Supplementary Material
Contents
1. Mixthe reagents by pipetting and collect the liquid at the bottom of the tube by brief centrifugation Label accordingly and set aside until 2 1 5 Prepare a Bait Master Mix for the required number of samples This master mix contains the RNA baits and an RNase inhibitor Reagent Volume pL per sample SUPERaseeIn 20U ul 1 RNA Baits 0 5 H O 4 5 Mix the reagents by pipetting Label accordingly and set aside until 2 1 5 Transfer the tube s containing the Library Master Mix from step 2 1 2 to the thermocycler and start the program set in step 2 1 1 This will denature the DNA library for 5 min at 95 C Once the thermocycler program reaches step 2 65 C see step 2 1 1 transfer the tube containing the Hybridization Master Mix from step 2 1 3 to the thermocycler This will pre warm the Hybridization Master Mix for 3 min at 65 C Leave the Library Master Mix in the thermocycler at this time Once the thermocycler program reaches step 3 65 C see step 2 1 1 transfer the tube containing the Baits Master Mix from step 2 1 4 to the thermocycler This will pre warm the Bait Master Mix for 2 min at 65 C Leave the Library Master Mix and the Hybridization Master Mix in the thermocycler at this time While keeping tubes at 65 C transfer 13 ul of Hybridization Master Mix and 7 ul of Library Master Mix to the tube s containing the Baits Master Mix and mix via pipetting Close the lid and incu2. thermal cycler 3 Clean up the reaction using the SPRI method adding 30 uL 20 PEG fora regular library or 80 uL 20 PEG for library with short inserts such as ancient or fragmented DNA Keep the dried beads Proceed immediately to the next step V Fill in Adapters are non phosphorylated and thus ligate to only one of the template strands Resulting single strand nicks are filled in using Bst polymerase to allow amplification of the insert 1 Prepare a master mix for the required number of samples Volume pL Final concentration per sample in 40 pL reaction ThermoPol reaction buffer 10x 4 1x dNTPs 25 mM each 0 4 250 uM each Bst polymerase large fragment 8 U uL 1 5 0 3 U uL H O 34 1 2 Add40 uL ofmaster mix to the samples Pipette up and down to mixthe sample and collect the liquid at the bottom of the tube by brief centrifugation Incubate the samples for 20 min at 37 C 3 Clean up the samples using the SPRI method adding 30 uL 20 PEG for regular libraries or 80 yL 20 PEG for libraries with short inserts such as ancient or fragmented DNA Elute the samples with 20 uL of nuclease free water Transfer the supernatant to a new tube labeled accordingly The libraries can be kept frozen at 20 C for a short period but we recommend to further process the libraries as soon as possible to avoid degradation of DNA VI Pre hybridization PCR Libraries are amplified using primers IS7_short_amp PS and IS8
3. 11 h 55 C for 11 h and 50 C for 11 h 1st wash at room temperature 18 22 C 2nd Wash at 45 C The protocol used is based on the user manual of the MY Baits target enrichment kit I Hybridization Amplified target DNA libraries are hybridized to biotinylated RNA baits 1 Set the following program on a thermal cycler 95 C for 5 min 65 C for 3 min 65 C for 2 min 65 C for 11 h 60 C for 11 h 55 C for 11 h 50 C for 11 h and hold at 50 C 2 Prepare a Library Master Mix for the required number of samples Block 1 Human Cot 1 binds and blocks repetitive elements in the target DNA to prevent non specific binding to the baits The blocking oligos are used to blanket the adapters and prevent adapter to adapter hybridization Reagent Volume pL per sample Block 1 Human Cot 1 1 ug L 2 5 BO1 P5short F 200 pM 0 08 BO3 P7 part1 F 200 uM 0 08 Add 2 5 uL of Library Master Mix from step 2 1 2 to empty 200 uL tubes and then add 6 5 uL of target DNA library from step 1 VI 3 to each tube and label accordingly Mix by pipetting Collect the liquid at the bottom of the tube by brief centrifu gation Set aside until step 2 1 5 3 Prepare a Hybridization Master Mix for the required number of samples This master mix contains various buffers to aid successful hybrid ization of baits to the target DNA library Reagent Volume pL per sample HYB 1 20x SSPE HYB 2 0 5 M EDTA HYB 3 50x Denhardt s HYB 4 1 SDS
4. 72 C for 1 min and hold at 4 C for 10 min The number of PCR cycles can be adjusted according to the starting material used to construct the library 3 Load 3 uL of PCR product to a mini agarose gel to check the size of the captured library The band should be barely visible 4 Clean up the PCR product using the SPRI bead method Elute the DNA using 20 uL of nuclease free water transfer it to anew tube and label accordingly IV Pooling multiple samples for sequencing 1 Determine the DNA concentration of indexed captured libraries using Qubit 2 0 Fluorometer or similar The concen tration of the samples should be around 0 1 0 9 ng uL or higher if more starting material was used 2 Pool all samples in equimolar ratios for sequencing 3 Clean up the pooled sample with SPRI beads adding 3 4 of the sample volume of 20 PEG Elute the sample with 20 uL nuclease free water 4 Quantify the pooled library using qPCR We utilized the KAPA Library Quantification Kit The pooled library should be 20 uL final volume at a concentration of gt 10 nM 2nM 50nM which is 2 6 ng uL 0 5 ng uL 13 ng uL for DNA 400 bp Recipes Oligo hybridization buffer 10x Reagent Volume Final concentration in 10 ml NaCl 5 M lmi 500 mM Tris Cl pH 8 0 1 M 100 pL 10 mM EDTA pH 8 0 0 5 M 20 uL 1 mM H O 8 88 ml Adapter Mix 50 uM Hybridization mix for adapter P5 100 uM Reagent Volume pL Final concentration in 100 pL reaction IS1
5. Library preparation and gene capture PROTOCOL FOR Capturing protein coding genes across highly divergent species Chenhong Li Michael Hofteiter Nicolas Straube Shannon Corrigan Gavin J P Naylor College of Fisheries and Life Science Shanghai Ocean University Shanghai China Department of Biology The University of York Heslington York UK and Hollings Marine Laboratory College of Charleston Charleston SC BioTechniques 54 321 326 June 2013 doi 10 2144 000114039 Keywords comparative biology cross species capture DNA hybridization capture next generation sequencing protein coding genes phylogenetics target enrichment Reagents DNeasy Blood and Tissue Kit Qiagen Valencia CA 7 Agencourt AMPure XP beads Beckman Coulter Inc Atlanta GA Dynabeads M 270 streptavidin beads Life Technologies Grand Island New York Polyethylene Glycol Life Technologies Tween 20 Life Technologies 5M NaCl Life Technologies 1M Tris Cl pH 8 0 Life Technologies 0 5 M EDTA pH 8 0 Life Technologies 10x Buffer Tango Fermentas Thermo Fisher Scientific Waltham MA 25 mM dNTPs Fermentas Thermo Fisher Scientific 100mM ATP Fermentas Thermo Fisher Scientific 50 PEG 4000 Fermentas Thermo Fisher Scientific T4 DNA ligase Fermentas Thermo Fisher Scientific 10x T4 DNA ligase buffer Fermentas Thermo Fisher Scientific 10x ThermoPol reaction buffer New England Bio
6. _adapter_P5 F 500 uM 20 100 uM IS3_adapter_P5 P7 R 500 uM 20 100 uM Oligo hybridization buffer 10x 10 Ix H O 50 Hybridization mix for adapter P7 100 M Reagent Volume pL Final concentration in 100 pL reaction IS2_adapter_P7 F 500 uM 20 100 uM 1S3_adapter_P5 P7 R 500 uM 20 100 uM Oligo hybridization buffer 10x 10 Ix H O 50 Mix and incubate both reactions in a thermal cycler for 10 s at 95 C followed by a ramp from 95 C to 12 C at a rate of 0 1 C s Combine both reactions to obtain a ready to use adapter mix 50 uM each adapter Equipment Covaris M220 Focused ultrasonicator Covaris Inc Woburn MA Qubit 2 0 Fluorometer Life Technologies Eppendorf Mastercycler pro S Hauppauge New York CFX Connect Real Time PCR system Bio Rad Hercules CA MiSeq sequencer Illumina Inc San Diego CA References 1 Meyer M Kircher M 2010 Illumina sequencing library preparation for highly multiplexed target capture and sequencing Cold Spring Harb Protoc 2010 6 pdb prot5448 Fisher S Barry A Abreu J Minie B Nolan J Delorey TM Young G Fennell TJ Allen A Ambrogio L et al 2011 A scalable fully automated process for construction of sequence ready human exome targeted capture libraries Genome Biol 12 1 R1 N
7. _short_amp P7 prior to gene capture and indexing 1 Prepare a master mix for the required number of samples Reagent Volume pL per Final concentration sample in 50 pL reaction KAPA HiFi Taq Ready Mix 2x Primer S7_short_ LO 0 3 uM amp P5 10 uM Primer IS8_short_ TS 0 3 uM amp P7 10 uM H O 16 2 Add 44 uL of master mix to empty tubes and then add 6 uL of the cleaned libraries from step 1 V 3 Mix well and amplify the samples using the following thermal profile 98 C for 45 s 12 to 18 cycles of 98 C for 15 s 65 C for 30 s and 72 C for 45 s followed by 72 C for 1 min and hold at 4 C for 10 min The number of cycles can be adjusted according to the amount of starting material used to construct the library 3 Clean up the PCR product using the SPRI bead method adding 30 uL 20 PEG Elute the DNA using 20 pL of nuclease free water and transfer it to a new tube labeled accordingly Measure the concentration of the amplified library using a Qubit 2 0 Fluorometer or similar The concentration should be around 6 10 ng uL or higher if more starting material was used 2 Gene capture We applied two sets of conditions for hybridization and washing the standard hybridization conditions hybridization at 65 C for 36 h 1st wash at room temperature 18 22 C 2nd wash at 65 C and the relaxed hybridization conditions hybrid ization under a touchdown scheme Figure 1 65 C for 11 h followed by 60 C for
8. bate the hybridization solution in the thermocycler for 48 h under the touchdown scheme described in step 2 1 1 This scheme represents the optimized conditions for capturing across divergent species Depending on the application hybridization time may require some optimization Step 2 1 5 Denature the library for 5 min Step 2 1 6 Warm the Hybridization Mix Step 2 1 7 Warm the Baits Mix Step 2 1 8 Transfer the Hybridization Mix and the library to the Baits Step 2 1 9 Touch down hybridization lt M Figure 1 Schematic representation of the touchdown hybridization procedure described in steps 2 1 5 to 2 1 9 II Binding hybridized libraries to beads and wash The resulting biotinylated target bait complex is bound to strepta vidin coated beads A low stringency washing step is used to remove unbound material This is followed by higher stringency washing to remove bound non target DNA We have optimized the tempera tures and number of washes for the higher stringency wash which is important to capture divergent sequences 1 Add 7 x 10 uL z is the number of samples of Dynabeads M 270 streptavidin beads to a200 uL or 1 5 mL tube according to the volume of the mixture 2 Pellet the beads for two min using a magnetic particle stand and discard the supernatant 3 Add 200 pL MY Baits target enrichment kit Binding Buffer 1M NaCl 10mM Tris HCI lmM EDTA pH 7 5 at room temperature to beads to wash Vortex tube fo
9. dapter P7 g t g a CTGGAGTTCAGACGTGTGCTCTTCCg a t c t IS3_adapter P5 P7 a g a t CGGAa g a g c AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACAC GACGCTCTT IS7_short_amp P5 ACACTCTTTCCCTACACGAC IS8_short_amp P7 GTGACTGGAGTTCAGACGTGT BO1 P5short F ACACTCTTTCCCTACACGACGCTCTTCCGATCT Pho BO3 P7 part1 F AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Pho indicates a phosphothioate oligonucleotide PTO bond Pho indicates a 3 phosphate IS4_indPCR P5 Legend ATTENTION HINT Procedure 1 Library preparation using the with bead method Genomic DNA was extracted from freshly preserved muscle tissue for all species using the DNeasy Blood and Tissue Kit according to the manufacturer s instructions Extracted genomic DNA was subsequently sheared to 500 bp using a Covaris M220 Focused ultrasonicator before library preparation The protocol used for library preparation is based on the Meyer and Kircher 1 method for preparing Illumina sequencing libraries for multiplexed target capture and sequencing with modifications to accommodate capture of divergent species The with bead method of Fisher et al 2 is also adopted meaning that the beads are kept in each of the DNA clean up steps The samples are not eluted from the beads until after the library preparation Thus all library preparation steps occur on the beads This modification to the regular Solid Phase Reversible Immobilization SPRI method can increase the complexity of the resultin
10. g library I Shearing genomic DNA Skip the shearing and size selection step if using samples with fragmented DNA e g ancient DNA or DNA extracted from museum samples 1 Start with 0 5 3 ug genomic DNA and shear it to 500 bp using the Covaris machineaccordingto the manufacturer sinstructions 130 ul sample in Covaris micro UBE temperature 18 to 22 C treatment 60 s Peak Power 50 Duty Factor 10 Cycles Burst 200 2 Check the size distribution of the sheared DNA on an agarose gel to confirm accuracy of the shearing process and appropriate fragment size II Size selection 7 the sheared DNA has a broad size distribution a size selection step may be applied using the SPRI bead method at different concentrations of polyethylene glycol PEG The following protocol is used to select DNA with fragment sizes gt 250 bp Skip the size selection step if using samples with fragmented DNA lt 100 bp 1 Add 50 uL Agencourt AMPure XP beads to a 200 uL tube Use individual tubes to avoid cross contamination Dry the beads for two min by placing the tubes on a magnetic plate allowing the beads to move to the walls of the tube before removing the supernatant 2 Add 50 uL sheared sample and 37 5 uL 20 PEG to the dried beads Prepare 1 positive and 1 negative control Add 50 uL AMPure XP beads to a tube with 30 uL nuclease free water and to another tube with 30 uL positive DNA 1 100 diluted PCR product of any DNA fragment with a
11. gation step i Prepare a master mix for the required number of samples Add 20 uL of the master mix to each sample Mix the samples well by pipetting Reagent Volume pL Final concentration per sample in 20 pL reaction Buffer Tango 10x 2 1x dNTPs 25 mM each 0 08 100 uM each ATP 100 mM 0 2 1 mM T4 polynucleotide kinase 10 U uL 1 0 5 U L T4 DNA polymerase 5 U uL 0 4 0 1 U uL H 0 16 32 2 Incubate the samples in a thermal cycler for 15 min at 25 C followed by 5 min at 12 C 3 Add 15 uL 20 PEG to the sample and clean up the reaction according to the SPRI protocol Keep the dried beads IV Adapter ligation PS and P7 adapters 2 are ligated to the ends of the repaired molecules using T4 DNA ligase If working with ancient or fragmented lt 100 bp DNA add 9 uL instead of 29 uL of water in step 1 1V 1 then add 19 uL of master mix to each sample 1 Prepare a master mix for the required number of samples Add 39 uL of the master mix to each sample tube Mix the samples well by pipetting Volume pL Final concentration per sample in 40 pL reaction T4 DNA ligase buffer 10x 4 ilsg PEG 4000 50 4 5 Adapter mix 50 uM each 2 1 25 uM each H O 29 2 Spin down the liquid by brief centrifugation Add 1 uL T4 DNA ligase 5 U uL to the sample Pipette up and down to mix the sample and collect the liquid at the bottom of the tube by brief centrifugation then incubate for 30 min at 22 C in a
12. labs Ipswich MA Bst polymerase large fragment New England Biolabs T polynucleotide kinase New England Biolabs T4 DNA polymerase New England Biolabs 2x KAPA HiFi Taq Ready Mix KAPA Biosystems Inc Woburn MA 7 KAPA Library Quantification Kit K ApA Biosystems Inc MYBaits Target Enrichment Kit M Ycroarray Ann Arbor Michigan including Block 1 Human Cot 1 ug L HYB 1 20x SSPE HYB 2 0 5 MEDTA HYB 3 50x Denhardt s HYB 4 1 SDS SUPERaseeIn 20 U ul RNA Baits Binding Buffer 1 M NaCl 10 mM Tris HCI ImM EDTA pH 75 Wash Buffer 1 1x SSC 0 1 SDS Wash Buffer 2 0 1x SSC 0 1 SDS 50 uM Adapter mix see recipes 10x Oligo hybridization buffer see recipes 7 Adapter 500 uM IS1_adapter_P5 F Integrated DNA Technol ogies Inc Coralville lowa wAdapter 500 uM IS3_adapter_P5 P7 R Integrated DNA Technologies Inc Indexing primer 10 yM Primer IS4_indPCR P5 Integrated DNA Technologies Inc Primer 10 uM Primer IS7_short_amp P5 Integrated DNA Technologies Inc Primer 10 uM Primer IS8_short_amp P7 Integrated DNA Technologies Inc Blocking oligo for adapter P5 200 yM BO1 P5short F Integrated DNA Technologies Inc Blocking oligo for part 1 ofadapter P7 200 yM BO3 P7 part1 F Integrated DNA Technologies Inc Sequences ofadapters primers and blocking oligos Sequences IS1_adapter P5 a c a c TCTT TCCCTACACGACGCTCTTCCg a t c t 1S2_a
13. last wash make sure all additional buffer is removed 11 Add 50 pL nuclease free water to the beads and label accord ingly III Post hybridization indexing PCR ofE beads amplification The captured library is recovered and amplified using off beads amplification 1 i e the captured target is amplified off the target bait bead complex during the indexing PCR This avoids the need for chemical denaturation and maximizes retention of captured products If performing double capture amplify the captured library off the beads as in 2 11 1 but replace the indexing primers with primers IS7_ short_amp PS and IS8_short_amp P7 as in step 1 VI 1 Clean up the amplified libraries using the SPRI method Use the product as template to repeat steps 2 1 1 through 2 11 11 After the second round of capture perform the post hybridization indexing PCR as described in 2 IIL 1 and continue the protocol to completion 1 Prepare a master mix for the required number of samples Reagent Volume pL Final concentration per sample in 50 pL reaction KAPA HiFi Taq Ready 25 1x Mix 2x Primer IS4_indPCR 0 5 0 2 uM P5 10 uM 2 Add 25 5 uL of master mix 23 pL well mixed sample including streptavidin beads from step 2 IL 11 and 0 5 uL indexing primer 10 uM to each tube Mix well and amplify the samples using the following thermal profile 98 C for 45 s 12 to 18 cycles of 98 C for 15 s 65 C for 30 s and 72 C for 45 s followed by
14. r 5 10 s place on magnetic particle stand for 2 min to pellet the beads and remove and discard supernatant 4 Repeat step 3 twice for a total of three washes 5 Resuspend the beads in z x 20 uL Binding Buffer add 1 uL 10 Tween 6 For each sample add 180 uL Binding Buffer to an empty 200 uL tube and then add 20 uL resuspended beads to it 7 Transfer the hybridization solution s from step 2 1 9 to the tube s containing the Binding Buffer and beads and incubate for 30 min at room temperature on a rotator Collect the liquid at the bottom of the tube by brief centrifugation Pellet the beads with the magnetic plate for two min and remove supernatant 8 Add 186 pL MYBaits target enrichment kit Wash Buffer 1 1x SSC 0 1 SDS to the beads and pipette up and down to resuspend Incubate for 10 min at room temperature Collect the liquid at the bottom of the tube by brief centrifugation Pellet beads with magnetic particle stand for two min and remove supernatant Repeat step 2 II 8 one more time for a total of two low stringency washes In the meantime preheat MYBaits target enrichment kit Wash Buffer 2 0 1x SSC 0 1 SDS to 45 C 9 Add 186 ml 45 C Wash Buffer 2 0 1x SSC 0 1 SDS to the beads and pipette up and down to mix the sample Incubate for 10 min at 45 C Pellet beads with the magnetic plate for two min and remove supernatant 10 Repeat step 2 11 9 2 times for a total of 3 higher stringency washes at 45 C After the
15. size of 100 200 bp Pipette up and down several times to mix the samples 3 Incubate at room temperature for 10 min Collect the liquid at the bottom of the tube by brief centrifugation Place the tube back on the magnetic plate and let it stand for 5 10 min to separate the beads from the solution Pipette offand discard the supernatant without removing the beads 4 Leaving the tube on the magnetic rack wash the beads by adding 186 uL of freshly prepared 70 ethanol Let stand for 1 min and remove the supernatant Keep the tube on the magnetic rack do not disturb the beads 5 Repeat step 4 one more time for a total of two washes 6 Remove residual traces of ethanol Let the beads air dry for 5 min at room temperature without caps 7 Proceed to the next step immediately III Blunt end repair After shearing overhanging S and 3 ends are repaired by T4 DNA polymerase and S phosphates are attached using T4 polynucleotide kinase If working with ancient or fragmented lt 100 bp DNA skip the size selection step and concentrate the samples using a speed vac Elute the concentrated DNA in 16 32 uL nuclease free water Replace the water in the recipe below adding the entire concen trated sample in its place After the blunt end repair skip step L III 3 Instead incubate the reaction at 75 C for 20 min to deactivate the enzymes followed by a ramp step decreasing to 12 C at the rate of 1 C s Immediately proceed to the li
Download Pdf Manuals
Related Search