGE sequencing reads and matches them to known sequences in your reference database of choice It is designed for use with the SOLiD SAGE Kit or the SOLiD SAGE Kit with Barcoding Adaptor Module which generates libraries of 27 bp tags for all transcripts in a cell Using the simple software interface you create a project name and location and then identify the directories containing e Sequences from a SOLiD System read csfasta formatted e Afasta formatted database of reference sequences e 2 from RefSeq The software then automatically matches the experimental data with the reference data or compares two experimental data sets The software identifies tags tabulates tag abundances and displays associated gene descriptions It also sorts multiplexed libraries by their barcodes It presents the data in a tabular format that is easy to read and export to spreadsheet or other programs for further analysis The user selects the folders containing the SOLiD SAGE reads and reference sequences and specifies the parameters of tag length and number of mismatches allowed The software then maps the reads using only a portion of the reference sequences to greatly reduce processing time The algorithm extracts tag length fragments flanking the Nla III sites CATG in the reference sequences and concatenates unique fragments together with a spacer of NNN Only the first tag length bases of SOLiD
39. th e Number of allowed mismatches more mismatches allowed longer processing time e Number of million reads per round of processing more rounds required longer processing time A typical read file with octet SOLID data mapped to the human Refseq mRNA dataset with a tag length 27 and mismatch 2 takes 10 minutes on a computer with a 2 33 GHz Duo CPU and 8 GB of memory note that only one CPU and 2 GB memory are actually used If you are mapping to the human genome with mismatch 0 it may take 2 3 hours and up to 15 hours with mismatch 2 14 SOLID SAGE Analysis Software v1 10 Guide Examples of Files and Formats Input File Formats SOLiD reads file This is a standard csfasta file which looks like Tue Dec 23 01 04 30 2008 comments follow Cwd home pipeline Title Solid0110_20081218_JMK26_Ribominus_JMK26_C_amp_1_ 2443 12 55 F3 211200121210112020020320000000 2443 12 118 F3 T000000000000000000000000000000 2443 12 170 F3 T213001130012102033033032131301 2443 12 201 F3 T003000032300000000000000000000 2443 12 278 F3 T000000000000000000000000000000 2443 12 294 F3 T000000000000000000000000000000 2443 12 336 F3 T000000000000000000000000000000 Reference files This is a standard NCBI fasta file part of a database file set in a single directory Files look like gi 155369268 ref NM 001100917 1 Homo sapiens tetraspanin 19 TSPAN19 mRNA AAACAATCTCGATTCTAAATTG bases follow
40. the reason for rejection and you may only reject the Software if it materially fails to comply with its accompanying documentation and user manual If you reject the Software Licensor s sole obligation and liability and your sole and exclusive remedy shall be for Licensor to use commercially reasonable efforts to deliver to you a replacement for the nonconforming Software and if Licensor is not able to deliver a replacement for the Software then the Agreement shall terminate 9 GRANT OF SOFTWARE LICENSE Subject to the terms and conditions of this Agreement Licensor grants to you a non exclusive non transferable license for Authorized Users to use the Software only to acquire and analyze data generated from an Array and only for your internal operations and internal data processing purposes License You may install and operate the Software on a single designated computer located at the Designated Site You may not network the Software for use at any other location at the Designated Site or any other site 4 RESTRICTIONS ON USE You acknowledge that you are receiving LICENSED RIGHTS only The Software may only be used internally by your Authorized Users with the license key provided for your copy ies of the Software If any Software is provided on separate media e g a CD ROM you may make a single copy solely for your internal backup purposes You shall not directly or indirectly 1 sell rent lease distribute redistribute or transfe
41. variant 1 mRNA gi 41406054 reflNM 201413 1 Homo sapiens amyloid beta SOLID SAGE Analysis Software v1 10 Guide Resetting and Exiting the Program Reset Clicking on Reset will reset all the options in the program screen including the project name selection You will be prompted to complete this action Exiting the Click on Exit to exit the program Depending on the state the program is in Program there may be a small or lengthy delay before exiting You can also end the program by using standard Unix commands e g CTRL C from the terminal where you launch the program SOLID SAGE Analysis Software v1 10 Guide Appendix Frequently Asked Questions Is the Program The program will sometimes appear frozen during processing This often Frozen happens when you first load the SOLiD reads or the reference sequences or when you attempt to switch application windows while the SOLiD SAGE program is actively running Allow the process to continue for a few minutes before force quitting Why Am I Getting The program includes various error messages most of which are self An Error explanatory If the error says something about balloon or cancellation you Message can ignore it These errors will not affect your results How Long Does The running time of the mapping analysis depends on a few factors Mapping Take e The number of reads in the input SOLiD SAGE file e The size of the reference genome e Input tag leng
Download Pdf Manuals
Related Search