Savant Genome Browser: User Manual
Contents
1. ATATTTGATAATATATGGGTTTA 49768884 40M 49768926 43_0001_FC20C CCTGGGTAACATTGGACTGCGC 49768926 40M 49768884 1L10_385 6 45 6 TTGCTAATATATGGGTTTATTTG 49768888 36M 49768915 IL10_385 6 45 6 TATTACAGATACCTGGGTTGCA 49768915 49768888 SRRO10942 283 TTAAAATCACATGGTATTTTGG 49768834 49768819 SRR006423 128 GATTGGGAAAATAATCATATGC 49768856 49768815 SRRO01139 936 TTAATCATATGCACCATCCTAT 49768866 49769022 IL17_297 1 218 AATCATATGCACCATCCTATIT 49768868 49768967 1L22_348 8 131 TGCACCATCCTATTTGATAATA 49768875 49768981 ERROO1300 593 GCACCATCCTATTTGATAATAT 49768876 49769073 AJ_0001_FC20C CCACCCTATTTGATAATATATG OORROOOROROAE 49768879 KSKE ECS aaa aaa al 49768926 ERROO1300 139 TCAGCCTCTCTGATAATATATG 49768879 49768681 VFOOOOORPSeEoOeEoro Figure 7 1 Table View module showing data from a read alignment track 7 1 Changing tracks The Table View only displays data from a single track at a time To change the track whose data is being displayed a drop down list of tracks is provided from which to chose from 7 2 Sorting rows The entries in the Table View can be sorted by clicking the2. In other words Savant is a program for visualizing and analyzing genomics data It was designed to run quickly and efficiently on conventional desktop or laptop computers 1 2 Who should use Savant Savant makes visualization and analysis of genomics data very efficient If you use genome browsers like UCSC or IGV or if you are a biologist or bioinformatician who works with genomics data you should try Savant Chapter 2 Formatting and Loading Data Savant supports a number file formats These files are specially formatted before use to ensure speedy data retrieval To learn how to directly output Savant formatted files see the Developer s Guide downloadable from the Savant website 2 1 Supported File Formats 2 1 1 Standard File Formats Savant supports the following standard file formats Table 2 1 Supported File Formats Format Description FASTA for representing nucleotide sequences BED an alternative to GFF format GFF for genes and other localized features SAM BAM for nucleotide sequence alignments WIG for continuous valued data in track format Partial support 2 1 2 Non standard aka Generic File Formats Savant also supports simple file formats for point interval and continuous annotations Files in so called generic format are tab delimited and have the following fields on each line e Point int position string annotation e Interval int start position int end position
3. field header by which the rows are to be sorted 16 7 3 Exporting Data The data in the Table View can be exported by clicking the Export button embedded in the module The resulting file is a tab delimited encoding of the information shown in the browser 17 Chapter 8 Plugins Savant is able to integrate plugins allowing for powerful extensions of the browser To learn how to develop a plugin see the Developer s Guide downloadable from the Savant website 8 1 Installing a plugin To install a third party plugin copy the plugin s jar file to the Savant plugins directory and restart Savant 8 2 Un installing a plugin To un install a third party plugin remove the plugin s jar file from the Savant plugins directory and restart Savant Do not remove the SavantCore jar file at any time 8 3 Using a plugin Every plugin works differently and may or may not have a user interface For instructions on how to use a third party plugin see the developer s documentation 18 Chapter 9 Other Features 9 1 Track Locking Individual tracks can also be locked to a particular range so that they are not updated until they are unlocked Locked tracks can be used as overview profiles from which subregions can be selected to specify range changes for other tracks To lock a track right click inside the track module and check the Lock option While a track is locked users may select a subrange from the track by using the mouse zoo
4. Be eA ia A 9 4 Visualization 10 4 1 Changing visualization mode 10 Docking Framework 5 1 Showing hiding and pinning modules 5 2 Resizing MoOdUleS s siraan eee an aes pe a een ta Roue A A a ae 5 3 Rearrange modules r a se de dus Ae a ee ee a a ee Ge ER 5 4 Maximizing and restoring modules 5 5 Detaching and attaching from and to the UI Bookmarking 6 1 Adding and removing bookmarks 6 2 Seeking toa Bookmark grg ee Se aa di eat is honte Dee ee 6 3 Adding annotations to bookmarks 6 4 Recording Navigation History 6 5 Saving and loading bookmarks Table View Wel Changing tracks soci wea ise ac eae o D A ne A A my ae Mazo COLLINS TOME ee ES Gen Ghat O A AD ve eg RRA ee Se a Ge eal eh Zh T EXporting Data o AAA A ee Oh a ee ee ek eh Pee ei oe Plugins 8 1 Installingapluginy dosa aa wee oe Re ee ee ln ee kA A ma a aye 320 Uneinstalling a plugins 2 206 a Goes ad a le a ade Et me he le ER 8 3 Using A P BIO sis AAA A a PR Rte E S nant A AA as Other Features 94 Track Docking tes wi ee ee es ee Se ee en ee Met A Sh wi a ae Chapter 1 Introduction 1 1 What is Savant Savant stands for Sequence Annotation Visualization and Analysis Tool
5. D Y redo range change Chapter 4 Visualization Savant retrieves and renders data every time a range change is requested by the user Together these processes happen nearly instantaneously so as to confer seamless navigation around the genome The renderer for each track is adaptive to both the display mode and the length of the viewed region chosen by the user 4 1 Changing visualization mode Particular data types can be displayed in different modes For example interval annotations can be squished together on a single line or packed neatly so that none overlap mimicking the squish and pack modes of the UCSC browser The representation can be dynamically toggled within the browser by right clicking inside a track going to the track name clicking Change Display Mode and then choosing the desired mode Each mode is meant to emphasize a different aspect of the data The variant and strand modes for read alignments for instance use colors to emphasize mismatches in reads and the strands to which reads are mapped respectively A novel mode for representing matepairs shows arcs between the mapped locations of paired reads where the height of each arc is proportional to the inferred insert size Arcs for anomalously mapped pairs such as those suggestive of inversions or duplications are colored differently yma 179 Change Display Mode gt E WARIANTS MATE_PAIRS Figure 4 1 Changing the visu
6. Savant Genome Browser User Manual May 7 2010 Author Marc Fiume Contact savant cs toronto edu Website http compbio cs toronto edu savant This document applies to Savant version 1 02 Contents 1 Introduction 4 Ted What is Savant csc ea ve ee ee D te ee ee ee REARS AA ee 4 1 2 r Who shoulduse Savant i g insu ei e RS Bae Me are te a Qe ae ee we 4 2 Formatting and Loading Data 5 2 1 Supported File Formats 5 2 1 1 Standard File Formats 5 2 1 2 Non standard aka Generic File Formats 5 22 Wownloading Data iate be RU dete ok atte AN A te delete Aba ee 6 2 3 Using the Format Dialog roi woe ite sv Se ea ee en ee ee A a A ee 6 2 4 1 Loading Tracks e dos fig by dere eta dde du Roe Bak Ba ate ela A ee a 7 2 4 1 Track loading prerequisites 7 2 4 2 Leading a Track i iia hae BP GR Geel air a le n Vo ve Ee eeh 7 3 Navigation 8 gol Navigation Toolbar x nest a A A ats Sia wa e etd 8 3 1 1 Range Selection Panel oi 60 24 50208 a ee ek ant ads eee de 8 32 ZOOMING Lan ee es ee Be ee eh ee he Ae ait ao er 8 3153 1 PANNINE cs e us ae de ns ah ae SD the ee ede Se ae a e a D h 8 3 1 4 Seeking to specific range 9 3 2 Mouse and Keyboard Shortcuts 9 3 3 Other Useful Shorteuts od pe nu ds Oe dle Se aa
7. alization mode 10 Chapter 5 Docking Framework Savant features a docking framework which allows users to rearrange modules to their liking Such modules include tracks and built in items e g Bookmark Table View etc and plugins Non track modules are constrained to be docked to the sides of the UI and not among tracks Similarly track modules are constrained so that they cannot be docked among other modules While a number of important functions are presented here the best way to learn all the features of the docking framework is to try using it Close Floating Sito tos Floating Maximize Dockable Auto Hide Maximize Dockable Figure 5 1 Left A track module Upper right Docking menu presented when the title bar of a module is right clicked Bottom right Docking controls embedded in the title bar of the module The latter controls are not available in the Mac version 5 1 Showing hiding and pinning modules By default built in modules are hidden Hidden modules appear as tabs located on the region of the Ul to which they are docked A module is shown once the mouse is held over the tab The shown module will hide once the mouse leaves the tab and focus is returned to another component of the UI To force the module to be shown always it can be pinned On Windows and Linux a module can be pinned by pressing the pin icon located on the title bar of the module making the pin point downwards A pinned modul
8. and typing in some text 6 4 Recording Navigation History Navigation history can be tracked by clicking the Record button embedded in the Bookmarks module From then on every new range viewed will be stored as a Bookmark To stop recording press the Stop Recording button 6 5 Saving and loading bookmarks Bookmarks can be saved to be reused in future sessions or to be shared with colleagues To save the existing bookmarks click the Save button embedded in the module These bookmarks can subsequently be loaded by clicking the Load button embedded in the module A user can opt to append the loaded bookmarks to the existing bookmarks or to replace the existing bookmarks entirely with the loaded ones 15 Chapter 7 Table View The Table View module displays the data in the current range in a tabular format This module displays records as rows and fields as columns in a spreadsheet The data is automatically updated when a range is changed unless the Auto Update checkbox is unchecked Log Batch Run Data View Track NA12878 chrom1 SLX maq SRP000032 2009_07 bam Read Name IL22_307 1 102 Sequence GTTGAATTTCACTGAGAGGCGT Length First of Pair Position 49768931 Al stos Mapping Quality CIGAR 36M Mate Position 49769028 Strand Inferred Insert Size ERRO01293 409 ATATGCACCATCCTATTTGATA 49768872 36M 49768668 AJ_0001_FC20C
9. e can be hidden again by pressing the pin again making the pin point to the left On a Mac a module can be pinned 11 by first right clicking the title bar of the module then unchecking Auto hide A pinned module can be hidden again by right clicking the title bar of the module and checking Auto hide The same functionality is possible through the title bar on Windows and Linux Annotation ad Annotation Esad Bookmarks Bookmarks leet xe Ca ere Coa tee From To Annotation o Annotation From T Figure 5 2 Hiding and showing modules Left The Annotation module hidden on the right of the Savant UI Middle The Annotation module shown by mousing over the Annotation tab Right The Annotation module pinned so that it will remain shown even when the user is interacting with other components of the UL 5 2 Resizing Modules Modules can be resized To resize a module click an edge and drag it until it occupies the desired size 5 3 Rearranging modules Modules can be arranged in virtually any configuration within the UI To move a module click its title bar and drag it to the desired new location While dragging a gray outline will appear showing the location the module will occupy if the mouse is released Track modules can be docked to the top or bottom of the track space while other modules can be docked to any edge of the UI In addition modules can be docked on top of eac
10. e user to zoom in and out with respect to the current range 3 1 3 Panning The pan buttons allow the user to shift the range to the left and to the right including to the beginning of the genome and to the end of the genome 3 1 4 Seeking to specific range Textboxes are afforded for the user to enter precisely the range to be displayed The range will be updated using the values entered in the textboxes when the user presses the Enter Return key while one of the textboxes has focus 3 2 Mouse and Keyboard Shortcuts Navigation can be done very quickly using a number of mouse and keyboard shortcuts described in the tables below Table 3 1 Navigation using the keyboard Keys Action CTRL CMD LEFT pan left CTRL CMD RIGHT pan right CTRL CMD UP zoom in CTRL CMD DOWN zoom out Table 3 2 Navigation using the mouse Keys Action Click and drag left right pan left right CTRL CMD Scroll up down pan left right CTRL CMD Click and drag zoom in on selected region Scroll up down zoom in out 3 3 Other Useful Shortcuts Range changes can be undone and redone using the commands in the following table Another option to save history is by clicking the Record button in the Bookmarks module which keeps track of range viewed This history can subsequently be saved for reviewing See the Bookmarks section for more details Table 3 3 Undoing and Redoing Range Changes Keys Action CTRL CMD Z undo range change CTRL CM
11. h other in which case tabs will appear allowing one to switch between modules or beside each other 5 4 Maximizing and restoring modules A module can be maximized to occupy the entire screen or UI to make interaction or visualization with it easier and then restored back to its original state among other modules to resume a concerted view To maximize press the embedded icon which resembles a square To restore press the embedded icon which resembles two overlapping squares in the same location as the icon pressed to maximize On a Mac you can maximize and restore by right clicking the title bar and click maximize and restore respectively The same functionality is possible through the title bar on Windows and Linux 5 5 Detaching and attaching from and to the UI A module can be detached from the UI and moved to a separate location on the screen This is particularly useful for multidisplay setups where for example analytics modules can be moved to one display and tracks kept on another To detach a module press the embedded icon which resembles to squares The detached 12 AAA enome Browser File Edit View Help File Edit View Help ers CC CCC e Cone JU Neal CCS GEIB e Figure 5 3 Rearranging modules Left Demonstration of the rearrangement process Right The result of the rearrangement module can then be moved to another location by clicking and dragging its title bar To reattach i
12. m options described previously which will become the new range for other unlocked tracks To unlock a track right click inside the track module and uncheck the Lock option 19
13. or amino acids are represented using single letter codes Output File mfiume My Documents Savant Data chri falchri fa savant Format Figure 2 1 The Format Dialog Components of the Format Dialog see Figure 2 1 e Input file the text file to be formatted Format the format of the input file Input is 1 based whether or not the input file s positional annotations start at 0 or 1 Output file the output file to be produced which can subsequently be loaded into Savant 2 4 Loading Tracks A track is an individual data set hence tracks and data may be used interchangeably hereafter Files formatted for use with Savant typically have the savant extension BAM files are exceptions which have bam extensions There may be other files created by the formatter with for example other extensions such as savant index It is essential that these accompanying files remain in the same folder as the savant files Otherwise the files aren t likely to load properly 2 4 1 Track loading prerequisites 1 Files must be formatted for use with Savant For help with formatting files please see Section 2 3 If you are unsure whether or not your file is formatted you can try to load it and Savant will prompt for formatting if it does not appear to have been formatted 2 A genome must be specified Option 1 Loading a genome sequence from file A formatted genome seq
14. string annotation e Continuous int float value Note that for continuous files the position at which the annotation applies is implicit in the line number That is the value on the ith row of a generic continuous file represents the value for position i on the genome Generic files can typically be generated easily with moderate knowledge of shell scripting 2 2 Downloading Data A number of common annotations e g sequence and gene for the human genome have been formatted and hosted on the Savant website at http compbio cs toronto edu savant data html Genomic annotations are also available from other databases Downloading and formatting data from these and other popular data sources is encouraged UCSC http genome ucsc edu 1000 Genomes Project http www 1000genomes org NCBI http www ncbi nlm nih gov EBI http www ebi ac uk 2 3 Using the Format Dialog The Format Dialog can be used to format text files e g ones downloaded from the various data sources listed above for use with Savant The Format Dialog can be opened by choosing File gt Format Format g Input File ettings mfiume My Documents Savant Data chr1 fa chri fa Format FASTA BED GFF BAM Coverage WIG Generic Interval Generic Point Generic Continuous Format Description FASTA format is a text based format for representing either nucleotide sequences or peptide sequences in which base pairs
15. t to the UI press the embedded icon which resembles a square with an L shape in it in the same location as the icon pressed to detach it On a Mac you can detach and reattach by right clicking the title bar and checking or unchecking Floating respectively The same functionality is possible through the title bar on Windows and Linux 13 Chapter 6 Bookmarking The Bookmarks module helps to keep track of interesting regions or to make annotations At any time users may add remove or seek to a bookmarked region by using buttons within the module or by using keyboard shortcuts Bookmarks Cas JC From To Annotation 49768670 49768705 potential CNY 49768705 low complexity 49768921 interesting region Figure 6 1 Bookmarks module 6 1 Adding and removing bookmarks A bookmark can be added by pressing the Add button embedded in the Bookmarks module The current range will be used for the bookmark although the from and to coordinates of the bookmark can be adjusted by double clicking and changing them The keyboard shortcut CTRL B or CMD B on a Mac can be used to quickly add a bookmark Bookmarks can be removed by right clicking them and choosing the Delete option 6 2 Seeking to a Bookmark A bookmark can be seeked to by right clicking it and choosing the Go option 14 6 3 Adding annotations to bookmarks An annotation can be added to a bookmark by double clicking the Annotation field
16. uence file is loaded by pressing the Genome button or by clicking File gt Load gt Genome and choosing Load From File This option loads the genome sequence as a track Option 2 Specifying the genome s without providing a sequence A genome is specified without a sequence by pressing the Genome button or by clicking File gt Load gt Genome and choosing Specify Length subsequently one can either choose from a list of common genome assemblies or specify a length 2 4 2 Loading a Track A track is loaded by pressing the Track button or by clicking File gt Load gt Track and using the File Chooser Dialog to open the appropriate file Chapter 3 Navigation Navigation refers to changing the region of the genome which is viewed by the browser A user can navigate by either interacting with the user interface in particular with the Navigation Toolbar located at the top of the interface or by using the appropriate keyboard and mouse shortcuts 3 1 Navigation Toolbar 77 643 547 J 68 523 594 C JE Gls f 77 643 547 88 523 534 Figure 3 1 The Navigation Toolbar found at the top of the Savant UI Components of the Navigation Toolbar from left to right are described below in turn 3 1 1 Range Selection Panel The Range Selection Panel displays the current displayed region in the context of the genome Users can select a new range by clicking and dragging within the panel 3 1 2 Zooming The zoom buttons allow th
Download Pdf Manuals
Related Search