RAPAd® Universal Adenoviral Expression System
Contents
1. Product Manual RAPAd Universal Adenoviral Expression System Catalog Number VPK 250 1 kit FOR RESEARCH USE ONLY Not for use in diagnostic procedures CELL BIOLABS INC Creating Solutions for Life Science Research Introduction Recombinant adenoviruses have tremendous potential in both research and therapeutic applications There are numerous advantages they provide when introducing genetic material into host cells The permissive host cell range is very wide The virus has been used to infect many mammalian cell types both replicative and non replicative for high expression of the recombinant protein Recombinant adenoviruses are especially useful for gene transfer and protein expression in cell lines that have low transfection efficiency with liposome After entering cells the virus remains epichromosomal i e does not integrate into the host chromosome so does not activate or inactivate host genes Recently recombinant adenoviruses have been used to deliver RNAi into cells Two methods have traditionally been used to generate recombinant adenoviruses The first involves homologous recombination of a shuttle vector containing gene of interest and an adenoviral backbone plasmid vector restricted in E1 E3 in an adenovirus packaging cell line The isolation of recombinant adenovirus by this method involves performing multiple plaque isolations to avoid wild type virus and is extremely laborious and time consuming The second me2. Adenovirus Titer Immunoassay Kit QuickTiter Adenovirus Titer ELISA Kit Rapid RCA Assay Kit ViraBind Retrovirus Concentration and Purification Kit RAPAd CMV Adenoviral Expression System RAPAd CMV Adenoviral Bicistronic Expression System GFP Kit Components 1 pacAd5 K NpA Shuttle Vector Part No 325001 One 40 uL vial at 0 25 mg mL pacAd5 9 2 100 Vector Part No 325002 One 40 uL vial at 0 25 mg mL 2 3 pacAd5 RSV GFP Control Vector Part No 325003 One 40 uL vial at 0 25 mg mL 4 pacAd5 CMV GFP Control Vector Part No 325004 One 40 uL vial at 0 25 mg mL Materials Not Supplied 1 293 cells we recommend 293AD Cell Line Cat AD 100 for high titer production of recombinant adenovirus 2 293 Cell Culture Medium 3 Transfection Reagents 4 Pacl New England Biolabs Cat RO547L Storage Upon receipt store all kit components at 20 C until their expiration dates Safety Considerations Remember that you will be working with samples containing infectious virus Follow the recommended NIH guidelines for all materials containing BSL 2 organisms CELL BIOLABS INC ae Vector Features Pacl Amp SV40pA pacAd5 K N pA 5 7 kb Figure 1 pacAd5 K NpA Vector 5679 bp Ampicillin resistant pacAd5 K NpA shuttle vector does not contain a promoter ahead of the multiple cloning sites You must clone a promoter into the vector along with your gene of interest pacAd5 K NpA Feature
3. shuttle plasmid recombination method In Cell Biolabs RAPAd Universal Adenoviral Expression System the shuttle vector does not contain any promoter ahead of the multiple cloning sites This allows you to introduce your own promoter that is optimal for your gene of interest or target cell This makes the system ideal for promoter studies and cloning of shRNA CELL BIOLABS INC Standard pAdEasy RAPAd Homologous Expression Expression Recombination System System Cotransfect 293 cells with Linearize Linearize Shuttle Vector and Shuttle Vector and Ad Shuttle Vector RAPAd Ad Backbone using Pmel Vector using PacI Backbone Vector Multiple Cotransform E coli BJ5183 Cotransfect Plaque cells with linearized Shuttle 293 cells Isolations Vector and pAdEasy Vector Virus Recombinant selection by Viral Stock Amplification restriction enzyme analysis Viral Stock Linearize recombinant plasmid using Pacl Transfect 293 cells Viral Stock 12 18 weeks 8 9 weeks 2 3 weeks Table 1 Outline of Recombinant Adenovirus Systems CELL BIOLABS INC A 3 Related Products ee oe ae a oe ee ee AD 100 293AD Cell Line AD 200 ViraDuctin Adenovirus Transduction Reagent VPK 090 VPK 099 VPK 100 VPK 109 VPK 110 VPK 111 VPK 130 10 VPK 252 11 VPK 254 ViraBind Lentivirus Concentration and Purification Kit ViraBind Adenovirus Miniprep Kit ViraBind Adenovirus Purification Kit QuickTiter
4. 5 9 2 100 Ad backbone vector with Pacl 2 Run 0 5 ug of each digested DNA and undigested DNA on a 0 8 agarose gel to confirm the completion of PacI digestion For pacAd5 9 2 100 one band of 33 kb and a second band of 2 0 kb 3 Remove buffer and enzyme from the remainder of the restriction reactions by phenol extraction ethanol precipitation or using a similar DNA purification kit 4 Resuspend the DNA in sterile dH20 Store the digested DNA at 20 C II Transfection 1 Seed 2 x 10 cells in a 60 mm culture dish without antibiotics one day before transfection CELL BIOLABS INC After 16 to 24 hours start transfection when the culture becomes 70 80 confluence Note We suggest transfecting cells with FuGENE Transfection Reagent Roche Applied Science or Lipofectamine Plus Invitrogen For example 4 ug of pacAd5 K NpA shuttle vector and I ug of pacAd5 9 2 100 Ad backbone vector are mixed with 9 uL FuGENE Transfection Reagent according to the manufacturer s recommendation The mixed DNA FuGENE complex is added by dropwise into the culture media Aspirate the media containing transfection reagent the next day and add 4 mL of complete culture medium After incubating for 7 days check for the presence of plaques If plate is ready for harvest gt 50 of cells lifted then collect the Crude Viral Lysate If not feed the cells with 1 mL of complete culture medium continue to incubate at 37 C with CO2 On da
5. ATGTAACCCACTCGTGCAC CAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATG GAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAA AGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGT CTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCT CGTCTTCAAGAA EE Q Q HPHAaAPHAAQAA References 1 Bett AJ Haddara W Prevec L and Graham FL 1994 Proc Natl Acad Sci U S A 91 8802 6 Homologous recombination in packaging cell line 2 He T C Zhou S da Costa L T Yu J Kinzler K W et al 1998 Proc Natl Acad Sci USA 95 2509 14 pAdEasy System 3 RD Anderson R E Haskell H Xia B J Roessler and B L Davidson 2000 Gene Ther 7 1034 8 RAPAd System Recent Product Citation Li P et al 2013 MicroRNA 663 regulates human vascular smooth muscle cell phenotypic switch and vascular neointimal formation Circ Res 113 1117 1127 Snyder G D et al 2008 Notice to Purchaser This product is sold for research and development purposes only and is not to be incorporated into prod
6. CGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCAT CACAAAAAT CGACGCTCAAGTCAGAGGTGGCG AAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTT CTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCG TTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAG GAGCGAGGTATGTAGGCGGTGCTACAGAGTT CTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCA ACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGG TTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAA GGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACT CACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGAT CACCTAGATCC AAATTAAAAATGAAG AAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCA ATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTG GATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGC CCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCA CGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTC CCGATCGTTGT CAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTC GTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGT CAACACGGGATAATACCGCGCCACATAGC GAAC AAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCG
7. GCGCGGTAGGCCCGGGACCAGCGGTCTCGGTCGTTGAGGGTCCTGTGTATT CCAGGACGTGGTAAAG GTGACTCTGGATGTTCAGATACATGGGCATAAGCCCGTCTCTGGGGTGGAGGTAGCACCACTGCAGAGCTTCATGCTGCGGGGTGGTGTTGTAGATGATCCAG TCGTAGCAGGAGCGCTGGGCGTGGTGCCTAAAAATGTCTTTCAGTAGCAAGCTGATTGCCAGGGGCAGGCCCTTGGTGTAAGTG ACAAAGCGGTTAAGC GGGATGGGTGCATACGTGGGGATATGAGATGCATCTTGGACTGTA TAGGTTGGCTATGTTCCCAGCCATATCCCTCCGGGGATT CATGTTGTGCAGAAC CACCAGCACAGTGTATCCGGTGCACTTGGGAAA GTCATGTAGCTTAGAAGGAAATGCGTGGAAGAACTTGGAGACGCCCTTGTGACCTCCAAGATTTTCC ATGCATTCGTCCATAATGATGGCAATGGGCCCACGGGCGGCGGCCTGGGCGAAGATATTTCTGGGATCACTAACGTCATAGTTGTGTTCCAGGATGAGATCG CATAGGCCATTTTTACAAAGCGCGGGCGGAGGGTGCCAGACTGCGGTATAATGGTTCCATCCGGCCCAGGGGCGTAGTTACCCTCACAGATTTGCATTTCCCA CGC GAGTTCAGATGGGGGGAT CATGTCTACCTGCGGGGCGATGAAGAAAACGGTTTCCGGGGTAGGGGAGAT CAGCTGGGAAGAAAGCAGGTTCCTGAGC AGCTGCGACTTACCGCAGCCGGTGGGCCCGTAAATCACACCTATTACCGGGTGCAACTGGTAGTTAAGAGAGCTGCAGCTGCCGTCATCCCTGAGCAGGGGGG CCACTTCGTTAAGCATGTCCCTGACTCGCATGT CCCTGACCAAATCCGCCAGAAGGCGCTCGCCGCCCAGCGATAGCAGTTCTTGCAAGGAAGCAAAGTT TTTCAACGGTTTGAGACCGTCCGCCGTAGGCATGC TGAGCG GACCAAGCAGTTCCAGGCGGTCCCACAGCTCGGTCACCTGCTCTACGGCATCTCGA TCCAGCATATCTCCTCGTTTCGCGGGTTGGGGCGGCTTTCGCTGTACGGCAGTAGTCGGTGCTCGTCCAGACGGGCCAGGGTCATGTCTTTCCACGGGCGCAG GGTCCTCGTCAGCGTAGTCTGGGT CACGGTGAAGGGGTGCGCTCCGGGCTGCGCGCTGGCCAGGGTGCGCTTGAGGCTGGTCCTGCTGGTGCTGAAGCGCTGC CGGTCTTCGCCCTGCGCGT CGGCCAGGTAGCATTTGACCATGGTGTCATAGTCCAGCCCCTCCGCGGCGTGGCCCTTGGCGCGCAGCTTGCCCTTGGAGGAGG CGCCGCACGAGGGGCAGTGCAGACTTTTGAGGGCGTAGAGCTTGGGCGCGAGAAATACCGATT CCGGGGA
8. GTAGGCATCCGCGCCGCAGGCCCCGCAGACGGT CGCATTCCACGAGCCAGGTGAGCTCTGGCCGTTCGGGGT CAAAAACCAGG CCCCCATGCTTTTTGATGCGTTTCTTACCTCTGGTTTCCATGAGCCGG GTCCACGCTCGGTGACGAAAAGGCTGTCCGTGTCCCCGTATACAGACTTGAGAGGCCTGTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCC CCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTC ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCG CGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCAC AAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCC ATGATTCTTCTCGCTTCCGGCGGCATCGGGATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAAGGCCAGC 9 QHHOa Q D N CELL BIOLABS INC AAAAGGCCAGGAACCGTAAAAAGGCCG
9. TGTACACAGGAAGTGACAATTTTCGCGCGGTTTTAGGCGGATGTTGTAGTAAA GGGCGTAACCGAGTAAGATTTGGCCATTTTCGCGGGAAAACTGAATA AGAGGAAGTGAAATCTGAATAATTTTGTGTTACTCATAGCGCGTAATATTTGTCTAGGGAGAT CCGGTACCGTTTAAACTCGAGGTCGACGGTATCGATAAGC TTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGGGAGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAA CCACAACTAGAATGCAGTGAAAAAAATGCTTTA GTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAA CAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTT AAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCCGGC TGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTTGACACATGCAGCTCCCGGAGACGGT CACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCC CGTCAGGGCGCGT CAGCGGGTGTTGGCGGGTGT CGGGGCGCAGCCATGAGGTCGACTCTAGTCCCCGCGGTGGCAGATCTGGAAGGTGCTGAGGTACGATGAG ACCCGCACCAGGTGCAGACCCTGCGAGTGTGGCGGTAAACATATTAGGAACCAGCCTGTGATGCTGGATGTGACCGAGGAGCTGAGGCCCGATCACTTGGTGC TGGCCTGCACCCGCGCTGAGTTTGGCTCTAGCGATGAAGATACAGATTGAGGTACTGAAATGTGTGGGCGTGGCTTAAGGGTGGGAAAGAATATATAAGGTGG GGGTCTTATGTAGTTTTGTATCTGTTTTGCAGCAGCCGCCGCCGCCATGAGCACCAACTCGTTTGATGGAAGCATTGTGAGCTCATATTTGACAACGCGCATG CCCCCATGGGCCGGGGTGCGTCAGAATGTGATGGGCTCCAGCATTGATGGTCGCCCCGTCCTGCCCGCAAACTCTACTACCTTGACCTACGAGACCGTGTCTG GAACGCCGTTGGAGACTGCAGCCTCCGCCGCCGCTTCAGCCGCTGCAGCCACCGCCCGCGGGATTGTGACTGACTTTGCTTTCCTGAGCCCGCTTGCAAGCAG TGCAGCTTCCCGTTCATCCGCCCGCGATGACAAGTTGACGGCTCTTTTGGCACAATTGGATTC GACCCGGGAACTTAATGTCGTTTCTCAGCAGCTGTTG GATCTGCGCCAGCAGG CTGCCCTGAAGGCTTCCTCCCCTCCCAATGCGG AAAACATAAATAAAAAACCAGACTCTGTTTGGATTTGGATCAAGCAAG TGTCTTGCTGTCTTTA AGGGGTTTTGCGC
10. e i e most cells rounded but not yet detached from the flask harvest cells by pipetting media up and down to wash the infected cells from the flask into the media Pool infected cells and medium Pellet cells by centrifugation at 1000 g for 5 minutes Remove supernatant resuspend cell pellet in medium or in 10 mM Tris pH 8 0 100 mM NaCl 0 25 0 5 mL per T75 flask Release the adenoviruses from the cell suspension with three freeze thaw cycles Centrifuge at 3000 g for 10 minutes to pellet the cell debris Discard the pellet and save supernatant as viral stock The viral supernatant can be stored at 80 C or immediately purified or titered oa CELL BIOLABS INC Pa Example of Results The following figures demonstrate typical results of generating recombinant adenovirus One should use the data below for reference only This data should not be used to interpret actual results Figure 5 Generation of recombinant adenovirus using the RAPAd Adenoviral Expression System 293 cells were transfected with Pacl linearized pacAdS RSV GFP vector and pacAd5 9 2 100 vector Plates were examined for the presence of viral foci under inverted fluorescence microscope Appendix pacAd5 K NpA Plasmid Sequence AATTAATTAAGCTAGCATCATCAATAATATACCTTATTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGTTTGTGACGTGGCGCGGGGCGTGGGAACG GGGCGGGTGACGTAGTAGTGTGGCGGAAGTGTGATGTTGCAAGTGTGGCGGAACACATGTAAGCGACGGATGTGGCAAAAGTGACGTTTTTGGTGTGCGCCGG
11. s 3 10 Pacl 16 368 1 353 of Ad5 375 464 MCS 457 904 SV40 pA 899 3363 3328 5792 of Ad5 4611 5471 B Lactamase Multiple Cloning Sites Pme Hind III EcoR Spe Not GGTACCGTTTAAACTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGC Kpn Xho Cla EcoR V BamH Xba CELL BIOLABS INC o gt Pacl Pacl pacAd5 9 2 100 34 9 kb AE3 A720 bp Ad5 Figure 2 pacAd5 9 2 100 Vector 34947 bp Ampicillin resistant The novel pacAd5 9 2 100 Ad backbone vector is devoid of the left hand ITR the packaging signal and E1 sequences Pacl eGFP pacAd5 RSV eGFP 6 8 kb SV40pA Figure 3 pacAd5 RSV GFP Control Vector 6799 bp Ampicillin resistant pacAd5 RSV GFP Features 3 10 Pacl 16 368 1 353 of Ad5 382 775 RSV Promoter 856 1575 GFP 1577 2024 SV40 pA 2025 4479 3328 5792 of Ad5 5731 6591 B Lactamase eo CELL BIOLABS INC Pacl eGFP SV40pA pacAd5 CMV eGFP 6 9 kb Figure 4 pacAdS5 CMV GFP Control Vector 6935 bp Ampicillin resistant pacAd5 CMV GFP Features 3 10 16 368 385 912 992 1711 1713 2160 2161 4615 5867 6727 Pacl 1 353 of Ad5 CMV Promoter GFP SV40 pA 3328 5792 of Ad5 B Lactamase Preparation of Recombinant Adenovirus I Vector Linearization with PaclI 1 Digest a sufficient amount of the pacAd5 K NpA shuttle vector containing promoter and gene of interest and the pacAd
12. thod pAdEasy system employs the homologous recombination machinery in E coli a recombinant adenovirus is produced by a double recombination event between cotransformed adenoviral backbone plasmid vector and a shuttle vector carrying the gene of interest For the pAdEasy method the system is high fidelity but inefficient and requires the screening of many bacterial colonies This results in a significant time commitment even before transfection of recombinant DNA into El expressing cells such as HEK293 cells Cell Biolabs RAPAd Adenoviral Expression System provides a much faster and safer method to generate RCA free recombinant adenovirus at high titer see Table 1 The RAPAd system uses a novel Ad backbone devoid of the left hand ITR the packaging signal and E1 sequences There is no need to perform the bacterial in vitro homologous recombination pAdEasy method and also the multiple plaque isolations standard homologous recombination method in packaging cell line The RAPAd system allows for generation of a recombinant virus within 2 weeks and the virus produced contained virtually no contaminating Ela sequences or replication competent virus RCA Cell Biolabs RAPAd Adenoviral Expression System is simple to use The method is straightforward and requires very limited hands on time from shuttle backbone cotransfection to the isolation of virus particles It produces equivalent infectious titers as the standard viral genome
13. ucts for resale without written permission from Cell Biolabs The patented RAPAd technology is covered by a license from University of Iowa By the use of this product you accept the terms and conditions of all applicable Limited Use Label Licenses You may contact our Business Development department at busdev cellbiolabs com for information on sublicensing this technology Warranty These products are warranted to perform as described in their labeling and in Cell Biolabs literature when used in accordance with their instructions THERE ARE NO WARRANTIES THAT EXTEND BEYOND THIS EXPRESSED WARRANTY AND CELL BIOLABS DISCLAIMS ANY IMPLIED WARRANTY OF MERCHANTABILITY OR WARRANTY OF FITNESS FOR PARTICULAR PURPOSE CELL BIOLABS sole obligation and purchaser s exclusive remedy for breach of this warranty shall be at the option of CELL BIOLABS to repair or replace the products In no event shall CELL BIOLABS be liable for any proximate incidental or consequential damages in connection with the products 10 A CELL BIOLABS INC A Contact Information Cell Biolabs Inc 7758 Arjons Drive San Diego CA 92126 Worldwide 1 858 271 6500 USA Toll Free 1 888 CBL 0505 E mail tech cellbiolabs com www cellbiolabs com 2008 2015 Cell Biolabs Inc All rights reserved No part of these works may be reproduced in any form without permissions in writing 11 eo CELL BIOLABS INC AN
14. y 10 check for the presence of plaques If plate is ready for harvest gt 50 of cells lifted then collect the Crude Viral Lysate If not feed the cells with 1 mL of complete culture medium continue to incubate at 37 C with CO2 Keep checking plate for the presence of plaques Do not keep plate more than 15 days III Harvesting the Crude Viral Lysate 1 2 3 4 Harvest adenovirus containing cells by squirting cells off the plate with a 5 or 10 mL sterile serological pipette Transfer cells and media to a sterile 15 ml tube ScrapE the cells into the medium with a cell lifter if necessary Release viruses from cells by three freeze thaw cycles 10 minutes each in 37 C water bath and dry ice methanol bath Centrifuge the cell lysate in a table top centrifuge at 3000 rpm for 15 minutes at room temperature to pellet the cell debris Aliquot and store the Crude Viral Lysate Initial Viral Stock at 80 C IV Amplification Note The following procedure is suggested for T75 flasks and may be optimized to suit individual needs 1 2 Seed 3 5 x 10 cells in a T75 flask one day before infection Add 50 of the above Crude Viral Lysate to the culture We recommend using a multiplicity of gt 0 5 PFU plaque forming units or enough viruses that cells demonstrate cytopathic effects CPEs within 48 hrs During 24 48 hr infection examine the monolayer twice per day under the microscope for CPE When CPE is nearly complet
Download Pdf Manuals
Related Search