Home

Automated DNA Sequencing

1. Figure 7 27 Rhodamine dye terminator data from the same template using a 30 mer primer and AmpliTaq DNA Polymerase Weak signal can also result if the primer anneals poorly due to secondary structure particularly at the 3 end Whether or not a primer is likely to have significant secondary structure can be determined by analyzing its sequence with one of several primer design programs that are available such as Primer Express software P N 402089 7 20 Data Evaluation and Troubleshooting Two or More Sequences Present More than one sequence can be present in an electropherogram if The primer used in the reaction is contaminated with N 1 primer primer that is one base shorter than the desired primer More than one primer is present in the sequencing reaction There is a secondary hybridization site for the primer in the template In each case there will be two or more sequences in the electropherogram The data will look similar to that shown in Figure 7 28 with peaks under peaks except where the bases in both sequences are the same Figure 7 28 shows data from a sequencing reaction where the primer was contaminated with N 1 primer Careful examination of the data from such a reaction shows that the two sequences are identical except that the sequence from the N 1 primer is one base shorter than the sequence from the full length primer For example the G at base 63 i
2. ar D A C C G amp R Cj Ae cao Figure 1 4 One cycle of dye terminator cycle sequencing Features of Dye labeled Terminator Reactions Anunlabeled primer can be used Dye terminator reactions are performed in a single tube They require fewer pipetting steps than dye primer reactions Four color dye labeled reactions are loaded in a single gel lane or capillary injection False stops i e fragments that are not terminated by a dideoxynucleotide see page 7 30 go undetected because no dye is attached See Chapter 2 for information on ABI PRisM DNA sequencing kits Introduction 1 5 Dye Labeled With dye primer labeling primers are tagged with four different fluorescent dyes Primers Labeled products are generated in four separate base specific reactions The products from these four reactions are then combined and loaded into a single gel lane or capillary injection Figure 1 5 1 6 Introduction N reaction specific ddNTP D e z Ques ACCGTIA DENATURATION ANNEALING EXTENSION PRODUCTS Enzyme dNTPs EE gt v v Q v E ji v v C v Q v C oo Figure 1 5 One cycle of dye primer cycle sequencing Features of Dye labeled Primer Reactions Dye primer chemistries generally produce more even signal i
3. 1 Place the tubes in a thermal cycler preheated to 95 C 2 Repeat the following for 15 cycles Rapid thermal rampa to 95 C 95 C for 30 sec Rapid thermal ramp to 55 C 55 C for 30 sec Rapid thermal ramp to 70 C 70 C for 1 min gt gt gt gt Repeat the following for 15 cycles Rapid thermal ramp to 95 C 95 C for 30 sec Rapid thermal ramp to 70 C 70 for 1 min 4 Rapid thermal ramp to 4 C and hold until ready to pool and precipitate a Rapid thermal ramp is 1 C sec BAC DNA on the GeneAmp 9700 in 9600 Emulation Mode or 9600 Note This protocol is for use only with the BigDye primer kits Step Action 1 Place the tubes in a thermal cycler set the volume at 10 uL and begin thermal cycling with the following parameters Rapid thermal rampa to 95 C 95 C for 5 min Repeat the following for 20 cycles Rapid thermal ramp to 95 C 95 C for 30 sec Rapid thermal ramp to 50 C 50 C for 15 sec Rapid thermal ramp to 70 C 70 C for 1 min gt e e gt o Repeat the following for 15 cycles Rapid thermal ramp to 95 C 95 C for 30 sec Rapid thermal ramp to 70 C 70 for 1 min 4 Rapid thermal ramp to 4 C and hold until ready to pool and precipitate a Rapid thermal ramp is 1 C sec 3 30 Performing DNA Sequencing Reactions Cycle Seque
4. Different laboratories may obtain different results We recommend testing several gel formulations to see which works best under your particular run conditions Table A 1 lists recommended gel formulations for the ABI 373 and ABI PRISM 377 DNA Sequencers Table A 1 Gel Formulations 34 cm or 36 cm well to read wtr 48 cm well to read wtr Volume Volume Instrument Gel Type mL Gel Type mL ABI 373 6 19 1 polyacrylamide 80 4 75 19 1 polyacrylamide 80 4 19 1 polyacrylamide 100 5 29 1 polyacrylamide 80 4 25 29 1 polyacrylamide 100 5 75 Long Ranger 80 5 Long Ranger 100 5 75 PAGE PLUS 80 5 25 PAGE PLUS 100 ABI PRISM 377 4 19 1 polyacrylamide 50 4 19 1 polyacrylamide 50 4 5 29 1 polyacrylamide 50 4 25 29 1 polyacrylamide 50 5 Long Ranger 50 4 75 Long Ranger 50 4 8 PAGE PLUS 50 5 25 PAGE PLUS 50 a Used for 24 cm well to read gels Gel Preparation A 1 Protocol and Run Conditions for 19 1 Polyacrylamide Gels Action Preparing 40 Acrylamide Stock Step 19 1 1 Working in a fume hood combine the following acrylamide and bisacrylamide in a glass beaker Acrylamide 57 g Bisacrylamide 3 g WARNING CHEMICAL HAZARD Acrylamide and bisacrylamide are poisons neurotoxins irritants carcinogens and possible teratogens Acrylamide and bisacrylamide sublime the solids release toxic vapor and are harmful if swallowed inhaled or absorbed throug
5. Evaluating data using the information in the gel file and sample files page 7 2 Practical examples of evaluating data page 7 10 Troubleshooting sequencing data DNA sequencing reactions page 7 16 DNA sequence composition page 7 30 Gel electrophoresis page 7 44 Capillary electrophoresis page 7 55 Software settings page 7 62 Data Evaluation and Troubleshooting 7 1 Data Evaluation Introduction Gel Files There are many variables associated with DNA sequencing that can affect data quality Understanding the data evaluation tools that are available in the Sequencing Analysis software can help in determining where problems may have occurred in the sequencing process This section provides an introduction to these tools The gel file stores the raw data collected during the entire run of an ABI 373 or ABI Prisv 377 instrument Initially the file contains the raw data collected during the run a gel image a copy of the data collection sample sheet and a copy of the instrument file After lane tracking and editing the file also contains the lane tracking information and any changes made to the original information in the file Note The ABI PRism 310 Genetic Analyzer does not use gel files because samples are run consecutively in a capillary not on a gel After the gel image has been generated and the lanes tracked you should perform the following steps Check the gel image for accurate lane
6. In This Chapter Theory of Polyacrylamide Gels This chapter describes the following Theory of polyacrylamide gels Reagents used to make sequencing gels Avoiding problems with sequencing gels Refer to page 7 44 for information on troubleshooting gel electrophoresis Many variables are involved in determining the number of bases you can expect to read when sequencing DNA One of the most important of these is the polyacrylamide gel Polyacrylamide gels are formed by co polymerization of acrylamide and bisacrylamide The reaction is a vinyl addition polymerization initiated by a free radical generating system Polymerization is initiated by TEMED tetramethylethylenediamine and APS ammonium persulfate The TEMED acts as an electron carrier to activate the acrylamide monomer providing an unpaired electron to convert the acrylamide monomer to a free radical The activated monomer then reacts with an unactivated monomer to begin the polymer chain reaction The elongating polymer chains are randomly crosslinked by bisacrylamide resulting in closed loops and a complex web polymer with a reproducible porosity that depends on the polymerization conditions and monomer concentration Polymerization depends on factors such as concentration of initiator temperature pH additives breakdown products and impurities in the chemicals and water used Light and high temperature can cause autopolymerization of linear acryl
7. Incorrect Run Module Incorrect Dye Set Primer Mobility File This section shows examples of problems that can occur in sequencing data when software settings are incorrect Figure 7 62 shows data from a dRhodamine terminator sample which should have been collected with a Filter Set E run module but was collected using a Filter Set A run module Note One of the most common mistakes made with the new dRhodamine based chemistries is to collect data using Filter Set A If you collect data using the wrong filter set you should rerun the samples If this is impossible a matrix can be made from the data on the ABI PRISM 310 and ABI PRISM 377 instruments see page 6 14 Data analyzed this way will not be free of multicomponenting noise TGCATTAATGAATNGGCNAACGCGCGGGGAGAGGCGGTTTGCGTATTG 290 300 31C 320 330 Figure 7 62 dRhodamine terminator sample run with a Filter Set A run module If you analyze data with the wrong mobility file the data can be reanalyzed with the correct mobility file as described in your user s manual Analyzing BigDye primer data with a mobility file for dRhodamine terminator or BigDye terminator chemistry or vice versa causes both shifted peaks and miscalled bases Figure 7 63 These three chemistries use the same dyes for fluorescence emission but on different bases See Chapter 2 especially page 2 14 for more information Figure 7 63 shows BigDye terminator data analyzed with a BigDye prime
8. Lancer UK Ltd 1 Pembroke Avenue Waterbeach Cambridge CB5 9QR Telephone 44 01223 861665 Fax 44 01223 861990 Sequencing plate rack 50 SPR 16 Lancer USA Inc as listed plate capacity for Lancer above dishwasher Labconco Undercounter 15 352 801 Fisher Scientific Glassware U S Headquarters 585 Alpha Drive Pittsburgh Pennsylvania 15238 Customer Service 1 800 766 7000 Fax 1 800 926 1166 Internet http www fishersci com We also recommend the following for preventing contamination of gel plates Clean plates as soon as possible following electrophoresis Once dry avoid excessive handling of the plates with ungloved hands Removing Contaminants The following procedures are not meant to be used for regular gel plate maintenance but for decontamination For regular plate cleaning we recommend using a dishwasher with a hot deionized water rinse see page 4 6 WARNING Preparation of all solutions should be carried out in a hood using safety glasses gloves and other appropriate protective clothing To perform an alcoholic KOH wash Step Action 1 Add 30 35 g of potassium hydroxide KOH or sodium hydroxide NaOH pellets to a plastic bottle WARNING Potassium hydroxide is hygroscopic and caustic It can cause severe burns and blindness if it comes in contact with the skin or eyes Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropr
9. PE Applied Biosystems A DIVISION OF PERKIN ELMER 850 Lincoln Centre Drive Foster City CA 94404 1128 P N 4305080 Rev A
10. Did not use deionized water Use only deionized or distilled water for making all solutions Gel loses signal around 200 bp see page 7 51 Contaminant polymers on plate surface Wash plates with mild detergent and hot deionized water rinses Lanes appear as smears Impure or degraded TEMED or APS Use fresh reagents Samples are overloaded Follow loading procedure Electrophoresis failure due to buffer leak see Figure 7 54 on page 7 48 Make sure that the plates are clamped correctly and that the upper buffer chamber gasket makes a proper seal Do not spill buffer behind the upper buffer chamber as wicking can occur Gel image contains vertical red streaks near end of run top of gel image red rain see Figure 7 55 on page 7 49 Gel destruction in read region Wrap the gel to prevent drying Run at a lower temperature or voltage Gel image contains green blue streaks throughout run see Figure 7 52 on page 7 46 Fluorescent contaminant in gel Vacuum filter solution Cast gel in dust free environment Urea crystals present in gel Use room temperature reagents Pour at 20 23 C IMPORTANT Do not refrigerate Particles on outer surface of plates in read region Wipe read region with damp lint free KimWipe Blue or green streaks curtain at top of gel image see Figure 7 53 on page 7 47 Buffer leak Make sure that the plates are clampe
11. Refer to your instrument user s manual for general instructions on creating instrument files To make the Dye Primer Matrix Step Action 1 Launch the Data Utility software located in the Utilities folder within the Sequencing Analysis folder 2 From the Utilities menu choose Make Matrix The Make Matrix dialog box appears as shown below Verify that the Dye Primer Matrix button at the lower left is selected Make Matrix Start at Start at Start at Start at Points Instrument Comment Dye Primer Matrix Taq Terminator Matrix OT Terminator Matrix 3 Click on the box for each nucleotide base and select the sample file that corresponds to the correct matrix standard as shown in the table below Dye Primer Box Matrix Cui dR110 A dR6G G dTAMRA T dROX 4 For each matrix standard sample start with the default value of 2000 for the start point Start with the default value of 1500 for the number of data points to analyze Note If the default values do not work follow the instructions for using other values in steps 8 and 9 below 6 8 Optimizing Software Settings To make the Dye Primer Matrix continued Step Action 5 Click New File A dialog window appears as shown below Name the file dRhod_BigDye or another appropriate name and save it in the ABI folder within the System
12. A G or T U A S W K GorT Keto H A C or T D H W S M A or C aMino V A C orG H D B V R A or G puRine N aNy base N N V B TUB Codes B 1 References Literature Ausubel F M Brent R Kingstin R E Moore D D Seidman J G Smith J A and References Struhl K eds 1998 Current Protocols in Molecular Biology John Wiley and Sons New York NY p A 3 0 2 Barr P J Thayer R M Laybourn P Najarian R C Seela F and Tolan D R 1986 7 deaza 2 deoxyguanosine 5 triphosphate enhanced resolution in M13 dideoxy sequencing Bio Techniques 4 428 432 Baskaran N Kandpal R P Bhargava A K Glynn M W Bale A and Weissman S M 1996 Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content Genome Res 6 633 638 Burgett S G and Rosteck P R Jr 1994 Use of dimethyl sulfoxide to improve fluorescent Taq cycle sequencing In Automated DNA Sequencing and Analysis ed Adams M D Fields C and Venter J C Academic Press San Diego CA pp 211 215 Devine S E and Boeke J D 1994 Efficient integration of artificial transposons into plasmid targets in vitro a useful tool for DNA mapping sequencing and functional analysis Nucleic Acids Res 22 3765 3772 Devine S E Chissoe S L Eby Y Wilson R K and Boeke J D 1997 A transposon based strategy for sequencing repetitive DNA in eukaryotic genomes Genome Res 7 551 563 Ferna
13. BaaCaTAAA GCACACATAGACAATT TT TTAA atc Naa TOATaAAA G CC acGaNTc a acCaTa GagaaTec oT TaGAA A c Ta GM aa cTTNa G TOCA aa a aagana a 4 1o cco i o ceo cso 60 ove cgo cso 00 10 Figure 7 3 Electropherogram from the sample run in lane 29 of the gel in Figure 7 1 on page 7 4 The arrow points to the miscalled base at position 244 caused by poor resolution Using the Raw Data View If the electropherogram is acceptable it is not necessary to look at the raw data However looking at the raw data can be helpful in the following cases The data has a poor signal to noise ratio The data has anomalies The data was not analyzed The Peak 1 Location and Start Point for data analysis were chosen incorrectly or a different Start Point is desired The raw data view shows the following Signal balance during the course of the run Abrupt signal changes during the run Elevated baselines Spikes on the ABI PRISM 310 Genetic Analyzer Figure 7 4 on page 7 7 shows the raw data from lane 29 of the gel in Figure 7 1 on page 7 4 The raw data is weak and has excess dye peaks which we already know from looking at the gel image and electropherogram 7 6 Data Evaluation and Troubleshooting Figure 7 4 Raw data from the sample run in lane 29 of the gel in Figure 7 1 on page 7 4 If analysis fails the raw data is the default window that appears when opening the sample file Figure 7 5 shows a failed BigDye terminator reaction
14. Mix by inverting the tube Incubate on ice for 5 minutes Remove cellular debris by spinning in a microcentrifuge at maximum speed for 10 minutes at room temperature Transfer the supernatant to a clean tube Add RNase A DNase free to a final concentration of 20 g mL Incubate the tube at 37 C for 20 minutes Extract the supernatant twice with chloroform a Add 400 uL of chloroform b Mix the layers by inversion for 30 seconds c Centrifuge the tube for 1 minute to separate the phases d Transfer the upper aqueous phase to a clean tube Add an equal volume of 100 isopropanol Mix the contents of the tube by inversion 10 Spin the tube in a microcentrifuge at maximum speed for 10 minutes at room temperature 11 Remove the isopropanol completely by aspiration 12 Wash the DNA pellet with 500 uL of 70 ethanol Dry under vacuum for 3 minutes 13 Dissolve the pellet in 32 uL of deionized water 14 Add 8 0 uL of 4 M NaCl then 40 uL of autoclaved 13 PEG 8000 15 Mix thoroughly then leave the sample on ice for 20 minutes 16 Pellet the plasmid DNA by spinning in a microcentrifuge at maximum speed for 15 minutes at 2 6 C 17 Carefully remove the supernatant Rinse the pellet with 500 uL of 70 ethanol 18 Resuspend the pellet in 20 uL of deionized water Store at 15 to 25 C 3 8 Performing DNA Sequencing Reactions BAC DNA Templa
15. Nucleic Acids Res 25 4500 4504 Sanger F Nicklen S and Coulson A R 1977 DNA sequencing with chain terminating inhibitors Proc Natl Acad Sci USA 74 5463 5467 Tabor S and Richardson C C 1990 DNA sequence analysis with a modified bacteriophage T7 DNA polymerase effect of pyrophosphorolysis and metal ions J Biol Chem 265 8322 8328 Tabor S and Richardson C C 1995 A single residue in DNA polymerases of Escherichia coli DNA polymerase family is critical for distinguishing between deoxy and dideoxynucleotides Proc Natl Acad Sci USA 92 6339 6343 Thomas M G Hesse S A McKie A T and Farzaneh F 1993 Sequencing of cDNA using anchored oligo dT primers Nucleic Acids Res 16 3915 3916 Thweaitt R Goldstein S and Shmookler Reis R J 1990 A universal primer mixture for sequence determination at the 3 ends of cDNAs Anal Biochem 190 314 316 Watson J D Hopkins N H Roberts J W Steitz J A and Weiner A M 1987 Molecular Biology of the Gene 4th ed Benjamin Cummings Menlo Park CA WWW Sites Werle E Schneider C Renner M Volker M and Fiehn W 1994 Convenient single step one tube purification of PCR products for direct sequencing Nucleic Acids Res 22 4354 4355 5 gt gt gt Bio Rad Laboratories http www bio rad com cgi bin Tango cgi ApplicationBits literature qry Centre National de S quengage CNS or G noscope http www cns fr
16. On the ABI PRISM 377 DNA Sequencer there is a filter to keep out most of the scattered laser light but data quality will still suffer Gel Plate Cleaning Cleaning gel plates properly is very important to prevent plate contamination and obtain good data Plate contamination can cause the following problems with gels Gel extrusion see page 4 9 Artifacts and background from fluorescent contamination see Figure 7 52 on page 7 46 Poor resolution Temporary loss of signal see page 4 9 Regular Cleaning We recommend using a laboratory dishwasher with a hot deionized water 90 C rinse for regular cleaning The quality of the water and its temperature pressure and volume are critical for effective cleaning Rinse residual gel material before placing plates in the dishwasher Use the longest deionized water rinse cycle initially followed by a drying cycle After some experimentation you may be able to reduce the rinse time The use of detergents is not necessary when a dishwasher is used If a dishwasher is not available then wash plates with a dilute solution of Alconox detergent Rinse with hot water then rinse again with deionized water 4 6 Optimizing Gel Electrophoresis The following dishwashers have been found to work well Dishwasher P N Supplier Lancer 1600 dishwasher Lancer 1600 UP Lancer USA Inc with facility for drying 705 West Highway 434 Longwood Florida 32750 Telephone 407 332 1855
17. Optimizing Capillary Electrophoresis 5 3 Optimizing Electrokinetic Injection Introduction Optimizing electrokinetic injection can greatly improve data quality and run to run reproducibility The goal is to inject sufficient DNA to yield peaks of adequate height that is data with a good signal to noise ratio while maintaining resolution and read length The ABI PRISM 310 run modules have preset values for injection times and voltages These values are adequate for most applications However you should consider modifying the injection parameters if the signal is too strong or too weak or if the resolution is poor Signal Too Strong Decrease the injection time Decrease the injection voltage Signal Too Weak Increase the injection time The default injection time is 30 seconds We do not recommend injection times gt 120 seconds Increase the injection voltage Increase the voltage in 1 2 kV increments The maximum possible injection voltage is 15 kV Reduce the amount of salt in the sample IMPORTANT Negative ions e g EDTA and acetate compete with DNA for injection To reduce the amount of salt in a sequencing reaction use a spin column see page 3 34 Poor Resolution Decrease the injection time This will decrease the signal strength so you may need to increase the injection voltage Modifying Injection When you modify the injection time you will encounter a tradeoff between signal Time strength and
18. Step Action 1 Spin the cultures in a centrifuge at 3250 rpm for 15 minutes to pellet the cells 2 While the cells are pelleting add 120 uL of PEG solution to each tube in a second 96 tube box 3 Carefully transfer 0 6 mL of M13 supernatant from each tube from the first box to the corresponding tube in the second box Cover the tubes with a Beckman 96 cap sealer and invert several times to mix 5 Leave the tubes at room temperature for 30 minutes then chill at 2 6 C for 30 minutes 6 Spin the cultures in a centrifuge at 3250 rpm for 15 minutes to pellet the M13 particles 7 When centrifugation is finished check for pellets by discarding the supernatant from a single row Be sure to place the row back in place correctly If the pellets are present then discard the supernatant from the rest of the samples Place the inverted tubes on a paper towel for a few minutes to drain 9 With the tubes still inverted place them on a dry paper towel in the centrifuge carrier Spin the inverted tubes in a centrifuge at 300 rpm for 3 5 minutes to remove all traces of PEG After spinning check to see that the pellets have stayed at the bottoms of the tubes To extract the M13 DNA Step Action 1 Add 20 uL of TTE buffer to each tube 2 Seal the tubes with aluminum foil tape and vortex vigorously Note Ensure that the pellet is well suspended 3 Heat the tubes at 80 C for 10 minutes in a water bath 1
19. banding Modified alkaline lysis PEG precipitation method see below PureGene DNA Isolation Kit Gentra Systems Inc P N D 5500A QIAGEN Plasmid Kits http Awww qiagen com Mini P N 12123 25 reactions 12125 100 reactions Midi P N 12143 25 reactions 12144 50 reactions 12145 100 reactions Maxi P N 12162 10 reactions 12163 25 reactions 12165 100 reactions gt e Modified Alkaline Lysis PEG Method Reagents required Chloroform WARNING CHEMICAL HAZARD Chloroform is extremely toxic and a potential human carcinogen This chemical is highly corrosive to skin and eyes Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Deionized water Ethanol 70 GET buffer 50 mM glucose 10 mM EDTA 25 mM Tris pH 8 0 Isopropanol 100 anhydrous PEG 8000 13 sterilized by autoclaving rather than by filtration WARNING CHEMICAL HAZARD Polyethylene glycol 8000 PEG can be harmful if inhaled ingested or absorbed through the skin It is irritating to the eyes skin and mucous membranes Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves gt gt gt Potassium acetate 3 M pH 4 8 RNase A DNase free 10 mg mL Sodium chloride NaCl 4 M Sodium hydroxide NaOH 0 2 N with 1 SDS freshly made W
20. bands virtual filters and stored as digital signals on a Power Macintosh computer for processing The Sequencing Analysis software see page 1 16 interprets the result calling the bases from the fluorescence intensity at each data point Refer to the ABI PRISM 310 Genetic Analyzer User s Manual P N 903565 for more information Virtual Filter Sets ABI PRISM 310 and ABI PRISM 377 All Models These instruments use virtual filter sets to detect light intensity in four non overlapping regions on a CCD camera Each region corresponds to a wavelength range that contains or is close to the emission maximum of an ABI PRISM dye The process is similar to using a physical filter to separate light of different wavelengths However the filter sets are called virtual filters because the instruments use no physical filtering hardware to perform the separation 2 The exact positions of the CCD regions and the dye combinations appropriate to these positions depend upon the virtual filter set used For example with Virtual Filter Set E the instrument records the light intensity in four regions or windows centered at 540 nm 570 nm 595 nm and 625 nm The window positions in each virtual filter set have been optimized to provide the maximum possible separation among the centers of detection for the different dyes while maintaining good signal strength The Data Collection Software color codes the intensity displays from the four ligh
21. buffer 3 50 sample loading volumes 3 51 preparing cycle sequencing reactions 3 21 to 3 26 dye primer chemistries 3 24 to 3 26 dye terminator chemistries 3 21 to 3 24 primer design and choosing 6 3 to 6 5 chemistry specific mobility information 6 4 using the wrong file 6 3 mobility correction described 1 13 troubleshooting software settings 7 62 dye spectra 2 12 dye terminator chemistries cycle sequencing 3 27 to 3 29 cycle sequencing kits 2 2 to 2 7 BigDye terminators 2 5 to quantitation 3 18 to 3 19 2 6 DNA templates dRhodamineterminators 2 3 determining quality of to 2 5 templates 3 15 to 3 16 DNA template quantity 3 17 rhodamine dye terminators 2 2 to 2 3 preparing dye spectra 2 12 BAC DNA templates 3 9 dye base relationships table performing DNA of 2 14 Peak 1 Location for data analysis 6 18 to 6 20 preparing sequencing reactions 3 21 to 3 24 dye base relationships 2 14 reactions 3 2 to 3 9 plasmid DNA templates 3 6 to 3 8 single stranded DNA templates 3 2 to 3 6 dye labeled primers description of 1 6 part numbers E 3 dye labeled terminators description of 1 5 E electrokinetic injection optimizing 5 4 to 5 6 description of 5 4 modifying injection time 5 4 to 5 5 modifying injection voltage 5 6 setting electrokinetic injection values 5 6 electrophoresis preparing extension products 3 33 to 3 49 96 well plate purification protocol 3 35 dye primer chemistries 3 33 procedures 3 46 to 3 49
22. carefully aspirate the supernatant and discard Dry the pellet in a vacuum centrifuge for 10 15 minutes or until dry Do not over dry Alternatively place the tubes with the lids open in a heat block or thermal cycler at 90 C for 1 minute 3 42 Performing DNA Sequencing Reactions Ethanol MgCl Note These procedures are for use only with the rhodamine dye terminator and Precipitation dRhodamine terminator chemistries These procedures require 70 ethanol EtOH containing 0 5 mM MgCl This reagent can be prepared in situ or as a stock solution IMPORTANT Use non denatured 95 ethanol rather than absolute 100 ethanol to prepare 70 ethanol solutions Absolute ethanol absorbs water from the atmosphere gradually decreasing its concentration This can lead to inaccurate final concentrations of ethanol which can affect some protocols To prepare 70 EtOH 0 5 mM MgCl stock solution Step Action 1 Combine the following in a 1 5 mL microcentrifuge tube 1mL70 EtOH 1yL0 5MMgClo 2 Vortex briefly to mix Precipitation in 96 Well MicroAmp Trays Equipment required Variable speed table top centrifuge with microtiter plate tray capable of reaching at least 1400 x g Strip caps or adhesive backed aluminum foil tape 3M Scotch Tape 425 3 To precipitate extension products in MicroAmp Trays Step Action 1 Remove the MicroAmp Tray from the thermal cycler Remove t
23. i e which instrument and the number of gel lanes In general a very clean template with a perfectly matched primer of good cycle sequencing characteristics will produce enough signal However GC rich templates tend to give weaker signals so more of the sample should be loaded The optimal range of total signal strength is 400 4000 For dRhodamine based chemistries the lower limit can be 200 The total signal is calculated by adding the signals for all four bases These numbers are located in the annotation view of the analyzed sample file see page 7 8 and at the top of the electropherogram printout Acceptable sequence can be obtained from data with total signal strength below these numbers However the background will be more noticeable and can interfere with basecalling especially at the end of the run If the total signal strength is below 400 200 for dRhodamine based chemistries and the quality of the data is unacceptable more of the reaction needs to be loaded If 100 of the reaction was already loaded try any of the following Check the quantitation and purity of the template Adjust the amount of template Sometimes adding 25 50 more template can raise signals Use a high sensitivity sequencing method 2X volume reaction Repurify the template to ensure that salt and ethanol contaminants are removed Ensure that the primer is suitable for the template and has good melting characteristics ideally having a Tm
24. 000 0 151 0 115 0 282 0 529 1 000 0 115 0 282 0 529 1 000 K Copy T Term Matrix 1 000 0 12 0 011 0 000 0 455 1 000 0 183 0 000 0 248 0 483 1 000 0 151 0 115 0 282 0 529 1 000 3 Make sure that all three matrix files have numbers that range from 0 1 The numbers on the diagonals from top left to bottom right should be 1 and the off diagonal numbers should decrease moving away from the diagonal in any direction If not then repeat the matrix making procedure starting with To make the Dye Primer Matrix on page 6 8 Note The corresponding numbers for all three matrix files will be the same or within 0 001 because of rounding 4 Click Cancel 5 Open or restart the Sequencing Analysis software and use dRhod_BigDye as the instrument file to analyze your sequencing data Optimizing Software Settings 6 13 Making an An instrument file can be made from matrix standards as explained above or it can be Instrument File from made from a sample file This procedure requires fewer steps than running matrix a Sample File standards however the matrix made from a sample file may not be as good as one made from matrix standards The quality of a matrix file made from a sample file depends on the quality of the sample file used The best samples to choose for making a matrix have approximately 25 each of A C G and T A good example of this is the pGEM control DNA that is included in every PE Applied Biosystems cycle sequenci
25. 3 35 T tables choosing a sequencing chemistry 2 15 to 2 16 DNA quantity used in sequencing reactions 3 17 dye set primer mobility files 6 5 dye base relationships 2 14 methods of preparing extension products for electrophoresis 3 33 run modules 6 2 sample loading volumes gel electrophoresis 3 51 troubleshooting capillary electrophoresis 7 57 to 7 61 troubleshooting gel electrophoresis 7 53 to 7 54 troubleshooting sequencing data 7 39 to 7 43 TBE buffer 4 2 preparing A 15 D 1 to D 4 e mail address phone fax D 1 Fax on Demand D 2 Internet WWW address D 1 regional offices D 3 to D 4 telephone hours D 1 TEMED gel electrophoresis 4 3 temperature avoiding gel problems 4 4 run temperature optimizing for capillary electrophoresis 5 7 Template Suppression Reagent TSR capillary electrophoresis 5 2 templates determining DNA template quality 3 15 to 3 16 Index 5 DNA template quantity 3 17 amount used 3 17 quantitation 3 17 preparing DNA templates 3 2 to 3 9 BAC 3 9 plasmid 3 6 to 3 8 single stranded 3 2 to 3 6 sequencing PCR templates 3 10 to 3 14 troubleshooting poor quality template 7 16 thermal cyclers preparing sequencing reactions 3 20 Tm estimating 3 18 troubleshooting avoiding problems with sequencing gels 4 4 to 4 9 cleaning gel plates 4 6 to 4 9 contaminants 4 4 gel plate quality 4 6 polymerization 4 4 to 4 5 red streaks 4 5 using fresh gels 4 5 capillary el
26. 7 19 This would also happen if the wrong primer is used for a particular vector or if a mutation is present in the primer binding site in the vector that results in the primer not working effectively Such a mutation is present in some samples of pUC18 and vectors such as pUC118 that were derived from it Lobet et al 1989 These vectors are missing a C in the lacZ region that is complementary to the 3 base for some reverse sequencing primers Very Weak Signal The signal in sequencing reactions can be very weak if the primer anneals poorly because of a low melting temperature Tm Generally primers should have a Tm above 45 C see Primer Design on page 3 18 In some cases however lowering the annealing temperature in the reaction can help in obtaining good signal The primer used to generate the sequence data in Figure 7 26 was 15 bases long and had a Tm of 41 C The same template was resequenced with a 30 mer primer that had a melting temperature of 58 C Figure 7 27 CGGAACCCCTATTTGTNCANNTCTCTANNTACATTICANATATGTATCCGNTCATG AG ACA NTAACCCTGATAAATG CT CANN 70 80 90 100 110 120 136 14C ji Figure 7 26 Rhodamine dye terminator data using a 15 mer primer and AmpliTaq DNA Polymerase EGGRACCCOTATTTIGTTTATTITICTAAATACATTC AAATATGTATCCE CTCATG AG ACAATAACCCTIGATARATECTTCAATA 120 130 140 150 160 170 180 190
27. 8 consumables 5 2 to 5 3 effect of salt contamination 5 4 electrokinetic injection 5 4 to 5 6 electrophoresis conditions 5 7 run parameters for sequencing chemistries 5 8 preparing and loading samples 3 53 to 3 54 loading the sample 3 54 preparing reaction mixture 3 53 preparing the sample 3 53 sample volume 3 53 Index 2 troubleshooting 7 55 to 7 61 table 7 57 to 7 61 CATALYST 800 cycle sequencing 3 31 chemistries AmpliTaq DNA Polymerase FS 1 5 chemistry specific mobility information 6 4 choosing a sequencing chemistry 2 15 to 2 16 compatibility with filter sets 2 13 compatibility with instruments 2 13 dye primer cycle sequencing kits 2 8 to 2 11 BigDye primers 2 9 to 2 11 fluorescein rhodamine dye primers 2 8 to 2 9 dye spectra 2 12 dye terminator cycle sequencing kits 2 2 to 2 7 BigDye terminators 2 5 to 2 6 dRhodamineterminators 2 3 to 2 5 rhodamine dye terminators 2 2 to 2 3 dye base relationships 2 14 dye labeled primers description of 1 6 dye labeled terminators description of 1 5 run parameters for capillary electrophoresis 5 8 chemistry guide what s new in this guide 1 1 cleaning dirty templates 3 16 compressions troubleshooting sequencing data 7 31 to 7 32 7 43 consumables capillary electrophoresis 5 2 to 5 3 contamination affecting quality of DNA template 3 15 avoiding problems with sequencing gels 4 4 control DNA effect on template quality 3 15 Custom Oligonucleotide Synthesis Serv
28. 920 930 940 950 960 970 980 990 Figure 2 6 Sequence data obtained from a plasmid with BigDye primers Reactions were run on an ABI PRISM 377 DNA Sequencer with a 5 25 PAGE PLUS 48 cm well to read gel BigDye Primer The ABI PRISM BigDye Primer Cycle Sequencing Ready Reaction Kits combine Ready Reaction Kits AmpliTaq DNA Polymerase FS the new BigDye primers and all the required components for the sequencing reaction The kits contain nucleotide mixes that have been specifically optimized for AmpliTaq DNA Polymerase FS The deoxy and dideoxynucleotide ratios in the nucleotide mixes have been formulated to give a good signal balance above 700 bases These formulations also contain 7 deaza dGTP in place of dGTP to minimize band compressions In the Ready Reaction format the dye labeled primers deoxynucleoside triphosphates dideoxynucleoside triphosphates AmpliTaq DNA Polymerase FS r Tth pyrophosphatase magnesium chloride and buffer are premixed into A C G and T Ready Reaction cocktails to eliminate time consuming reagent preparation These reagents are suitable for performing fluorescence based cycle sequencing reactions 2 10 ABI PRISM DNA Sequencing Chemistries on single stranded or double stranded DNA templates on polymerase chain reaction PCR fragments and on large templates e g the ends of BAC clones The cycle sequencing protocols are optimized for GeneAmp PCR Instrument Systems thermal cyclers the CATALYST 80
29. BaseSprinter or 373 18 run on the ABI 373 ABI100 Typical 1200 scan hr 36 cm well to read gel on the ABI PRISM 377 ABI100 Typical 2400 scan hr 36 cm well to read gel on the ABI PRISM 377 ABI200 48 cm well to read gel on the ABI 373 ABI50 48 cm well to read 5 25 PAGE PLUS gel on the ABI PRISM 377 ABI50 48 cm well to read Long Ranger or 19 1 or 29 1 polyacrylamide gel ABI100 on the ABI PRISM 377 Run with many insertions or deletions near the end of the run SemiAdaptive If the spacing is a negative number SemiAdaptive If the spacing is still a negative number with SemiAdaptive Adaptive If you noticed problems with run conditions Adaptive IMPORTANT Although each basecaller is optimized for a specific type of run depending on your run conditions you might get better data using a different basecaller Analyze your data with different basecallers to determine which one works best for your run conditions IMPORTANT If you reanalyze a sample file the previous analysis results are overwritten by the new results To avoid erasing the previous analysis results save a copy of the sample file under a different name before you reanalyze For more information refer to the ABI PRisw DNA Sequencing Analysis Software User s Manual 6 6 Optimizing Software Settings Creating an Instrument Matrix File Overview When an Instrument File Needs to be Remade Data Utility Software You must use an appropri
30. BigDye Filter Wheel Table 3 5 Loading Amounts for Different Comb Sizes and Chemistries Chemistry Volume pL 18 well 24 well 36 well 48 well 64 well dRhodamine Resuspend 4 4 4 2 2 Terminator Load 2 4 2 4 2 4 1 2 H2 BigDye Resuspend 4 4 4 4 4 Terminator Load 1 2 1 2 m 1 2 1 2 BigDye Primer Resuspend 4 4 4 4 4 Load 1 2 1 2 1 2 1 2 1 2 ABI PRISM 377 All Models Table 3 6 Loading Amounts for Different Comb Sizes and Chemistries Chemistry Volume uL 18 well 36 well 48 well 64 well 96 well Rhodamine Resuspend 6 6 4 6 4 6 4 6 Dye Terminator f oad 1 5 15 15 1 5 15 dRhodamine Resuspend 4 4 2 2 2 Terminator Load 2 2 1 1 1 BigDye 1X reactions Resuspend 6 8 6 8 4 6 4 6 4 6 Terminator Load 0 75 1 5 0 75 15 05 1 0 5 1 0 5 1 0 5X reactions Resuspend 2 2 2 2 2 Load 2 2 1 5 2 1 1 5 1 1 5 2X reactions Resuspend 2 2 1 5 1 5 1 5 Load 2 2 1 5 1 5 1 1 5 Fluorescein Resuspend 6 6 4 6 4 6 4 6 Se a Load 1 5 1 5 1 5 1 5 1 5 BigDye Primer 1X reactions Resuspend 6 6 4 6 4 6 4 6 Load 1 1 5 1 1 5 1 1 1 0 5X reactions Resuspend 2 4 2 4 1 2 1 1 5 1 2 Load 2 2 1 1 1 2X reactions Resuspend 2 2 1 5 1 1 5 Load 2 2 eS 1 1 Performing DNA Sequencing Reactions 3 51 Loading Samples Step Action 1 Resuspend each sample pellet in the appropriate volume of loading buffer according to Table 3 4 through Table 3 6 on page 3 51 Vortex and spin the samples Heat the samples at 95 C for
31. DNA fragments migrate true to molecular weight and no mobility correction is needed However the dye set primer file is needed to tell the software which matrix file is used for analysis and which color is associated with each of the four bases dRhodamine Terminators and BigDye Terminators dRhodamine and BigDye labeled DNA fragments do not necessarily migrate true to molecular weight Some mobility correction is required Mobility shifts and dye set primer file names for the dRhodamine Terminators are similar to those for the BigDye Terminators If a mobility file for the wrong sequencing chemistry is used C and T bases will be miscalled because of differences in which terminators are labeled with which dyes see page 2 14 6 4 Optimizing Software Settings List of Dye Set Primer Files Table 6 2 Dye Set Primer Mobility Files Instrument Sequencing Chemisiry Rhodamine Dye Terminator dRhodamine Terminator BigDye Terminator Fluorescein Rhodamine Dye Primer BigDye Primer ABI PRISM 310 DT POP6 DT5 CEHV A Set AnyPrimer DT POP6 dR Set Any Primer DT DSP dR Set AnyPrimer DT POP6 BD Set Any Primer DP5 CEHV 21M13 DP5 CEHV M13Rev DP5 CEHV SP6 DP5 CEHV T3 DP5 CEHV T7 DP POP6 BD Set 21M13 DP POP6 BD Set M13 Reverse ABI 373 and ABI 373 with XL Upgrade DT4 Ac A Set AnyPrimer DT6 Ac A Set AnyPrimer DP4 Acv2 M13Rev DP4 Ac 21M13 DP4 Ac SP6 DP4 Ac T3
32. Data Evaluation and Troubleshooting 7 41 Troubleshooting Sequencing Data continued Observation Possible Causes Recommended Actions Early signal loss see page 7 14 GC rich region in template Increase the denaturation temperature to 98 C Add DMSO to a final concentration v v of 5 Incubate the reaction at 96 C for 10 minutes before cycling Double all reaction components and incubate at 98 C for 10 minutes before cycling Add 5 10 glycerol or 5 10 formamide to the reactions Linearize the DNA with a restriction enzyme Shear the insert into smaller fragments lt 200 bp and subclone Amplify the DNA using 7 deaza dGTP in the PCR then sequence the PCR product Poor lane tracking such that tracker line diverges from the data Check lane tracking Retrack and reextract lanes if necessary Poor quantitation of primer Quantitate the primer See page 3 19 Poor quantitation of template Quantitate the DNA template especially with PCR products See page 3 17 Excess dye peaks at the beginning of the sequence in dye terminator chemistries see page 7 27 Poor removal of unincorporated dye terminators Choose the Start Point for data analysis to exclude the excess dye peaks See page 6 18 Follow the protocols for excess dye terminator removal carefully See page 3 33 Refer also to the Precipitation Methods to Remove Residual Dy
33. Dilute an aliquot of the culture 1 100 in 2X TY medium and dispense 5 mL aliquots into sterile 10 mL tubes Using the tip of a Pasteur pipette add one agar plug from the recombinant plaque to each 10 mL tube Shake the 10 mL tubes at 37 C for 6 7 hours Note Incubation longer than 6 7 hours may complicate purification To clarify the culture by centrifugation and PEG precipitation Step Action 1 Spin the culture in a centrifuge at 2500 x g for 10 minutes Transfer the supernatant containing the M13 particles to a sterile tube Note The supernatant can be stored for up to 1 month at 2 6 C Spin the supernatant in a centrifuge for 10 minutes at 5000 x g Transfer the resulting supernatant to a fresh 10 mL tube that will withstand centrifugation at 10 000 x g Note This second centrifugation is necessary even if supernatants have not been stored Note The supernatant from the second centrifugation can be stored after addition of 50 uL chloroform mL of supernatant The chloroform kills any remaining bacteria and destroys any enzymes without damaging the DNA Add 1 mL PEG solution to aggregate the M13 particles Mix the culture and PEG solution well and allow the mixture to stand at 2 6 C for 30 minutes Centrifuge the PEG phage suspension for 10 minutes at 10 000 x g to sediment the M13 particles Aspirate and discard the supernatant Invert the tube to drain excess liquid a
34. For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 4 0 uL 2 5X Sequencing Buffer 4 0 uL Template single stranded DNA 50 100 ng double stranded DNA 200 500 ng PCR product DNA 1 100 ng depending on size see Table 3 1 on page 3 17 Primer 3 2 pmol Deionized water q s Total Volume 20 uL 2 Mix well and spin briefly 3 If using the DNA Thermal Cycler TC1 or DNA Thermal Cycler 480 Overlay the reaction mixture with 40 uL of light mineral oil High Sensitivity 2X Reactions for BACs PACs YACs and Cosmids Step Action 1 For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 16 uL DNA Template 0 5 1 0 ug Primer 5 10 pmol Deionized water q s Total Volume 40 uL 2 Mix well and spin briefly Note These high sensitivity reactions have been optimized on the GeneAmp PCR System 9600 or 9700 in 9600 emulation mode The protocols would need to be reoptimized for use on other thermal cyclers The cycle sequencing procedure is on page 3 28 Performing DNA Sequencing Reactions 3 23 High Sensitivity 2X Reactions for Bacterial Genomic DNA Step Action 1 For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 16 uL DNA Template 2 3 ug Primer 6 13 pmol Deionized water q s
35. M13 0 5X PCR product standard plasmid M13 High sensitivity 2X Large DNA template containing 21 M13 modified IMPORTANT Prepare separate tubes for each of the four reactions A C G and T The cycle sequencing procedures for BigDye primers start on page 3 29 1X Reactions Step Action 1 Aliquot the following reagents into four PCR tubes Reagent A uL C uL G uL T uL Ready Reaction Premix 4 4 4 DNA Template see Table 3 1 1 on page 3 17 for quantity Total Volume 5 5 5 2 If using the DNA Thermal Cycler TC1 or DNA Thermal Cycler 480 a Add 20 ut of light mineral oil b Spin to layer the oil over the aqueous reaction Performing DNA Sequencing Reactions 3 25 3 26 0 5X Reactions Dilute 5X Sequencing Buffer 400 mM Tris HCI 10 mM MgCl pH 9 0 P N 4305605 600 reactions 4305603 5400 reactions with four parts deionized water to 1X for use in this procedure Step Action 1 Dilute each Ready Reaction Premix A C G T 1 1 with 1X Sequencing Buffer in a separate tube e g 2 uL of A Mix and 2 uL of 1X Sequencing Buffer 2 Aliquot the following reagents into four PCR tubes for each DNA template Reagent A uL C uL G uL T uL Diluted Ready Reaction 4 4 4 4 Premix DNA Template see 1 1 1 1 Table 3 1 on page 3 17 for quantity Total Volume 5 5 5 5 3 If using the DNA
36. N R Template Plasmid lt 15 kb R R R M13 R R R BAC cosmid lambda large PCR product S R S Bacterial genomic DNA N R N PCR amplicon R R R PCR amplicon heterozygous 50 50 S R R PCR amplicon heterozygous 30 70 N S R PCR amplicon heterozygous 10 90 N N S a R recommended S satisfactory N not recommended b All cycle sequencing chemistries can have difficulties with homopolymers gt 40 bp ABI PRISM DNA Sequencing Chemistries 2 15 The dRhodamine terminators are useful for templates with long homopolymer gt 25 bases stretches or templates with GT rich motifs However the dRhodamine terminators produce weaker signals than the BigDye chemistries More of the sample must be loaded to ensure adequate signal is available This is especially important for running 48 64 and 96 lane gels on the ABI PRISM 377 DNA Sequencer where less signal is detected because the lanes are narrower To compensate for the decreased signal strength with dRhodamine terminators increase the CCD gain from 2 to 4 ABI 373 DNA Table 2 7 provides a list of sequencing applications and suggests kits that best suit Sequencer them Table 2 7 ABI 373 Chemistry Recommendations Fluorescein Rhodamine Rhodamine Dye Terminator Dye Primer DNA Sequencing Application De novo sequencing high throughput Ra R De novo sequencing mid to low throughput R S Compa
37. Optimizing Capillary Electrophoresis Capillaries The capillary has an opaque polyimide external coating except in the window area The laser and detector read samples during electrophoresis through the window in the coating Capillaries are very fragile in the uncoated window area Capillaries should last at least 100 runs if treated properly You may be able to get more injections from a capillary depending on your template preparation methods and run conditions Do not let capillaries with polymer in them dry out Store their ends in buffer or deionized water when not in use Store unused capillaries in a dust free environment Do not touch capillary windows If you do touch a window accidentally clean it with 95 ethanol Signs of capillary failure are the following Decreased resolution High baseline Noisy data Trailing peaks in data Figure 7 59 on page 7 55 Information about the capillaries used on the ABI PRISM 310 Genetic Analyzer is given in Table 5 1 Table 5 1 Capillary Types 10X Genetic Length to Internal Capillary Marking Coated Analyzer Length Detector Diameter Type Color Polymer Used Uncoated Buffer Type cm cm um Rapid green POP 6 internally with EDTA 47 36 50 sequencing uncoated Long read pink POP 6 internally with EDTA 61 50 50 sequencing uncoated Sequencing silver DNA internally without EDTA 47 36 75 Sequencing coated Polymer DSP
38. PCR Templates 3 10 DNA Template Quality 3 15 DNA Template Quantity 3 17 Primer Design and Quantitation 3 18 Reagent and Equipment Considerations 3 20 Preparing Cycle Sequencing Reactions 3 21 Cycle Sequencing 3 27 Preparing Extension Products for Electrophoresis 3 33 Preparing and Loading Samples for Gel Electrophoresis 3 50 Preparing and Loading Samples for Capillary Electrophoresis 3 53 Performing DNA Sequencing Reactions 3 1 DNA Template Preparation Overview The DNA purification method used can affect the quality of the template Some recommendations for purifying DNA templates are given below Prepare adequate template to check purity see Determining DNA Quality on page 3 16 to quantitate the DNA accurately see Quantitating DNA on page 3 17 and to perform the sequencing reactions The recommended quantities for sequencing reactions are shown in Table 3 1 on page 3 17 Single stranded You can use the following methods to prepare single stranded templates such as M13 DNA Templates 4 QIAGEN http Avww giagen com QlAprep Spin M13 Kit P N 27704 50 reactions High throughput ThermoMAX procedure see below PEG precipitation followed by phenol extraction see below ThermoMAX Procedure Cells infected with recombinant M13 phage are grown in liquid medium The growth medium is clarified by centrifugation and PEG precipitation The phage particles are resuspended in buffer and then heated to release
39. Total Volume 40 uL 2 Mix well and spin briefly a Shearing the DNA by passing it seven times through a 21 gauge 1 inch long needle can improve signals Note These high sensitivity reactions have been optimized on the GeneAmp PCR System 9600 or 9700 in 9600 emulation mode The protocols would need to be reoptimized for use on other thermal cyclers The cycle sequencing procedure is on page 3 29 Fluorescein The procedure given here is for the ABI PRISM Dye Primer Cycle Sequencing Ready Rhodamine Reaction Kits Refer to the ABI PRISM Dye Primer Cycle Sequencing Core Kit Protocol Dye Primers P N 402114 for information on preparing reactions with the core kits Step Action 1 Aliquot the following reagents into four PCR tubes Reagent A uL C uL G uL T uL Ready Reaction Premix 4 4 8 8 DNA Template see Table 3 1 1 on page 3 17 for quantity Total Volume 5 5 10 10 2 If using the DNA Thermal Cycler TC1 or DNA Thermal Cycler 480 a Add 20 uL of light mineral oil b Spin to layer the oil over the aqueous reaction The cycle sequencing procedures for fluorescein rhodamine dye primers start on page 3 29 3 24 Performing DNA Sequencing Reactions BigDye Primers The flexibility of the BigDye primers allows three options for cycle sequencing and or M13 Reverse priming site Reaction Type Template Cycle 1X PCR product standard plasmid
40. a Includes the ABI 373 and ABI 373 with XL Upgrade instruments b All models Table 2 2 shows the filter sets and virtual filter sets that are used with the PE Applied Biosystems cycle sequencing chemistries Table 2 2 Sequencing Chemistries and Filter Sets Filter Set Virtual Filter Set ABI 3734 with ABI PRISM 310 and Chemisiry ABI 3734 BigDye Filter Wheel ABI PRISM 3775 Rhodamine A Cannot use these A Dye Terminator chemistries with this Fluorescein instrument Rhodamine configuration Dye Primer dRhodamine Cannot use these A E Terminator chemistries with this BigDye instrument Terminator configuration BigDye Primer a Includes the ABI 373 and ABI 373 with XL Upgrade instruments b All models ABI PRISM DNA Sequencing Chemistries 2 13 Dye Base Relationships for Sequencing Chemistries Overview During the development of a new sequencing chemistry alternative dye base relationships are investigated to see which produces the most uniform signal in the analyzed data For this reason different sequencing chemistries may have different dye base relationships The Sequencing Analysis software compensates for this when the correct dye set primer mobility file is used See page 6 3 The software always displays A as green C as blue G as black and T as red in the electropherogram view of analyzed data Dye Base Relationships Table 2 3 dRhodamine Terminator Dye Base Relatio
41. a point mutation in the amino terminal domain replacing glycine with aspartate at residue 46 G46D which removes almost all of the 5 43 nuclease activity This eliminates artifacts that arise from the exonuclease activity The enzyme has been formulated with a thermally stable inorganic pyrophosphatase that cleaves the inorganic pyrophosphate PP byproduct of the extension reaction and prevents its accumulation in the sequencing reaction In the presence of high concentrations of PP the polymerization reaction can be reversed Kornberg and Baker 1992 a reaction called pyrophosphorolysis In this reaction a nucleoside monophosphate is removed from the extension product with the addition of PP to form the nucleoside triphsphate In a sequencing reaction if a dideoxynucleotide is frequently removed at a particular position and replaced by a deoxynucleotide eventually there is little or no chain termination at that location This results in a weak or missing peak in the sequence data Tabor and Richardson 1990 With dye terminator labeling each of the four dideoxy terminators ddNTPs is tagged with a different fluorescent dye The growing chain is simultaneously terminated and labeled with the dye that corresponds to that base Figure 1 4 DENATURATION ANNEALING EXTENSION PRODUCTS e Enzyme dNTPs x S dye labeled terminators Ale b a n c C O
42. and holding the right direction arrow at the bottom of the window a Click and drag in the window to change the cursor to a cross hair b Move the cursor along the raw data until the region of the desired Stop Point is in view For a PCR product this would be in front of the full length PCR peak Figure 6 3 on page 6 21 or at the end of the sequence peaks c Align the cross hair just before the peak d Read the scan number data point that is reported on the top of the window Use this number as the Stop Point 6 22 Optimizing Software Settings Using Sequencing Analysis Version 3 0 or 3 2 continued Step Action 6 Return to the Sample Manager window Highlight the Stop Point box and enter the information With the Sequencing Analysis software versions 3 0 and 3 2 you can set an earlier Stop Point either manually in the Sample Manager window or automatically by changing the values on the Basecaller Settings page of the Preferences dialog box During basecalling the basecaller considers both the Basecaller Settings in the Preferences and the Stop Point value in the Sample Manager window and stops at the earliest designated endpoint Optimizing Software Settings 6 23 Data Evaluation and Troubleshooting Overview In This Chapter This chapter describes how to use the tools in the Sequencing Analysis software to evaluate and troubleshoot sequencing data The chapter has three parts
43. briefly 4 Leave the tubes at room temperature for 15 minutes to precipitate the extension products Note Precipitation times lt 15 minutes will result in the loss of very short extension products Precipitation times gt 24 hours will increase the precipitation of unincorporated dye terminators Place the tubes in a microcentrifuge and mark their orientations Spin the tubes for 20 minutes at maximum speed IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Carefully aspirate the supernatants with a separate pipette tip for each sample and discard Pellets may or may not be visible IMPORTANT The supernatants must be removed completely as unincorporated dye terminators are dissolved in them The more residual supernatant left in the tubes the more unincorporated dye terminators will remain in the samples Add 250 uL of 70 ethanol to the tubes and vortex them briefly Place the tubes in the microcentrifuge in the same orientation as in step 5 and spin for 10 minutes at maximum speed Aspirate the supernatants carefully as in step 6 Dry the samples in a vacuum centrifuge for 10 15 minutes or to dryness Alternatively place the tubes with the lids open in a heat block or thermal cycler at 90 C for 1 minute 3 40 Performing DNA Sequencing Reactions Ethanol Sodium IMPORTANT Use non denatu
44. by clicking and holding the right direction arrow at the bottom of the window a Click and drag in the window to change the cursor to a cross hair b Move the cursor along the raw data until the region of the desired Stop Point is in view For a PCR product this would be in front of the full length PCR peak Figure 6 3 on page 6 21 or at the end of the sequence peaks c Align the cross hair just before the peak d Read the scan number data point that is reported on the top of the window Use this number as the Stop Point Return to the Sample File Queue display a Highlight the name of the file just inspected and click the Custom Settings window Select the Sample file or files you wish to change Click Custom Settings to display the Analysis Settings dialog box Select the Change Stop Point check box oaog Enter a new number in the entry field Using Sequencing Analysis Version 3 0 or 3 2 Step Action 1 Launch the Sequencing Analysis software if it is not already open 2 In the Sample Manager window click the Add Files button and choose the sample to be analyzed Click Done Highlight the sample name and click the Open Files button to display the raw data or double click the sample file name Zoom in completely From the Window menu choose Actual Size or use the keys on the keyboard Starting at the beginning of the raw data file scroll along the data by clicking
45. cause gradient drift towards the anode Unreacted TEMED will focus at the cathode and produce a more alkaline pH gradient Because TEMED is only active as a free base polymerization is inhibited at low pH Use of more than the recommended volume of TEMED will result in brittle gels TEMED and APS The properties of the gel depend on the concentrations of APS and TEMED Concentrations Optimal amounts of APS TEMED result in long chain lengths low turbidity and gel elasticity These are desirable properties f concentrations of APS TEMED are too low polymerization will be too slow When polymerization is too slow oxygen can enter the monomer solution during the process and inhibit polymerization further Too little polymerization leads to extension products migrating too quickly If concentrations of APS TEMED are too high chain initiation events increase resulting in shorter chain lengths higher gel turbidity and decreased gel elasticity Low percentage acrylamide gels are most sensitive to excess initiator concentrations Excess TEMED increases buffer pH Excess APS acts as a buffer between pH 8 and 9 If you use degraded TEMED or APS the concentration of initiators will be less than that recommended in the protocol Optimizing Gel Electrophoresis 4 3 Avoiding Problems with Sequencing Gels Formulation Contaminants Polymerization Use the correct gel formulation for your instrument and application See Append
46. concentration This can lead to inaccurate final concentrations of ethanol which can affect some protocols Method 1 Step Action 1 Add 53 uL of 95 ethanol 100 uL if sequencing BAC DNA or other high sensitivity reactions to a clean microcentrifuge tube Note The use of sodium acetate is not necessary for precipitation Pipet the extension reactions from the bottom of each of the four tubes into the ethanol mixture Mix thoroughly Note Ifthe TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 1 on page 3 37 Place the tube on wet ice or leave it at room temperature for 10 15 minutes to precipitate the extension products Spin the tube in a microcentrifuge for 10 20 minutes at maximum speed Carefully aspirate the supernatant and discard At this point a pellet may or may not be visible Optional Rinse the pellet with 250 uL of 70 ethanol and spin for 5 minutes in a microcentrifuge Again carefully aspirate the supernatant and discard This may remove some of the salts from the pellet but doing so is often not necessary Note If you use sodium acetate you must rinse the pellet This will reduce the carryover of salt Dry the pellet in a vacuum centrifuge for 1 3 minutes or until dry Do not overdry Performing DNA Sequencing Reactions 3 47 Method 2 Step Action 1 Add 53 uL of 95 ethanol 100 uL if sequen
47. ddNTP is incorporated Stops are invisible because they are not labeled 7 24 Data Evaluation and Troubleshooting Salt Contamination Salts used in template preparation can decrease signal strength and read length if not completely removed before sequencing Figure 7 32 shows the effect of adding increasing concentrations of sodium chloride NaCl to BigDye terminator sequencing reactions before cycle sequencing Lane 1 has no added salt Lanes 2 11 have added salt in 10 mM increments from 10 100 mM At 40 mM NaCl lane 5 the reduction in read length is apparent 1 2 3 4 5 6 7 g 9 10 11 Figure 7 32 Effect of contaminating NaCl on sequencing data Figure 7 33 on page 7 26 shows the effect of EDTA on BigDye terminator cycle sequencing reactions The impact on read length is not as great as that of NaCl Figure 7 32 but there is a steady decrease in signal as EDTA concentration increases right to left on gel image Data Evaluation and Troubleshooting 7 25 Lane EDTA mM 14 1 15 0 8 16 0 6 17 0 4 18 0 3 19 0 2 20 0 1 At EDTA concentrations of 1 mM or higher up to 6 mM was examined data not shown no signal is obtained 14 15 16 17 18 19 20 21 22 23 24 25 26 27 LEE ZARE YOOX OLX Figure 7 33 Effect of contaminating EDTA on BigDye terminator sequencing data Salt is not seen in the usual template quality determination methods such as agarose gel electrophoresis and spec
48. design Primer Express software is useful in identifying potential secondary structure problems calculating melting temperature Tm more accurately and determining if a secondary hybridization site exists on the target DNA Primers should be at least 18 bases long to ensure good hybridization Avoid runs of an identical nucleotide especially runs of four or more Gs Keep the G C content in the range 30 80 preferably 50 55 For cycle sequencing primers with Tm gt 45 C produce better results than primers with lower Tm using our recommended thermal cycling parameters For primers with a G C content less than 50 it may be necessary to extend the primer sequence beyond 18 bases to keep the T gt 45 C Use of primers longer than 18 bases also minimizes the chance of having a secondary hybridization site on the target DNA Avoid primers that can hybridize to form dimers Avoid palindromes because they can form secondary structures The primer should be as pure as possible preferably purified by HPLC Estimating Melting The following formula can be used for a rough estimate of melting temperature Temperature Tm number of A T residues x 2 C number of G C residues x 4 C 3 18 Performing DNA Sequencing Reactions Primer Quantitation Oligonucleotide Molecular Weights Primer Problems and Possible Causes Custom Oligonucleotides The following formula which is derived from Beer s Law converts Agogo r
49. dimer products rather than template molecules and short reads are observed No oGTaCTCT ACGTCTG 2GTGTCaATT TCT TC 2aTGGG acagagcagatTacac NoNcNNNc oNooT acttce 10 to 0 0 50 an 70 Figure 7 31 Stop peak in dye primer chemistry caused by primer dimer formation Stop Peaks in Dye Primer Chemistry Caused by Default Fragments Sometimes a default fragment is generated from free vector included in the PCR along with the cloned target vector with insert During PCR the vector s multiple cloning region is amplified as well as the intended insert The resulting default fragment is extended by the dye primers during sequencing creating a large stop peak the size of the multiple cloning region Eliminating Stop Peaks Use careful design for your PCR primers to avoid stop peaks caused by primer dimer formation Make sure there is no sequence complementarity between the two PCR primers especially at the 3 ends Use a sequencing primer that is different from either of the PCR primers Ensure that your sequencing primer does not overlap the sequence of the PCR primers Use a Hot Start technique for the PCR amplification used to generate the sequencing template e g AmpliTaq Gold DNA Polymerase You can also use dye terminator chemistries to eliminate stop peaks caused by primer dimers or default fragments With dye terminators extension products only appear in the sequencing data when a dye labeled
50. dye labeled sequence ladders are generated resulting in noisy data Excess dNTPs from the amplification reaction can affect the balance of the sequencing reaction resulting in decreased termination in shorter extension fragments Nonspecific PCR Products Nonspecific PCR products include primer dimer artifacts and secondary PCR products The presence of any significant quantity of either in a PCR product can result in poor quality sequencing data Nonspecific PCR products behave as templates in the sequencing reaction and produce extension products which results in noisy data These products often can be visualized on an agarose gel before sequencing If they are present the PCR amplification should be optimized and repeated before sequencing Use of a nested or semi nested sequencing primer can also allow good sequence data to be obtained Alternatively the PCR product of interest can be purified by agarose gel electrophoresis Performing DNA Sequencing Reactions 3 11 3 12 Minimizing Contaminants Preparing PCR Products for Sequencing There are several ways to minimize contaminants in a PCR amplification PCR optimization Innis and Gelfand 1990 Amount of starting DNA Careful primer design Primer concentration Enzyme concentration Magnesium ion Mg2 concentration Nucleotide concentration Buffer composition Number of cycles a pH Manual Hot Start method AmpliTaq Gold
51. dye terminator chemistries 3 33 procedures 3 34 to 3 45 ethanol precipitation BigDye primers 3 47 BigDye terminators 3 38 to 3 40 fluorescein rhodamine dye primers 3 46 ethanol MgClo precipitation 3 43 to 3 45 ethanol sodium acetate precipitation 3 41 to 3 42 express load for 36 lane gels 3 49 isopropanol precipitation 3 36 to 3 38 methods table of 3 33 shrimp alkaline phosphatase digestion 3 45 spincolumn purification 3 34 to 3 35 See also capillary electrophoresis gel electrophoresis e mail address technical support evaluating data 7 2 to 7 15 gel files 7 2 to 7 4 practical examples 7 10 to 7 15 early signal loss 7 14 to 7 15 no usable sequence 7 10 noise 7 11 to 7 13 poor mobility correction 7 13 to 7 14 sample files 7 5 to 7 9 D 1 Index 3 using the Annotation View 7 8 to 7 9 using the Electropherogram View 7 5 to 7 6 using the Raw Data View 7 6 to 7 8 express load option 36 lane gels 3 49 F Fax on Demand D 2 files instrument files 1 14 to 1 16 matrix files what s in the file 1 16 multicomponent analysis 1 14 to 1 15 Filter Set E making 6 8 to 6 13 filter sets ABI 373 1 8 compatibilities with chemistries 2 13 filter wheel ABI PRISM BigDye Filter Wheel 1 8 fluorescein rhodamine dye primers See dye primer chemistries fluorescent sequencing description of 1 3 G GC rich templates troubleshooting 7 32 to 7 33 gel electrophoresis optimizing 4 1 to 4 9 avoiding problems with sequencing
52. folder S ABI Folder Y Shadow 2 Generic Matrix 2 Eject Koshka s Matrix Seq Analysis Command File Desktop Seq Analysis Error File Shadow s Matrix Name for new matrix file Cancel dRhod_BigDye 6 The Make Matrix dialog box should look like that shown below Make Matrix 21 dR110 matrix std Start at 17 dR66 matrix std Start at G 19 dTAMRA matrix std Start at 23 dROH matrix std Start at Points dRhod_BigDye Instrument Comment Dye Primer Matrix Taq Terminator Matrix T Terminator Matrix a Click OK The computer makes the matrix When finished a dialog window appears with the message Make matrix successfully completed b Click OK 7 If the computer is unable to make a matrix examine the raw data again in the Sequencing Analysis software If you used the default values then select new start points as directed in steps 8 and 9 below If many peaks are off scale dilute the matrix standards and rerun them Optimizing Software Settings 6 9 To make the Dye Primer Matrix continued Step Action 8 If the matrix cannot be made with the default values proceed with steps a b and c below a Inthe Sequencing Analysis software open a matrix standard sample and examine the raw data An example is shown below b Select a starting point where there are no peaks and the baseline is flat c Select a number of data points to analyze such that no peaks in the range are off scale
53. gel surface Do not touch the gel surface with the pipet tip See page 3 34 IMPORTANT When using BigDye terminators be sure to hydrate the column for at least 2 hours Pull up peaks bleedthrough see page 7 22 Total signal strength above 4000 Quantitate the DNA template see page 3 17 Use less template Load or inject less of the resuspended sequencing reactions See Preparing and Loading Samples for Gel Electrophoresis on page 3 50 or Preparing and Loading Samples for Capillary Electrophoresis on page 3 53 Stop peaks in dye primer chemistry Primer dimer contamination in PCR sequencing see page 7 24 Optimize your PCR amplification See page 3 10 Make sure there is no sequence complementarity between the two PCR primers especially at the 3 end Use a Hot Start technique for the PCR amplification used to generate the sequencing template e g AmpliTaq Gold DNA Polymerase Use a dye terminator sequencing chemistry Default fragments in PCR sequencing of plasmid inserts see page 7 24 Ensure that you have only one template See Plasmid DNA Templates on page 3 6 and Determining DNA Quality on page 3 16 DNA sequence composition see page 7 30 Use a dye terminator sequencing chemistry See page 2 2 Sequence the opposite strand Compressions see page 7 31 Sequence dependent region of anomalous mobility particularly with dye primer
54. gt Benchtop microcentrifuge capable of reaching at least 14000 x g Vacuum centrifuge Sodium acetate NaOAc 3 M pH 4 6 P N 400320 95 Ethanol ACS reagent grade non denatured Step Action 1 For each sequencing reaction prepare a 1 5 mL microcentrifuge tube containing the following 2 0 uL of 3M sodium acetate NaOAc pH 4 6 50 uL of 95 ethanol EtOH Note Ifthe TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 1 on page 3 37 Pipet the entire contents of each extension reaction into a tube of sodium acetate ethanol mixture Mix thoroughly Vortex the tubes and leave at room temperature for 15 minutes to precipitate the extension products Precipitation times lt 15 minutes will result in the loss of very short extension products Precipitation times gt 24 hours will increase the precipitation of unincorporated dye terminators Spin the tubes in a microcentrifuge for 20 minutes at maximum speed Carefully aspirate the supernatant with a pipette tip and discard IMPORTANT The supernatants must be removed completely as unincorporated dye terminators are dissolved in them The more residual supernatant left in the tubes the more unincorporated dye terminators will remain in the samples Rinse the pellet with 250 uL of 70 ethanol Vortex briefly Spin for 5 minutes in a microcentrifuge at maximum speed Again
55. in a thermal cycler and set the volume to 40 uL 2 Heat the tubes at 95 C for 5 minutes 3 Repeat the following for 45 cycles gt gt gt gt o Rapid thermal rampa to 95 C 95 C for 30 sec Rapid thermal ramp to 50 55 C depending on template 55 C for 20 sec Rapid thermal ramp to 60 C 60 C for 4 min 4 Rapid thermal ramp to 4 C and hold until ready to purify 5 Spin down the contents of the tubes in a microcentrifuge a Rapid thermal ramp is 1 C sec Dye Primer These protocols except for BAC DNA sequencing are used for the fluorescein Chemistries rhodamine dye primer and BigDye primer chemistries GeneAmp 9700 in 9600 Emulation Mode 9600 or 2400 Step Action 1 Place the tubes in a thermal cycler and set the volume to 5 uL 2 Repeat the following for 15 cycles gt gt gt gt gt Rapid thermal rampa to 96 C 96 C for 10 sec Rapid thermal ramp to 55 C 55 C for 5 sec Rapid thermal ramp to 70 C 70 C for 1 min Repeat the following for 15 cycles Rapid thermal ramp to 96 C 96 C for 10 sec Rapid thermal ramp to 70 C 70 C for 1 min 4 Rapid thermal ramp to 4 C and hold until ready to pool and precipitate a Rapid thermal ramp is 1 C sec Performing DNA Sequencing Reactions 3 29 TC1 or DNA Thermal Cycler 480 Step Action
56. is aligned at the left edge of the first data peak Figure 6 2 on page 6 19 c Read the scan number data point that is reported at the top of the dialog box 960 in the example shown in Figure 6 2 Use this number as the Peak 1 Location of the file Return to the Sample Manager window Highlight the Peak 1 Location box and enter the information If you want to use the Peak 1 Location value for the Start Point enter the new Start Point as well Note The Start Point value must be equal to or greater than the Peak 1 Location value or an error will occur If the Start Point is not greater than the Peak 1 Location highlight the Start Point box and enter a number greater than or equal to the number used for the Peak 1 Location 6 20 Optimizing Software Settings Stop Point The Stop Point specifies the last raw data point to be including in the base calling If the default Stop Point is used this endpoint is the last data point in the file Basecalling can be stopped earlier if there is clearly unusable raw data at the end of the file or if you want to analyze only a portion of the raw data in the file Most often this is done for short PCR products to eliminate the unusable data at the end of the run With dye primer chemistries there will be a large peak at the end of the PCR product Set the Stop Point just in front of this full length PCR peak Figure 6 3 With dye terminator chemistries there is no full length PC
57. its concentration This can lead to inaccurate final concentrations of ethanol which can affect some protocols Method 1 Step Action 1 Add 80 uL of 95 ethanol to a clean microcentrifuge tube Note The use of sodium acetate is not necessary for precipitation Pipet the extension reactions from the bottom of each of the four tubes into the ethanol mixture Mix thoroughly Note Ifthe TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 1 on page 3 37 Place the tube on wet ice or leave it at room temperature for 10 15 minutes to precipitate the extension products Spin the tube in a microcentrifuge for 10 20 minutes at maximum speed Carefully aspirate the supernatant and discard At this point a pellet may or may not be visible Optional Rinse the pellet with 250 uL of 70 ethanol and spin for 5 minutes in a microcentrifuge Again carefully aspirate the supernatant and discard This may remove some of the salts from the pellet but doing so is often not necessary Note If you use sodium acetate you must rinse the pellet This will reduce the carryover of salt Dry the pellet in a vacuum centrifuge for 1 3 minutes or until dry Do not overdry Method 2 Step Action 1 Add 80 uL of 95 ethanol to the A reaction tube Note This method will not work if the TC1 or DNA Thermal Cycler 480 was used for therm
58. matrix using same polymer buffer and run conditions as sample injections Data Evaluation and Troubleshooting 7 59 Troubleshooting Capillary Electrophoresis continued Observation Possible Causes Recommended Actions Noisy baseline Incorrectly prepared and or old buffer or polymer solutions Replace buffer and polymer with fresh solutions Dirty capillary holder aperture Clean the capillary holder Defective capillary Replace the capillary Spikes in baseline see Figure 7 60 on page 7 56 Precipitate in polymer Allow polymer to equilibrate to room temperature before adding to capillary Filter the polymer with a 0 2 um or 0 45 um disk filter attached to a plastic syringe Use fresh polymer Old polymer Use fresh polymer Extra peaks in additional colors displayed underneath the position of one strong peak Too much sample injected into capillary indicated if any peak is greater than 4000 RFU Decrease injection time or injection voltage Repeat using less DNA Incorrect matrix chosen or poor matrix Check matrix selection on Injection List If correct create a new matrix Extraneous peaks Unincorporated dye primers or dye terminators dye blobs Purify the extension products thoroughly before sequencing Fluorescent contaminant in sample often from marking pen ink Prepare new samples Do not write on sample tubes
59. of this position is very important If the Peak 1 Location value is wrong due to low signal excess dye peaks or other pathology your data can show bad spacing or strange mobility shifts The Peak 1 Location value is calculated by the Sequencing Analysis software In the 2 1 version of the software the term Primer Peak Location is used to designate this value Occasionally the basecalling software assigns the Peak 1 Location value either too early or too late In either case the correct Peak 1 Location should be identified and changed for optimal basecalling The procedure used to change the Peak 1 Location Primer Peak Location will depend on which version of Sequencing Analysis software and the type of chemistry i e dye primer or dye terminator you are using Table 6 5 below and Table 6 6 on page 6 16 show typical Peak 1 Location values for various instrument configurations and run conditions Table 6 5 Approximate Peak 1 Locations for the ABI 373 and ABI PRISM 377 DNA Sequencers Approximate Approximate Well to Read Peak 1 Location Time to Instrument Length cm RunType Gel Type scan number Peak 1 min ABI 3735 24 Full or XL scan 6 Ac19 700 70 24 BaseSprinter 4 75 Ac19 1000 50 34 Full or XL scan 4 75 Ac19 800 80 34 BaseSprinter 4 25 Ac19 1200 60 48 Full or XL scan 4 Ac19 1000 100 ABI PRISM 377 36 1200 scans hr 4 Ac19 4 5 Ac29 800 40 5 LR 4 8 PP 36 2400 scans hr 4 Ac19 4 5 Ac2
60. or septa with marking pens Renaturation of denatured samples Dust or dirt in polymer see Figure 7 60 on page 7 56 Load samples immediately following denaturation or store on ice until you are ready to load IMPORTANT Do not store samples on ice for more than 2 hours before loading Filter the polymer with a 0 2 um or 0 45 um disk filter attached to a plastic syringe Stop peak strong peak in all four colors Secondary structure in sequence Use dye terminator chemistries instead of dye primer chemistries Primer dimer primer oligomerization in PCR sequencing Make sure that there is no sequence complementarity between the two PCR primers Use a sequencing primer that is different from the two PCR primers Ensure that the sequencing primer does not overlap the sequence of either PCR primer Poor base spacing Incorrect dye set primer file Check dye set primer file used Incorrect polymer composition Check urea concentration and polymer composition against protocol Incorrect electrophoresis temperature Check the Injection List for temperature setting If correct on Injection List check the Log for a recording of the actual electrophoresis temperature Inconsistent peak mobilities at beginning of run i e peaks come off at higher scan numbers in the first injection Capillary temperature not at equilibrium Repeat the injection of the first sample
61. page 7 30 When the DNA was reisolated and the new template DNA sequenced the data was clean in this region Figure 7 21 on page 7 18 TCACATTTAAGCAARGTTAGCGCCTTGCTGAATTCAGCCTTTGTARAAAAAAGAGAWNNWNTAGTGCATATTTTAACGGTACATT GT 270 280 290 300 310 320 330 340 Figure 7 20 Sequence data obtained using BigDye primers with an old template preparation Data Evaluation and Troubleshooting 7 17 PTCACATTTAAGCAAGTTAGCGCCTTGCTGAATTCAGCCTTTGTAAARAAAAAGAGACTTAGTGCATATTTTAACGGTACATTSG 270 280 290 300 310 320 330 340 3 Figure 7 21 Sequence data obtained using BigDye primers with a newer template preparation Multiple Templates The presence of more than one template in a reaction will result in multiple overlapping sequences in the data This can happen with both PCR templates and cloned DNA templates For PCR reactions lack of complete specificity can result in more than one product being produced Figure 7 22 The majority of cleanup procedures for PCR products are designed to remove unincorporated nucleotides and residual PCR primers not secondary PCR products The presence of secondary PCR products can be detected by agarose gel electrophoresis see page 3 16 Optimization of PCR conditions and or use of a Hot Start method usually result in generation of a clean PCR product If necessary the PCR product can be gel purified before sequencing The sequence data shown in Figure 7 22 is from a PCR product th
62. products lost during reaction cleanup 7 10 Data Evaluation and Troubleshooting Extension products not resuspended Lane tracking failure ABI 373 and ABI PRISM 377 DNA Sequencers Electrokinetic injection failure ABI PRISM 310 Genetic Analyzer Noise Some background noise is always present in sequencing data Noisy data is characterized by a high background and peaks under peaks Noise can be grouped into several categories including the following Noise throughout the sequence Noise up to or after a specific point in the sequence e Noise caused by incorrect or poor quality instrument matrix file Noise Throughout the Sequence Figure 7 10 shows an example of noisy data The background is high enough to cause ambiguities in basecalling e g the N at base 377 For this sample the annotation view not shown indicates the cause to be low signal strengths C 47 A 35 G 30 T 38 The raw data for this sample shown in Figure 7 11 confirms the low signal strength Other than the primer peak the data is very weak 4640 4720 4800 4880 4960 5040 51 TE GLTCACTG ARETEGCTGCCGOCTECGE TECTIA GOGET 350 360 370 360 uw ano ha Figure 7 10 Analyzed data from a BigDye primer reaction run on an ABI PRISM 310 Genetic Analyzer Figure 7 11 Raw data view for the sample file shown in Figure 7 10 Data Evaluation and Troubleshooting 7 11 Not all noisy data is caused by low signal In other cases
63. resolution Signal strength as measured both by peak height and by peak area increases linearly with increasing injection time for most applications Figure 5 1 and Figure 5 2 on page 5 5 However an n fold increase in injection time does not result in an n fold increase in peak height In Figure 5 1 no improvement is seen after 10 seconds for the larger fragment The signal decreases dramatically after 40 seconds for the smaller fragment As the injection time increases the resolution decreases because of increasing peak widths Figure 5 3 on page 5 5 There is too much sample to move as a discrete well resolved band 5 4 Optimizing Capillary Electrophoresis D o gt S H 3000 os a a N o o o 20 30 Injection Time sec Figure 5 1 Peak height vs injection time for two different sized fragments 90 bp and 300 bp 30 40 Injection Time sec Figure 5 2 Peak area vs injection time for two different sized fragments 150 bp and 340 bp 160bp range E 360bp range Resolution 20 30 40 50 Injection Time sec Figure 5 3 Resolution vs injection time for different sized fragments Optimizing Capillary Electrophoresis 5 5 Modifying Injection Voltage Setting Flectrokinetic Injection Values Injection voltage has little effect on peak resolution Resolution with injection voltages of 319 V cm the highest possible setting is often indistinguishable fro
64. sequencing data 7 44 Data Evaluation and Troubleshooting Salt Excess salt in the wells can cause pinching of lanes toward the center of the gel Figure 7 51 Note Lanes 3 8 are short PCR products Lane 11 was not loaded When performing ethanol precipitation remove all of the ethanol by aspiration after the first spin If residual ethanol is dried down with the sample the pinching and bending of lanes is worsened Performing a 70 ethanol wash after ethanol precipitation of dye terminator reactions also helps to alleviate this problem Figure 7 51 Effect of excess salt on an ABI PRISM 377 gel The overall signal strength is also lowered Data Evaluation and Troubleshooting 7 45 Fluorescent Contaminating fluorescent species can obscure sequencing data completely A Contaminants common cause of fluorescent contamination is ink from marker pens Do not write on the gel plates spacers combs or buffer chambers In Figure 7 52 a large green band is seen shortly after the first fragments are detected The band is from a marking pen that was used to label a spacer Even though the spacer was cleaned before use enough ink remained to ruin the sequencing data Figure 7 52 Fluorescent contamination from a marking pen 7 46 Data Evaluation and Troubleshooting Buffer Leaks If buffer spills or leaks onto the read region of the gel plates it can cause blue or green artifacts on the gel image Figure 7 53 To avoid buffer leak
65. size and more than one fragment can migrate at the same position In dye primer chemistries 7 deaza dGTP is used to minimize problems with compressions Barr et al 1986 Mizusawa et al 1986 but it is not effective at eliminating all of them Figure 7 39 In the fluorescein rhodamine dye primer sequencing data shown in Figure 7 39 compressions are present at bases 257 and 323 see arrows Note Stop peaks are present at bases 304 and 308 ACCTG Se A ir ee ea a ee i ACA 260 270 260 290 300 laity ih Figure 7 39 Compressions in pGEM control DNA sequenced with the M13 Reverse primer using fluorescein rhodamine dye primer chemistry on an ABI PRISM 377 DNA Sequencer In dye terminator reactions dITP is used in place of dGTP This eliminates most compressions Figure 7 40 on page 7 32 Data Evaluation and Troubleshooting 7 31 GCOCTGAATGGCGAATGGACGCGCCCTGTIAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACAC 270 280 290 300 310 320 330 340 Figure 7 40 Same template as in Figure 7 39 on page 7 31 but sequenced using BigDye terminator chemistry When problems are encountered with compressions in dye primer data there are three ways to resolve them Sequence the DNA template using a dye terminator chemistry Sequence the complementary strand if possible Compressions rarely occur at the same position in both strands of a te
66. terminator sequencing extension products are labeled only if a dye labeled dideoxynucleotide is incorporated If the enzyme falls off the template at a region of secondary structure and no dye labeled dideoxynucleotide is incorporated the fragment is not detected Figure 7 38 on page 7 31 TCA TAGOTGTTTCONGTGTGAAATT GOTTA 130 140 Figure 7 37 A false stop in pGEM control DNA sequenced using fluorescein rhodamine dye primer chemistry A peak is seen in all four colors at the position of the N on the electropherogram where secondary structure creates a false stop for the polymerase 7 30 Data Evaluation and Troubleshooting Compressions GTCATAGCTGTTTCCTGTG TG AAAT TOT Figure 7 38 The same region of pGEM control DNA sequenced with dye terminators The site of the false stop evident in Figure 7 37 on page 7 30 is not seen when using dye terminators An arrow marks the base that was called as an N in Figure 7 37 Ways to Obtain the Sequence There are two ways to obtain the sequence at false stops when Ns are called Sequence the region using a dye terminator chemistry Figure 7 38 Sequence the opposite strand False stops rarely occur at exactly the same base position on both strands Band compressions in DNA sequencing result from the formation of secondary structures in the DNA fragments that are not eliminated by the denaturing conditions of the gel Mills and Kramer 1979 The fragments do not migrate according to their
67. the signal strength and the raw data can appear normal so other possibilities should be considered Potential causes for noise throughout the sequence include the following Low signal strength as in the example above High signal strength saturating the detector Contaminated template Expired or mishandled reagents Multiple templates in sequencing reaction Multiple priming sites Multiple primers N 1 primer Thermal cycler failure Lane tracking failure ABI 373 and ABI PRISM 377 DNA Sequencers Electrokinetic injection problem ABI PRISM 310 Genetic Analyzer Incorrect run module used to collect the data o oo i a A a a a a Incorrect instrument matrix file used to analyze the data Noise Up To or After a Specific Point in the Sequence Figure 7 12 shows data from a plasmid clone sequenced with the BigDye terminators on an ABI PRISM 377 DNA Sequencer Because the noise starts after the multiple cloning region of the vector base 62 see arrow below the probable cause was picking a colony that was not well isolated and also had bacteria with no insert or a different insert in the plasmid The raw data not shown appears normal For this sample the annotation view shows normal base spacing In other cases it could show default base spacing if the noise occurred at the beginning of the sequence because base spacing is calculated from the early data CCCCCCTCGAGGTCGACGGTATCGATTGGCCGGCAACGGNANTGGNCAGTGNAGCCTGNTGNNC
68. uL TEMED 48 uL Gel Preparation For 48 cm WTR Runs 5 0 Long Ranger Gel 8 3 M Urea Ingredient For 100 mL Run Conditions urea 50g Use the standard run time of 50 gel stock solution 10 mL 18 hours 10X TBE 10 mL deionized water to 100 mL 10 APS 500 uL TEMED 50 uL 5 25 PAGE PLUS Gel 8 3 M Urea Ingredient For 100 mL Run Conditions urea 50g Use the standard run time of 40 gel stock solution 13 2 mL 18 hours 10X TBE 10 0 mL deionized water to 100 mL 10 APS 500 uL TEMED 50 uL Gel Preparation A 13 Preparing Preliminary gel preparation steps PAGE PLUS and Long Ranger Gels for the ABI 373 A 14 Gel Preparation Step Action 1 Referring to the appropriate list of ingredients above and your user s manual gather all the necessary equipment and ingredients Prepare all stock solutions per the appropriate list of ingredients above Clean the gel plates thoroughly and prepare them for gel pouring To prepare 5 0 Long Ranger and 4 8 and 5 25 PAGE PLUS gels Step Action 1 Weigh out the urea and carefully transfer it to a 250 mL stoppered graduated cylinder 2 Using a pipette add the appropriate amount of gel stock solution and 10X TBE buffer to the cylinder 3 Adjust the volume to 75 mL by slowly adding deionized water Tap the cylinder to re
69. use salt To precipitate extension products in MicroAmp Trays Step Action 1 Remove the MicroAmp Tray from the thermal cycler Remove the caps from each tube 2 Add the following 16 uL of deionized water 64 uL of non denatured 95 ethanol The final ethanol concentration should be 60 3 1 Contact 3M in the USA at 800 364 3577 for your local 3M representative Use of other tapes may result in leakage or contamination of the sample 3 38 Performing DNA Sequencing Reactions To precipitate extension products in MicroAmp Trays continued Step Action 3 Seal the tubes with strip caps or by applying a piece of 3M Scotch Tape 425 3 adhesive backed aluminum foil tape Press the foil onto the tubes to prevent any leakage 4 Invert the tray a few times to mix 5 Leave the tray at room temperature for 15 minutes to precipitate the extension products Note Precipitation times lt 15 minutes will result in the loss of very short extension products Precipitation times gt 24 hours will increase the precipitation of unincorporated dye terminators 6 Place the tray in a table top centrifuge with tube tray adaptor and spin it at the maximum speed which must be 21400 x g but lt 3000 x g 1400 2000 x g 45 minutes 2000 3000 x g 30 minutes Note A MicroAmp tube in a MicroAmp Tray can withstand 3000 x g for 30 minutes IMPORTANT Proceed to the next step immediately If not pos
70. used to make instrument files You must put the correct data file for each matrix standard into the correct box in the Data Utility application Table 6 4 shows the correct placement for making a Filter Set E instrument file Filter Set A on the ABI 373 DNA Sequencer with BigDye Filter Wheel Table 6 4 Placement of Standards for dRhodamine Based Chemistries Dye Primer Taq Terminator T7 Terminator Box Matrix Matrix Matrix C dR110 dROX dR6G A dR6G dR6G dTAMRA G dTAMRA dR110 dROX Tasi dROX dTAMRA dR110 When creating a Filter Set E instrument file you need to make all three matrix files even if you are only using one dRhodamine based chemistry The data collection software will not run with only a Taq or T7 terminator matrix in the file The T7 Terminator Matrix file is needed to analyze dRhodamine terminator and BigDye terminator sequencing data It has a baselining algorithm associated with it that works well with these chemistries The dRhodamine terminator and BigDye terminator dye set primer files have tags in them that tell the Sequencing Analysis software to select this matrix file Optimizing Software Settings 6 7 Making a Filter Set E Instrument File from Matrix Standards This procedure is for making instrument files for dRhodamine based chemistries Filter Set E on the ABI PRISM 310 and ABI PRISM 377 instruments Filter Set A on the ABI 373 DNA Sequencer with BigDye Filter Wheel
71. wear chemical resistant gloves when handling TEMED solutions Read the MSDS in the Safety Summary included with your instrument user s manual Cast the gel using one of the methods described in your instrument user s manual Note Allow the gel to polymerize for a minimum of 2 hours Gel Preparation A 5 Protocol and Run Conditions for 29 1 Polyacrylamide Gels Action Preparing 40 Acrylamide Stock Step 29 1 1 Working in a fume hood combine the following amounts of acrylamide and bisacrylamide in a glass beaker Acrylamide 58 g Bisacrylamide 2 g WARNING CHEMICAL HAZARD Acrylamide and bisacrylamide are poisons neurotoxins irritants carcinogens and possible teratogens Acrylamide and bisacrylamide sublime the solids release toxic vapor and are harmful if swallowed inhaled or absorbed through the skin Effects are cumulative When handling always wear protective equipment lab coat safety glasses and chemical resistant gloves and use in a well ventilated area On a routine basis thoroughly clean surfaces subject to contamination Dissolve the crystalline acrylamide and bisacrylamide in sufficient distilled deionized water to bring the total volume to 135 mL Add 15 g of mixed bed ion exchange resin Stir at room temperature until all crystals dissolve Continue stirring for 5 10 minutes Filter the mixture through a 0 2 um cellulose nitrate filter Tran
72. with XL Upgrade description of 1 9 See Also ABI PRISM 377 ABI PRISM 377 18 description of 1 9 ABI PRISM 877 ITC cycle sequencing 3 32 ABI Prism DNA sequencing kits and reagents E 1 to E 4 dye labeled primers E 3 kits E 1 to E 2 matrix and sequencing standards E 3 reagent kit protocols part numbers E 4 acrylamide gel electrophoresis 4 2 ammonium persulfate APS 4 2 preparing A 15 AmpliTaq DNA Polymerase FS description of 1 5 B background fluorescence problem with gel 4 4 Index 1 bacterial artificial chromosome BAC DNA templates cycle sequencing using BigDye primers 3 30 using BigDye terminators 3 28 preparing 3 9 base spacing default value 7 8 basecaller choosing the correct basecaller 6 6 Beer s Law converting Azgo to concentration 3 17 BigDye Filter Wheel choosing chemistry 2 15 to 2 16 to use new chemistries 1 8 BigDye primers chemistry description of 2 9 to 2 11 cycle sequencing 3 29 to 3 30 dye base relationships 2 14 ethanol precipitation method 3 47 preparing sequencing reactions 3 25 to 3 26 BigDye terminators chemistry description of 2 6 cycle sequencing 3 27 to 3 29 dye base relationships 2 14 ethanol precipitation method 3 38 to 3 40 isopropanol precipitation method 3 36 to 3 38 preparing sequencing reactions 3 22 to 3 24 troubleshooting GT rich template 7 34 to 7 35 bleedthrough troubleshooting sequencing data 7 43 2 5 to C capillary electrophoresis optimizing 5 1 to 5
73. 0 Molecular Biology LabStation and the ABI PRISM 877 Integrated Thermal Cycler For more information refer to the ABI PRISM BigDye Primer Cycle Sequencing Ready Reaction Kit Protocol P N 403057 Instrument Platforms The ABI PRISM BigDye Primer Cycle Sequencing Ready Reaction Kits are for use with the ABI PRISM 310 Genetic Analyzer and ABI PRISM 377 DNA Sequencer all models These kits can also be used with ABI 373 DNA Sequencers on which the new ABI PRISM BigDye Filter Wheel has been installed Refer to the ABI PRISM BigDye Filter Wheel User Bulletin P N 4304367 for more information IMPORTANT This kit is not designed for use with ABI 373 DNA Sequencers and ABI 373 DNA Sequencers with XL Upgrade that do not have the ABI Prism BigDye Filter Wheel 1 Includes the ABI PRISM 377 ABI PRISM 377 18 ABI PRISM 377 with XL Upgrade and the ABI PRISM 377 with 96 Lane Upgrade instruments 2 Includes the ABI 373 and ABI 373 with XL Upgrade instruments ABI PRISM DNA Sequencing Chemistries 2 11 Dye Spectra Rhodamine and The normalized emission spectra of the rhodamine and dRhodamine dyes are shown dRhodamine Dyes in Figure 2 7 The dRhodamine dyes are used in the ABI PRISM dRhodamine Terminator BigDye Primer and BigDye Terminator Cycle Sequencing Ready Reaction Kits Rhodamine Emission Spectra dRhodamine Emission Spectra 100 100 80 80 60 60 40 40 20 20 NORMALIZED EMISSION INTENSITY NORMALIZED EMISSION
74. 11 18 x rx rpm 1000 2 where g relative centrifugal force rpm revolutions per minute r radius of the rotor in cm Do not spin for more than 2 minutes Perform the entire procedure without interruption to ensure optimal results Do not allow the column to dry out To perform spin column purification Step Action 1 Gently tap the column to cause the gel material to settle to the bottom of the column 2 Remove the upper end cap and add 0 8 mL of deionized water 3 Replace the upper end cap and vortex or invert the column a few times to mix the water and gel material 4 Allow the gel to hydrate at room temperature for 30 minutes at least 2 hours for BigDye terminators Note Hydrated columns can be stored for a few days at 2 6 C Longer storage in water is not recommended Allow columns that have been stored at 2 6 C to warm to room temperature before use 5 Remove any air bubbles by inverting or tapping the column and allowing the gel to settle 6 Remove the upper end cap first then remove the bottom cap Allow the column to drain completely by gravity Note If flow does not begin immediately apply gentle pressure to the column with a pipette bulb 7 Insert the column into the wash tube provided 8 Spin the column in a microcentrifuge at 730 x g for 2 minutes to remove the interstitial fluid 3 34 Performing DNA Sequencing Reactions To perform spin column purificatio
75. 1993 Note When sequencing with a polyT primer that has a wobble A C or G at the 3 end use 3 2 pmol of each primer i e 9 6 pmol total of primer ACAATAA AATARAAGATTIATTGAATACTATGTTGAGCTTITAAGAATAATCATAACGACTATACATAR 20 30 0 5D 60 7a ao Figure 7 47 Sequencing past a polyA region in the template using a primer with the sequence T 5G The sequence past the homopolymer region is improved markedly over that shown in Figure 7 45 on page 7 35 With PCR Templates Slippage also occurs in PCR amplification and is a common problem when sequencing PCR products Slippage can occur at regions that normally are not problematic to sequence with cloned DNA Sequence data is shown below from a plasmid clone in which the sequencing template was prepared by amplification of the insert Figure 7 48 on page 7 37 or by isolation of the plasmid DNA Figure 7 49 on page 7 37 After the homopolymer G region the sequence data is unusable for the amplified template When the plasmid 7 36 Data Evaluation and Troubleshooting DNA was sequenced directly the sequence data was weak but unambiguous after the homopolymer G stretch CG COPE eee ee Dona a ee a a ee aa 100 110 12 130 140 50 160 Wi Ine thal Naty shila ile Figure 7 48 Fluorescein rhodamine dye primers with AmpliTaq DNA Polymerase CS were used to sequence a template obtained from a plasmid clone by PCR amplification of t
76. 2 minutes to denature then place on ice Load the appropriate volume of each sample into a separate lane of the gel according to Table 3 4 through Table 3 6 on page 3 51 3 52 Performing DNA Sequencing Reactions Preparing and Loading Samples for Capillary Electrophoresis Minimum Sample The minimum sample volume is 10 uL Volume as l One sample can be injected several times because very little sample volume is used for each injection Preparing the Samples Step Action 1 Add 12 25 uL of TSR see page 5 2 to each sample pellet Note Because injection is electrokinetic the resuspension volume is not as important as for slab gel electrophoresis 2 Mix thoroughly on a vortex mixer and heat for 2 minutes at 95 C Note If you are using a 96 well tray samples can be denatured directly in the tray 3 Chill on ice vortex thoroughly then spin briefly in a microcentrifuge Hold on ice until ready to load on the instrument 5 Transfer the samples to 0 5 mL or 0 2 mL sample tubes and cover with tube septa Note You must use tube septa to prevent evaporation of samples especially if samples are put in the autosampler more than six hours before analysis Preparing a Portion Occasionally you may want to prepare only a portion of a sequencing reaction mixture of a Reaction for analysis on the ABI PRISM 310 Genetic Analyzer and reserve the rest of the Mixture for Analysis sample
77. 3 dye labeled dideoxynucleotide triphosphates dye terminators The most appropriate labeling method to use depends on your sequencing objectives the performance characteristics of each method and on personal preference PE Applied Biosystems DNA sequencers detect fluorescence from four different dyes that are used to identify the A C G and T extension reactions Each dye emits light at a different wavelength when excited by an argon ion laser All four colors and therefore all four bases can be detected and distinguished in a single gel lane or capillary injection Figure 1 2 ATTCCACACAACATACGAGCCGGAAGCATAARAG 160 190 200 Aylwin Figure 1 2 Four color one lane fluorescent sequencing vs one color four lane method such as radioactive sequencing Introduction 1 3 Cycle Sequencing Cycle sequencing is a simple method in which successive rounds of denaturation annealing and extension in a thermal cycler result in linear amplification of extension products Figure 1 3 The products are then loaded onto a gel or injected into a capillary All current ABI PRISM DNA sequencing kits use cycle sequencing protocols Advantages of Cycle Sequencing 1 4 Introduction See Chapter 3 for information on cycle sequencing protocols Reaction Mixture Enzyme dNTPs Annealin E i g xtension ddNTPs buffer 50 55 C 60 70 C Primer L 7 h I C B
78. 60 1020 eso WN NA A A M dh AA MAn Figure 7 59 Trailing peaks caused by capillary failure Pi 34 Spikes are caused by particulate matter in the polymer passing through the detection window and scattering laser light Figure 7 60 on page 7 56 shows the effect of a spike on analyzed sequencing data from a BigDye primer reaction The spike observed in the center of the panel is almost twofold higher than the sequencing peaks The mobility shift algorithm makes this spike look as if the red portion precedes the blue portion but in the raw data the spike is a single four color peak Figure 7 61 on page 7 56 If your data shows spikes Clean the syringe and pump block with filtered deionized water Use a fresh capillary that has not been exposed to dust i e left on the benchtop Filter the POP 6 polymer with a 0 2 um or 0 45 um disk filter attached to a plastic syringe Data Evaluation and Troubleshooting 7 55 Figure 7 60 A spike in analyzed sequencing data f 2728 2976 3224 3472 3720 3968 4216 LL asl alll aa ora i vain ictal hh Figure 7 61 A spike in raw data 7 56 Data Evaluation and Troubleshooting Troubleshooting Capillary Electrophoresis Observation Possible Causes Recommended Actions Data was not Sample Sheet not completed or automatically analyzed completed incorrectly Complete the Sample Sheet as described in your user s manual Injec
79. 9 800 20 5 LR 48 1200 scans hr 4 Ac19 4 25 Ac29 1200 60 4 75 LR 5 25 PP a Ac19 19 1 polyacrylamide Ac29 29 1 polyacrylamide LR Long Ranger PP PAGE PLUS b ABI 373 and ABI 373 with XL Upgrade c All models Note For the ABI 373 and ABI PRISM 377 instruments scan numbers correspond to data points These terms are sometimes used interchangeably Optimizing Software Settings 6 15 Table 6 6 Approximate Peak 1 Locations for the ABI PRISM 310 Genetic Analyzer Approximate Approximate Capillary Peak 1 Location Time to Peak Length cm Run Type Polymer Type data points 1 min 47 rapid sequencing POP 6 1050 1150 25 61 long read POP 6 1700 2000 40 sequencing Note Peak 1 Locations and run times on the ABI PRISM 310 instrument can be affected by the laboratory temperature Start Point The Start Point is the starting point for data analysis The Start Point is normally the same as the Peak 1 Location value However the Start Point can be set later than the Peak 1 Location if desired see page 7 64 Note The Start Point can never be less than the Peak 1 Location value Stop Point The Stop Point specifies the last raw data point to be included in the basecalling If the default Stop Point is used this endpoint is the last data point in the file However the basecalling can be stopped earlier if there is unusable raw data at the end of the file or if you
80. A GCACATC TCAGT GA CACTASAATG TCA GATG TG4 GTTTAS CAGAAA ATIGGT TC TG4 GG4 GT GG CATCCAS TACAG TR TTTAAA TAS AA CCAG TGT GACTAAAAG TAASA TIAA C 720 730 740 750 760 770 780 790 300 810 820 830 840 850 IC ACCCTGAATA AATTTAATG AGA CTTGGA TGGTAATG AGT CTATACHNTIGS CT AGCTGT GGNCASSCAC GNGCTNS G CTG AATCCAG CTTTTGG46 GCCA GGC GGGCNAACATAAGTC GGHAATICAGA 860 870 880 890 900 910 920 930 940 950 960 970 980 990 Figure 2 4 Sequence data obtained from a plasmid with BigDye terminators Reactions were run on an ABI PRISM 377 DNA Sequencer with a 5 25 PAGE PLUS 48 cm well to read gel BigDye Terminator The ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kits combine Ready Reaction Kits AmpliTaq DNA Polymerase FS the new BigDye terminators and all the required components for the sequencing reaction In the Ready Reaction format the dye terminators deoxynucleoside triphosphates Ampli Taq DNA Polymerase FS r Tth pyrophosphatase magnesium chloride and buffer are premixed into a single tube of Ready Reaction Mix and are ready to use These reagents are suitable for performing fluorescence based cycle sequencing reactions on single stranded or double stranded DNA templates on polymerase chain reaction PCR fragments and on large templates e g BAC clones The dNTP mix includes dITP in place of dGTP to minimize band compressions The dNTP mix also uses dUTP in place of dTTP dUTP improves the incorporation of the T terminator a
81. A Sequencing Analysis Software User s Manual Early Signal Loss There are two kinds of early signal loss Gradual Abrupt Gradual Signal Loss Figure 7 15 shows BigDye terminator sequencing data where the signal gradually dies after a region of CTT trinucleotide repeats starting at base 280 In this example the loss of signal is enough to cause some miscalls but there is still usable data Bases were called accurately to 650 Figure 7 16 on page 7 15 shows raw data from the same sample As in the analyzed data the signal in the raw data dies out gradually in the repeat region In this example the annotation view does not provide useful information If the signal loss had occurred early in the sequence signal strengths would be low and default base spacings might be assigned CA AAG CT GG aac TCCAC C GCGGTGGC GG CACACAGAGTAA GTTCCAAGACA GC CA GGGC TACACA GAG ALAC COTGTCT TANGCOOOC CAG AATCTCCAATTGCT GRC CTTTAAC AAGTAAT 100 ito LES ar A D ma A aa CAC TAGCTAATTTTTAATTAGAAAAGATGATTAGTAATATTCAAAGGTAAT TAC G AT A GCT TOAGGATOC GGC CTAGGA 64 GAGAT AGG G TTAG A GTCA GAGA GTC TTTCTA i utaa a aGGCAGGATCTCAGATAGTTTAGGATACC CC AA AT TC TC TTOTOT TC Te TTOTCTTOTOTTNTCTTATCTTNTCTTCTCTTCTCTTOTOCTTOTCTTTTCCTTTCCTTTOTTTTATOTTTC o 00 10 o 30 40 50 60 h N fal ANT WN Figure 7 15 Gradual signal loss 7 14 Data Evaluation and Troubleshooting 2688 5376 8064 10752 13440 2579 2127 Figure 7 16 Raw
82. A ddC ROX Figure 2 1 Rhodamine dye terminators The ABI PRISM Dye Terminator Cycle Sequencing Kits combine AmpliTaq DNA Polymerase FS rhodamine dye terminators and all the required components for the sequencing reaction Note Throughout this manual these kits will be referred to as rhodamine dye terminators The concentrations of the dye labeled dideoxynucleotides and deoxynucleotides in the dNTP mix have been optimized to give a balanced distribution of signal above 700 bases The dNTP mix includes dITP in place of dGTP to minimize band compressions In the Ready Reaction format the dye terminators deoxynucleoside triphosphates AmpliTaq DNA Polymerase FS r7th pyrophosphatase magnesium chloride and buffer are premixed into a single tube of Ready Reaction Mix and are ready to use These reagents are suitable for performing fluorescence based cycle sequencing reactions on single stranded or double stranded DNA templates or on polymerase chain reaction PCR fragments 2 2 ABI PRISM DNA Sequencing Chemistries In the Core Kit format the reagents are supplied in individual tubes to maximize kit flexibility For convenience when sequencing large quantities of templates the reagents can be premixed and stored The cycle sequencing protocols are optimized for GeneAmp PCR Instrument Systems thermal cyclers the CATALYST 800 Molecular Biology LabStation and the ABI PRISM 877 Integrated Thermal Cycler For more informa
83. ARNING CHEMICAL HAZARD Sodium hydroxide NaOH can cause severe burns to the skin eyes and respiratory tract Always work in a fume hood Obiain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves WARNING CHEMICAL HAZARD Sodium dodecyl sulfate SDS is a toxic chemical that is harmful to the lungs and internal organs if swallowed Contact with the eyes can cause serious damage Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Performing DNA Sequencing Reactions 3 7 Note To minimize shearing of contaminating chromosomal DNA do not use a vortexer during this procedure To prepare plasmid DNA by alkaline lysis PEG treatment Step Action 1 Pellet 1 5 mL aliquots of culture for 1 minute in a microcentrifuge at maximum speed Note A total culture volume of 4 5 mL can be spun down per tube without changing volumes in the procedure This allows you to achieve a threefold increase in yield while eliminating the need for extra tubes and additional handling Remove the supernatant by aspiration Resuspend the bacterial pellet in 200 uL of GET buffer by pipetting up and down Add 300 uL of freshly prepared 0 2 N NaOH 1 SDS Mix the contents of the tube by inversion Incubate on ice for 5 minutes Neutralize the solution by adding 300 uL of 3 0 M potassium acetate pH 4 8
84. Almost all known cases of gel extrusion have been resolved by either acid washing or alcoholic KOH washing Refer to the cleaning procedures on page 4 9 Figure 7 56 Effect of gel extrusion on sample migration 7 50 Data Evaluation and Troubleshooting Temporary Loss of This problem usually occurs at the beginning of the gel between 150 and 250 base Signal pairs in the analyzed data It manifests itself as a band of little or no signal across the entire width of the gel image Temporary loss of signal has been traced to contaminants on the gel plates These contaminants include surfactants fatty acids and long chain polymers that are not removed when the plates are washed Rinsing glass plates with hot deionized water 90 C has been found to remove the contaminants that cause temporary loss of signal Refer to for more information Figure 7 57 Portion of an ABI PRISM 377 gel image showing temporary loss of signal The vertical blue line is from dust in the read region of the gel Data Evaluation and Troubleshooting 7 51 Poor Quality Plates from vendors other than PE Applied Biosystems may not have adequate quality Gel Plates control for use on our instruments Several problems result from poor quality plates including warping Figure 7 58 shows data from plates that warped after 6 months of use When plates become warped the laser is no longer focused correctly on the gel When this occurs on the ABI 373 DNA Sequencer lase
85. Cc 5 FAM G TAMRA T ROX The structures of the fluorescein rhodamine dye primers are shown in Figure 2 5 Note that 5 FAM and JOE are fluorescein dyes and TAMRA and ROX are rhodamine dyes The emission spectra of the dyes are shown in Figure 2 8 on page 2 12 Note Throughout this manual this chemistry will be referred to as fluorescein rhodamine dye primer to distinguish it from BigDye primer chemistry 5 FAM JOE DNA DNA TAMRA ROX Figure 2 5 Fluorescein rhodamine dye primers The ABI Prism Dye Primer Cycle Sequencing Kits include AmpliTaq DNA Polymerase FS dye labeled primers and all the required components for the sequencing reaction The deoxy and dideoxynucleotide ratios in the dNTP mix have been optimized to give a balanced distribution of signal between base 10 and base 700 after the primer The dNTP mix includes 7 deaza dGTP in place of dGTP to minimize band compressions In the Ready Reaction format the dye labeled primers deoxynucleoside triphosphates dideoxynucleoside triphosphates AmpliTaq DNA Polymerase FS r Tth 2 8 ABI PRISM DNA Sequencing Chemistries BigDye Primers pyrophosphatase magnesium chloride and buffer are premixed into A C G and T Ready Reaction cocktails to eliminate time consuming reagent preparation These reagents are suitable for performing fluorescence based cycle sequencing reactions on single stranded or double stranded DNA templates or on polymerase chain rea
86. Channel Number 156 Number of Scans 9448 No of Channels 480 Length 940 3 12 1998 18 40 3 13 1998 02 41 Gel File DT dR Set Any Primer Collect Vers 2 5b3 Data Analysis Base Call Start 879 Base Call End 9448 Peak 1 Location 879 Signal G 1045 A 94 gt C 13639 T 1039 Matrix Name dRhodA Channels Ave 3 Basecal ler ABI 100 Basecaller Version Version 3 1 Base Spacing Used 10 26 Base Spacing Calculated 10 26 Figure 7 8 Annotation view In the annotation view for lane 29 the signal strength values are G 104 A 94 C 136 and T 103 These values are twice the minimum usually required for successful data analysis of dRhodamine terminator reactions but are probably artificially raised by the excess dye peaks The annotation view also shows that the correct dye set primer file instrument file and basecaller were used Data Evaluation and Troubleshooting 7 9 Practical Examples of Data Evaluation Overview The following are common features of poor sequencing data No recognizable sequence Noise Poor mobility correction Early signal loss Examples of these problems are given below Possible causes for them are listed Some of the causes are described in more detail in the troubleshooting section of this chapter along with potential solutions No Usable Sequence Figure 7 9 shows analyzed data with a high level of noise and lack of well defined peaks In this reaction pGEM con
87. Click the Change Primer Peak radio button to display the entry field The number in the data field is the number used for the Primer Peak Location during the last analysis d Enter the new number Note If the value assigned for the Primer Peak location is greater than that assigned for the Start Point the Start Point value needs to be changed to that of the Primer Peak Location If you want the Primer Peak location to be used as the Start Point changing the Start Point value and leaving the Change Primer Peak radio button as the default Use Start Point should also work In Sequencing Analysis version 2 1 there is a link between the Start Point and the Primer Peak Location Using Sequencing Analysis Version 3 0 or 3 2 Step Action 1 Launch the Sequencing Analysis software if it is not already open 2 In the Sample Manager window click the Add Files button and choose the sample to be analyzed Click Done Highlight the sample name and click the Open Files button to display the raw data or double click the sample file name Zoom in completely From the Window menu choose Actual Size or use the keys on the keyboard Starting at the beginning of the raw data file scroll along the data by clicking and holding the right direction arrow at the bottom of the window a Click and drag in the window to change the cursor to a cross hair b Move the cursor along the data until the vertical dotted line
88. Contact 3M in the USA at 800 364 3577 for your local 3M representative Use of other tapes may result in leakage or contamination of the sample Performing DNA Sequencing Reactions 3 3 To extract the M13 DNA continued Step Action 4 While the samples are heating add 70 uL of deionized water to each well of a fresh 96 well plate 5 When heating is complete spin the samples briefly in a centrifuge to return the liquid to the bottoms of the tubes Transfer the samples to the 96 well plate containing the deionized water 6 Cover the samples with foil tape and place in a non frost free 15 to 25 C freezer For more information refer to the Washington University School of Medicine Genome Sequencing Center Genome Sequencing Manual http genome wustl edu gsc manual protocols M13_ThermoMAX_prep html Preparing DNA from M13 Phage by PEG Precipitation and Phenol Extraction Cells infected with recombinant M13 phage are grown in liquid medium After clarification of the growth medium by centrifugation and PEG precipitation single stranded DNA is extracted from the phage particles in the supernatant Reagents and equipment required 2XTY medium pH 7 2 7 4 Step Action 1 Combine the following Bactotryptone 16 0 g Yeast extract 5 0 g NaCl 5 0g Make up to 1 L in autoclaved water 2 Adjust the pH to 7 2 7 4 with NaOH Chloroform WARNING CHEMICAL HAZA
89. DNA Polymerase as an automatic Hot Start Limiting dNTPs and primers All of these methods increase the specificity of the PCR amplification and decrease the amount of contaminants that can interfere with a sequencing reaction Purification There are several methods for purifying PCR products Column purification Ethanol precipitation Gel purification IMPORTANT If more than one PCR product is present neither column purification nor ethanol precipitation will isolate the desired product Use gel purification to isolate the desired product or reoptimize the PCR to obtain a single product Commercially available products for PCR product purification are listed below Centricon 100 columns P N N930 2119 These columns contain an ultrafiltration membrane that separates primers and dNTPs from larger PCR products However they may not work as well for short PCR products lt 125 bases To purify PCR fragments by ultrafiltration Step Action 1 Assemble the Centricon 100 column according to the manufacturer s recommendations 2 Load 2 mL deionized water onto the column 3 Add the entire sample to the column 4 Spin the column at 3000 x g in a fixed angle centrifuge for 10 minutes Note The manufacturer recommends a maximum speed of 1000 x g but 3000 x g has worked well in PE Applied Biosystems laboratories If you are following the manufacturer s guidelines increase the time to compensate Perfo
90. DP4 Ac T7 DP6 Ac 21M13 DP6 Ac M13Rev DP6 Ac SP6 DP6 Ac T3 DP6 Ac T7 Pl mob Pl mob ABI 373 and ABI 373XL with BigDye Filter Wheel 373 dRDT 373 BDT 373 BDP 21 373 BDP rev ABI PRISM 377 All Models DT4 Ac A Set AnyPrimer DT dR Set Any Primer DT BD Set Any Primer DP4 Acv2 M13Rev DP4 Ac 21M13 DP4 Ac SP6 DP4 Ac T3 DP4 Ac T7 Pl mob Pl mob DP5 LR BD M13 FWD amp REV Refer to your instrument user s manual and the ABI PRISM DNA Sequencing Analysis Software User s Manual for more specific information on choosing a dye set primer file Optimizing Software Settings 6 5 Choosing the Correct Basecaller Choosing a_ The basecaller is the program that determines the individual base identities in a Basecaller sequence The PE Applied Biosystems basecallers differ from each other primarily in the shape of the internal spacing curves Choosing the most effective basecaller for any given sample file depends on the quality of the data the type of run and the run and gel conditions Table 6 3 shows basecaller for each run type You can try other basecallers with your data to see which works best Table 6 3 Choosing the Correct Basecaller If the samples are from a Then use ABI PRISM 310 rhodamine dye terminator chemistry with POP 6 CE 2 ABI PRISM 310 all other applications CE 1 24 or 34 cm well to read gel on the ABI 373 ABI50
91. DVIEW fins tesa eee Tan ek od eR ed Ear ate Pitino Oe wai eee eines A 7 1 Data Evaluation ss 00090 shes as oh aaa baie RRS Sw eid aoe le Le gi Roe ES ee 7 2 Practical Examples of Data Evaluation 0 0 00 c cece eee eee 7 10 Troubleshooting Sequencing Reactions 00 0 7 16 Troubleshooting DNA Sequence Composition Problems 02 0 0000 7 30 Troubleshooting Sequencing Data 0 eee nee 7 39 Troubleshooting Gel Electrophoresis on the ABI 373 and ABI PRISM 377 7 44 Troubleshooting Capillary Electrophoresis on the ABI PRISM 310 4 7 55 Troubleshooting Software Settings 0 0 0 cece eee 7 62 A Gel Preparation Ge 5 6 Se peice ee CREDA TATE RRS Rae ET MNO MUCHON 222 2 sate hoa ak pasate e e E E ted ahaa eats ae eee lame us tt Ne A 1 Protocol and Run Conditions for 19 1 Polyacrylamide Gels 000 A 2 Protocol and Run Conditions for 29 1 Polyacrylamide Gels 0000 A 6 Protocol and Run Conditions for Long Ranger and PAGE PLUS Gels A 10 Preparing APS TBE Buffer and Deionized Formamide 0 2 00 0 eee eee A 15 IUB COGS irran bls Os 05 weiss ee Bae oes nad Referentes 50 84 ie kde Rs Wh REDE OCA AAA R a aa ad Technical Support 0c ccc cece cee cence eee Deal How to Get Helps isoscsrs 2s acd aer a x deke E A ae bad wed diss homes sete NG eae D 1 Part N umbefsS Soh ke Ee ee teas Re e
92. E Applied Biosystems takes advantage of this with the ABI PRISM 310 Genetic Analyzer a highly automated capillary electrophoresis instrument Advantages of Capillary Electrophoresis Capillary and slab gel electrophoresis both separate DNA fragments by size through a sieving matrix but there are important differences between the two techniques There is no gel pouring The ABI PRISM 310 Genetic Analyzer uses a liquid polymer that is pumped automatically into the capillary There is no manual sample loading The instrument uses electrokinetic injection Run times are shorter Quantitation is more accurate gt e gt Very little sample is injected which allows the sample to be run several times if necessary Refer to the ABI PRISM 310 Genetic Analyzer User s Manual P N 903565 for more information Optimizing Capillary Electrophoresis 5 1 Capillary Electrophoresis Consumables Polymer The polymer is the medium used to separate DNA fragments There are two types of polymer available for DNA sequencing on the ABI PRISM 310 Genetic Analyzer DNA Sequencing Polymer DSP Performance Optimized Polymer 6 POP 6 POP 6 provides superior performance over DSP because it can be run at a higher temperature and yields greater read lengths Note We do not recommend using the POP 6 polymer with fluorescein rhodamine dye primer chemistry IMPORTANT Do not leave polymer on the instrument more than 5 days Introductio
93. Ensure that the ambient temperature is between 15 and 30 C and the humidity is below 80 Check for excessive condensation on the instrument No signal No sample added Add sample Sample not at bottom of tube Spin sample tube in microcentrifuge Air bubble at bottom of sample tube Spin sample tube in microcentrifuge to remove air bubbles Capillary misaligned with electrode Align capillary and electrode Note The capillary should be adjacent to but not touching the electrode The capillary should protrude 0 5 mm past the electrode 7 58 Data Evaluation and Troubleshooting Troubleshooting Capillary Electrophoresis continued Observation Possible Causes Recommended Actions No signal Capillary bent out of sample tube Align capillary and electrode Recalibrate autosampler Note To verify whether a bent capillary is the problem watch the movement of the autosampler tray during run operation Autosampler not calibrated correctly Calibrate autosampler in X Y and Z directions IMPORTANT The capillary should almost touch the Z calibration point Sealed sample tube septum i e septum will not open to allow electrode into sample tube Septum not placed in the sample tube properly Replace septum Signal too low Insufficient sample injected Increase injection time Old Template Suppression Reagent TSR Use fresh TSR lons in sample l
94. F g a ni Of P Me fd E q pof Z Q0 a E f N W ig Le nae gt RA aia SSi VODLIOVIVS Copyright 1998 The Perkin Elmer Corporation This product is for research purposes only ABI PRISM MicroAmp and Perkin Elmer are registered trademarks of The Perkin Elmer Corporation ABI ABI PRISM Applied Biosystems BigDye CATALYST PE PE Applied Biosystems POP POP 4 POP 6 and Primer Express are trademarks of The Perkin Elmer Corporation AmpliTaq AmpliTaq Gold and GeneAmp are registered trademarks of Roche Molecular Systems Inc Centricon is a registered trademark of W R Grace and Co Centri Sep is a trademark of Princeton Separations Inc Long Ranger is a trademark of The FMC Corporation Macintosh and Power Macintosh are registered trademarks of Apple Computer Inc pGEM is a registered trademark of Promega Corporation Contents 1 IRV OOUCHON cacti ieee eee SORE kanes heel New DNA Sequencing Chemistry Guide 0 0 2 0 0 0 00 e eee ec ee eee 1 1 Introduction to Automated DNA Sequencing 0 00 cece eee ee eee 1 2 ABI PRISM Sequencing Chemistries 0 0 0 eee eee cee eee eens 1 5 PE Applied Biosystems DNA Sequencing Instruments 0000020008 1 7 Data Collection and Analysis Settings 0 0 ee eee 1 12 2 ABI PRISM DNA Sequencing Chemistries 2 1 OVEIVICW Seach et elk uae ee es EE hg Fie de piel ea
95. GCCGG CRANGGNANTGGNCANTGGAGCCTGNTGGNCTCGAAGGCGNCGGC 40 50 60 70 80 90 100 110 idl jhe i my Figure 7 24 Sequence data obtained with BigDye Terminators and a template preparation that contained two different plasmid templates When the DNA was reisolated from a pure colony clean sequence data was obtained Figure 7 25 When picking bacterial colonies for growth and DNA isolation select a colony that is well isolated With M13 plaques fresh plates should be used for plaque picking Check the DNA template purity on an agarose gel see page 3 16 GGGCCCCCCCTCGAGGTCGACGGTATCGATTGGCCGCCAACGGCAATGGGCAGTGGAGCCTGGTGGGCGCGAAGGCGCCGCCGGCE 40 50 60 70 80 90 100 110 120 Figure 7 25 Sequence data obtained with BigDye Terminators and a template isolated from a pure colony There are several primer related problems that can affect the data obtained in sequencing reactions These can be divided into three categories based on the type of problem seen in the data No recognizable sequence Very weak signal Two or more sequences present in the electropherogram No Recognizable Sequence If there is no priming site for the primer in the template no sequence data will be obtained The raw data will show only a flat line except for the primer peak in primer reactions or sometimes excess terminator peaks in the case of terminator reactions Figure 7 9 on page 7 10 Data Evaluation and Troubleshooting
96. Gel Pump value in the Status Window to increase by only 1 2 steps If the instrument detects a syringe leak a warning message appears on the screen Pump blockage pump is plugged with urea or crystallized buffer Remove and clean pump block Refer to the ABI PRISM 310 Genetic Analyzer User s Manual Loose valve fittings or syringe Tighten valve fittings and syringe Anode buffer valve does not open Open buffer valve Note The valve should depress easily when you push the top with your finger tip After you release the pressure the valve should spring to the open position If the valve is stuck it should be cleaned Plugged broken or nonconducting capillary Replace the capillary Poor quality water in buffer solutions Remake buffer with freshly autoclaved distilled deionized water Incorrect polymer solution formulation Make or install new polymer solution Data Evaluation and Troubleshooting 7 57 Troubleshooting Capillary Electrophoresis continued Observation Possible Causes Recommended Actions No current Corrupted firmware Resend firmware by performing a cold boot reset Syringe Pump Force too low Capillary is not being filled completely Call DNA Technical Support Low current Small bubble in capillary blocking current flow Replenish gel in capillary Small bubble in pump block Remove bubble by repriming the pump block with p
97. I 373 DNA Sequencer does not use run modules Run parameters are set on the instrument s keypad Refer to the 373 DNA Sequencing System User s Manual P N 902376 for information on setting run parameters ABI PRISM 310 and ABI PRISM 377 All Models A run module file contains all the parameters required for a particular function or application The parameters include the following Electrophoresis voltage Current and power settings Laser settings Scanner settings ABI PRISM 377 DNA Sequencer only Dye Set Primer Files Virtual filters and CCD gain and offset Run temperature settings Injection time and voltage ABI PRISM 310 Genetic Analyzer There are three types of module files Not all of the parameters listed above are in each module file Plate check These modules are for checking the cleanliness and alignment of the gel plates Laser scanning virtual filter and CCD conditions are associated with these types of files Prerun These modules are for prerunning the gel or polymer Laser scanning virtual filter and electrophoresis CCD and gel temperature conditions are associated with these types of files Note Plate check and prerun modules are not used with the ABI PRISM 310 Genetic Analyzer Run These modules are for running the gel or polymer Laser scanning virtual filter CCD and electrophoresis parameters and gel temperature are associated with these types of files IMPORTA
98. I TTT GTA GATCTCACAAATTATCT TA GA GCT GGTATTIAGAATCTTCTT CAGGGTCAGCATAT TT CATACGA G GG TATTACGAAAT GTATTAT GTATTTGT GASA4 GCAGASA GTA GAAAATAATCTACASATTT 10 20 30 49 50 60 70 80 90 100 110 120 130 148 r ITTAGCTGTT GGTTATACT CA GAAGRAGAAAGTGCITTTCTIT TO TITCTTITC CTTTTCTITTC ATITCCATC CCCCCCGAGATC GGAGTTTCA CCCTG TTGCCCA GGETG GAG 50 160 170 180 190 200 210 220 230 240 250 260 270 280 A Aa a a a aAa a A N A AAN TA CAGTGGCATGATCTCGGCTCACT GCAAC CTCCACCTCCT G GGTT CAAGCA GTTCCTCTGCCT CACCAT CCCGA GTA GATG GGAT TACA GGT GC CTGC CATGAAGCCC GGCTAATT c 20 300 310 320 330 340 350 360 370 380 390 400 410 luau wt nn lana adn allan nan TAT A GTAGA GACT GGGT TTCACCA TTTGCCCT GGCTGGTCTC GSACTC CTGAC CTCAAATTATCCA CCCGCCTCGGCCT CCCAAA GTGETA GGATGACA GGCGTGAG CC CGCTTCTATT TGA 420 430 440 450 460 470 480 490 500 510 520 530 549 GAT TCAATAT G GCTT TGACCCAGTTT GT GTCTGTAT CT GATAGTCTT TAG GCAGT C4GGCTT CT GGGGTCT CGACTAC CTTCCCGAGASAGTCT GCATT TGGACTCTG AAAG GGGCAGTASTGTTCT 550 560 570 580 590 600 610 620 630 640 650 660 670 680 TC CAT FATCAAAAGT GTAATATTA TGGAATA GAA AGCACGTAATTTTGAATCTTAATGGSTASCATAC CCT TCTGGCATTT TASATTGO CT CAT TIT GT CAGA CT TCCCCCTG GACACCAGGGCGACT CGA T TCAT CAG 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 BICT TTGACTGAGACAGCTT CT GG4G4T GOT TCCAGGT GGTACTAAAASTAG AAGGATATCCAT GGAGTG TAA GAGA THT ASTAAGA SIGATCATICT T THTEG GEATICS AAAG CIGA 850 860 870 880 890 900 910
99. INTENSITY pitiuia Pepi tii tiiliirilirri 0 oo 520 540 560 580 600 620 640 660 0 S500 520 540 560 580 600 620 640 660 WAVELENGTH nm WAVELENGTH nm R110 R6G TAMRA ROX d R110 dR6G dTAMRA dROX Figure 2 7 Emission spectra of rhodamine and dRhodamine dyes Note the narrower emission spectra of the dRhodamine dyes Fluorescein The normalized emission spectra of the fluorescein and rhodamine dyes used in the Rhodamine Dyes ABI PRISM Dye Primer Cycle Sequencing Kits are shown in Figure 2 8 100 NORMALIZED FLUORESCENCE INTENSITY 0 L aa E E Ii po tag yp yp ss s r 500 520 540 560 580 600 620 640 WAVELENGTH nm 5 FAM JOE TAMRA ROX Figure 2 8 Emission spectra of the dyes used in ABI PRISM Dye Primer Cycle Sequencing Kits 2 12 ABI PRISM DNA Sequencing Chemistries Chemistry Instrument Filter Set Compatibilities Chemistry and Table 2 1 shows which chemistries can be used on which instruments Instrument Compatibilities Filter Sets Table 2 1 Chemisiry Instrument Compatibilities Sequencing Chemisiry Rhodamine Fluorescein Dye dRhodamine BigDye Rhodamine BigDye Instrument Terminator Terminator Terminator Dye Primer Primer ABI 3734 yes no no yes no ABI 3732 with no yes yes no yes BigDye Filter Wheel ABI PRISM 310 yes yes yes yes yes and ABI PRISM 377
100. Incorrect instrument file used as in the example above Poor quality instrument file Choosing the wrong run module which causes the wrong filter set to be used to collect the data Figure 7 14 shows BigDye terminator sequencing data with poor mobility correction Some peaks are very close together while others have large gaps between them The annotation view not shown reveals that the BigDye primer mobility file was used to analyze the data Looking at the raw data is not helpful because mobility corrections are not applied to raw data TTTCCCC NTTIGTGAWNAGTC TTGCT ACC TAGCT AC TGGC ACG AGGTG AGA 40 50 60 70 60 Figure 7 14 BigDye terminator data analyzed with a BigDye primer dye set primer mobility file which results in poor mobility correction Data Evaluation and Troubleshooting 7 13 There are three potential causes of poor mobility correction Choosing the incorrect dye set primer mobility file as in the example above Incorrect Peak 1 Location for data analysis If the Peak 1 Location is not set correctly the mobility algorithm is not applied correctly see Setting the Data Analysis Range on page 6 15 Using a gel matrix on the ABI 373 or ABI PRISM 377 DNA Sequencer with very different separation properties from the gel matrices that were used to construct the dye set primer mobility files For information on selecting the correct dye set primer file for your gel type refer to the ABI PRISM DN
101. Ligochem http www ligochem com PE Applied Biosystems http www perkin elmer com ab Genetic Analysis page http Awww2 perkin elmer com 80 ga index htm QIAGEN http www qiagen com Sanger Centre http www sanger ac uk The Institute for Genome Research TIGR http Avww tigr org University of Oklahoma Advanced Center for Genome Technology ACGT http www genome ou edu University of Washington Genome Center http www genome washington edu uwgc Washington University School of Medicine Genome Sequencing Center GSC http genome wustl edu gsc References C 3 Technical Support How to Get Help To Reach Us On the World Wide Web To Reach Us by Telephone Fax or E mail Hours for Telephone Technical Support Our Web site address is http Awww perkin elmer com ab We strongly encourage you to visit our Web site for answers to frequently asked questions and to learn more about our products You can also order technical documents and or an index of available documents and have them faxed to you through our site see the Fax on Demand section below Phone 1 800 831 6844 Select 22 for Fluorescent DNA Sequencing Technical Support To open a service call for other support needs or in case of an emergency press 1 after dialing 1 800 831 6844 Fax 1 650 638 5891 E mail galab perkin elmer com In the United States and Canada technical support is available between 5 30 a m and 5 00 p m P
102. NT When you select a run module the virtual filter set is chosen automatically You must be careful to select the correct run module for your sequencing chemistry The available run modules are listed in Table 6 1 on page 6 2 Mobility Correction The different dyes affect the electrophoretic mobility of cycle sequencing extension products The relative mobility of the dye labeled fragments is specific to each sequencing chemistry see page 6 4 for more information Under the same set of conditions the mobilities are very reproducible The analysis software is able to compensate for these mobility differences by applying mobility shifts to the data so that evenly spaced peaks are presented in the analyzed data The files that contain the mobility shift information are called dye set primer files Dye set primer files also tell the Sequencing Analysis software see page 1 16 the following Which matrix file in the instrument file see page 1 14 to use to analyze the data Dye base relationships for converting raw data colors to base calls see page 2 14 The dye set primer files available are listed in Table 6 2 on page 6 5 Introduction 1 13 Instrument Files Multicomponent Analysis 1 14 Introduction Multicomponent analysis is the process that separates the four different fluorescent dye colors into distinct spectral components Although each of these dyes emits its maximum fluorescence at a different wavelength there is so
103. Note The run temperature can be set in the Manual Control window while the samples are being prepared but we still recommend repeating the first sample 7 60 Data Evaluation and Troubleshooting Troubleshooting Capillary Electrophoresis continued Observation Possible Causes Recommended Actions Fragments migrate slower than normally Capillary allowed to dry out Leave capillary in buffer or water when not in use Dirty sample Purify extension reactions before sequencing Air bubbles in pump block or capillary Check for leaks and remove air bubbles Incorrect buffer concentration Remake running buffer Clogged pump block Remove pump block and clean it Syringe pump failure Call DNA Technical Support Runs get progressively slower i e primer peaks come off at higher and higher scan numbers Leaking syringe polymer is not filling capillary before every injection Clean syringe thoroughly Replace syringe Syringe out of polymer Fill syringe with fresh polymer Runs get progressively faster i e primer peaks come off at lower and lower scan numbers Water in syringe Prime syringe with small volume of polymer invert syringe to coat capillary walls and discard polymer Then fill syringe with fresh running polymer Poor resolution see Figure 7 59 on page 7 55 Poor capillary performance Replace capillary Incorrectly p
104. P N Item Size Amt 402837 Performance Optimized Polymer 6 POP 6 3 mL Generally used for sequencing No template suppression reagent included 200 sample run 402844 Performance Optimized Polymer 6 POP 6 with TSR 3 mL Includes two 4 mL vials of Template Suppression Reagent 200 sample runs 403076 POP 6 polymer with TSR for Shared Instruments 3 mL Includes eight 4 mL vials of Template Suppression Reagent 200 sample runs 402824 10X Genetic Analyzer Buffer with EDTA 25 mL Used with POP 6 polymer 402839 ABI PRISM 310 Capillaries 47 cm x 50 um internally uncoated 5 pkg Used with POP 6 polymer for rapid sequencing 500 sample runs 100 runs capillary 402840 ABI PRISM 310 Capillaries 61 cm x 50 um internally uncoated 2 pkg Used with POP 6 polymer for long read sequencing 200 sample runs 100 runs capillary 401957 Genetic Analyzer Sample Tubes 0 5 mL 500 pkg 401956 Genetic Analyzer Septa for 0 5 mL Sample Tubes 500 pkg For 48 Tube Tray 402059 Genetic Analyzer Septa Strips 0 2 mL tube 485 pkg For 96 Tube Tray 24 strips Part Numbers E 5 E 6 Part Numbers Polymers and Consumables for the ABI PRISM 310 Genetic Analyzer continued P N Item Size Amt 402866 Genetic Analyzer Retainer Clips 4 pkg 96 Tube Tray Septa Clips N801 0580 MicroAmp 0 2 mL Sample Tubes 8 strip 1000 pkg 403081 MicroAmp Tray and Retainer 10 sets N801 0531 MicroAmp Base 10 pk
105. R peak but there will be an abrupt end to sequence peaks in the data file Set the Stop Point there For other samples the Stop Point can be set where the data becomes too weak to give useful information or after a position where the sequence data stopped abruptly due to secondary structure in the template or for some other reason The inclusion of large amounts of data points with little or no signal at the end of the sequence will affect the scaling of the analyzed data Their removal may be necessary to get better data in the region where there is good signal If you need to change the Stop Point use the following procedure refer to Figure 6 3 during the procedure 632 1264 1896 2528 31 60 3792 zig 6368 Stop Point Sara 477E z980 3184 2388 1592 i pa 736 Figure 6 3 Electropherogram of raw data from a fluorescein rhodamine dye primer sequencing reaction run on a short PCR product The dashed vertical line shows the recommended position of the Stop Point Optimizing Software Settings 6 21 Using Sequencing Analysis Version 2 1 Step Action 1 Launch the Sequencing Analysis software if it is not already open 2 In the Sample File Queue display double click the first file to be analyzed to view the raw data Zoom in completely From the Window menu choose Actual Size or use the keys on the keyboard Starting at the beginning of the raw data file scroll along the data
106. RD Chloroform is extremely toxic and a potential human carcinogen This chemical is highly corrosive to skin and eyes Always work ina fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Ethanol 95 Ethanol 70 PEG solution 20 PEG 2 5 M NaCl Make up fresh as needed from equal volumes of 40 PEG in deionized water and 5 M NaCl stocks Sodium acetate NaOAc 3 M pH 5 2 TE buffer 10 mM Tris HCl 1 mM EDTA pH 8 0 TEg buffer 10 mM Tris 0 1 mM EDTA pH 8 0 Tris buffer 10 mM pH 8 0 Tris saturated phenol pH gt 7 6 5 gt A gt o 3 4 Performing DNA Sequencing Reactions WARNING CHEMICAL HAZARD Phenol is a highly toxic combustible and vesicant chemical that causes burns and is readily absorbed through the skin It is extremely destructive to mucous membranes eyes and skin Inhalation and ingestion can cause CNS liver pancreas and spleen damage and can be fatal Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves 1 5 mL microcentrifuge tubes Sterile 10 mL tubes centrifugable at 10 000 x g Sterile cotton tipped swabs Sterile Pasteur pipettes To grow M13 infected cells Step Action 1 Inoculate 10 mL of 2X TY medium with a single colony of E coli grown on glucose minimal agar Shake overnight at 37 C
107. Reagents and equipment required Variable speed table top centrifuge with microtiter plate tray capable of reaching at least 1400 x g Strip caps or adhesive backed aluminum foil tape 3M Scotch Tape 425 3 75 Isopropanol 2 propanol or 100 isopropanol anhydrous at room temperature Note This procedure does not use salt To precipitate extension products in MicroAmp Trays Step Action 1 Remove the MicroAmp Tray from the thermal cycler Remove the caps from each tube Add one of the following 80 uL of 75 isopropanol or 20 uL of deionized water and 60 uL of 100 isopropanol The final isopropanol concentration should be 60 5 Seal the tubes with strip caps or by applying a piece of 3M Scotch Tape 425 3 adhesive backed aluminum foil tape Press the foil onto the tubes to prevent any leakage Invert the tray a few times to mix Leave the tray at room temperature for 15 minutes to precipitate the extension products Note Precipitation times lt 15 minutes will result in the loss of very short extension products Precipitation times gt 24 hours will increase the precipitation of unincorporated dye terminators Place the tray in a table top centrifuge with tube tray adaptor and spin it at the maximum speed which must be 21400 x g but lt 3000 x g 1400 2000 x g 45 minutes 2000 3000 x g 30 minutes Note A MicroAmp tube in a MicroAmp Tray can withstand 3000 x g for 30 min
108. SM 377 DNA Sequencer clean the gel plates thoroughly and mount them in the gel pouring cassette or alternative device For the ABI 373 DNA Sequencer clean the gel plates thoroughly and prepare them for gel pouring Preparing the acrylamide urea solution Step Action 1 Combine urea 40 acrylamide stock deionized water and mixed bed ion exchange resin in a 150 mL beaker WARNING CHEMICAL HAZARD Urea causes eye skin and respiratory irritation Lab experiments have shown mutagenic effects Avoid contact Wear chemical resistant gloves safety goggles and other protective clothing WARNING CHEMICAL HAZARD Acrylamide and bisacrylamide are neurotoxins Avoid inhalation and skin contact Wear gloves at all times and work in a fume hood when handling acrylamide solutions Use appropriate precautions to avoid inhalation of crystalline acrylamide Read the manufacturer s MSDS before handling 2 Stir the solution until all the urea crystals have dissolved 3 Filter the solution through a 0 2 um cellulose nitrate filter A 8 Gel Preparation Preparing the acrylamide urea solution continued Step Action 4 Degas for 2 5 minutes Note Degas time for all gels should be constant to ensure a reproducible polymerization rate for all gels 5 Transfer the solution to a 100 mL graduated cylinder 6 Add filtered 10X TBE buffer IMPORTANT Always remove the mixed b
109. TCG 40 50 60 70 60 90 100 Figure 7 12 Noisy data after a specific point This kind of noise can have the following causes Mixed plasmid or PCR preparation as in the example above Frame shift mutation Primer dimer contamination in PCR sequencing Slippage after homopolymer region in template 7 12 Data Evaluation and Troubleshooting Noise Caused by an Incorrect or Poor Quality Instrument Matrix File Figure 7 13 on page 7 13 shows BigDye terminator data collected on an ABI PRISM 377 DNA Sequencer with specific peaks under peaks throughout the run For example every black peak has a smaller red peak underneath it The annotation view not shown indicates that an incorrect instrument file one for Filter Set A instead of Filter Set E was used to analyze the data If your data looks like this you should check that the correct run module was used to collect the data If the correct run module and instrument file were used you may have a poor quality matrix In this case the instrument file should be remade see page 6 7 For this type of noise the raw data appears normal because a matrix is not applied to raw data Poor Mobility Correction GCCAGCGCAAGCGGGCCGAGCGGGCGCTGAACGACCAGCTGGAATTWATGCGCGTGCTCATCGACGGCA 120 130 140 150 160 170 160 Figure 7 13 BigDye terminator data analyzed with an incorrect Filter Set A instrument file Potential causes of this type of noise are the following
110. The damaged gel matrix scatters the laser light with the effect on red light the greatest Gel destruction often results from drying out of the gel and is exacerbated by extreme run conditions i e high voltage high power high temperature and long run times Therefore 36 cm 2400 scan hr and 48 cm runs are expected to suffer from red rain more readily than 36 cm 1200 scan hr runs However red rain has been reported to occur in all three standard ABI PRISM 377 run conditions Optimizing Gel Electrophoresis 4 5 The following can be used to help prevent red rain Wrap the gel plates to prevent the gel from drying out Lower the run temperature from 51 C to 48 C A lower temperature results in a slower run speed Less data will be collected in the same run time A lower temperature also means less denaturing power in the gel which can lead to more compressions Gel Plate Quality Use high quality gel plates Plates from vendors other than PE Applied Biosystems may not have the same quality control Several problems result from poor quality plates including warping Figure 7 58 on page 7 52 shows data from plates that warped after 6 months of use When plates become warped the pathlength of the light changes and the laser no longer focuses correctly on the gel When this occurs on the ABI 373 DNA Sequencer laser light is scattered back to the detector causing the gel image to appear blue and green and obscuring data
111. Thermal Cycler TC1 or DNA Thermal Cycler 480 a Add 20 ut of light mineral oil b Spin to layer the oil over the aqueous reaction High Sensitivity 2X Reactions Aliquot the following reagents into four PCR tubes Reagent A uL C uL G pL T pL Ready Reaction Premix 8 8 8 8 DNA Template see Table 3 1 on 2 2 2 2 page 3 17 for quantity Total Volume 10 10 10 10 Note These high sensitivity reactions have been optimized on the GeneAmp PCR System 9600 or 9700 in 9600 emulation mode The protocols would need to be reoptimized for use on other thermal cyclers The cycle sequencing procedure is on page 3 30 Performing DNA Sequencing Reactions Cycle Sequencing Overview These protocols have been optimized for all PE Applied Biosystems thermal cyclers including the DNA Thermal Cycler TC1 the DNA Thermal Cycler 480 the CATALYST 800 Molecular Biology LabStation the ABI PRISM 877 Integrated Thermal Cycler and the GeneAmp PCR Systems 9600 2400 and 9700 in 9600 emulation mode The protocols contained in this section should work for all seven instruments If you use a thermal cycler not manufactured by PE Applied Biosystems you may need to optimize thermal cycling conditions Ramping time is very important If the thermal ramping time is too fast gt 1 C sec poor noisy data may result Dye Terminator These protocols except for sequencing BAC DNA and other large templates are used Chemistries for
112. a AGTAGTGTTGGTTGTAGAAGGTGATTGAACAGGA ATTGAATT TGGAGTN NAAGAAGAGGANGAGG NNNNGNNGG N NGCNNNNT GNGANNNNNNN N NNGAC CNTTNE N NNNAT NI 240 250 260 270 280 290 300 310 320 330 348 358 Figure 7 43 A template with a very GT rich region sequenced using BigDye terminator chemistry Note the lack of signal after the GT rich region When the same template was sequenced with dRhodamine terminators good data was obtained beyond the GT rich region Figure 7 44 AATGT AST ACGACTCACTA TANGGCGS A TG GGTACCGGGCCCCCCCTCGAGGT CGACGGT AT CGATAAGCTTG ATATCGAATTCCTT TIGTTTAGTTTATT TTGATT TGTAGT GAAAG GTTTGT 100 110 120 TT GTATTG GAGAG GTTTATAGTT TIAATGATTT GAAGTAGTTGT TGTTGTTGTAGTT GTGGTTGTGTIGT TAGT TGT TGATGAAGTA GTGT TGGTT GTAGAAGG TGAT TGA4 149 150 160 170 180 190 200 210 220 230 249 250 260 l CAGGAATTGAATT TGGAGTA GAA GAAGAGGA GGAG GTA GTTGA AG GT GA AGCA GAAT GA GAATT TAA ATT TGA TGACACATT TG CA TT TGAATT TGAAGAGGAGGATTGATTAGAA G 270 280 290 300 310 320 330 340 350 360 370 38 Figure 7 44 Same template as in Figure 7 43 but sequenced with dRhodamine terminators In both chemistries dITP is used in place of dGTP but in the BigDye terminator chemistry the dTTP has been replaced with dUTP as well Both dITP and dUTP will lower the melting temperature of DNA Presumably with such a high concentration of Gs and Ts in this region the duplex formed by the extended primer and the templat
113. acific Time See Regional Offices on page D 3 for how to contact local service representatives outside of the United States and Canada Technical Support D 1 Fax on Demand Free 24 hour access to PE Applied Biosystems technical documents is available by fax You can access Fax on Demand documents through the internet or by telephone If you want to order Then through the Use http www perkin elmer com fod nternet You can search for documents to order using keywords Up to five documents can be faxed to you if you already know the titles by phone fromthe a Call 1 800 487 6809 from a touch tone phone Have your fax United States or number ready Canada b Press 1 to order an index of available documents and have it faxed to you Each document in the index has an ID number Use this as your order number in step d below c Call 1 800 487 6809 from a touch tone phone a second time d Press 2 to order up to five documents and have them faxed to you by phone from a Dial your international access code then 1 650 596 4419 from a outside the United touch tone phone States and Have your complete fax number and country code ready 011 Canada precedes the country code b Press 1 to order an index of available documents and have it faxed to you Each document in the index has an ID number Use this as your order number in step d below c Call 1 650 596 4419 from a touch tone phone a second
114. ady Reaction 100 403045 Ready Reaction 1000 4303143 Ready Reaction 5000 ABI PRISM BigDye Terminator Cycle Sequencing Kits with AmpliTaq DNA Polymerase FS P N Kit Reactions 4303573 Ready Reaction 24 4303149 Ready Reaction 100 4303150 Ready Reaction 1000 4303151 Ready Reaction 5000 ABI PRISM BigDye Primer Cycle Sequencing Ready Reaction Kits with AmpliTaq DNA Polymerase FS P N Primer Reactions 403051 21 M13 100 403049 21 M13 5000 403052 M13 Reverse 100 403050 M13 Reverse 5000 Part Numbers E 1 ABI PRISM Dye Terminator Cycle Sequencing Kits with AmpliTaq DNA Polymerase FS P N Kit Reactions 402080 Ready Reaction 100 402119 Ready Reaction 1000 402118 Core Kit 100 ABI PRISM Dye Primer Cycle Sequencing Ready Reaction Kits with AmpliTaq DNA Polymerase FS P N Primer Reactions 402111 21 M13 100 402109 M13 Reverse 100 ABI PRISM Dye Primer Cycle Sequencing Core Kits with AmpliTaq DNA Polymerase FS P N Primer Reactions 402071 21 M13 100 402072 M13 Reverse 100 402073 21 M13 M13 Reverse 100 402126 T7 100 402127 T3 100 402128 SP6 100 402129 T7 SP6 100 402130 T3 T7 100 402125 Kit reagents only primerless 100 E 2 Part Numbers Dye Labeled Includes 20 pmol of FAM and JOE labeled primer 40 pmol of TAMRA and Primers ROX
115. age high power high temperature and long run times The following can be used to help prevent red rain Wrap the gel plates to prevent the gel from drying out Lower the run temperature from 51 C to 48 C A lower temperature results in a slower run speed Less data is collected in the same run time A lower temperature also means less denaturing power in the gel which can lead to more extension product secondary structure in the gel This can result in more compressions particularly with dye primer chemistries see page 7 31 Figure 7 55 Red rain on a 48 cm 36 lane ABI PRISM 377 gel Data Evaluation and Troubleshooting 7 49 Gel Extrusion When voltage is applied on the ABI PRISM 377 DNA Sequencer the polyacrylamide gel sometimes moves from between the glass gel plates toward the cathode upper electrode and into the upper buffer chamber In extreme cases up to about five centimeters of gel in a folded sheet can be deposited in the chamber This gel extrusion usually begins at the start of a run or even during the prerun It is believed to be caused by a buildup of charge on the surface of the glass plate such that the gel is not bound to the plate after pouring As the voltage is applied the gel migrates toward the upper electrode The gel image can show a variety of anomalous effects including catastrophic loss of resolution lane splitting extreme band tilt and band distortion Figure 7 56
116. age 3 18 Multiple primers when sequencing PCR products Purify your PCR template to remove excess primers See page 3 12 Primer with N 1 contamination Use HPLC purified primers High signal saturating detector Use less DNA in the sequencing reactions or load less on the gel or into the capillary Incorrect run module Use the correct run module See page 6 2 Incorrect instrument matrix file Use the correct instrument file for your sequencing chemistry See page 6 7 for information on creating instrument files 7 40 Data Evaluation and Troubleshooting Troubleshooting Sequencing Data continued Observation Possible Causes Recommended Actions Noise up to or after a specific point in the sequence see page 7 12 Mixed plasmid preparation Ensure that you have only one template See Plasmid DNA Templates on page 3 6 and Determining DNA Quality on page 3 16 Multiple PCR products Ensure that you have only one template See Preparing PCR Products for Sequencing on page 3 12 and Determining DNA Quality on page 3 16 Primer dimer contamination in PCR sequencing Optimize your PCR amplification See page 3 10 Make sure there is no sequence complementarity between the two PCR primers Use a sequencing primer that is different from either of the PCR primers Ensure that your sequencing primer does not overlap the sequenc
117. age 3 50 or Preparing and Loading Samples for Capillary Electrophoresis on page 3 53 GC rich template or GC rich region in template Increase the denaturation temperature to 98 C Add DMSO to a final concentration v v of 5 Incubate the reaction at 96 C for 10 minutes before cycling Double all reaction components and incubate at 98 C for 10 minutes before cycling Add 5 10 glycerol or 5 10 formamide to the reactions Linearize the DNA with a restriction enzyme Shear the insert into smaller fragments lt 200 bp and subclone Amplify the DNA using 7 deaza dGTP in the PCR then sequence the PCR product Expired or mishandled reagents Use fresh reagents See page 3 20 Thermal cycling conditions Calibrate the thermal cycler regularly Use the correct thermal cycling parameters Use the correct tube for your thermal cycler Set ramp rates to 1 C second Lane tracking failure Check lane tracking Retrack and reextract lanes if necessary Noisy data throughout sequence with good signal strength see page 7 11 Contaminated template Clean up the template See page 3 16 Multiple templates in sequencing reaction Examine your template on an agarose gel to see that only one template is present See page 3 16 Multiple priming sites Ensure that your primer has only one priming site Redesign the primer if necessary See p
118. al cycling Transfer the contents of the A reaction tube into the C reaction tube Pipet that mixture into the G reaction tube and so on until the contents of all four reaction tubes have been transferred into a single 1 5 mL microcentrifuge tube Spin the tube in a microcentrifuge for 10 20 minutes at maximum speed Carefully aspirate the supernatant and discard At this point a pellet may or may not be visible 3 46 Performing DNA Sequencing Reactions Method 2 continued Step Action 5 Optional Rinse the pellet with 250 uL of 70 ethanol and spin for 5 minutes in a microcentrifuge Again carefully aspirate the supernatant and discard This may remove some of the salts from the pellet but doing so is often not necessary Note If you use sodium acetate you must rinse the pellet This will reduce the carryover of salt Dry the pellet in a vacuum centrifuge for 1 3 minutes or until dry Do not overdry Ethanol Reagents and equipment required for this method Precipitation for 4 BigDye Primers 1 5 mL microcentrifuge tubes Benchtop microcentrifuge capable of reaching at least 14000 x g Vacuum centrifuge 95 Ethanol ACS reagent grade non denatured Note This procedure does not use salt IMPORTANT Use non denatured 95 ethanol rather than absolute 100 ethanol Absolute ethanol absorbs water from the atmosphere gradually decreasing its
119. amide which hinders the reproducibility of gel formation When used in conjunction with the ABI 373 or ABI PRism 377 DNA Sequencer a typical gel made with good reagents and properly polymerized can separate DNA fragments from 1 600 bases in length easily An exceptional gel used on the ABI 373 or ABI PRISM 377 DNA Sequencer can yield basecalling beyond 900 bases For more information refer to Acrylamide Polymerization A Practical Approach on the Bio Rad Laboratories World Wide Web site http Awww bio rad com 38973 html Optimizing Gel Electrophoresis 4 1 Reagents Acrylamide Urea TBE Buffer APS WARNING CHEMICAL HAZARD Acrylamide and bisacrylamide are poisons neurotoxins irritants carcinogens and possible teratogens Acrylamide and bisacrylamide sublime the solids release toxic vapor and are harmful if swallowed inhaled or absorbed through the skin Effects are cumulative When handling always wear protective equipment lab coat safety glasses and chemical resistant gloves and use in a well ventilated area On a routine basis thoroughly clean surfaces subject to contamination Use fresh high quality acrylamide Poor quality acrylamide contains acrylic acid a deamidation product and linear polyacrylamide which will copolymerize and cause local pH changes in the gel This causes streaking and smearing of bands Figure 7 50 on page 7 44 Store acrylamide solutions at 2 6 C up to 1 month During
120. are if it is not already open 2 In the Sample Manager window click the Add Files button and choose the sample to be analyzed Click Done 3 Highlight the sample name and click the Open Files button to display the raw data or double click the sample file name Zoom in completely From the Window menu choose Actual Size or use the keys on the keyboard Optimizing Software Settings 6 17 Using Sequencing Analysis Version 3 0 or 3 2 continued Step Action 4 Starting at the beginning of the raw data file scroll along the data by clicking and holding the right direction arrow at the bottom of the window Continue scrolling until the primer peak is approximately in the center of the dialog window 5 a Click and drag in the window to change the cursor to a cross hair b Move the cursor along the data until the vertical dotted line is aligned at the right edge of the primer peak Figure 6 1 on page 6 16 c Read the scan number data point that is reported at the top of the dialog box 1109 in the example shown in Figure 6 1 Use this number as the Peak 1 Location of the file 6 Return to the Sample Manager window Highlight the Peak 1 Location box and enter the information If you want to use the Peak 1 location value for the Start Point enter the new Start Point as well Note The Start Point value must be equal to or greater than the Peak 1 Location value or an error will occur If the St
121. art Point is not greater than the Peak 1 Location highlight the Start Point box and enter a number greater than or equal to the number used for the Peak 1 Location Peak 1 Location for As with dye primer chemistries the Peak 1 Location value Primer Peak Location is Dye Terminator the position that marks the beginning of the first base in the file To determine the Peak Chemistries 1 Location in terminator chemistry the software looks for an increase in signal followed by several peaks With dye terminator chemistries the raw data can show peaks between scan points These peaks can be designated erroneously as the Peak 1 Location value by the software These peaks are due to unincorporated dye terminators that are not removed during the purification of the dye terminator reactions If your data has excess dye peaks or if the software has not chosen the Peak 1 Location correctly you will need to set this manually To change the Peak 1 Location use one of the following procedures depending on which version of the Sequencing Analysis software you are using refer to Figure 6 2 on page 6 19 during the procedure 6 18 Optimizing Software Settings 500 720 340 960 1080 360 Figure 6 2 Electropherogram of raw data with the dashed vertical line showing the left edge of the first data peak which is the recommended position of the Peak 1 Location for this sample file i e 960 scans Using Sequencing Analysis Ve
122. ass Plates Spacers Kit Includes two sets of 48 cm Well to Read Glass Plates and Gel Spacers 4305810 48 cm Glass Plates Spacers Kit for the for the ABI PRISM 377 with 96 Lane Upgrade Includes one set of 48 cm Well to Read Glass Plates and Gel Spacers 401876 36 cm Glass Plates Spacers Kit Includes two sets of 36 cm Well to Read Glass Plates and Gel Spacers 4305693 36 cm Glass Plates Spacers Kit for the ABI PRISM 377 with 96 Lane Upgrade Includes one set of 36 cm Well to Read Glass Plates and Gel Spacers 401835 48 cm Rear Glass Plate 401838 48 cm Front Glass Plate 4305387 48 cm 0 4 mm Stepped Front Glass Plate for the ABI PRISM 377 with 96 Lane Upgrade 401837 Two 48 cm Gel Spacers 0 2 mm thick 401839 36 cm Rear Glass Plate 401840 36 cm Front Glass Plate 4305384 36 cm 0 4 mm Stepped Front Glass Plate for the ABI PRISM 377 with 96 Lane Upgrade 401836 Two 36 cm Gel Spacers 0 2 mm thick P N Item 402168 18 well Sharktooth Comb 0 2 mm thick 401827 24 well Sharktooth Comb 0 2 mm thick 401922 32 well Sharktooth Comb 0 2 mm thick 401828 36 well Sharktooth Comb 0 2 mm thick 402177 48 well Sharktooth Comb 0 2 mm thick 402180 64 well Sharktooth Comb 0 2 mm thick 4305385 100 well Sharktooth Comb 0 4 mm thick for the ABI PRISM 377 with 96 Lane Upgrade Cassette Buffer Chambers and Heat P N Item Plate 604297 Gel Cassette 401991 Gel Pouring Fixture Kit contains top and bottom fixtures clamps and s
123. at showed three bands on an agarose gel even though the PCR product was cleaned up by ultrafiltration After gel purification good sequence data was obtained for the product of interest Figure 7 23 INCGCATTGTCTCTGAAACCCAAAGTNNAGNGTGTTWCCATTG NTCCCNNTGTANTCNHNCTTCCAGACARAACAG ACNNTTANAGCTACNTC 0 30 40 50 60 70 80 90 100 110 mit Mak eS Hh Ny Ht IN dull H Lily wll Figure 7 22 Rhodamine dye terminator data from a contaminated PCR product ATTGTNTGATCTTGTTTCACTGCATGTACATACATGGTATATTTTCTGTGTTCATGCTATTAAAAAATCCCATAAAGTCCCATGTTCTAAR 40 50 60 70 60 30 100 110 120 7 Figure 7 23 Rhodamine dye terminator data from the same PCR product after gel purification 7 18 Data Evaluation and Troubleshooting Primer Related Problems For cloned DNA the presence of two or more sequences generally results when mixed plaques or colonies are picked In Figure 7 24 the plasmid DNA used in the sequencing reaction was isolated from a mixed culture that contained bacteria with only vector DNA and bacteria with vector containing the insert of interest With a mixed clone such as this the early sequence data is clean because this is the sequence of the multiple cloning site After the cloning site the data is noisy with peaks under peaks CGGGCCCCCCCTCGAGGTCGACGGTATCGATTG
124. ate instrument matrix file to get good data The instrument file contains the information that allows the Sequencing Analysis software to compensate for the spectral overlap between the dyes when data is analyzed In some cases using an incorrect instrument file causes analysis to fail Instrument files vary between different instruments and between filter sets on a single instrument An instrument file must be made for each filter set on each instrument The appropriate matrix file can be applied to data on subsequent capillary runs or gels on the same instrument as long as the same filter set is used This is because the spectral overlap between the four dyes is very reproducible You will need to make a new instrument file if Different dye set used Aging filter wheel on an ABI 373 DNA Sequencer Changes to any optics occur e g new filter wheel on an ABI 373 DNA Sequencer or CCD camera on an ABI PRISM 310 or ABI PRISM 377 instrument If you use the wrong instrument file Figure 7 65 on page 7 63 you will need to reanalyze the data with the correct instrument file However if you collect data using the wrong filter set you should rerun the samples using the correct filter set Refer to the ABI PRISM DNA Sequencing Analysis Software User s Manual for instructions on creating a new instrument file or follow the instructions on page 6 8 for creating an instrument file for dRhodamine based chemistries The Data Utility software is
125. ater A 2 Gel Preparation Ingredients and Run For 24 cm WTR Runs 6 19 1 Polyacrylamide Gel 8 3 M Urea Conditions for the ABI 373 exchange resin Filter and degas the above ingredients before adding TBE 10X TBE 8 0 mL 10 APS 400 uL TEMED 45 uL deionized water Bring to final volume 80 mL with Ingredient For 80 mL Run Conditions urea 40 0g Use the standard run time of 40 acrylamide stock 12 mL 14 hours deionized water 27 mL Mixed bed ion 0 5g For 34 cm WTR Runs 4 75 19 1 Polyacrylamide Gel 8 3 M Urea exchange resin Filter and degas the above ingredients before adding TBE 10X TBE 8 0 mL 10 APS 400 uL TEMED 45 uL deionized water Bring to final volume 80 mL with Ingredient For 80 mL Run Conditions urea 40 0g Use the standard run time of 40 acrylamide stock 9 5 mL 14 hours deionized water 27 mL Mixed bed ion 0 5g For 48 cm WTR Runs 4 19 1 Polyacrylamide Gel 8 3 M Urea Ingredient For 100 mL Run Conditions urea 50 0 g Use the standard run time of 40 acrylamide stock 10 mL 18 hours deionized water 37 mL Mixed bed ion 0 5g exchange resin Filter and degas the above ingredients before adding TBE 10X TBE 10 mL 10 APS 500 uL TEMED 50 uL Bring to final volume 100 mL with deionized water Gel Preparatio
126. ates should be nearly level so that the cleaning solution does not run off onto the bench Only the inside gel side surface of the plates need be cleaned though the outside surfaces can be cleaned similarly 4 Pour approximately 15 mL of the cleaning solution in the center of each plate to be cleaned Spread the solution over the surface of plate 5 Allow the solution to remain on the plates for 5 minutes Note Longer times will not harm the plates but are unnecessary 6 Rinse the plates thoroughly with distilled deionized water Allow plates to dry Note Avoid other cleaning procedures or solutions that can reintroduce contaminants to the plates When voltage is applied on the ABI PRISM 377 DNA Sequencer the polyacrylamide gel sometimes moves from between the glass gel plates toward the cathode upper electrode and into the upper buffer chamber Up to about five centimeters of gel in a folded sheet can be deposited in the chamber This gel extrusion usually begins at the start of a run or even during the prerun It is believed to be caused by a buildup of charge on the surface of the glass plate such that the gel is not bound to the plate after pouring As the voltage is applied the gel migrates toward the upper electrode The gel image can show a variety of anomalous effects including catastrophic loss of resolution lane splitting extreme band tilt and band distortion Figure 7 56 on page 7 50 Almos
127. cally analyzed 7 57 extra peaks under strong peak 7 60 extraneous peaks 7 60 fluctuating current 7 58 fragments migrate slowly 7 61 high baseline 7 59 inconsistent peak mobilities 7 60 low current 7 58 no current 7 57 to 7 58 no signal 7 58 to 7 59 noisy baseline 7 60 poor base spacing 7 60 poor resolution 7 61 runs get faster 7 61 runs get slower 7 61 signal too high 7 59 signal too low 7 59 spikes 7 55 to 7 56 spikes in baseline 7 60 stop peak 7 60 virtual filter sets 1 11 poor quality acrylamide 7 44 ABI PRISM 377 poor quality gel plates 7 52 red streaks vertical 7 49 swirls in gel 7 53 temporary loss of signal 7 51 19 1 polyacrylamide gels A 2 29 1 polyacrylamide gels A 6 to A 7 choosing a sequencing chemistry 2 15 to 2 16 dye set primer mobility files 6 5 instrument description 1 8 to 1 9 Long Ranger gels A 10 to A 12 PAGE PLUS gels A 10 to A 12 part numbers E 8 to E 9 run modules 1 12 to 1 13 6 2 troubleshooting gel electrophoresis 7 44 to 7 54 buffer leaks 7 47 to 7 48 excess salt 7 45 fluorescent contaminants 7 46 gel extrusion 7 50 gel runs too quickly 7 53 gel runs too slowly 7 53 green streak in lane 7 54 greenish yellow haze 7 54 lanes appear smeared 7 54 polymerization too slow 7 54 poor resolution caused by gel 7 53 poor quality acrylamide 7 44 poor quality gel plates 7 52 red streaks vertical 7 49 swirls in gel 7 53 temporary loss of signal 7 51 virtual filter sets 1 11 ABI PRISM 377
128. chemistries If using dye primer chemistry try a dye terminator sequencing chemistry See page 2 2 Sequence the opposite strand Increase the denaturing ability of the gel or polymer by using higher run temperatures or denaturing agents such as formamide Note This can decrease the resolution of the gel or polymer and give shorter read lengths Poor data following a long homopolymer region see page 7 35 Slippage Try an alternate sequencing chemistry Use an anchored primer to determine sequence after a homopolymer T region in the sequence A region in the template strand See page 7 36 Data Evaluation and Troubleshooting 7 43 Troubleshooting Gel Electrophoresis on the ABI 373 and ABI PRISM 377 Overview This section shows examples of common problems that can occur with gel electrophoresis Refer to the table on page 7 53 for a more complete guide to troubleshooting gel electrophoresis Poor Quality Use fresh high quality acrylamide Poor quality acrylamide contains acrylic acid a Acrylamide deamidation product and linear polyacrylamide which will copolymerize and cause local pH changes in the gel This causes streaking and smearing of bands Figure 7 50 During storage at room temperature especially in water acrylamide breaks down into acrylic acid Prepare only as much acrylamide bisacrylamide solution as you will need in a month Figure 7 50 Effect of poor quality acrylamide on
129. cing BAC DNA or other high sensitivity reactions to the A reaction tube Note This method will not work if the TC1 or DNA Thermal Cycler 480 was used for thermal cycling Transfer the contents of the A reaction tube into the C reaction tube Pipet that mixture into the G reaction tube and so on until the contents of all four reaction tubes have been transferred into a single 1 5 mL microcentrifuge tube Spin the tube in a microcentrifuge for 10 20 minutes at maximum speed Carefully aspirate the supernatant and discard At this point a pellet may or may not be visible Optional Rinse the pellet with 250 uL of 70 ethanol and spin for 5 minutes in a microcentrifuge Again carefully aspirate the supernatant and discard This may remove some of the salts from the pellet but doing so is often not necessary Note If you use sodium acetate you must rinse the pellet This will reduce the carryover of salt Dry the pellet in a vacuum centrifuge for 1 3 minutes or until dry Do not overdry 3 48 Performing DNA Sequencing Reactions Express Load Option Note for BigDye Primers This procedure is for use only with the BigDye primers Run on 36 Lane Gels Reagents and equipment required for this method 0 2 mL PCR tubes gt gt e Benchtop microcentrifuge capable of reaching at least 14000 x g Vortexer Ethylenediaminetetraacetic acid disodium salt NapEDTA 5 mM 25
130. ction PCR fragments In the Core Kit format the reagents are supplied in individual tubes to maximize kit flexibility For convenience when sequencing large quantities of templates the reagents can be premixed and stored for later use The cycle sequencing protocols are optimized for GeneAmp PCR Instrument Systems thermal cyclers the CATALYST 800 Molecular Biology LabStation and the ABI PRISM 877 Integrated Thermal Cycler Note We do not recommend using fluorescein rhodamine dye primers with the POP 6 polymer on the ABI PRISM 310 Genetic Analyzer For more information refer to the ABI PRISM Dye Primer Cycle Sequencing Ready Reaction Kit Protocol P N 402113 or the ABI PRISM Dye Primer Cycle Sequencing Core Kit Protocol P N 402114 PE Applied Biosystems has developed a set of dye primers labeled with novel high sensitivity dyes Lee et al 1997 The new dye structures contain a fluorescein donor dye e g 6 carboxyfluorescein 6 FAM linked to one of four dichlororhodamine dRhodamine acceptor dyes The excitation maximum of each dye label is that of the fluorescein donor and the emission spectrum is that of the dRhodamine acceptor Figure 2 7 on page 2 12 The donor dye is optimized to absorb the excitation energy of the argon ion laser in the PE Applied Biosystems DNA sequencing instruments The linker affords extremely efficient energy transfer quantum efficiency nearly 1 0 i e 100 between the donor and acceptor dy
131. d correctly and that the upper buffer chamber gasket makes a proper seal Do not spill buffer behind the upper buffer chamber as wicking can occur Blue or green curtain obscuring entire gel image see Figure 7 58 on page 7 52 Warped gel plate Use gel plates from PE Applied Biosystems Green streak through entire gel lane Protein in template Clean up the template before performing sequencing reactions Greenish yellow haze Poor gel plate alignment Remove the gel plates and realign them correctly Fluorescent contaminant in gel Use fresh reagents Do not write on the gel plates with marking pens Residual detergent on plates Rinse plates thoroughly with hot deionized water 7 54 Data Evaluation and Troubleshooting Troubleshooting Capillary Electrophoresis on the ABI PRISM 310 Overview Capillary Failure Spikes This section shows examples of problems that are specific to capillary electrophoresis Refer to the table on page 7 57 for a more complete guide to troubleshooting capillary electrophoresis Figure 7 59 shows data from a capillary that had been used for more than 100 injections Data is noisy and has trailing peaks We recommend that capillaries be replaced after 100 injections or when you start to see signs of capillary failure 1200 1280 1360 1440 1520 1600 1680 AGGGCCACC ANGGRACNCAGGTNTNACATANGANATGACNGCCNGGG 100 110 120 130 40 13
132. d Run For 34 cm WTR Runs 5 29 1 Polyacrylamide Gel 8 3 M Urea Conditions for the ABI 373 Ingredient For 80 mL Run Conditions urea 40 0 g Increase run time to 18 hours 40 acrylamide stock 10 mL deionized water 37 mL Mixed bed ion 0 5g exchange resin Filter and degas the above ingredients before adding TBE 10X TBE 8 0 mL 10 APS 400 uL TEMED 48 uL Bring to final volume 80 mL with deionized water Gel Preparation A 7 For 48 cm WTR Runs 4 25 29 1 Polyacrylamide Gel 7 M Urea This formulation has not been tested in PE Applied Biosystems laboratories but has been used successfully in several customer laboratories Ingredient For 100 mL Run Conditions urea 42g Run at 40 W for 17 hours 40 acrylamide stock 10 65 mL deionized water 44 mL Mixed bed ion 0 5g exchange resin Filter and degas the above ingredients before adding TBE 10X TBE 10 mL 10 APS 500 uL TEMED 70 uL Bring to final volume 100 mL with deionized water Preparing 29 1 Preliminary gel preparation steps Polyacrylamide Gels Step Action 1 Referring to the appropriate list of ingredients above and the 373 DNA Sequencing System User s Manual or ABI PRISM 377 DNA Sequencer User s Manual gather all the necessary lab equipment and ingredients Prepare all stock solutions per the list of ingredients For the ABI PRI
133. d dye terminators must be removed before the samples can be analyzed by electrophoresis Excess dye terminators in sequencing reactions obscure data in the early part of the sequence and can interfere with basecalling Several protocols for each sequencing chemistry are presented to offer a choice of reagents and process We recommend performing controlled reactions with each method to determine the one that works best for you Precipitation methods are cheaper and faster but if performed poorly can leave unincorporated dye labeled terminators that can obscure data at the beginning of the sequence Refer to the Precipitation Methods to Remove Residual Dye Terminators from Sequencing Reactions User Bulletin P N 4304655 This document can be obtained from the PE Applied Biosystems WWW site http www2 perkin elmer com ab techsupp pdf ga ub Precipitation_UB pdf The spin column and 96 well plate procedures remove all excess terminators if performed correctly but are more costly than precipitation methods Dye Primer Chemistries The standard procedure is ethanol precipitation which concentrates the sample An Express Load option is also available for BigDye primers See page 3 49 Table 3 3 Recommended Methods for Preparing Extension Products for Electrophoresis Chemisiry Recommended Methods See Page Rhodamine Spin Column Purification 3 34 Dye Terminator and 96 Well Plate Purification Prot
134. d to one of four dichlororhodamine dRhodamine acceptor dyes The excitation maximum of each dye label is that of the fluorescein donor and the emission spectrum is that of the dRhodamine acceptor Figure 2 7 on page 2 12 The donor dye is optimized to absorb the excitation energy of the argon ion laser in the PE Applied Biosystems DNA sequencing instruments The linker affords extremely efficient energy transfer quantum efficiency nearly 1 0 i e 100 between the donor and acceptor dyes The BigDye terminators are 2 3 times brighter than the rhodamine dye terminators when incorporated into cycle sequencing products The BigDye terminators are labeled with the following dRhodamine acceptor dyes Terminator Acceptor Dye A dichloro R6G Cc dichloro ROX G dichloro R1 10 T dichloro TAMRA Note The individual dRhodamine dye structures are shown in Figure 2 2 on page 2 3 The BigDye terminators also have narrower emission spectra than the rhodamine dye terminators giving less spectral overlap and therefore less noise Figure 2 7 on page 2 12 The brighter signal and decreased noise provide an overall 4 5X gain in signal to noise ratio Figure 2 4 on page 2 6 The nucleotide dideoxynucleotide mixes have been optimized to give longer more accurate reads above 700 bases Large templates can be sequenced more readily One such application is BAC end sequencing Reactions using half the amount
135. data view from the sample shown in Figure 7 15 on page 7 14 Abrupt Signal Loss Figure 7 17 shows BigDye terminator sequencing data that has an abrupt loss of signal The signal dies out so completely that the basecaller fails after base 640 The raw data view in this example looks like that in Figure 7 16 but with flatter lines after the signal loss The annotation view would be uninformative as it was in the case of gradual signal loss JC CATT GCATCAAGTAC GTAGGCAAC CAGAAATTCAAAC COGAAAAATCATGTGGCA GAGG AATTGCS TAT AATG GS AAA HDATAGTCACCASGG TAC 430 500 S10 s20 550 560 570 580 Figure 7 17 Abrupt signal loss Gradual and abrupt signal losses have many causes including the following Region of secondary structure in the template Template sequence idiosyncrasies Poor lane tracking such that the tracker line diverges from the data Poor quantitation of primer and or template leading to top heavy data Buffer leak on the ABI 373 or ABI PRISM 377 DNA Sequencer gt gt gt Data Evaluation and Troubleshooting 7 15 Troubleshooting Sequencing Reactions Overview Poor Template Quality This section shows common examples of unsatisfactory sequencing data caused by poor template preparation sequencing reaction setup or reaction cleanup procedures Refer to the table on page 7 39 for a more complete guide to troubleshooting sequencing data Poor template quality is one of the most common causes of seque
136. degrees especially on shorter fragments However these mobility shifts are consistent for each dye set and can be corrected readily during analysis The analysis software is able to compensate for these mobility differences by applying mobility shifts to the data so that evenly spaced peaks are presented in the analyzed data The files that contain the mobility shift information are called dye set primer mobility files The dye set primer files available are listed on page 6 5 The files are located in the ABI folder within the System folder on the Macintosh or Power Macintosh computer They are selected in the sample sheet during instrument setup They can also be selected in the Sequencing Analysis software if samples need to be reanalyzed The seriousness of choosing the wrong dye set primer file mobility depends on which mobility file you choose to analyze the data Analyzing fluorescein rhodamine dye primer data with the wrong fluorescein rhodamine dye primer mobility file causes shifted peaks Analyzing fluorescein rhodamine dye primer data with rhodamine dye terminator mobility files or vice versa causes both shifted peaks and miscalled bases because the dyes used for the fluorescein rhodamine dye primer and rhodamine dye terminator chemistries are different Analyzing fluorescein rhodamine dye primer data with BigDye primer mobility files causes shifted peaks Analyzing BigDye primer data with a mobility file
137. ding Samples for Gel Electrophoresis 000 0000 3 50 Preparing and Loading Samples for Capillary Electrophoresis 04 3 53 Optimizing Gel Electrophoresis 00 ccc cee eee cece ne Fl Ening OONA BLOT n MAINELE pails Ae hs el eies Lie tet E ah eave he pats at E 4 1 REASENIS esua e a hahha ewe aa de Meet Te kal Meena obey aah ieS 4 2 Avoiding Problems with Sequencing Gels 0 00 0 c cece eee 4 4 5 Optimizing Capillary Electrophoresis 0000002 Sel IntroduchOnes sess has aS a SRS OR AS a Se Rates haem sobs Sa aa 5 1 Capillary Electrophoresis Consumables 0 0 0 cee cece ee eee 5 2 Optimizing Electrokinetic Injection 0 0 00 cece eee 5 4 Optimizing Electrophoresis Conditions 0 0 00 c eee cece eee 5 7 Run Parameters for Specific Sequencing Chemistries 0 00000 00 0000 5 8 6 Optimizing Software Settings 0 0 c ccc cece cece eens 6 1 Introduction 223 siie cco iat eae wale ta ag Wine hg eet ie has tee tea ace 6 1 Choosing a Run Module s sns esa o oh eis e Gh ee eek we eh She oe ee bee 6 2 Choosing a Dye Set Primer Mobility File 0 0 00 0 0 2 eee eee eee eee 6 3 Choosing the Correct Basecaller 0 0 ec ccc eens 6 6 Creating an Instrument Matrix File 2 0 eee eee eee nee 6 7 Setting the Data Analysis Range 0 0 ee eee eens 6 15 7 Data Evaluation and Troubleshooting 0 00024 7 1 OVE
138. e sometimes longer Gel Preparation A 9 Protocol and Run Conditions for Long Ranger and PAGE PLUS Gels Ingredients and Run For 36 cm WTR Runs Conditions tor Ne 5 0 Long Ranger Gel 6 M Urea A 10 Gel Preparation ABI PRISM 377 Ingredient For 50mL Run Conditions urea 18 0 g For 1200 scans hr runs 50 gel stock solution 5 0 mL Use standard 36 cm 10X TBE 5 0 mL 1200 scans hr run Se modules deionized water to 50 mL Increase run time to 10 APS 250 uL 9 hours TEMED 25 uL For 2400 scans hr runs use standard 36 cm 2400 scans hr run modules 4 8 PAGE PLUS Gel 6 M Urea Ingredient For50mL_ Run Conditions urea 18 0g For 1200 scans hr runs 40 gel stock solution 6 0 mL Use standard 36 cm 10X TBE 5 0 mL 1200 scans hr run R modules deionized water to 50 mL Increase run time to 10 APS 300 uL 9 hours TEMED 30 uL For 2400 scans hr runs use standard 36 cm 2400 scans hr run modules For 48 cm WTR Runs This is the best formulation to use for 48 cm gels 5 25 PAGE PLUS Gel 6 M Urea Ingredient For 50mL Run Conditions urea 18 0 g Use standard 48 cm run 40 gel stock solution 6 6 mL modules 10X TBE 5 0 mL Increase run time to ee 12 hours deionized water to 50 mL 10 APS 250 uL TEMED 25 uL 4 75 Long Ranger Gel 6 M Urea Ingredient For50mL_ Run C
139. e Terminators from Sequencing Reactions User Bulletin P N 4304655 This document can be obtained from the PE Applied Biosystems WWW site http www2 perkin elmer com ab techsupp pdf ga ub Precipitation_UB pdf When using Centri Sep spin columns be careful to load the sample onto the center of the gel surface Do not touch the gel surface with the pipet tip See page 3 34 IMPORTANT When using BigDye terminators be sure to hydrate the column for at least 2 hours Spin samples in the centrifuge for the recommended times Spinning too long precipitates more dyes with the sample When working with microcentrifuge tubes aspirate the supernatant rather than decant it Decanting leaves excess ethanol on the sides of the tube 7 42 Data Evaluation and Troubleshooting Troubleshooting Sequencing Data continued Observation Possible Causes Recommended Actions Broad red peak between base 200 and 350 see page 7 28 Poor removal of unincorporated dye terminators Follow the protocols for excess dye terminator removal carefully See page 3 33 Refer also to the Precipitation Methods to Remove Residual Dye Terminators from Sequencing Reactions User Bulletin P N 4304655 It can be obtained from the PE Applied Biosystems WWW site http Awww2 perkin elmer com ab techsupp pdf ga ub Precipitation_UB pdf When using Centri Sep spin columns be careful to load the sample onto the center of the
140. e is less stable The polymerase has difficulty extending through the region 7 34 Data Evaluation and Troubleshooting Homopolymer Regions Further studies with this template showed that replacement of either the dITP with dGTP or the dUTP with dTTP allowed good extension through this region data not shown The following methods were found useful at PE Applied Biosystems to improve the sequencing results for this template Lowering the extension temperature from 60 C to 55 C or 50 C Note Lowering the extension temperature will result in some loss of signal strength Addition of 1 mM magnesium chloride to the reaction which increases the final concentration in the BigDye terminator reaction from 2 mM to 3 mM magnesium chloride Using dRhodamine terminator chemistry Figure 7 44 on page 7 34 At the present time the exact composition of a GT rich region that is sufficient to cause this problem with BigDye Terminators is unknown With Cloned DNA Long homopolymer T regions or A regions can cause problems in DNA sequencing reactions due to slippage in the region of the homopolymer Although the sequence data can be clean through the homopolymer region the data after this region is noisy due to the presence of multiple sequences Figure 7 45 The exact mechanism of slippage is not known Presumably the two strands do not stay paired correctly during polymerization through the homopolymer region This generates fra
141. e oe eh Oe a 2 1 Dye Terminator Cycle Sequencing Kits 2 0 0 0 0 eee ce eee eee 2 2 Dye Primer Cycle Sequencing Kits 0 0 ec cee eee 2 8 Dye Specttaina s c0 nan cated eek et E aus Tag celeste PERG Ae eee De re MR ie hare Sty 2 12 Chemistry Instrument Filter Set Compatibilities 0 0 0 0 000 eee eee ee eee 2 13 Dye Base Relationships for Sequencing Chemistries 00020 e eee eee ee 2 14 Choosing a Sequencing Chemistry 0 cee eee eae 2 15 3 Performing DNA Sequencing Reactions 3 1 OVERVIEW oiie yee Ret tetiyenn ted bebe Seb n GA a hence obec ie i eta et 3 1 DNA Template Preparation si ssss pior idee ke eka Sede eee eee ade ERRA ENA ia 3 2 Sequencing PCR Templates 00 E E a cece eens 3 10 DNA Template QUa lity cain ce sige hide RES ee TON ER ee PIE Ee eee 0 3 15 DNA Template Quantity 0 0 cence eee nee 3 17 Primer Design and Quantitation 2 22 cee eee eae 3 18 Reagent and Equipment Considerations 00 0 cece eee ee eee 3 20 Preparing Cycle Sequencing Reactions 0 0 0 cece eee eae 3 21 Cycle Sequencing 2 3400 Sisa G es Gy ese eh StS Ce eet CPEaa Ne eee ees 3 27 Preparing Extension Products for Electrophoresis 0 0 0 0 cee eee eee ee 3 33 Removing Unincorporated Dye Terminators 0 0 00 cee cece ee eee 3 34 Preparing Dye Primer Reaction Products for Electrophoresis 0 00 eee 3 46 Preparing and Loa
142. e of the PCR primers Use a Hot Start technique e g AmpliTaq Gold DNA Polymerase Slippage after repeat region in template Try an alternate sequencing chemisiry See page 2 15 Use an anchored primer See page 7 36 Poor mobility correction see page 7 13 Incorrect dye set primer mobility file Use the correct mobility file See page 6 5 Incorrect Peak 1 Location for data analysis Choose a new Peak 1 Location See page 6 15 Gel with very different separation properties from the gel matrices that were used to construct the dye set primer mobility files Use the correct dye set primer file for your gel type Refer to the ABI PRISM DNA Sequencing Analysis Software User s Manual Early signal loss see page 7 14 Region of secondary structure in the template Sequence the opposite strand Use a sequencing primer that anneals at a different position Try an alternate sequencing chemistry See page 2 15 Incubate the reaction at 96 C for 10 minutes before cycling Increase the denaturation temperature to 98 C Increase the extension temperature by 2 3 C GT rich regions with BigDye terminators see page 7 34 Decrease the extension temperature in cycle sequencing to 55 C or 50 C Increase the magnesium ion concentration by 1 mM Sequence the opposite strand Try an alternate sequencing chemistry See page 2 15
143. e should all be less than 1 These values represent the amount of spectral overlap observed for each dye in each virtual filter For example the values in the third row reflect quantitatively the amount of each dye detected in the third yellow virtual filter Copy Matrix Source dRhod_BigDye Instrument Comment Destination No Destination File Instrument Comment E Copy Primer Matrix J Copy Taq Term Matrix 1 000 0 12 0 011 0 000 1 000 0 12 0 011 0 000 0 455 1 000 0 183 0 000 0 455 1 000 0 183 0 000 0 248 0 483 1 000 0 151 0 248 0 483 1 000 0 151 0 115 0 282 0 529 1 000 0 115 0 282 0 529 1 000 EJ Copy T Term Matrix 1 000 0 12 0 011 0 000 0 455 1 000 0 183 0 000 0 248 0 483 1 000 0 151 0 115 0 282 0 529 1 000 Figure 1 7 Instrument file created in the Data Utility software indicating the values obtained with the dRhodamine matrix standards for Filter Set E on a particular ABI PRISM 377 instrument Note that the numbers decrease moving away from the diagonal in any direction For example in the first column the amount of blue fluorescence seen through the red filter fourth row should be less than that seen in the yellow filter third row which should be less than that seen in the green filter second row These values will vary between different instruments and between filter sets on a single instrument An instrument file must be made for each filter set used on each instrument The instrumen
144. eactive by nature and is prone to reduction and decomposition It begins to break down almost immediately when dissolved in water Optimally APS should be prepared fresh daily At the very least store 10 stocks at 15 to 25 C and replace every week Listen for a crackling sound when adding water to dry APS Material that has broken down due to high humidity or liquid contamination will no longer crackle when moistened Persulfate is consumed in the polymerization because it provides the free radicals that drive polymerization but excess APS can cause oxidation of proteins and nucleic acids Prerunning gels keeps excess APS traveling ahead of the sample 4 2 Optimizing Gel Electrophoresis TEMED WARNING CHEMICAL HAZARD TEMED Tetramethylethylenediamine is extremely flammable and can be very destructive to the skin eyes nose and respiratory system Keep TEMED in a tightly closed container Avoid inhalation and contact with the skin eyes and clothing Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves TEMED oxidizes readily which causes a gradual loss in catalytic activity It is hygroscopic and accumulates water which accelerates oxidative decomposition Discard it as chemical waste when oxidation products begin to give it a yellow color For this reason use colorless tips to add TEMED TEMED introduces fixed charges into the gel matrix that
145. eading to insufficient sample injected Dialyze sample to remove ions Sample not thoroughly mixed with TSR Mix sample into TSR by pipetting up and down several times Signal too high Too much sample injected into capillary Decrease injection time or injection voltage High baseline Dirty capillary window Clean capillary window with 95 ethanol Capillary moved out of position in front of laser window Position capillary in front of laser window Precipitate in polymer Allow polymer to equilibrate to room temperature before using Use fresh polymer Contaminant in polymer Filter the polymer with a 0 2 um or 0 45 um disk filter attached to a plastic syringe Incorrectly prepared and or old buffer or polymer solutions Replace buffer and polymer with fresh solutions Improper filling of capillary Run the Seq Fill Capillary run module to fill the capillary Fluorescent contaminant in the capillary holder Clean the capillary holder Fluorescent contaminant in the sample Purify the sample Defective or old capillary Replace the capillary Matrix made incorrectly resulting in too much correction also indicated by troughs under peaks Remake matrix Be sure to Remove the primer peak or aberrant off scale peaks from the scan range Pick the start and stop points on flat parts of the baseline when viewing raw data Make the
146. eadings into pmol uL concentrations C pmol uL or UM Ago x 100 1 54n 0 75N 1 17Ng 0 92n7 where C concentration nx number of residues of base x in the oligonucleotide Molecular weight of a DNA oligonucleotide sodium salt pH 7 MW Na x 335 2 Nc x 311 2 Ng x 351 2 Nq x 326 2 P where Ny number of residues of base x in the oligonucleotide 101 0 for dephosphorylated oligonucleotides 40 0 for phosphorylated oligonucleotides Table 3 2 Primer Problems and Possible Causes Problems Possible Causes Poor priming resultingin Melting temperature is too low due to low GC content and or weak or no signal short primer length Secondary structure of the primer particularly at the 3 end Secondary structure of the template in the region of hybridization Incorrect primer concentration Priming site not present Adequate signal Secondary hybridization site which results in many extra strength with noisy data peaks Impure primer You may see a shadow sequence of N 1 You can obtain custom primers from the PE Applied Biosystems Custom Oligonucleotide Synthesis Service Phone 800 345 5224 E mail OligosUS perkin elmer com Online http oligos abd perkin elmer com custom Performing DNA Sequencing Reactions 3 19 Reagent and Equipment Considerations Reagent Handling The freshest reagents are likely to perform the best The following met
147. ectrophoresis 7 55 to 7 61 capillary failure 7 55 current decreases over run 7 58 current too high 7 58 data not automatically analyzed 7 57 extra peaks under strong peak 7 60 extraneous peaks 7 60 fluctuating current 7 58 fragments migrate slowly 7 61 high baseline 7 59 inconsistent peak mobilities 7 60 low current 7 58 no current 7 57 to 7 58 no signal 7 58 to 7 59 noisy baseline 7 60 poor base spacing 7 60 poor resolution 7 61 runs get faster 7 61 runs get slower 7 61 signal too high 7 59 signal too low 7 59 spikes 7 55 to 7 56 spikes in baseline 7 60 stop peak 7 60 troubleshooting table 7 57 to 7 61 data evaluation practical examples 7 10 to 7 15 no usable sequence 7 10 Index 6 noise 7 11 to 7 13 determining quality of DNA template 3 15 to 3 16 DNA sequence composition 7 30 to 7 38 compressions 7 31 to 7 32 false stops in dye primer chemistry 7 30 to 7 31 GC rich templates 7 32 to 7 33 GT rich template with BigDye terminators 7 34 to 7 35 homopolymer regions 7 35 to 7 37 using anchored primers 7 36 repetitive DNA 7 38 secondary structure 7 33 gel electrophoresis 7 44 to 7 54 buffer leaks 7 47 to 7 48 excess salt 7 45 fluorescent contaminants 7 46 gel extrusion 7 50 gel runs too quickly 7 53 gel runs too slowly 7 53 green streak inlane 7 54 greenish yellow haze 7 54 lanes appears smeared 7 54 polymerization too slow 7 54 poor resolution caused by gel 7 53 poor quality acrylamide 7 44 poor quality g
148. ed ion exchange resin by filtration step 3 above before adding the TBE buffer Resin will destroy the effectiveness of the buffer 7 Add deionized water to make the final volume 50 mL for a 36 cm or 48 cm gel for the ABI PRISM 377 DNA Sequencer 80 mL for a 34 cm gel for the ABI 373 DNA Sequencer 100 mL for a 48 cm gel for the ABI 373 DNA Sequencer IMPORTANT If the plates are not clean and ready for gel pouring prepare them before adding the polymerizing agents to your solution Adding the polymerizing reagents Step Action 1 Add freshly made 10 APS and swirl carefully to mix without introducing air bubbles Note Be as accurate and reproducible as possible when making the 10 APS solution Significant variation in this reagent can produce changes in data quality 2 Add TEMED and swirl carefully to mix without introducing air bubbles WARNING CHEMICAL AND FIRE HAZARD TEMED is extremely flammable and can be very destructive to the skin eyes nose and respiratory system Keep it in a tightly closed container Avoid inhalation and contact with skin eyes and clothing Always work under a hood and wear chemical resistant gloves when handling TEMED solutions Read the MSDS in the Safety Summary included with your instrument user s manual 3 Cast the gel using one of the methods described in your instrument user s manual Note 29 1 polyacrylamide gels take a minimum of 2 hours to polymeriz
149. eference Table for Specific Sequencing Chemisiries Set M13rev Run Base Capillary Capillary Chemisiry Syringe Polymer Module Dye Sei Primer File Caller Size Mark Rhodamine 250 uL DSP Seq Run DT5 CEHV A Set CE 1 47 cm x silver Dye Terminator 250 uL A any primer 75 um Rhodamine 1 0 mL POP 6 SeqPOP6 DT POP 6 CE 2 61cmx pink Dye Terminator 1 0 mL A 50 um long read sequencing Rhodamine 1 0 mL POP 6 Seq POP6 DT POP 6 CE 2 47 cm x green Dye Terminator 1 0 mL 50 um rapid sequencing Rapid A dRhodamine 250 uL DSP Seq Run DT5 CEHV dR Set CE 1 47 cm x silver Terminator 250 uL E any primer 75 um dRhodamine 1 0 mL POP 6 Seq POP6 DT POP6 dR Set CE 1 61 cm x pink Terminator 1 0 mL E any primer 50 um long read sequencing dRhodamine 1 0 mL POP 6 Seq POP6 DT POP6 dR Set CE 1 47 cm x green Terminator 1 0 mL any primer 50 um rapid sequencing Rapid E BigDye 1 0 mL POP 62 Seq POP6 DT POP6 BD Set CE 1 61 cmx pink Terminator 1 0 mL E any primer 50 um long read sequencing BigDye Terminator 1 0 mL POP 6 Seq POP6 DT POP6 BD Set CE 1 47 cm x green rapid sequencing 1 0 mL any primer 50 um Rapid E Fluorescein 250 uL DSP Seq Run DP5 CEHV 21M13 CE 1 47 cm x silver Rhodamine 250 uL A or 75 um Dye Primer DP5 CEHV M13rev BigDye Primer 1 0 mL POP 62 Seq POP6 DP POP6 BD CE 1 61 cm x pink long read 1 0 mL E Set 21M13 or 50 um sequenci
150. el ABI PRISM DNA Sequencing Kits and Reagents 0 0 c cece eee eee E 1 ABI PRISM 310 Genetic Analyzer cee coepi o na a cee eee ene E 5 ABI PRISM 377 DNA Sequencer 0 2 2 eee tenet eens E 8 ABI373 DNA SCQUENCED se sce sts eb deh e SEG Se OA REN SEER EAM eth oe SEIEREN E 9 Documentation and Software 0 enren rreren ereere E 10 Index Introduction New DNA Sequencing Chemistry Guide Purpose Since the original DNA Sequencing Chemistry Guide was published in early 1995 PE Applied Biosystems has released two new instrument platforms five new sequencing chemistries and a new sequencing enzyme To accommodate this new information we have written the Automated DNA Sequencing Chemistry Guide This updated guide provides the following An introduction to automated DNA sequencing Descriptions of PE Applied Biosystems sequencing instruments chemistries and software Detailed protocols for preparing DNA templates performing cycle sequencing and preparing the extension products for electrophoresis Guidelines for optimizing electrophoresis and interpreting and troubleshooting sequencing data Introduction 1 1 Introduction to Automated DNA Sequencing Sanger Dideoxy DNA polymerases copy single stranded DNA templates by adding nucleotides to a Sequencing growing chain extension product Chain elongation occurs at the 3 end of a primer an oligonucleotide that anneals to the template The deoxynucleo
151. el and photomultiplier tube The PMT detects the fluorescence emission and converts it into a digital signal Each time the stage traverses across the gel a scan a different bandpass filter is positioned in front of the PMT to detect each of the four dyes A single scan of the gel with one filter takes 1 5 seconds and measures signal in 194 channels A complete scan with four filters takes 6 seconds and equals one data point The data is then transmitted to the Macintosh computer and stored for processing The Sequencing Analysis software see page 1 16 interprets the result calling the bases from the fluorescence intensity at each data point Refer to the 373 DNA Sequencing System User s Manual P N 902376 for more information XL Upgrade The ABI 373 DNA Sequencer with XL Upgrade increases the number of samples that can be analyzed simultaneously This increased throughput is made possible by reengineering the instrument to collect data from 388 channels instead of 194 With the XL Upgrade the operation of the ABI 373 DNA Sequencer is controlled from the Power Macintosh computer supplied with the upgrade After the initial calibration by the Field Service Engineer the instrument automatically increases the PMT voltage to compensate for the smaller amount of signal generated per lane when running 48 or 64 lane gels The XL Upgrade also includes new combs and spacers For sequencing applications 48 well and 64 well shark s toot
152. el plates 7 52 red streaks vertical 7 49 swirls ingel 7 53 temporary loss of signal 7 51 troubleshootingtable 7 53to 7 54 poor template quality 3 15 primer problems and causes 3 19 sequencing data 7 39 to 7 43 broad red peak between base 200 and 350 7 43 compressions 7 43 early signalloss 7 41 to 7 42 excess dye peaks at the beginning of the sequence 7 42 no recognizable sequence 7 39 noise up to or after point in sequence 7 41 noisy data throughout sequence 7 40 poor data following long homopolymer region 7 43 poor mobility correction 7 41 pull up peaks bleedthrough 7 43 stop peaks in dye primer chemistry 7 43 troubleshooting table 7 39 to 7 43 sequencing reactions 7 16 to 7 29 excess dye peaks 7 27 to 7 29 poor quality template 7 16 primer related problems 7 19 to 7 22 pull up peaks 7 22 to 7 23 salt contamination from template preparation 7 25 to 7 26 stop peaks in PCR sequencing 7 24 software settings 7 62 to 7 65 incorrect dye set primer file 7 62 incorrect or poor quality matrix file 7 63 to 7 64 incorrect Peak 1 Location 7 64 incorrect run module 7 62 TSR Template Suppression Reagent capillary electrophoresis 5 2 U urea gel electrophoresis 4 2 user s manuals part numbers E 10 V virtual filter sets ABI PRISM 310 and ABI PRISM 377 1 11 Ww WWW address D 1 Fax on Demand D 2 X XL Upgrade ABI 373 description of 1 7 run modules 1 12 6 2 ABI PRISM 377 description of 1 9
153. encing PCR products but it is not meant to be a detailed guide to PCR amplification General information on PCR amplification can be found in the Guide to PCR Enzymes Stock No 700905 and in the product inserts included with GeneAmp PCR reagents For PCR amplification use GeneAmp PCR Instrument Systems and GeneAmp PCR Core Reagents Although PCR fragments can be difficult to denature with traditional single temperature sequencing methods cycle sequencing provides several chances to denature and extend the template which ensures adequate signal in the sequencing reaction Visualize PCR products by agarose gel electrophoresis see Determining DNA Quality on page 3 16 For more detailed information about PCR sequencing refer to Comparative PCR Sequencing A Guide to Sequencing Based Mutation Detection Stock No 770901 001 This booklet can also be obtained from the PE Applied Biosystems WWW site http www2 perkin elmer com 80 ga CompPCRSeq pdf PCR Strategies Single Amplification In the simplest PCR sequencing case the target DNA is amplified with a single set of primers and then sequenced using the same primers For many samples this works well For the samples that do not work well with this method optimization of the PCR amplification may be required see page 3 12 Optimizing the PCR minimizes the presence of non specific product bands and ensures adequate yield A single PCR amplification is also compatible with
154. erase Two examples are shown Data Evaluation and Troubleshooting 7 29 Troubleshooting DNA Sequence Composition Problems Overview DNA sequence compositions cause different problems depending on the sequencing chemistry used No single chemistry works with all sequences Modification of a particular method or use of an alternative chemistry may be necessary This section describes some sequence contexts that cause problems and some of the common sequence related problems False stops in dye primer chemistry Compressions GC rich gt 70 regions of sequence Overall GC rich sequences Regions of pronounced secondary structure GT rich regions in BigDye terminator chemistry Homopolymer regions Repetitive DNA gt gt gt o o o o False Stops in Dye One of the advantages of cycle sequencing is that the high extension temperature Primer Chemistry discourages the formation of template secondary structures Certain templates particularly GC rich sequences can still form intrastrand complexes through which AmpliTaq DNA Polymerase FS has difficulty extending In dye primer sequencing when the DNA polymerase dissociates from a partially extended fragment without incorporating a dideoxynucleotide terminator a false stop is seen If this occurs in all four dye primer reactions a peak appears in the electropherogram at that position in all four colors Figure 7 37 In the most severe cases sequence data stops abruptly In dye
155. es Hence the BigDye primers are 2 3 times brighter than the fluorescein rhodamine dye primers when incorporated into cycle sequencing products The BigDye primers are labeled with the following dRhodamine acceptor dyes Primer Acceptor Dye A dichloro R6G C dichloro R110 G dichloro TAMRA T dichloro ROX Note The individual dRhodamine dye structures are shown in Figure 2 2 on page 2 3 The BigDye primers use the same dyes as the BigDye terminators The BigDye primers also have narrower emission spectra than the fluorescein rhodamine dye primers giving less spectral overlap and therefore less noise Figure 2 7 on page 2 12 The brighter signal and decreased noise provide an overall 4 5X gain in signal to noise ratio giving added flexibility in sequencing applications The A C G andT reactions are carried out in a 1 1 1 1 ratio The nucleotide dideoxynucleotide mixes have been optimized to give longer more accurate reads above 700 bases ABI PRISM DNA Sequencing Chemistries 2 9 Large templates can be sequenced more readily One such application is BAC end sequencing Reactions using half the amount of Ready Reaction Premix can be run on some templates such as PCR products and plasmids see page 3 25 In some cases reactions can be loaded onto the sequencing instrument without precipitation see page 3 49 Figure 2 6 shows BigDye primer sequencing data IT GATT IAT GT G
156. ess Software Index Numerics 310 See ABI PRISM 310 36 lane gels express load option 3 49 373 and 373XL See ABI 373 and ABI 373 with XL Upgrade 377 and 377XL See ABI PRISM 377 and ABI PRISM 377 with XL Upgrade 377 18 description of 1 9 96 Lane Upgrade description of 1 9 96 well plate purification protocol 3 35 A A260 Converting to concentration 3 17 ABI 373 19 1 polyacrylamide gels A 3 29 1 polyacrylamide gels A 7 to A 8 choosing a sequencing chemistry 2 16 dye set primer mobility files 6 5 filter sets 1 8 Long Ranger gels A 12 to A 14 PAGE PLUS gels A 12 to A 14 part numbers E 9 to E 10 troubleshooting gel electrophoresis 7 44 to 7 54 buffer leaks 7 47 to 7 48 excess salt 7 45 fluorescent contaminants 7 46 gel extrusion 7 50 gel runs too quickly 7 53 gel runs too slowly 7 53 green streak inlane 7 54 greenish yellow haze 7 54 lanes appear smeared 7 54 polymerization too slow 7 54 poor resolution caused by gel 7 53 with BigDye Filter Wheel choosing chemistry 2 15 to 2 16 ABI 373 with XL Upgrade description of 1 7 run modules 1 12 6 2 See Also ABI 373 ABI PRism 310 choosing a sequencing chemistry 2 15 to 2 16 dye set primer mobility files 6 5 instrument description 1 10 part numbers E 5 to E 7 run modules 1 12 to 1 13 6 2 troubleshooting capillary electrophoresis 7 55 to 7 61 capillary failure 7 55 current decreases over run 7 58 current too high 7 58 data not automati
157. euz Tel 0 41 799 7708 Fax 0 41 790 0676 Hungary Budapest Tel 1 251 1116 Fax 1 251 1461 United Kingdom Warrington Cheshire Tel 01925 825650 Fax 01925 282502 Italy Milano Tel 039 23831 Fax 039 2383490 All other European countries Middle East West Asia Africa except South Africa Langen Germany Tel 496103 708 301 Fax 496103 708 310 Technical Support D 3 D 4 Technical Support Japan Pacific Rim Japan Chiba Tel 0473 80 8500 Fax 0473 80 8505 Eastern Asia China Oceania Australia Scoresby Victoria Tel 03 9212 8585 Fax 03 9212 8502 Malaysia Kuala Lumpur Tel 603758 1118 Fax 603 758 5688 China Beijing Tel 86106238 1156 Fax 86 10 6238 1162 Singapore Tel 65 336 0322 Fax 65 338 3991 Hong Kong Tel 852 2590 0238 Fax 852 2590 0513 Taiwan Taipei Hsisn Tel 886 2 698 3505 Fax 886 2 698 3405 Korea Seoul Tel 822 592 7238 Fax 822 532 4908 Thailand Bangkok Tel 662 719 6405 Fax 662 319 9788 Part Numbers ABI PRISM DNA Sequencing Kits and Reagents Kits Ready Reaction formulations contain all necessary reagents in one stable premix Core Kit configurations contain all essential reagents packaged in separate tubes ABI PrisM dRhodamine Terminator Cycle Sequencing Kits with AmpliTaq DNA Polymerase FS P N Kit Reactions 403044 Re
158. f ammonium persulfate APS into a 15 mL polypropylene tube WARNING CHEMICAL HAZARD Always wear appropriate safety attire full length laboratory coat protective glasses gloves etc when handling and mixing hazardous chemicals Always work under a chemical fume hood when handling and mixing hazardous chemicals The room in which you work must have proper ventilation and a waste collection system 2 Using a P 5000 Pipetman or equivalent add 5 mL of deionized water to the tube 3 Vortex until all crystals dissolve Note Optimally APS should be prepared fresh daily At the very least store 10 stocks at 15 to 25 C and replace every week Listen for a crackling sound when adding water to dry APS Material that has broken down due to high humidity or liquid contamination will no longer crackle when moistened 10X TBE To make 500 mL of 10X TBE Step Action 1 To a 500 mL container add the following 54g Tris 28 g Boric acid 4g Ethylenediaminetetraacetic acid disodium salt Na EDTA Distilled deionized water to 500 mL IMPORTANT Use Tris base see page 4 2 Use disodium EDTA to make 10X TBE stock Some major laboratory suppliers provide monosodium EDTA or tetrasodium EDTA Mix ingredients thoroughly by vortexing Verify that the pH is 8 2 8 3 Note 10X TBE stored at room temperature should be used within 1 month Do not use if a precipitate is present Gel P
159. f lanes x maximum electrophoresis speed 50 bph for ABI 370 and ABI 373 models 200 bph for ABI PRISM 377 models b Allows use of dRhodamine based chemistries on any ABI 373 or ABI 373 with XL Upgrade instrument with a 5 filter wheel See page 1 8 for ABI 373 filter sets ABI PRISM 310 The ABI PRISM 310 Genetic Analyzer is an automated instrument for analyzing Genetic Analyzer fluorescently labeled DNA fragments by capillary electrophoresis 1 10 Introduction The sequencing reaction sample tubes are placed in an autosampler tray that holds either 48 or 96 samples The autosampler successively brings each sample into contact with the cathode electrode and one end of a glass capillary filled with a separation polymer An anode electrode at the other end of the capillary is immersed in buffer The sample enters the capillary as current flows from the cathode to the anode The short period of electrophoresis conducted while the capillary and cathode are immersed in the sample is called electrokinetic injection The sample forms a tight band in the capillary during this injection The end of the capillary near the cathode is then placed in buffer Current is applied again to continue electrophoresis When the DNA fragments reach a detector window in the capillary a laser excites the fluorescent dye labels Emitted fluorescence from the dyes is collected once per second by a cooled charge coupled device CCD camera at particular wavelength
160. f signal at these positions so it also underestimates the amount of spectral overlap to correct Hence pull up peaks are seen These extra peaks are consistently observed at places in the electropherogram where there is a tall peak Usually they are of only one color Occasionally when the signals are very strong more than one pull up peak color is observed as in Figure 7 29 TARAAGATCGAAG RTTGTTTATGCATCATG 90 100 110 HTTCTTTAG E 120 Figure 7 29 Pull up peaks with rhodamine dye terminator chemistry In the sample file from Figure 7 29 the total signal strength shown in the annotation view is 6077 which is much higher than the recommended maximum of 4000 1000 for each base You can also look in the raw data to determine if signals are too strong After zooming in if any peaks are truncated at the top e off scale then pull up peaks may be observed in the analyzed data 7 22 Data Evaluation and Troubleshooting Very strong signals are common when sequencing short PCR fragments as the sequencing reaction is often very efficient You may need to load less of this type of sample to compensate for the increased signal Another influence on pull up peaks is the sequence specific peak patterns associated with each chemistry The rhodamine dye terminators have several peak patterns in the electropherogram data where very strong signals occur For example an A after G a T after G and a C after one or more Ts all disp
161. f the desired PCR product is high and the product is specific i e it produces a single band when analyzed by agarose gel electrophoresis the sample can be diluted before sequencing and will give good results The dilution ratio depends on the concentration of your PCR product and needs to be determined empirically start with 1 2 and 1 10 dilutions with deionized water When you limit concentrations of primers and dNTPs and dilute the PCR products the PCR parameters have to be robust Direct PCR sequencing is most useful in applications where the same target is being amplified and sequenced repeatedly and PCR conditions have been optimized Direct PCR sequencing is usually done with dye primer chemistries With dye terminator chemistries it is much more critical that the PCR primers be consumed Excess PCR primers will be extended and labeled by the cycle sequencing reaction resulting in noisy data Direct PCR sequencing does not work for XL PCR because limiting amounts of primers and dNTPs cannot be used The PCR product should be purified see page 3 12 or the excess primers and nucleotides should be degraded by SAP Exo treatment See page 3 13 3 14 Performing DNA Sequencing Reactions DNA Template Quality Using Control DNA Poor Template Quality Contamination Include a control DNA template as one of the templates in a set of sequencing reactions The results from the control can help determine whether failed reactions a
162. for analysis later or elsewhere Step Action 1 Add 6 uL of TSR to the dried DNA sequencing reaction Vortex to dissolve the extension products Heat for 1 minute at 95 C to ensure denaturation Add 2 uL of the sample to 10 uL of TSR in a sample tube Cover the tube with a septum and vortex well O 0O OIN Heat the mixture for 2 minutes at 95 C then place it on ice until ready to use Although not recommended on a routine basis you can keep samples prepared in TSR frozen for several weeks before running on the ABI PRISM 310 Genetic Analyzer with no detectable loss in resolution or base calling Performing DNA Sequencing Reactions 3 53 Loading the Samples Move the samples into the autosampler as follows Step Action 1 Transfer the denatured samples to a 48 or 96 well tray Note If you are using a 96 well tray samples can be denatured directly in the tray IMPORTANT The tube arrangement and order of the samples in the tray and on the Sample Sheet must be the same Make note of the tube arrangement you use so that you can prepare the Sample Sheet correctly Seal each tube with a septum and place the tray into the autosampler Refer to the ABI PRISM 310 Genetic Analyzer User s Manual for electrophoresis procedures 3 54 Performing DNA Sequencing Reactions Performing DNA Sequencing Reactions 3 55 Optimizing Gel Electrophoresis Introduction
163. for dRhodamine terminator or BigDye terminator chemistry or vice versa causes both shifted peaks and miscalled bases Figure 7 63 on page 7 62 These three chemistries use the same dyes for fluorescence emission but on different bases from each other See Chapter 2 especially page 2 14 for more information Analyzing dye terminator chemistry data with the wrong type of dye terminator mobility file can cause both shifted peaks and miscalled bases The dRhodamine terminators and BigDye terminators use different dyes for different bases i e the dyes for the C and T bases are switched see page 2 14 The dye set primer file used for data analysis is shown in the annotation view of the sample file see page 7 8 and is also part of the header information on the sequence electropherogram printout If you do analyze with incorrect information the data can be reanalyzed with the correct dye set primer file as described in your user s manual Optimizing Software Settings 6 3 Chemistry Specific Fluorescein Rhodamine Dye Primers Mobility The four fluorescent dyes used for fluorescein rhodamine dye primer sequencing are Information of two structural types 5 FAM and JOE molecules are fluorescein dyes and TAMRA and ROX are rhodamine dyes see Figure 2 5 on page 2 8 Rhodamine dyes migrate more slowly during electrophoresis than fluorescein dyes The dyes affect the mobilities of different primers in ways specific to each primer The anal
164. ftware Tracks gel files if using the ABI 373 or ABI PRISM 377 DNA Sequencer Extracts sample information from gel files if using the ABI 373 or ABI PRISM 377 DNA Sequencer Performs multicomponent analysis Applies mobility corrections Normalizes the base spacing Baselines data Determines analysis starting points e e e gt Calls bases See Chapter 7 for information on interpreting and troubleshooting sequencing data Refer to the ABI PRISM DNA Sequencing Analysis Software User s Manual for specific information about the Sequencing Analysis software ABI PRISM DNA Sequencing Chemistries Overview In This Chapter This chapter describes the PE Applied Biosystems cycle sequencing chemistries the dyes used in them and how to choose a sequencing chemistry Topic See page Dye Terminator Cycle Sequencing Kits 2 2 Dye Primer Cycle Sequencing Kits 2 8 Dye Spectra 2 12 Chemistry Instrument Filter Set Compatibilities 2 13 Dye Base Relationships for Sequencing Chemistries 2 14 Choosing a Sequencing Chemistry 2 15 ABI PRISM DNA Sequencing Chemistries 2 1 Dye Terminator Cycle Sequencing Kits Rhodamine Dye The rhodamine dye terminators have the following dye labels The structures of the Terminators Rhodamine Dye Terminator Kits rhodamine dye terminators are shown in Figure 2 1 Terminator Dye Label A R6G C ROX G R110 T TAMRA ddT TAMR
165. g 4305051 96 Well Tray Adapter 1 each 401958 Genetic Analyzer Capillary Cutters 2 each 401955 Genetic Analyzer Buffer Vials 4 0 mL 50 pkg Includes cap adapters 005914 Platinum cathode electrode 1 each 604418 1 0 mL Glass Syringe 1 each Used for GeneScan and sequencing applications Contains syringe O rings and ferrule 604042 GeneScan Glass Syringe 2 5 mL 1 each Contains syringe O rings and ferrule 603803 DNA Sequencing Glass Syringe 250 uL 1 each Contains syringe O rings and ferrule 221102 Syringe O rings 1 each O ring inside of glass syringe assembly 005401 Syringe ferrule 1 each Ferrule inside of glass syringe assembly 005404 Capillary Fitting 1 each Screw fitting used to hold the capillary in the pump block 005572 0 5 mL Sample Tray 1 each Holds 48 0 5 mL sample tubes 603796 Waste vial 1 each Vial attaches to the gel pump block collects waste generated during gel pump priming with Sequence Polymer 005402 Anode buffer jar 1 each Buffer jar attaches to gel pump block holds the anode buffer 604076 Valve waste vial 1 each Gel pump block manual valve the waste vial attaches to the fitting on this valve 604075 Valve plastic syringe Luer 1 each Gel pump block manual valve the DNA sequencing polymer plastic syringe attaches to the fitting on this valve 310021 Thermal Tape 1 each For affixing the capillary to the heat plate Chemical These kits are shipped with new instruments for the purpose of installa
166. gels 4 4 to 4 9 polyacrylamide gels theory of 4 1 reagents 4 2 to 4 3 preparing and loading samples 3 50 to 3 52 loading recommendations 3 50 loading samples 3 52 preparing loading buffer 3 50 sample loading volumes 3 51 troubleshooting 7 44 to 7 54 table 7 53 to 7 54 gels avoid problems with 4 4 to 4 9 cleaning gel plates 4 6 to 4 9 contaminants 4 4 gel plate quality 4 6 polymerization 4 4 to 4 5 red streaks 4 5 using fresh gels 4 5 evaluating 7 2 to 7 4 Index 4 preparing A 1 to A 16 19 1 polyacrylamide gels A 2 to A 5 29 1 polyacrylamide gels A 6 to A 9 APS TBE buffer and deionized formamide A 15 to A 16 gel formulations table of Long Ranger and PAGE PLUS gels A 10 to A 14 overview A 1 Genetic Analyzer Buffer description of 5 2 genomic DNA templates cycle sequencing using BigDye terminators 3 29 A 1 H help D 1 to D 4 e mail address phone fax D 1 Fax on Demand D 2 Internet WWW address D 1 regional offices D 3 to D 4 telephone hours D 1 homopolymer regions poor data following 7 43 humidity capillary electrophoresis optimizing 5 7 I initiator concentrations effect on gel 4 3 injection time modifying 5 4 to 5 5 injection voltage modifying 5 6 instrument files 1 14 to 1 16 matrix files what s in the file 1 16 multicomponent analysis 1 14 to 1 15 Internet WWW address D 1 Fax on Demand D 2 IUB codes B 1 L laboratory temperature capillary electrophoresis optimizing 5 7 literat
167. gies ed Innis M A Gelfand D H and Sninsky J J Academic Press San Diego CA pp 3 16 Lee L G Spurgeon S L Heiner C R Benson S C Rosenblum B B Menchen S M Graham R J Constantinescu A Upadhya K G and Cassel J M 1997 New energy transfer dyes for DNA sequencing Nucleic Acids Res 25 2816 2822 Lobet Y Peacock M G and Cieplak W Jr 1989 Frame shift mutation in the lacZ gene of certain commercially available pUC18 plasmids Nucleic Acids Res 17 4897 Marra M Weinstock L A and Mardis E R 1996 End sequence determination from large insert cloning using energy transfer fluorescent primers Genome Res 6 1118 1122 McMurray A A Sulston J E and Quail M A 1998 Short insert libraries as a method of problem solving in genome sequencing Genome Res 8 562 566 Mills D R and Kramer F R 1979 Structure independent nucleotide sequence analysis Proc Natl Acad Sci USA 76 2232 2235 Mizusawa S Nishimura S and Seela F 1986 Improvement of the dideoxy chain termination method of DNA sequencing by use of deoxy 7 deazaguanosine triphosphate in place of dGTP Nucleic Acids Res 14 1319 1324 Molecular Probes Inc 1995 User Bulletin MP 7581 4 01 95 Picogreen dsDNA Quantitation Reagent P N P 7581 Rosenblum B B Lee L G Spurgeon S L Khan S H Menchen S M Heiner C R and Chen S M 1997 New dye labeled terminators for improved DNA sequencing patterns
168. gments with homopolymer regions of different length that have the same sequence after that region LOFT TET TTC TTT LETT TTT ATT TTT TT eT TTT eR CAR TAR AR TAR RAGA OTA 60 90 100 110 120 130 140 AN TNGAATNCTATGTNGNGCTTTAANAATAATCATAACGACTNTNCATAAAATNTTAAACGAATTAAA 151 160 171 180 200 190 Figure 7 45 Homopolymer region sequenced using BigDye terminator chemistry The occurrence of slippage is length dependent and short homopolymer regions are rarely problematic in sequencing reactions Slippage is more of a problem with T regions A in the template strand in BigDye terminator reactions due to the use of dUTP in the deoxynucleotide mixture Data Evaluation and Troubleshooting 7 35 When the same template shown in Figure 7 45 is sequenced with dRhodamine terminators the sequence data is much cleaner Figure 7 46 BTETTTETTTETITTTTELTTTTITITTTTEITTTTEITTTTITITTTTTTERACRRTRAARTRRA RAG 60 90 100 110 120 130 141 n ATTTATTGAATACTANGTTGAGCTTTAAGAATAATCATAACGACTATACATAAAATCTTARA J 150 160 170 180 190 200 Figure 7 46 Homopolymer A region sequenced using dRhodamine terminator chemistry Good sequence data immediately past a polyA region can be obtained by using an anchored primer a sequencing primer that is polyT containing an A C or G base at its 3 end Figure 7 47 The 3 base anchors the primer into place at the end of the homopolymer region Khan et al 1991 Thweat et al 1990 Thomas et al
169. h combs are available You can still use 24 well or 36 well combs if desired Note These combs are not interchangeable with combs for the ABI PRISM 377 DNA Sequencer Refer to the 373 DNA Sequencer With XL Upgrade User s Manual P N 904258 for more information Introduction 1 7 Filter Sets ABI PRISM 377 DNA Sequencer 1 8 Introduction The ABI 373 and ABI 373 with XL Upgrade DNA Sequencers use filters mounted on a filter wheel to separate light of different wavelengths The instruments record the light intensity in four regions collectively called Filter Set A centered at the following wavelengths Four filter wheel 540 nm 560 nm 580 nm 610 nm Five filter wheel 531 nm 560 nm 580 nm and 610 nm Note The five filter wheel instruments also have Filter Set B 531 nm 545 nm 560nm and 580 nm but it is not used with existing PE Applied Biosystems sequencing chemistries Filter Set B was used for the T7 Sequenase terminator chemistries which have been discontinued BigDye Filter Wheel To use the new dRhodamine terminator BigDye terminator and BigDye primer sequencing chemistries see Chapter 2 on the ABI 373 and ABI 373 with XL Upgrade DNA Sequencers the ABI PRism BigDye Filter Wheel has been developed Its Filter Set A is as follows 540 nm 570 nm 595 nm and 625 nm Note The BigDye Filter Wheel also has Filter Set B 540 nm 555 nm 570 and 595 nm but it is not used with existing PE Ap
170. h the skin Effects are cumulative When handling always wear protective equipment lab coat safety glasses and chemical resistant gloves and use in a well ventilated area On a routine basis thoroughly clean surfaces subject to contamination Dissolve the crystalline acrylamide and bisacrylamide in sufficient distilled deionized water to bring the total volume to 135 mL Add 15 g of mixed bed ion exchange resin Stir at room temperature until all crystals dissolve Continue stirring for 5 10 minutes Filter the mixture through a 0 2 um cellulose nitrate filter Transfer the filtrate to a graduated cylinder and bring the total volume to 150 mL with distilled deionized water Store at 2 6 C Note 40 acrylamide stock lasts for 1 month at 2 6 C Ingredients and Run For 36 cm and 48 cm WTR Runs 4 19 1 Polyacrylamide Gel 6 M Urea Conditions for the ABI PRISM 377 Ingredient For 50 mL Run Conditions urea 18 0g For 1200 scans hr runs 40 acrylamide stock 5 0 mL use standard 36 cm 1200 scans hr run deionized water 25 mL modules Mixed bed ion 0 59 For 2400 scans hr runs exchange resin use standard 36 cm Filter and degas the above ingredients 2400 scans hr run before adding TBE modules 10X TBE 5 0 mL For 48 cm gels use 10 APS 250 uL standard 48 cm 1200 scans hr run TEMED 35 uL modules Bring to final volume 50 mL with deionized w
171. he base composition of the repeat is problematic For example with a relatively short CGG repeat consisting of 38 repeat units we have had difficulty getting good sequence data beyond the repeat In this case the DNA was handled as for GC rich templates When the length of the repeat is more than 500 bases it can be difficult to get good sequence data from both strands Since there is generally no unique sequence in these repeats synthesis of walking primers is not an option Two approaches have been used successfully with such clones Use of directed deletions Use of an in vitro transposon system such as the Primer Island Transposition Kit Devine and Boeke 1994 Devine et al 1997 Refer to the Primer Island Transposition Kit Protocol P N 402920 for more information about this kit 7 38 Data Evaluation and Troubleshooting Troubleshooting Sequencing Data Troubleshooting Sequencing Data Observation No recognizable sequence see page 7 10 Possible Causes Insufficient template Recommended Actions Quantitate the DNA template Increase the amount of DNA in the sequencing reactions See page 3 17 Inhibitory contaminant in template Clean up the template See page 3 16 Insufficient primer Quantitate the primer Increase the amount of primer in the sequencing reactions See page 3 19 Primer has no annealing site Use a primer that is complementary to the template Poor primer des
172. he caps from each tube 2 Add 74 uL of 70 EtOH 0 5 mM MgCl to each tube Alternatively add 20 uL of 2 mM MgCl and then 55 uL of 95 ethanol 3 Seal the tubes by applying a piece of 3M Scotch Tape 425 3 adhesive backed aluminum foil tape Press the foil onto the tubes to prevent any leakage 4 Invert the tray a few times to mix 5 Leave the tray at room temperature for 15 minutes to precipitate the extension products Note Precipitation times lt 15 minutes will result in the loss of very short extension products Precipitation times gt 24 hours will increase the precipitation of unincorporated dye terminators 1 Contact 3M in the USA at 800 364 3577 for your local 3M representative Use of other tapes may result in leakage or contamination of the sample Performing DNA Sequencing Reactions 3 43 To precipitate extension products in MicroAmp Trays continued Step Action 6 Place the tray in a table top centrifuge with tube tray adaptor and spin it at the maximum speed which must be 21400 x g but lt 3000 x g 1400 2000 x g 45 minutes 2000 3000 x g 30 minutes Note A MicroAmp tube in a MicroAmp Tray can withstand 3000 x g for 30 minutes IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Without disturbing the precipitates remove the adhesive tape and discard the superna
173. he insert TCGAATTCAACTCGCTCGCCCAGGGGGGGGGGGGGGGGGGGGAATCTTGCCCACGTTCAAGTTCTCCAACGICCATTTTCTACCARAATG 100 110 120 130 140 150 160 170 ii Figure 7 49 BigDye terminator data from the same plasmid clone as in Figure 7 48 but the template was obtained by isolation of the plasmid DNA At the present time there is no easy solution for the problem of slippage in PCR amplifications There are three approaches that can be used to obtain the sequence data after such a region in PCR generated templates Anchored primers can sometimes be used to obtain sequence data after homopolymer T regions see page 7 36 Sequence the complementary strand This will give good sequence for the ambiguous region up to the homopolymer region but the same problem will occur afterwards It can be difficult to determine the exact number of bases present in the homopolymer region Clone the PCR product In many cases the cloned product will not show any evidence of slippage when sequenced Multiple clones need to be sequenced to be certain that the correct species has been identified The main disadvantage of this is the work required to isolate and sequence a reasonable number of clones Data Evaluation and Troubleshooting 7 37 Repetitive DNA DNA containing short repetitive regions up to 200 300 bases is generally not difficult to sequence unless t
174. he tube to mix c Chill the mixture for at least 20 minutes at 70 C or overnight at 15 to 25 C 5 Spin the mixture in a microcentrifuge for 15 minutes at maximum speed Aspirate all of the supernatant and discard 6 Wash the pellet with 70 ethanol a Add 250 uL of 70 ethanol to the pellet b Spin in a microcentrifuge at maximum speed for 5 minutes c Carefully draw off the ethanol and dry the pellet in a vacuum centrifuge for no more than 5 minutes 7 Dissolve the DNA pellet in 20 uL of deionized water or TEg buffer Assess the quality of the DNA spectrophotometrically or by agarose gel electrophoresis see Determining DNA Quality on page 3 16 Quantitate the DNA spectrophotometrically see Quantitating DNA on page 3 17 8 Store the DNA at 15 to 25 C until needed for sequencing reactions Plasmid DNA When purifying recombinant plasmids in bacteria plate out the transformants to Templates obtain isolated colonies Select a single colony and restreak out on a plate Select an isolated colony from that plate to obtain plasmids with the desired insert The optimal procedure for preparing a particular plasmid depends on the particular bacterial strain and the yield of each construct Good sequencing data has been obtained from the following methods ABI PRismM Plasmid Miniprep Kit P N 402790 or 402791 3 6 Performing DNA Sequencing Reactions Cesium chloride CsCl
175. hods are and recommended for guaranteeing reagent freshness Reaction Storage Store reagents at 15 to 25 C when not in use and thaw completely at room temperature or in an ice bath do not heat before use Note Do not use a frost free freezer The automatic cycling of the temperature for defrosting can damage reagents particularly enzymes Avoid excess more than ten freeze thaw cycles Aliquot reagents in smaller amounts if necessary Shield reagents and sequencing reactions from light Fluorescent dyes are susceptible to bleaching If you would like to store sequencing reactions for future use purify and dry them Store the reactions at 15 to 25 C Reaction Tubes The type of tube required depends on the type of thermal cycler used For the DNA Thermal Cycler TC1 and DNA Thermal Cycler 480 use 0 5 mL GeneAmp Thin Walled PCR tubes For the GeneAmp PCR Systems 9700 9600 and 2400 use 0 2 mL MicroAmp PCR tubes If using the CATALYST 800 Molecular Biology LabStation or ABI PRiSM 877 Integrated Thermal Cycler refer to your instrument user s manual for reaction tube selection Thermal Cyclers The type and performance of the thermal cycler used to prepare sequencing reactions can affect the quality of the reactions Ensure that the thermal cycler is calibrated regularly by the manufacturer and that ramping rates are 1 C second 3 20 Performing DNA Sequencing Reactions Preparing Cycle Sequencing React
176. i e above 4000 relative fluorescence units RFU and that the baseline at the end of the range is flat A typical number of data points is 1500 23edROH matrix std El 1920 2000 2080 2160 2240 1358_ 1142_ 926_ 710 i 494_ 278_ FENCES EC Repeat step 8 for each matrix standard sample Record the results for later use IMPORTANT The number of data points analyzed is the same for each matrix standard Choose starting points for each sample such that all peaks are less than 4000 RFU and that both the starting and ending points have flat baselines and no peaks 6 10 Optimizing Software Settings To make the Tag Terminator Matrix Step Action 1 In the Data Utility application choose Make Matrix from the Utilities menu The Make Matrix dialog box appears 2 In the Make Matrix dialog box click the Taq Terminator Matrix button at the lower left 3 Click on the box for each nucleotide base and enter the data file that corresponds to the correct matrix standard as shown in the table below Taq Terminator Box Matrix Cs dROX A dR6G G dR110 T dTAMRA IMPORTANT The order of matrix standard data files is different from that in the Dye Primer Matrix see Table 6 4 on page 6 7 4 Enter the same numbers for each matrix standard sample in the Start at and Points boxes as were used f
177. iate protective eyewear clothing and gloves 2 Add 200 mL of absolute ethanol to the bottle WARNING CHEMICAL HAZARD Ethanol is a flammable chemical and is irritating to the skin eyes respiratory system It can cause nerve and liver damage CNS depression nausea vomiting and headache Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Optimizing Gel Electrophoresis 4 7 To perform an alcoholic KOH wash continued Step Action 3 Mix the solution well It will take at least 15 minutes for most of the pellets to dissolve Note This recipe is for a saturated solution so some pellets will remain Store the solution with the bottle capped tightly During storage the color of the solution will turn dark red brown The solution can still be used and is good for 1 year Place some uncolored absorbent towels or other covering in the hood to catch spills Place the gel plates on the towels with the inside surfaces facing up Note The plates should be nearly level so that the cleaning solution does not run off onto the bench Only the inside gel side surface of the plates need be cleaned though the outside surfaces can be cleaned similarly Pour approximately 15 mL of the cleaning solution onto the center of each plate to be cleaned Spread the solution over the surface of plate Allow the solution to
178. ice 3 19 cycle sequencing advantages of 1 4 description of 1 4 performing DNA sequencing reactions 3 27 to 3 32 dye primer chemistries 3 29 to 3 32 dye terminator chemistries 3 27 to 3 29 3 31 3 32 preparing sequencing reactions 3 21 to 3 26 dye primer chemistries 3 24 to 3 26 dye terminator chemistries 3 21 to 3 24 D data analysis setting range 6 15 to 6 23 Peak 1 Location for dye primer chemistries 6 16 to 6 18 Peak 1 Location for dye terminator chemistries 6 18 to 6 20 Stop Point 6 21 to 6 23 Data Utility software using to make matrix file 6 7 deionized formamide 3 50 preparing A 16 DNA quality determining 3 16 DNA sequence troubleshooting 7 30 to 7 38 compressions 7 31 to 7 32 false stops in dye primer chemistry 7 30 to 7 31 GC rich templates 7 32 to 7 33 GT rich template with BigDye terminators 7 34 to 7 35 homopolymer regions 7 35 to 7 37 using anchored primers 7 36 repetitive DNA 7 38 secondary structure 7 33 DNA Sequencing Polymer DSP capillary electrophoresis 5 2 DNA sequencing performing capillary electrophoresis preparing and loading samples 3 53 to 3 54 loading the sample 3 54 preparing reaction mixture 3 53 preparing the sample 3 53 sample volume 3 53 choosing a sequencing chemistry 2 15 to 2 16 cycle sequencing 3 27 to 3 32 dye primer chemistries 3 29 to 3 32 dye terminator chemistries 3 27 to 3 29 3 31 3 32 electrophoresis preparing for 3 33 to 3 49 96 well plate purification pr
179. ies however the extension products from the residual primers will also be labeled and will result in a second sequence being present in the data Data Evaluation and Troubleshooting 7 21 Complete removal of the unincorporated primers from the PCR amplification before sequencing will prevent this Ultrafiltration in a Centricon 100 column is an effective way to remove the unincorporated primers as well as the unused dNTPs see page 3 12 If a secondary hybridization site for the primer is present in the template two sequences will be detected resulting in noisy data Hybridization at a secondary site that is not a perfect match for the primer will happen more readily at lower annealing temperatures and at higher concentrations of primer To minimize this keep the annealing temperature as high as possible and do not use excessively high concentrations of primer If the secondary hybridization site is a perfect match for the primer due to the presence of homologous sequence you will have to redesign the primer or use a different sequencing strategy Pull up Peaks Figure 7 29 shows rhodamine dye terminator data collected on an ABI PRISM 377 DNA Sequencer The data has pull up peaks also known as bleedthrough multiple peaks in the same position at some points Pull up peaks are caused by very strong signals that saturate the detector These signals are therefore clipped digitally truncated The software underestimates the amount o
180. ign or incorrect primer sequence Redesign the primer See page 3 18 Missing reagent Repeat reactions following the protocol carefully See page 3 21 Old or mishandled reagents Use fresh reagents See page 3 20 Thermal cycler power failure Repeat reactions Thermal cycling conditions Calibrate the thermal cycler regularly Use the correct thermal cycling parameters Use the correct tube for your thermal cycler Set ramp rates to 1 C second Extension products lost during reaction cleanup Ensure that correct centrifugation speeds and times are used for precipitation and spin column procedures See page 3 33 Extension products not resuspended Resuspend sample pellet in loading buffer or TSR carefully Lane tracking failure ABI 373 or ABI PRISM 377 DNA Sequencer Check lane tracking Retrack and reextract lanes if necessary Electrokinetic injection failure ABI PRISM 310 Genetic Analyzer Repeat injections Data Evaluation and Troubleshooting 7 39 Troubleshooting Sequencing Data continued Observation Possible Causes Recommended Actions Noisy data throughout sequence with low signal strength see page 7 11 Not enough DNA in the sequencing reactions Use more DNA in the sequencing reactions Load or inject more of the resuspended sequencing reactions See Preparing and Loading Samples for Gel Electrophoresis on p
181. in a spectrophotometer One O D unit is the amount of a substance dissolved in 1 0 mL that gives an absorbance reading of 1 00 in a spectrophotometer with a 1 cm path length The wavelength is assumed to be 260 nm unless stated otherwise As values can be converted into ng uL using Beer s Law Absorbance 260 nm sum of extinction coefficient contributions x cuvette pathlength x concentration The following formulas are derived from Beer s Law Ausubel et al 1998 One A60 unit of single stranded DNA contains 33 ng L One Az 69 unit of double stranded DNA contains 50 ng uL Note O D lt 0 05 DNA samples can be inaccurate Absorbance measurements of highly concentrated O D gt 1 0 or very dilute DNA can also be quantitated by fluorometric analysis employing either Hoechst dye 33258 Hoefer Inc 1993 or Picogreen Molecular Probes Inc 1995 The amount of DNA template used in a sequencing reaction can affect the quality of the data Too much template makes data appear top heavy with strong peaks at the beginning of the run that fade rapidly Too little template or primer reduces the signal strength and peak height In the worst case the noise level increases so that bases cannot be called Table 3 1 on page 3 17 shows the recommended quantities for each sequencing chemistry Table 3 1 Recommended Ranges of DNA Template Quantity for Each Chemistry Cycle Sequencing Chemisiry F
182. ing primer or else requires premixing template with primer in the sample tube Terminator Automix Sequencing combines reaction cocktail lacking primers water primer from one tube and template from another tube This eliminates the requirement for premixing of samples and primers The profile is chosen on the Chemistry page of the Sequencing Notebook and can be edited to make custom profiles Refer to Chapter 4 Using the ABI PRISM 877 Software in the ABI PRISM 877 Integrated Thermal Cycler User s Manual P N 904414 Dye Primer Sequencing Options Predefined temperature profiles are provided for the following on the ABI PRISM 877 Integrated Thermal Cycler Double Stranded Forward Universal Primer Double Stranded Reverse Universal Primer Single Stranded Forward Primer Quick Cycle These are chosen on the Chemistry page of the Sequencing Notebook and can be edited to make custom profiles Refer to Chapter 4 Using the ABI PRISM 877 Software in the ABI PRISM 877 Integrated Thermal Cycler User s Manual for instructions on editing temperature profiles IMPORTANT Load only the reagents that you plan to use Do not store kit reagents on the worksurface Performing DNA Sequencing Reactions Preparing Extension Products for Electrophoresis Overview Preparation of extension products for electrophoresis will vary depending on the cycle sequencing chemistry used Dye Terminator Chemistries Unincorporate
183. ions Rhodamine Dye The procedure given here is for the ABI PRISM Dye Terminator Cycle Sequencing Terminators Ready Reaction Kits Refer to the ABI PRISM Dye Terminator Cycle Sequencing Core kit Protocol P N 402116 for information on preparing reactions with the core kits dRhodamine Terminators Step Action 1 For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 8 0 uL Template 7 single stranded DNA 100 250 ng double stranded DNA 200 500 ng PCR product 1 100 ng depending on size see Table 3 1 on page 3 17 Primer 3 2 pmol Deionized water q s Total Volume 20 uL 2 Mix well and spin briefly 3 If using the DNA Thermal Cycler TC1 or DNA Thermal Cycler 480 Overlay the reaction mixture with 40 uL of light mineral oil The cycle sequencing procedures for rhodamine dye terminators start on page 3 27 Step Action 1 For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 8 0 uL Template single stranded DNA 50 100 ng double stranded DNA 200 500 ng PCR product 1 100 ng depending on size see Table 3 1 on page 3 17 Primer 3 2 pmol Deionized water q s Total Volume 20 uL 2 Mix well and spin briefly 3 If using the DNA Thermal Cycler TC1 or DNA Thermal Cycler 480 Overlay the reaction mixture with 40 uL of light mineral
184. is Data Evaluation and Troubleshooting 7 3 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 O DEP E ii a his basi ie Gigs a j Lal Bahai iahjj TOLI EIU Figure 7 1 96 lane gel run on an ABI PRISM 377 DNA Sequencer at 1200 scans hr Figure 7 2 Zoomed in view of the excess dye peaks in lanes 4 51 of 7 4 Data Evaluation and Troubleshooting Sample Files There are six different fields within the sample file that can be used to display information about the sample Three of these fields are useful for data evaluation Electropherogram view Raw data view Annotation view Refer to the ABI PRISM DNA Sequencing Analysis Software User s Manual for more information about the other three views and their uses For ABI PRISM 310 users the sample file contains all of the necessary information for data evaluation Using the Electropherogram View If your data was analyzed successfully this is the default window that appears when opening the sample file Scrolling through the data provides the following information for evaluating performance Whether the Peak 1 Location and Start Point for data analysis are set correctly Presence of any extraneous dye peaks from unincorporated terminators or other fluorescent contaminants Peak shape and resolution Quality of mobility correction Match of basecalling with e
185. is particularly useful in cases where limiting concentrations of primers and nucleotides cannot be used for direct PCR sequencing see page 3 14 IMPORTANT This method only works when a single PCR product is obtained To degrade PCR primers and nucleotides using SAP Exo Step Action 1 For each sample combine the following SAP 1 Unit uL 2 uL Exo 10 Units uL 0 2 uL Deionized water 6 0 uL Note In general this procedure works well using 0 5 units of each enzyme per microliter of PCR products used The procedure seems to work equally well with or without the use of SAP buffer so this has been excluded in this protocol 2 Add 4 0 uL of PCR product to the above mix Incubate at 37 C for 1 hour Incubate at 72 C for 15 minutes to inactivate the enzymes The PCR product may need dilution before sequencing Determine the dilution ratio empirically start with 1 2 and 1 10 dilutions with deionized water Performing DNA Sequencing Reactions 3 13 The recommended DNA quantities for sequencing reactions are shown in Table 3 1 on page 3 17 Direct PCR PCR protocols that limit amounts of primers and dNTPs allow the product of the Sequencing reaction to be used for sequencing with no purification This is usually carried out by setting up the PCR amplification with 5 10 pmol of primers and 20 40 uM dNTPs so that most of the primers and dNTPs are exhausted during amplification If the yield o
186. itated with ethanol and resequenced Figure 7 19 on page 7 17 After ethanol precipitation the signal was much stronger with 0 25 ug having signal strength of 558 and 1 0 ug having signal strength of 1383 The ethanol precipitation probably removed a contaminant that was present in the original template preparation and was inhibiting the sequencing reaction see Salt Contamination on page 7 25 7 16 Data Evaluation and Troubleshooting RIRAATRAATARARTRARTATATATATATATATATA TATA TAT GTA TATAT TTT TT TT TAT TTT TTT TTR T TAT TA CAT CTT TT eC Cr 80 90 100 110 120 130 150 160 140 iON aa Figure 7 18 Sequence data obtained from a contaminated template preparation 0 25 ug of template was sequenced The total signal strength was 144 ATRA ATAR ATA RTAR ATR TR TR TREAT ATR TA TA TATA TA TC TATA TAT OTT TTT PTT TT ETT TAT TAT TAA T GT TT Te 30 100 110 120 130 140 150 160 1 Figure 7 19 Same template after ethanol precipitation 0 25 ug of template was sequenced The total signal strength was 558 Degraded DNA Nuclease contamination in a template preparation and repeat freeze thaw cycles can result in degradation of DNA over time Figure 7 20 shows sequence data from a BigDye primer reaction done with an old template preparation There is a large stop peak present in the sequence data after base 320 Note Stop peaks are common to all chemistries but are detected only in dye primer chemistries see
187. ix A for gel preparation protocols Contaminants cause a variety of problems that affect the quality of sequence data adversely Contaminants in gels can come from many sources Glassware used to make the gel Sinks used to clean gel plates and glassware Sponges used to clean gel plates Colored paper towels Water used for cleaning or gel formulation Solvents used for cleaning glass plates gt gt gt gt Marking pens Background Fluorescence Background fluorescence on the gel is a problem because it masks the signals from the dyes used to detect sequencing extension products It can be avoided by careful handling of glass plates spacers combs and buffer chambers Do not use any kind of ink on plates spacers combs and buffer chambers Ink fluoresces strongly obscuring data Figure 7 52 on page 7 46 Washing plates in communal sinks where fluorescent products are disposed can also lead to background fluorescence problems The properties of the gel depend on the rate of polymerization The rate of polymerization is affected by temperature initiator APS and TEMED concentrations oxygen and contaminants in the reagents used to formulate gels Temperature Controlling the temperature is crucial for achieving reproducible gels because it directly affects the polymerization time and thus affects the gel properties A gel formed in a cold environment such as a room at 2 6 C will be turbid porous inelas
188. l Cycler 480 Place the pipette tip into the bottom of the reaction and carefully remove the reaction from the oil Oil Reaction IMPORTANT Transfer as little oil as possible 2 Add one of the following 80 uL of 75 isopropanol or 20 uL of deionized water and 60 uL of 100 isopropanol The final isopropanol concentration should be 60 5 3 Close the tubes and vortex briefly 4 Leave the tubes at room temperature for 15 minutes to precipitate the extension products Note Precipitation times lt 15 minutes will result in the loss of very short extension products Precipitation times gt 24 hours will increase the precipitation of unincorporated dye terminators 5 Place the tubes in a microcentrifuge and mark their orientations Spin the tubes for 20 minutes at maximum speed IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Performing DNA Sequencing Reactions 3 37 To precipitate extension products in microcentrifuge tubes continued Step Action 6 Carefully aspirate the supernatants with a separate pipette tip for each sample and discard Pellets may or may not be visible IMPORTANT The supernatants must be removed completely as unincorporated dye terminators are dissolved in them The more residual supernatant left in the tubes the more unincorporated dye terminators will remain in the samples Add 250 uL
189. labeled primer and a control template Enough for 50 ss or dsDNA sequencing Matrix and Sequencing Standards Sample Preparation Reagents reactions P N Primers 401131 21 M13 Dye Primers 4 x 50 5 TGT AAA ACG ACG GCC AGT 3 401130 M13 Reverse Dye Primers 4 x 50 5 CAG GAA ACA GCT ATG ACC 3 401127 T7 Dye Primers 4 x 50 5 TAA TAC GAC TCA CTA TAG GG 3 401128 T3 Dye Primers 4 x 50 5 ATT AAC CCT CAC TAA AGG GA 3 401129 SP6 Dye Primers 4 x 50 5 ATT TAG GTG ACA CTA TAG 3 403013 PI Dye Primers 4 x 50 5 CAG GAC ATT GGA TGC TGA GAA TTC G3 403014 PI Dye Primers 4 x 50 5 CAG GAG CCG TCT ATC CTG CTT GC 3 P N Standard 403047 dRhodamine Matrix Standards Kit 401071 Dye Terminator Matrix Standards Kit 401114 Dye Primer Matrix Standards Kit 4303120 dRhodamine Terminator Cycle Sequencing Standard 4304154 BigDye Terminator Cycle Sequencing Standard 402830 Dye Terminator Cycle Sequencing Standard 401920 Dye Primer Cycle Sequencing Standard P N Standard 402790 ABI Prism Plasmid Miniprep Kit 100 purifications 402791 ABI Prism Plasmid Miniprep Kit 500 purifications 4305605 5X Sequencing Buffer 600 reactions 4305603 5X Sequencing Buffer 5400 reactions Part Numbers E 3 Reagent Kit Protocols E 4 Part Numbers P N Protocol 403041 ABI PRISM dRhodamine Termi
190. lay an enhanced signal These base composition effects increase the chance of a pull up peak being observed at these positions Figure 7 29 on page 7 22 The dRhodamine terminators and BigDye terminators have more uniform peak heights that lessen the potential for individual signals to go off scale Figure 7 30 However if combined signals are above 4000 then pull up peaks are likely to be observed Figure 7 30 Same template as in Figure 7 29 but sequenced with dRhodamine terminators The arrows point to bases where pull up peaks were seen with the rhodamine dye terminators Data Evaluation and Troubleshooting 7 23 Stop Peaks in PCR Stop Peaks in Dye Primer Chemistry Caused by Primer Dimer Formation Sequencing Sometimes during PCR amplification the forward and reverse primers form a primer dimer If one of the PCR primers is used for sequencing that primer can anneal to and extend both the PCR fragment and the primer dimer In dye primer sequencing the multiple annealing can create noise in bases up to the end of the primer dimer and a large stop peak at the end of the primer dimer Figure 7 31 This kind of artifact is typically seen in the first 25 60 bases of the sequence but can extend as far as 100 bases The sequence data after the primer dimer stop peak is often unaffected unless very significant amounts of primer dimer are present in the reaction In this case much of the sequencing primer is used in priming primer
191. le top centrifuge with tube tray adaptor and spin it at the maximum speed which must be 21400 x g but lt 3000 x g 1400 2000 x g 45 minutes 2000 3000 x g 30 minutes Note A MicroAmp tube in a MicroAmp Tray can withstand 3000 x g for 30 minutes IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Without disturbing the precipitates remove the adhesive tape and discard the supernatant by inverting the tray onto a paper towel folded to the size of the tray Place the inverted tray with the towel into the table top centrifuge and spin at 700 x g for 1 minute Add 150 uL of 70 ethanol to each pellet 1 Contact 3M in the USA at 800 364 3577 for your local 3M representative Use of other tapes may result in leakage or contamination of the sample Performing DNA Sequencing Reactions 3 41 To precipitate extension products in MicroAmp Trays continued Step Action 10 Cap or seal the tubes then invert the tray a few times to mix 11 Spin the tray for 10 minutes at maximum speed 12 Repeat steps 7 and 8 13 Remove the tray and discard the paper towel Note Pellets may or may not be visible Vacuum drying of the samples is not necessary Precipitation in Microcentrifuge Tubes Reagents and equipment required 1 5 mL microcentrifuge tubes gt gt
192. lease air bubbles trapped by the urea Stopper the cylinder and invert to dissolve the urea 5 Allow the solution to warm to room temperature 6 Add deionized water to make the final volume 80 mL for 34 cm gels 100 mL for 48 cm gels 7 Stopper the cylinder and mix the contents thoroughly 8 Filter the solution through a 0 2 um cellulose nitrate filter 9 Degas for 2 5 minutes and transfer the solution to a wide mouthed container Note Degas time for all gels should be constant to ensure a reproducible polymerization rate for all gels Adding the polymerizing reagents Step Action 1 IMPORTANT If the plates are not clean and ready for gel pouring prepare them before adding the polymerizing agents to your solution 2 Add freshly made 10 APS and swirl carefully to mix without introducing air bubbles Note Be as accurate and reproducible as possible when making the 10 APS solution Significant variation in this reagent can produce changes in data quality 3 Add TEMED and swirl carefully to mix without introducing air bubbles Cast the gel using one of the methods described in the 373 DNA Sequencing System User s Manual 5 Allow the gel to polymerize for 2 hours before using Preparing APS TBE Buffer and Deionized Formamide 10 Ammonium IMPORTANT Use fresh ammonium persulfate The crystals should crackle as they Persulfate dissolve Step Action 1 Weigh out 0 50 0 005 g o
193. lectropherogram peaks gt gt gt Point at which basecalling accuracy declines number of Ns increases significantly Signal to noise ratio Anomalies in the data that require further review Figure 7 3 on page 7 6 shows an example of dRhodamine terminator data run on an ABI PRISM 377 DNA Sequencer This sample was run in lane 29 of the gel shown in Figure 7 1 on page 7 4 so we already know that the sample has weak signal and excess dye peaks The electropherogram view provides the following additional information Excess dye peaks The dye peaks at the beginning of the sequence cause the Peak 1 Location and Start Point to be chosen incorrectly by the software see page 7 64 The dye peaks also obscure data up to base 40 Poor peak shape and resolution The peaks in the data are broad and asymmetric They are not well resolved from each other which leads to miscalled bases For example the C peak at base 243 obscures the T peak at base 244 giving an ambiguous basecall N Poor signal to noise The data in the fourth panel is weak and noisy causing many Ns Data Evaluation and Troubleshooting 7 5 cco Nb aaa TTTACC TTce CanTacacaaNs acta scaNaacaacacc GcNT Ga GT GQTG440G COTCGGATC ATAA A ACTS TGTTATTAGGG44G00CHTaAaTETAT Q co 30 so 7 ha GTAACTGATGCACATCTTGACGAGTACCTA ATCAGAAAGCOCACEG CTA ACTACGTGCOCAGCA GCCACAATA ATAC GTAGGTGGAAGCGTTATCCGGAATTATTH LLLI 120 130 140 150 160 170 130 130 coo t
194. les Rapid thermal rampa to 96 C 96 C for 30 sec Rapid thermal ramp to 50 C 50 C for 15 sec Rapid thermal ramp to 60 C 60 C for 4 min gt gt gt 3 Rapid thermal ramp to 4 C and hold until ready to purify 4 Spin down the contents of the tubes in a microcentrifuge a Rapid thermal ramp is 1 C sec BACs PACs YACs and Cosmids on the GeneAmp 9700 in 9600 Emulation Mode 9600 or 2400 Note This protocol is for use only with the BigDye terminator kits Step Action 1 Place the tubes in a thermal cycler and set the volume to 40 uL 2 Heat the tubes at 95 C for 5 minutes 3 Repeat the following for 30 cycles Rapid thermal ramp to 95 C 95 C for 30 sec Rapid thermal ramp to 50 55 C depending on template 50 55 C for 10 sec Rapid thermal ramp to 60 C 60 C for 4 min gt gt gt gt 4 Rapid thermal ramp to 4 C and hold until ready to purify 5 Spin down the contents of the tubes in a microcentrifuge a Some laboratories have found that increasing the number of cycles gives better results b Rapid thermal ramp is 1 C sec 3 28 Performing DNA Sequencing Reactions Bacterial Genomic DNA on the GeneAmp 9700 in 9600 Emulation Mode 9600 or 2400 Note This protocol is for use only with the BigDye terminator kits Step Action 1 Place the tubes
195. les evaluating 7 5 to 7 9 using the Annotation View 7 8 to 7 9 using the Electropherogram View 7 5 to 7 6 using the Raw Data View 7 6 to 7 8 Sanger Dideoxy sequencing description of 1 2 sequencing data troubleshooting table 7 39 to 7 43 sequencing instruments See specific instrument sequencing PCR templates 3 10 to 3 14 sequencing reactions factors affecting data quality 3 1 preparing 3 21 to 3 26 BigDye primers 3 25 to 3 26 BigDye terminators 3 22 to 3 24 dRhodamine terminators 3 21 fluorescein rhodamine dye primers 3 24 reaction tubes type of 3 20 reagent handling and reaction storage 3 20 rhodamine dye terminators 3 21 thermal cyclers type of 3 20 signal early signal loss practical example 7 14 to 7 15 troubleshooting sequencing data 7 41 to 7 42 preventing loss of 4 9 temporary loss of gel electrophoresis 7 51 single stranded DNA templates preparing 3 2 to 3 6 software optimizing settings 6 2 to 6 23 choosing a dye set primer file 6 3 to 6 5 choosing a run module 6 2 choosing the correct technical support basecaller 6 6 creating instrument matrix files 6 7 to 6 13 dye set primer files table of 6 5 setting the data analysis range 6 15 to 6 23 Sequencing Analysis software described 1 16 troubleshooting 7 62 to 7 65 incorrect dye set primer file 7 62 incorrect or poor quality matrix file 7 63 to 7 64 incorrect Peak 1 Location 7 64 incorrect run module 7 62 spin column purification 3 34 to
196. line is aligned at the right edge of the primer peak Figure 6 1 on page 6 16 c Read the scan number data point that is reported at the top of the dialog box 1109 in the example shown in Figure 6 1 Use this number as the Primer Peak Location for the file 5 Return to the Sample File Queue display a Highlight the name of the file just inspected and click the Custom Settings window b Select the Change Primer Peak check box The Use Start Point and Change Primer Peak radio buttons become active The Use Start Point radio button is selected by default since the Primer Peak Location and the Start Point are the same in most cases c Click the Change Primer Peak radio button to display the entry field The number in the data field is the number used for the Primer Peak Location during the last analysis d Enter the new number Note If the value assigned for the Primer Peak location is greater than that assigned for the Start Point the Start Point value needs to be changed to that of the Primer Peak Location If you want the Primer Peak location to be used as the Start Point changing the Start Point value and leaving the Change Primer Peak radio button as the default Use Start Point should also work In Sequencing Analysis version 2 1 there is a link between the Start Point and the Primer Peak Location Using Sequencing Analysis Version 3 0 or 3 2 Step Action 1 Launch the Sequencing Analysis softw
197. ltering and gel casting should be done with the solution at room temperature Also be careful not to introduce bubbles during the stirring and pouring steps of gel casting Air bubbles trapped while casting the gel should be eliminated as they occur Ideally gels should be poured carefully and gently so that bubbles never form Tapping gently on the plates while pouring the gel solution will help prevent bubbles from forming For consistent results use gels within 2 6 hours after casting Be sure to wait at least 2 hours after casting the gel to ensure complete polymerization but not longer than 6 hours as resolution begins to noticeably deteriorate after this time Gels that stand overnight can show significantly slower DNA migration due to the slow hydrolysis of urea to ammonium carbonate Because the amide groups of the polymer slowly hydrolyze into carboxylate groups gels that stand more than 48 hours may also show significant loss in resolution beyond 350 bases If read length is not important for your application gels can be stored overnight Wrap the ends of the gels in plastic wrap to prevent drying The ABI PRISM 377 DNA Sequencer sometimes produces a gel image having intense vertical red streaks This phenomenon called red rain is usually found near the end of a run top of the gel image but can begin much earlier Figure 7 55 on page 7 49 Red rain is caused by gel destruction in the read region of the gel
198. luorescein Rhodamine dRhodamine BigDye Rhodamine Template Dye Terminator Terminator Terminator Dye Primer BigDye Primer PCR product 100 200 bp 1 3 ng 1 3 ng 1 3 ng 2 5 ng 2 5 ng 200 500 bp 3 10 ng 3 10 ng 3 10 ng 5 10 ng 5 10 ng 500 1000 bp 5 20 ng 5 20 ng 5 20 ng 10 20 ng 10 20 ng 1000 2000 bp 10 40 ng 10 40 ng 10 40 ng 20 50 ng 20 50 ng gt 2000 bp 40 100 ng 40 100 ng 40 100 ng 50 150 ng 50 150 ng single stranded 100 250 ng 50 100 ng 50 100 ng 150 300 ng 150 400 ng double stranded 200 500 ng 200 500 ng 200 500 ng 300 600 ng 200 800 ng cosmid BAC 0 5 2 0 yg not 0 5 1 0 ug 0 5 2 0 ug 0 5 1 0 ug recommended bacterial genomic not recommended 2 3 ug not recommended DNA Performing DNA Sequencing Reactions 3 17 Primer Design and Quantitation Overview The choice of primer sequence method of primer synthesis and approach to primer purification can have a significant effect on the quality of the sequencing data obtained in dye terminator cycle sequencing reactions Dye primer cycle sequencing kits include dye labeled primers that are already optimized and quantitated Primer Design Some of the recommendations given here are based on information that is general knowledge while others are based on practical experience gained by scientists at PE Applied Biosystems The following recommendations are provided to help optimize primer selection ft gt gt Use Primer Express software P N 402089 for primer
199. m resolution with injection voltages of 53 V cm a typical value for a 47 cm capillary Peak height and peak area increase linearly with increasing injection voltage For information on setting electrokinetic injection values refer to the ABI PRISM 310 Genetic Analyzer User s Manual 5 6 Optimizing Capillary Electrophoresis Optimizing Electrophoresis Conditions Introduction Run Time Run Temperature Laboratory Temperature and Humidity For More Information Optimizing electrophoresis conditions run time run voltage and run temperature can greatly improve data quality run to run reproducibility and or throughput When selecting values for these parameters consider the following factors Read length desired Required degree of resolution Determining Required Run Time To ensure that you collect sufficient data to perform analysis set the electrophoresis run time approximately 10 higher than the migration time of the longest fragment you want to detect For sequencing samples using DSP the standard run voltage is 160 volts cm For a 47 cm capillary this translates to 7 5 kV The current at this voltage is 7 10 pA The time required for a 450 base fragment to reach the detector window is about 135 minutes with these run conditions For sequencing samples using POP 6 and long read sequencing the standard run voltage is 200 volts cm For a 61 cm capillary this translates to 12 2 kV The current at thi
200. mM EDTA pH 8 0 with 50 mg mL blue dextran P N 402055 Deionized formamide To perform express load with BigDye primers Step Action 1 Combine the four reactions A C G T with 5 uL of 5 mM EDTA 25 uL total volume Vortex briefly then spin in a microcentrifuge Prepare a loading buffer by combining the following in a 5 1 ratio deionized formamide 25mM EDTA pH 8 0 with blue dextran 50 mg mL WARNING CHEMICAL HAZARD Formamide is a teratogen and is harmful by inhalation skin contact and ingestion Use in a well ventilated area Use chemical resistant gloves and safety glasses when handling Combine 4 uL of each 25 uL reaction EDTA mixture with 4 uL of loading buffer in a fresh tube Store the remaining reaction EDTA mixture at 15 to 25 C This mixture can be concentrated by ethanol precipitation if the Express Load procedure does not yield enough signal Heat the samples at 98 C for 5 minutes with the lids open to denature and concentrate the sample Place on ice until ready to load Load 2 5 uL of each sample onto the gel Performing DNA Sequencing Reactions 3 49 Preparing and Loading Samples for Gel Electrophoresis Loading Recommendations Preparing Loading Buffer The amount of sample to load depends on many factors including Sequencing chemistry used Quality and nature of the DNA template Primer performance Instrument configuration
201. me overlap in the emission spectra between the four dyes Figure 1 6 The goal of multicomponent analysis is to isolate the signal from each dye so that there is as little noise in the data as possible 00 80 60 40 20 NORMALIZED EMISSION INTENSITY 500 520 540 560 580 600 620 640 660 WAVELENGTH nm Figure 1 6 Spectral overlap of the dRhodamine dyes in the four virtual filters vertical gray bars of Filter Set E The precise spectral overlap between the four dyes is measured by running DNA fragments labeled with each of the dyes in separate lanes of a gel or in separate injections on a capillary These dye labeled DNA fragments are called matrix standards The Data Utility software see page 6 7 then analyzes the data from each of the four matrix standard samples and creates an instrument file The instrument file contains three matrix files which have tables of numbers with four columns and four rows Figure 1 7 on page 1 15 These numbers are normalized fluorescence intensities and represent a mathematical description of the spectral overlap that is observed between the four dyes The rows in the tables represent the virtual filters and the columns represent the dyes The top lefthand value 1 000 represents the normalized fluorescence of the blue dye in the blue filter It follows that all matrix tables should have values of 1 000 on the diagonal from top left to bottom right The other values in the tabl
202. minator chemistries Filter Set A is used For dRhodamine based chemistries on instruments with the BigDye Filter Wheel Filter Set A is also used but the filters have different wavelengths see page 1 8 Table 6 1 Run Modules Instrument Filter Set A Filter Set E ABI PRISM 310 Seq Fill Capillary Seq Fill Capillary Seq POP6 1 mL A Seq POP6 1 mL E Seq POP6 Rapid 1 mL A Seq POP6 250 uL E Seq Run 250 uL A Seq POP6 Rapid 1 mL E Test CCD 4 Color Seq Run 250 uL E Test CCD 4 Color ABI 373 with Plate Check XL Upgrade Pre Run Seq Run ABI PRISM 377 All Plate Check Plate Check Models Plate Check A Seq PR 36A 1200 Seq PR 36A 2400 Seq Run 36A 1200 Seq Run 36A 2400 Seq Run 48A 1200 Plate Check Ab Plate Check EC Seq PR 36A 1200 Seq PR 36A 24005 Seq PR 36E 1200 Seq PR 36E 2400 Seq Run 36E 1200 Seq Run 36E 2400 Seq Run 48E 1200 a Older versions of the ABI PRISM 377 Collection Software may use different nomenclature for run modules e g PR 2X A Seq PR 36A 1200 Run 4X A Seq Run 36A 2400 b Any plate check and prerun module can be used on the ABI Prism 377 DNA Sequencer c For the ABI PRISM 377 DNA Sequencer with 96 Lane Upgrade only 6 2 Optimizing Software Settings Choosing a Dye Set Primer Mobility File Overview Using the Wrong Dye Set Primer File The different dyes affect the electrophoretic mobility of cycle sequencing extension products to varying
203. mine terminator chemistry lanes 27 52 except 42 and 43 Note Lanes 42 and 43 were not loaded because the wells were damaged This gel file has several problems including the following Background noise A horizontal yellow band runs across the loaded region of the gel It is clearly visible in lanes 27 52 This band might show up as noise in the analyzed data blue in dRhodamine chemistry and red in BigDye terminator chemistry see Dye Base Relationships for Sequencing Chemistries on page 2 14 and Figure 7 36 on page 7 29 Excess dye peaks Lanes 5 52 show excess dye peaks which are more pronounced in lanes 5 26 The dye peaks result from poor ethanol precipitation Figure 7 2 on page 7 4 shows a closeup view of the excess dye peaks at the bottom of the gel image Using the closeup view can give information about peak shape as well as excess dye peaks Refer to the ABI PRISM DNA Sequencing Analysis Software User s Manual for information on magnifying the gel image Excess dye peaks obscure data at the beginning of the sequence Weak and failed reactions Lanes 8 11 18 22 27 29 31 33 and 48 have weak signal strengths that can cause the analyzed data to be noisy Lanes 28 30 32 34 47 and 49 52 show failed reactions i e they have signal too low to be analyzed or no usable data Observing the overall gel image or magnified areas of the gel image can help you identify features that can cause problems in data analys
204. module was used to collect the data If the correct run module and instrument file were used you may have a poor quality matrix In this case the instrument file should be remade see page 6 7 Figure 7 66 on page 7 64 shows the same data analyzed with the correct instrument file GCCAGCGCAAGCGGGCCGAGCGGGCGCTGAACGACCAGCTGGAATTWATGCGCGTGCTCATCGACGGCA 120 130 14 150 160 170 160 Figure 7 65 BigDye terminator data collected with a Filter Set E run module and analyzed with an incorrect Filter Set A instrument file Data Evaluation and Troubleshooting 7 63 S a PG See ee eRe OPE ec a a Eh iE le de 150 160 170 160 ulin aA Figure 7 66 BigDye terminator data collected with a Filter Set E run module and analyzed with the correct Filter Set E instrument file Instrument files do not change over time but instruments do change You may need to remake the instrument file as the filter wheel on an ABI 373 DNA Sequencer ages or if any changes to the optics occur e g the CCD camera on an ABI PRISM 310 or ABI PRISM 377 instrument is replaced Figure 7 67 shows BigDye terminator data analyzed with a poor matrix file Bad multicomponenting is characterized by specific peaks under peaks throughout the run in this case smaller red peaks under blue peaks TCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTG 150 160 170 160 896 67 SCT Figure 7 67 BigDye terminator data analyzed with a poor Filter Set E mat
205. mplate Increase the denaturing power of the gel or polymer by using a higher run temperature and or by increasing the concentration of denaturant An additional denaturant such as formamide can be used in slab gels These changes can affect the resolution of the gel or polymer and tend to decrease the read length which makes them less than ideal GC Rich Templates Templates with a GC content greater than 70 can be difficult to sequence when or GC Rich Regions using the standard reaction conditions This is probably related to the higher melting temperature of the DNA caused by the higher proportion of GC base pairs Even a template that has a fairly average base composition overall can have a very GC rich region that affects its ability to be sequenced The most common problem seen with GC rich templates is weak signal Figure 7 41 shows data that was obtained with GC rich DNA using BigDye terminators and the standard cycling conditions The signal strengths of the four bases are G 63 A 34 T 26 and C 64 The increased T noise red is due to the software scaling up the low T signal GCCTGGTGGGCGCGAAGGCGCCGCCGGCGCCCAAGCCCECGCCGCAGCCGGGTCCCCAGCCGCCGCAGCCGCCGCAGCCGCA 90 100 110 120 130 140 150 160 70 a aa n bil t Figure 7 41 GC rich template sequenced using BigDye terminators under standard conditions ali When the denaturation temperature was raised from the standard 96 C to 98 C the signals obtained
206. n continued Step Action 9 Remove the column from the wash tube and insert it into a sample collection tube e g a 1 5 mL microcentrifuge tube 10 Remove the extension reaction mixture from its tube and load it carefully onto the center of the gel material Note Ifthe TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 1 on page 3 37 11 Spin the column in a microcentrifuge at 730 x g for 2 minutes Note If using a centrifuge with a fixed angle rotor place the column in the same orientation as it was in for the first spin This is important because the surface of the gel will be at an angle in the column after the first spin 12 Discard the column The sample is in the sample collection tube 13 Dry the sample in a vacuum centrifuge for 10 15 minutes or until dry Do not over dry 96 Well Plate For large scale procedures you can use the following commercially available 96 well Purification Protocol plates 96 Well Gel Filtration Block Edge Biosystems P N 21520 192 reactions 91751 960 reactions Multiscreen 96 Well Filter Plates Millipore P N MADYEKIT1 Refer to the manufacturer s instructions for the procedures Performing DNA Sequencing Reactions 3 35 Isopropanol Note Precipitation These procedures are for use only with the BigDye terminators Precipitation in 96 Well MicroAmp Trays
207. n A 3 Preparing 19 1 Preliminary gel preparation steps Polyacrylamide Gels A 4 Gel Preparation Step Action 1 Referring to the appropriate list of ingredients above and the 373 DNA Sequencing System User s Manual or ABI PRISM 377 DNA Sequencer User s Manual gather all the necessary lab equipment and ingredients Prepare all stock solutions per the list of ingredients For the ABI PRISM 377 DNA Sequencer clean the gel plates thoroughly and mount them in the gel pouring cassette or alternative device For the ABI 373 DNA Sequencer clean the gel plates thoroughly and prepare them for gel pouring Preparing the acrylamide urea solution Step Action 1 Combine urea 40 acrylamide stock deionized water and mixed bed ion exchange resin in a 150 mL beaker WARNING CHEMICAL HAZARD Urea causes eye skin and respiratory irritation Lab experiments have shown mutagenic effects Avoid contact Wear chemical resistant gloves safety goggles and other protective clothing WARNING CHEMICAL HAZARD Acrylamide and bisacrylamide are neurotoxins Avoid inhalation and skin contact Wear gloves at all times and work in a fume hood when handling acrylamide solutions Use appropriate precautions to avoid inhalation of crystalline acrylamide Read the manufacturer s MSDS before handling Stir the solution until all the urea crystals have dissolved 3 Filter the solution thro
208. n of any kind of dust into the polymer can cause spikes in the data We recommended that you minimize any actions that could introduce particles into the polymer Do not leave the POP 6 polymer exposed to the air by leaving the vial with the lid open Do not clean the syringe and gel block with unfiltered water Do not install a capillary that has been sitting on a bench exposed to dust Genetic Analyzer Genetic Analyzer Buffer is used for electrophoresis It is supplied in 10X concentration Buffer and should be diluted to 1X concentration for use Use 10X Genetic Analyzer Buffer with EDTA P N 402824 with uncoated capillaries If you do not use buffer with EDTA capillary life will be shortened greatly Change the buffer every 2 3 days Note Use 10X Genetic Analyzer Buffer without EDTA with coated capillaries which are used only with DNA Sequencing Polymer TSR The cycle sequencing protocols on the ABI PRISM 310 Genetic Analyzer use a sample preparation reagent called Template Suppression Reagent TSR TSR is used to prevent high molecular weight species from being injected into and clogging the capillary Store TSR at 2 6 C At room temperature samples in TSR are stable for a maximum of 48 hours Although not recommended on a routine basis you can keep samples prepared in TSR frozen for several weeks before running on the ABI PRISM 310 Genetic Analyzer with no detectable loss in resolution or base calling 5 2
209. nator Cycle Sequencing Ready Reaction Kit Protocol 4303237 ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit Protocol 403057 ABI PRISM BigDye Primer Cycle Sequencing Ready Reaction Kit Protocol 402078 ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit Protocol 402116 ABI PRISM Dye Terminator Cycle Sequencing Core Kit Protocol 402113 ABI PRISM Dye Primer Cycle Sequencing Ready Reaction Kit Protocol 402114 ABI Prism Dye Primer Cycle Sequencing Core Kit Protocol 402920 Primer Island Transposition Kit Protocol ABI PRISM 310 Genetic Analyzer Kit 48 Tube Sample Tray Kit Includes 48 Tube Sample Trays 2 0 5 mL Tube Septa 500 0 5 mL Sample Tubes 500 Individual Part Numbers One 48 Tube Sample Tray P N 005572 0 5 mL Tube Septa P N 401956 0 5 mL Sample Tubes P N 401957 Autosampler Tray Kits P N 402867 402868 96 Tube Sample Tray Kit Includes 96 Tube Septa Clips 4 0 2 mL Tube Septa Strips 24 strips 480 septa 0 2 mL Sample Tubes 1000 MicroAmp Tray and Retainer 10 sets MicroAmp Base 10 Individual Part Numbers Septa Clips P N 402866 0 2 mL Tube Septa Strips P N 402059 0 2 mL MicroAmp Tubes 8 strip P N N801 0580 MicroAmp Tray and Retainer P N 403081 MicroAmp Base P N N801 0531 96 Well Tray Adapter P N 4305051 Polymers and Polymers and Consumables for the ABI PRISM 310 Genetic Analyzer Consumables
210. nators on page 3 34 Figure 7 35 on page 7 28 shows the effect of ethanol concentration on the precipitation of BigDye terminator sequencing reactions A 60 concentration removes most of the unincorporated dye terminators without decreasing signal strength Similar results are obtained with isopropanol Use an appropriate precipitation method for your sequencing chemistry Data Evaluation and Troubleshooting 7 27 70 65 60 55 Figure 7 35 Effect of ethanol concentration on BigDye terminator sequencing reaction precipitation Second or Third Panel T Terminator Peak When removing excess dye terminators from rhodamine dye terminator or BigDye terminator reactions a broad red peak sometimes appears in the second or third panel of analyzed data Figure 7 36 on page 7 29 Often this peak is the result of poor spin column purification procedure To avoid this problem load the sample in the center of the column bed Make sure that the sample does not touch the sides of the column See page 3 34 for more information on spin column purification This peak can also result from poor ethanol precipitation procedures if all of the supernatant is not aspirated after the first centrifugation 7 28 Data Evaluation and Troubleshooting GGETCTTCGCCAGTN ATOT CGOAGGTGG amp TSG CTATGAT NTTTANTATT ANG GG AG GGT 310 220 330 Figure 7 36 The second or third panel T peak in rhodamine dye terminator chemistry with AmpliTaq DNA Polym
211. ncing on Templates that have been prepared as described in this chapter should be suitable for use on the CATALYST 800 Molecular Biology LabStation using LabStation 3 0 protocols Follow the protocols in the Turbo Appendix of the CATALYST 800 Molecular Biology LabStation User s Manual P N 903939 to set up your reactions the CATALYST 800 Dye Terminator Sequencing Options Terminator Sequencing has two options Using a reaction premix containing the sequencing primer or premixing template with primer in the sample tube Combining reaction cocktail lacking primers water and primer from one tube and template from another tube This eliminates the requirement for premixing samples and primers Dye Primer Sequencing Options Predefined temperature profiles are provided for the following Double Stranded Forward Universal Primer Double Stranded Reverse Universal Primer Single Stranded Forward Primer Quick Cycle These are chosen during the pre run dialogue and can be edited to make custom profiles IMPORTANT Load only the reagents that you plan to use Do not store kit reagents on the worksurface Performing DNA Sequencing Reactions 3 31 Cycle Sequencing on Dye Terminator Sequencing Options the ABI PRISM 877 3 32 ITC Predefined temperature profiles are provided for the following on the ABI PRISM 877 Integrated Thermal Cycler Terminator Sequencing uses a reaction premix containing the sequenc
212. ncing problems see DNA Template Quality on page 3 15 Template quality can be affected by Residual salts or organic chemicals carried over from the template preparation Incomplete removal of cellular components such as RNA proteins polysaccharides and contaminating chromosomal DNA The presence of residual RNA or chromosomal DNA in the template preparation will affect the quantitation of the DNA if this is done spectrophotometrically The presence of such contaminants can be determined by analysis of the template preparations on agarose gels see Determining DNA Quality on page 3 16 Degradation of DNA in storage More than one template DNA in the sequencing reaction The appearance of the sequence data will vary depending on the source of the problem Contaminants The presence of various types of contaminants in the template preparation can result in inhibition of the sequencing reaction giving weak signal This may or may not be accompanied by significant noise Figure 7 18 on page 7 17 shows data from a template preparation that gave fairly clean data with BigDye terminator chemistry but with weak signal Although the sequence data is fairly good the background is apparent because of the low signal and the increased scaling of the noise by the software Increasing the amount of template from 0 25 ug to 1 0 ug resulted in only a slight increase in total signal strength from 144 to 189 The template was precip
213. nd carefully remove any remaining traces of supernatant with cotton tipped swabs IMPORTANT Removal of all supernatant is critical PEG and salt inhibit sequencing reactions The PEG phage pellet should be visible at this stage of preparation Performing DNA Sequencing Reactions 3 5 To extract DNA from the phage particles Step Action 1 Resuspend the pellet in 400 uL TE buffer Transfer the suspension to microcentrifuge tubes 2 Extract the suspension twice with Tris saturated phenol a Add 400 uL of Tris saturated phenol b Vortex to mix c Centrifuge the extraction mix for 1 minute in a microcentrifuge to separate the organic and aqueous phases d Remove the upper aqueous phase and transfer it to a fresh microcentrifuge tube IMPORTANT Take care not to disturb the aqueous organic interface which contains lipid and denatured protein that can inhibit the DNA polymerase used for cycle sequencing reactions 3 Extract the aqueous phase twice with chloroform to remove phenol which can affect sequencing data a Add 400 uL of chloroform b Vortex each extraction until all cloudiness disappears c Spin the emulsion 30 seconds in a microcentrifuge to separate the phases d Transfer the upper aqueous phase to a fresh microcentrifuge tube Remove any remaining chloroform by vacuum centrifugation 4 Precipitate the DNA a Add 40 uL of 3 M sodium acetate and 1 mL of 95 ethanol b Invert t
214. nd results in a better T pattern The cycle sequencing protocols are optimized for GeneAmp PCR Instrument Systems thermal cyclers the CATALYST 800 Molecular Biology LabStation and the ABI PRISM 877 Integrated Thermal Cycler For more information refer to the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit Protocol P N 4303237 2 6 ABI PRISM DNA Sequencing Chemistries Instrument Platforms The ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kits are for use with the ABI PRISM 310 Genetic Analyzer and ABI PRISM 377 DNA Sequencer all models These kits can also be used with ABI 373 DNA Sequencers on which the new ABI PRISM BigDye Filter Wheel has been installed Refer to the ABI PRISM BigDye Filter Wheel User Bulletin P N 4304367 for more information IMPORTANT This kit is not designed for use with ABI 373 DNA Sequencers and ABI 373 DNA Sequencers with XL Upgrade that do not have the ABI PRISM BigDye Filter Wheel 1 Includes the ABI PRISM 377 ABI PRISM 377 18 ABI PRISM 377 with XL Upgrade and the ABI PRISM 377 with 96 Lane Upgrade instruments 2 Includes the ABI 373 and ABI 373 with XL Upgrade instruments ABI PRISM DNA Sequencing Chemistries 2 7 Dye Primer Cycle Sequencing Kits Fluorescein Rhodamine Dye Primers Fluorescein Rhodamine Dye Primer Kits The fluorescein rhodamine dye primers See note below have the following dye labels Primer Dye Label A JOE
215. ndez Rachubinski F Eng B Murray W W Blajchman M A and Rachubinski R A 1990 Incorporation of 7 deaza dGTP during the amplification step in the polymerase chain reaction procedure improves subsequent DNA sequencing DNA Seq 1 137 140 Henke W Herdel K Jung K Schnorr D and Loening S A 1997 Betaine improves the PCR amplification of GC rich DNA sequences Nucleic Acids Res 25 3957 3958 Hoefer Inc 1993 Hoefer TKO 100 Mini fluorometer Operator s Manual 20788 Rev C 3 05 93 Innis M A and Gelfand D H 1990 Optimization of PCRs In PCR Protocols A Guide to Methods and Applications ed Innis M A Gelfand D H Sninsky J J and White T J Academic Press San Diego CA pp 3 12 Innis M A 1990 PCR with 7 deaza 2 deoxyguanosine triphosphate In PCR Protocols A Guide to Methods and Applications ed Innis M A Gelfand D H Sninsky J J and White T J Academic Press San Diego CA pp 54 59 References C 1 C 2 References Khan A S Wilcox A S Hopkins J A and Sikela J M 1991 Efficient double stranded sequencing of cDNA clones containing long poly A tails using anchored poly dT primers Nucleic Acids Res 19 1715 Kornberg A and Baker T 1992 DNA Replication 2nd ed W H Freeman and Company New York NY pp 132 133 Landre P A Gelfand D H and Watson R M 1995 The use of cosolvents to enhance amplification by the polymerase chain reaction In PCR Strate
216. next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step 3 44 Performing DNA Sequencing Reactions Shrimp Alkaline To precipitate extension products in microcentrifuge tubes continued Step Action 6 Carefully aspirate the supernatant with a separate pipette tip for each sample and discard Pellets may or may not be visible IMPORTANT The supernatant must be removed completely as unincorporated dye terminators are dissolved in it The more residual supernatant left in the tubes the more unincorporated dye terminators will remain in the samples 7 Visually inspect the sample tubes for residual supernatant If there is any residual supernatant a Place the tubes in the microcentrifuge in the same orientation as in step 5 and spin for 10 seconds b Aspirate the supernatant carefully as in step 6 8 Rinse the pellet with 250 uL of 70 ethanol 9 Vortex briefly 10 Spin for 5 minutes in a microcentrifuge at maximum speed Again carefully aspirate the supernatant and discard 11 Dry the samples in a vacuum centrifuge for 10 15 minutes or to dryness Alternatively place the tubes with the lids open in a heat block or thermal cycler at 90 C for 1 minute Note This procedure is for use only with the rhodamine dye terminator and dRhodamine Phosphatase terminator chemistries It can be used for more efficient removal of uninco
217. ng DP POP6 BD Set M13rev BigDye Primer 1 0 mL POP 6 Seq POP6 DP POP6 BD CE 1 47 cm x green rapid sequencing 1 0 mL Set 21M13 or 50 um Rapid E DP POP6 BD a The BigDye terminator and BigDye primer chemistries are not used with DNA Sequencing Polymer DSP on the ABI PRISM 310 instrument 5 8 Optimizing Capillary Electrophoresis Optimizing Software Settings Introduction In This Chapter This chapter describes the following Topic See page Choosing a Run Module 6 2 Choosing a Dye Set Primer Mobility File 6 3 Choosing the Correct Basecaller 6 6 Creating an Instrument Matrix File 6 7 Setting the Data Analysis Range 6 15 Optimizing Software Settings 6 1 Choosing a Run Module Overview List of Run Modules Arun module file contains all the parameters required for a particular function or application see page 1 12 On the ABI PrRism 310 ABI 373 with XL Upgrade and ABI PrisM 377 instruments choosing a run module automatically chooses the filter set used to collect the data If an incorrect run module is chosen for a particular chemistry the data will be poor with low resolution and miscalled bases Figure 7 62 on page 7 62 If this happens rerun the samples using the correct run module On ABI 373 instruments there are no run modules so the filter set and electrophoresis parameters must be chosen manually For fluorescein rhodamine dye primer and rhodamine dye ter
218. ng kit To create a matrix from a sample file follow the steps below Step Action 1 Before making the matrix verify that lane tracking is accurate Adjust if necessary 2 Duplicate the unanalyzed sample file three times Use the Duplicate command from the File menu in the Finder You will have a total of four copies of the same sample file with the following names Sample name Sample name Copy 1 Sample name Copy 2 Sample name Copy 3 These four sample files can now be used in the same way as the four matrix standard samples The same instructions can be used with these four samples as with the four matrix standard samples Follow the directions in your instrument user s manual for creating an instrument file Wherever the protocol indicates a specific matrix standard to be used follow the table below Matrix Standard Standard File C Sample name A Sample name Copy 1 G Sample name Copy 2 T Sample name Copy 3 6 14 Optimizing Software Settings Setting the Data Analysis Range Overview Three values are important in setting the data analysis range Peak 1 Location Start Point Stop Point Peak 1 Location The Peak 1 Location is the data point that marks the beginning of the first base peak in the data This data point is the reference point for the spacing and mobility corrections performed by the basecalling software Correct identification
219. ngth for each base should be gt 50 Signal limits are lower for these chemistries because of their better signal to noise ratios Basecaller setting Base spacing The base spacing value indicates the speed of electrophoresis The higher the base spacing the slower the run as there are more data points detected per peak For basecalling the software requires values between 8 16 If the base spacing falls outside this range a default value is assigned a red 9 0 in the Sample Manager in Sequencing Analysis version 3 0 and higher and a 12 in Sequencing Analysis 2 1 and lower Refer to the ABI PRISM DNA Sequencing Analysis Software User s Manual for a more detailed discussion of base spacing Analysis Start Point and Peak 1 Location These should be checked against those of other samples to determine whether data analysis started too early or too late 7 8 Data Evaluation and Troubleshooting Run module on the ABI PRISM 310 Genetic Analyzer This is useful for determining whether the correct filter set was used to collect data Note All of the information described above can also be obtained from the top of the electropherogram printout Figure 7 8 shows the annotation view for lane 29 of the gel in Figure 7 1 on page 7 4 Useful items are highlighted Data Collection Run started at Run stopped at Gel Dyeset Primer omb Instrument Name File 2902 5 15F Sample 2 5 15F Comment Lane Number 29
220. nships Color of Color of Unanalyzed Data Color of Raw Data Analyzed Data on Terminator Dye on Electropherogram on Gel Image Electropherograms A dR6G green green green C dTAMRA black yellow blue G dR110 blue blue black T dROX red red red Table 2 4 Rhodamine Dye Terminator and BigDye Terminator Dye Base Relationships Dye Rhodamine Color of Color of Dye BigDye Unanalyzed Data Color of Raw Data Analyzed Data on Terminator Terminator Terminator on Electropherogram on Gel Image Electropherograms A R6G dR6G green green green C ROX dROX red red blue G R110 dR110 blue blue black T TAMRA dTAMRA black yellow red Table 2 5 Fluorescein Rhodamine Dye Primer and BigDye Primer Dye Base Relationships Dye Fluorescein Color of Color of Rhodamine Unanalyzed Data Color of Raw Data Analyzed Data on Base Dye Primer BigDye Primer on Electropherogram on Gel Image gt Electropherograms A JOE dR6G green green green C 5 FAM dR110 blue blue blue G TAMRA dTAMRA black yellow black T ROX dROX red red red a ABI PRISM 310 Genetic Analyzer b ABI 373 and ABI PRISM 377 DNA Sequencers See Table 2 1 on page 2 13 for chemistry instrument compatibilities c All instruments See Table 2 1 on page 2 13 for chemistry instrument compatibilities 2 14 ABI PRISM DNA Sequencing Chemistries Choosing a Sequencing Chemistry Overview Although all of the sequencing chemistries are relatively versatile some are better choices than other
221. nsity combs but only with the original notched front glass plates that were provided with the instrument The new notched front glass plate has a bevel in the loading region that increases the thickness of the gel in this region from 0 2 mm to 0 4 mm In addition the scan region has been increased from 6 inches to 7 5 inches This makes sample loading easier than for a 64 lane gel Refer to the ABI PRISM 377 DNA Sequencer 96 Lane Upgrade User s Manual P N 4305423 for more information Introduction 1 9 Gel Electrophoresis Instruments Table 1 1 PE Applied Biosystems Gel Electrophoresis Instruments Maximum Well to Read Number of Throughput Instrument Length cm Lanes bases hr Detection System Computer ABI 370 24 16 800 PMT 4 filter wheel HP Vectra ABI 373 24 1200 Macintosh ABI 373 Leon Model 6 12 24 34 24 36 1800 PMT 5 filter wheel ABI 373 Stretch Model 6 12 24 34 48 ABI 373 with XL 24 or 24 36 48 64 3200 Power Upgrade 6 12 24 34 or Macintosh ABI 373 with BigDye 6 12 24 34 48 24 36 or 1800 or PMT new5 filter Macintosh or Filter Wheel 24 36 48 64 3200 wheel Power Macintosh ABI PRISM 377 12 36 48 24 36 7200 CCD camera Power ABI PRISM 377 18 18 3600 spectrograph Macintosh ABI PRISM 377 with 24 36 48 64 12 800 XL Upgrade ABI PRISM 377 with 24 36 48 64 19 200 96 Lane Upgrade 96 a Maximum throughput maximum number o
222. ntensities than dye terminator chemistries Labeled primers are available for common priming sites Custom primers can also be labeled Four color dye labeled reactions are loaded onto a single lane or capillary injection See Chapter 2 for information on ABI PRism DNA sequencing kits PE Applied Biosystems DNA Sequencing Instruments ABI 373 The ABI 373 DNA Sequencer is an automated instrument for analyzing fluorescently DNA Sequencer labeled DNA fragments by gel electrophoresis You can use three sizes of gel plates for sequencing applications 24 cm 34 cm and 48 cm well to read lengths see Table 1 1 on page 1 10 The longer the well to read length the better the resolution of the gel Sequencing reaction products labeled with four different fluorescent dyes are loaded into each lane of a 0 3 mm or 0 4 mm vertical slab gel made of polymerized acrylamide or acrylamide derivatives You can run up to 36 lanes simultaneously on a single gel The dye labeled DNA fragments migrate through the acrylamide gel and separate according to size At the lower portion of the gel they pass through a region where a laser beam scans continuously across the gel The laser excites the fluorescent dyes attached to the fragments and they emit light at a specific wavelength for each dye The fluorescence intensity is detected by a photomultiplier tube PMT and recorded as a function of time A moving stage contains the optical equipment filter whe
223. oA H Template 5 on 3 e A y a ag a Q PRODUCTS 7 Denaturation A 3 95 96 C mmm A C Original z Ace Template i pa o ACCGAGTAIT Figure 1 3 Cycle sequencing gt gt gt Protocols are robust and easy to perform Cycle sequencing requires much less template DNA than single temperature extension methods Cycle sequencing is more convenient than traditional single temperature labeling methods that require a chemical denaturation step for double stranded templates High temperatures reduce secondary structure allowing for more complete extension High temperatures reduce secondary primer to template annealing The same protocol is used for double and single stranded DNA The protocols work well for direct sequencing of PCR products see page 3 14 Difficult templates such as bacterial artificial chromosomes BACs can be sequenced ABI PRISM Sequencing Chemistries AmpliTag DNA Polymerase FS Dye Labeled Terminators AmpliTaq DNA Polymerase FS is the sequencing enzyme used in ABI PRISM cycle sequencing kits It is a mutant form of Thermus aquaticus Taq DNA polymerase and contains a point mutation in the active site replacing phenylalanine with tyrosine at residue 667 F667Y This mutation results in less discrimination against dideoxynucleotides and leads to a much more even peak intensity pattern Tabor and Richardson 1995 AmpliTaq DNA Polymerase FS also contains
224. ocol 3 35 dRhodamine ss Terminator Ethanol Sodium Acetate Precipitation 3 41 Ethanol MgCl2 Precipitation 3 43 Shrimp Alkaline Phosphatase Digestion 3 45 BigDye Terminator Spin Column Purification 3 34 96 Well Plate Purification Protocol 3 35 Isopropanol Precipitation 3 36 Ethanol Precipitation for BigDye Terminators 3 38 Ethanol Sodium Acetate Precipitation 3 41 Fluorescein Ethanol Precipitation for Fluorescein Rhodamine 3 46 Rhodamine Dye Primers Dye Primer BigDye Primer Ethanol Precipitation for BigDye Primers 3 47 Express Load Option for BigDye Primers Run on 3 49 36 Lane Gels Performing DNA Sequencing Reactions 3 33 Removing Unincorporated Dye Terminators Spin Column We recommend Centri Sep spin columns from Princeton Separations P N CS 901 Purification IMPORTANT For the BigDye terminators hydrate the column for 2 hours Tips for optimizing spin column purification Use one column for each sample Do not process more columns than you can handle conveniently at one time Load the sample in the center of the column bed Make sure that the sample does not touch the sides of the column and that the pipet tip does not touch the gel surface If samples are not properly loaded peaks from unincorporated dye terminators can result see Figure 7 36 on page 7 29 Spin the column at 325 730 x g for best results Use the following formula to calculate the best speed for your centrifuge g
225. of 75 isopropanol to the tubes and vortex them briefly Place the tubes in the microcentrifuge in the same orientation as in step 5 and spin for 5 minutes at maximum speed 9 Aspirate the supernatants carefully as in step 6 10 Dry the samples in a vacuum centrifuge for 10 15 minutes or to dryness Alternatively place the tubes with the lids open in a heat block or thermal cycler at 90 C for 1 minute Ethanol Note These procedures are for use with BigDye terminators only Precipitation for BigDye Terminators With ethanol precipitation traces of unincorporated terminators may be seen at the beginning of the sequence data up to base 40 but this is usually minimal Some loss in the recovery of the smallest fragments may also be observed IMPORTANT Where 95 ethanol is recommended in precipitation protocols purchase non denatured ethanol at this concentration rather than absolute 100 ethanol Absolute ethanol absorbs water from the atmosphere gradually decreasing its concentration This can lead to inaccurate final concentrations of ethanol which can affect some protocols Precipitation in 96 Well MicroAmp Trays Reagents and equipment required Variable speed table top centrifuge with microtiter plate tray capable of reaching at least 1400 x g Strip caps or adhesive backed aluminum foil tape 3M Scotch Tape 425 3 95 Ethanol ACS reagent grade non denatured Note This procedure does not
226. of Ready Reaction Premix can be run on some templates such as PCR products and plasmids see page 3 22 1 Includes the ABI PRISM 377 ABI PRISM 377 18 ABI PRISM 377 with XL Upgrade and the ABI PRISM 377 with 96 Lane Upgrade instruments 2 Includes the ABI 373 and ABI 373 with XL Upgrade instruments ABI PRISM DNA Sequencing Chemistries 2 5 GTACCCCGCATTTCTAAG TACTACCTGCTGGT TAGATA TGTCTTGT TCTATTTTATT GAS8GA4T TCAGAAGACT TT TAAAAT BGG TATATAGAGGGT G TAAASATGC CTCT CTTAACAG TA GAATGASACTGT GATT 100 110 120 130 TACTGAAGCCACAA C CT CCTGAGAAGGAAAATAA GABA AGT AAAAGAAAACATT RAGGAAGATGT CTTTCTACCTTITGCIAT GIAA TCT TTCTGTTGGTGCCCTACACCACTG ACACCTCCCTGCCA GC T CAC 160 170 180 190 220 230 240 250 260 270 KGAA TCGCA CAG GT TAC TATTGGGAACAA TAGA CAAA GAAAAAAATG A ATTGGTA TTA ASGAS CTGAGATGTA GAGGASAAAGA ACTGCAGTGAAAGTC GGCAATGAATTA TTCAAT TC CT TC TTT POG 300 310 320 330 340 350 360 370 380 390 490 410 420 434 lal TGAC CT TAACG AATGCASAGTGATT TGAA CTAA AAG TAA TTAA CAAGAGA GAGTGTGCCTAGTAAAAC AG ASAGAAT CATATTTGTT TAGGAATCA ATAA CA GCCAGTGA CTGAAGGTCA TAS AGGAAC CATTCAGG 440 450 460 470 480 490 500 510 520 530 549 550 560 570 AAA ACASAG AG CCT TT TGC CASGG CAGTTG TCA TGC TGTATATGTGTGCACS TATG G GGA TTTTAGCTGTGAC CGTGTACTAGGAAGATTTAAT AC ATGAAAATGTCTTCTACAGAAAA TAA AGTGAGGAGAAAAATGA AC 580 590 600 610 620 630 649 650 660 670 680 690 700 710 TRAGH
227. of approximately 50 60 C If you are running these chemistries for the first time use the upper limit of the load amount Table 3 4 through Table 3 6 on page 3 51 Having more signal than you need is better than having an insufficient amount of signal to analyze the data Prepare the loading buffer by combining the following in a 5 1 ratio Deionized formamide see page A 16 for preparation 25 mM EDTA pH 8 0 with 50 mg mL blue dextran P N 402055 WARNING CHEMICAL HAZARD Formamide is a teratogen and is harmful by inhalation skin contact and ingestion Use in a well ventilated area Use chemical resistant gloves and safety glasses when handling Note With ABI 373 instruments you can use 50 mM EDTA with or without blue dextran in place of 25 mM EDTA with blue dextran Do not use 50 mM EDTA on ABI PRISM 377 instruments 3 50 Performing DNA Sequencing Reactions Sample Loading ABI 373 and ABI 373 with XL Upgrade Volumes Table 3 4 Loading Amounts for Different Comb Sizes and Chemistries Chemistry Volume uL 18 well 24 well 36 well 48 well 64 well Rhodamine Resuspend 4 6 4 6 3 4 2 2 Dye Terminator jLoad 1 2 1 2 34 24 34cm 1 2 1 1 5 2 4 48 cm Fluorescein Resuspend 4 6 4 6 3 4 2 2 ue Load 4 6 4 6 3 4 24 34cm 1 2 1 1 5 2 4 48 cm ABI 373 and ABI 373XL with
228. oil The cycle sequencing procedures for dRhodamine terminators start on page 3 27 Performing DNA Sequencing Reactions 3 21 BigDye Terminators The flexibility of the BigDye terminators allows three options for cycle sequencing Reaction Type Template Cycle 1X PCR product plasmid M13 standard PCR product plasmid M13 standard High sensitivity 2X ee o oe o Large DNA templates bacterial genomic DNA modified The cycle sequencing procedures for BigDye terminators start on page 3 27 1X Reactions Step Action 1 For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 8 0 uL Template single stranded DNA 50 100 ng double stranded DNA 200 500 ng PCR product DNA 1 100 ng depending on size see Table 3 1 on page 3 17 Primer 3 2 pmol Deionized water q s Total Volume 20 uL 2 Mix well and spin briefly 3 If using the DNA Thermal Cycler TC1 or DNA Thermal Cycler 480 Overlay the reaction mixture with 40 uL of light mineral oil 3 22 Performing DNA Sequencing Reactions 0 5X Reactions Dilute 5X Sequencing Buffer 400 mM Tris HCI 10 mM MgCl pH 9 0 P N 4305605 600 reactions 4305603 5400 reactions with an equal volume of deionized water to 2 5X for use in this procedure Step Action 1
229. olymer Plugged broken or nonconducting capillary Replace the capillary Poor quality water in buffer solutions Remake buffer with freshly autoclaved distilled deionized water Old defective or incorrectly made buffer or polymer solution Replace buffer or polymer solution Fluctuating current Too little buffer in anodic jar Replenish buffer jar Small bubble in capillary blocking current flow Replenish gel in capillary Small bubble in pump block Remove bubble by repriming the pump block with polymer Broken or cracked capillary Replace the capillary Arcing to conductive surface on the instrument Clean the hotplate and autosampler Ensure that the ambient temperature is between 15 and 30 C and the humidity is below 80 Check for excessive condensation on the instrument Position of electrode is not sufficiently below the buffer surface Replenish buffer Reposition electrode and recalibrate autosampler Current is normal at Loss of anodic buffer capacity beginning of run and then decreases rapidly over the next several Replace the buffer minutes Current too high Decomposition of urea in polymer Add fresh polymer solution to the syringe solution Incorrect buffer formulation most Replace buffer with appropriate 1X running buffer likely too concentrated Arcing to conductive surface on the Clean the hotplate and autosampler instrument
230. on the ABI PRISM 310 Genetic Analyzer Only unincorporated dye terminator peaks are seen 1744 3498 5232 6976 8720 red 229 L 191 s 1 ae 1163_ 787 Figure 7 5 Raw data from a failed reaction Figure 7 6 shows raw data from a successful BigDye terminator reaction on the ABI PRISM 310 Genetic Analyzer 1568 3136 4704 6272 7840 an 521 i 3998 orn 1 sez h E L NEATE O aan 347 Figure 7 6 Raw data from a successful reaction Data Evaluation and Troubleshooting 7 7 Figure 7 7 shows an example of BigDye terminator raw data from an ABI PRISM 377 DNA Sequencer run The data shows signal imbalance The signal is top heavy i e stronger at the beginning of the sequence then tapering off Figure 7 7 Top heavy data Using the Annotation View The annotation view shows data collection and analysis information associated with a sample file The most useful information for evaluating data is the following Dye set primer mobility file Instrument matrix file Signal strength Signal strength indicators are a useful guide for determining whether signal strength is sufficient to obtain good data Signal strengths for each nucleotide should usually be from 100 1000 For fluorescein rhodamine dye primers and rhodamine dye terminators the signal strength for each base should be gt 100 For BigDye primers dRhodamine terminators and BigDye terminators the signal stre
231. onditions urea 18 0g Use standard 48 cm run 50 gel stock solution 4 75 mL modules 10X TBE 5 0 mL Increase run time to am 11 hours deionized water to 50 mL 10 APS 250 uL TEMED 25 uL Preparing Preliminary gel preparation steps PAGE PLUS and Long Ranger Gels for the ABI PRISM 377 Step Action 1 Referring to the appropriate list of ingredients above and your user s manual gather all the necessary equipment and ingredients Prepare all stock solutions per the appropriate list of ingredients above Clean the gel plates thoroughly and mount them in the gel pouring cassette or alternative device To prepare 5 0 Long Ranger and 4 8 and 5 25 PAGE PLUS gels Step Action 1 Weigh out the urea and carefully transfer it to a stoppered graduated cylinder 2 Using a pipette add the appropriate amount of gel stock solution and 10X TBE buffer to the cylinder Adjust the volume to 45 mL by slowly adding deionized water and tapping the cylinder to release air bubbles trapped by the urea Stopper the cylinder and invert to dissolve the urea Allow the solution to warm to room temperature Add deionized water to make the final volume 50 mL Stopper the cylinder and mix the contents thoroughly Filter the solution through a 0 2 um cellulose nitrate filter OJON O A Degas for 2 5 minutes and transfer the solution to a
232. or the Dye Primer Matrix Click Update File A dialog window appears 6 Choose dRhod_BigDye from the ABI folder within the System folder and click Open The Make Matrix dialog box should look like that shown below Note The numbers in the Start at and Points boxes are default values Your numbers may vary Make Matrix 23edROH matrix std Start at 17 dR6G matrix std Start at G 21 dR110 matrix std Start at T 19 dTAMRA matriz std Start at Points dRhod_BigDye Instrument Comment Dye Primer Matrix Taq Terminator Matrix T Terminator Matrix 7 a Click OK The computer makes the matrix When finished a dialog window appears with the message Make matrix successfully completed b Click OK Optimizing Software Settings 6 11 To make the T7 Terminator Matrix Step Action 1 In the Data Utility application choose Make Matrix from the Utilities menu The Make Matrix dialog box appears In the Make Matrix dialog box click the T7 Terminator Matrix button at the lower left Click on the box for each nucleotide base and enter the data file that corresponds to the correct matrix standard as shown in the table below note the order of the matrix standard files T7 Terminator Box Matrix dR6G dTAMRA dROX dR110 AW Pe oO Enter the same numbers for each matrix standard sample in the Start at and Points boxes as were used in the Dye Prime
233. organic chemicals e g phenol chloroform and ethanol Residual detergents Performing DNA Sequencing Reactions 3 15 Host Strain The host strain used for template preparation can impact template quality One host Variability strain may produce better sequencing results for a specific template than another If you plan to use a commercial template preparation kit contact the vendor for information about host strains that work well with that kit A good source of information relating to host strain effects can be found in the QIAGEN Guide to Template Preparation and DNA Sequencing 2nd edition Contact your local QIAGEN office http Awww qiagen com qiagenww html to obtain a copy of this guide Determining DNA The following methods can be used to examine DNA quality Quality 4 Agarose gel electrophoresis Purified DNA should run as a single band on an agarose gel Note Uncut plasmid DNA can run as three bands supercoiled nicked and linear Spectrophotometry The A26 A2g ratio should be 1 7 1 9 Smaller ratios usually indicate contamination by protein or organic chemicals Agarose gels reveal the presence of contaminating DNAs and RNAs but not proteins Spectrophotometry can indicate the presence of protein contamination but not DNA and RNA contamination These methods should be used together to get the most information about your DNA template before sequencing Note RNA contamination up to 1 ug can be tolerated but it
234. otocol 3 35 sequencing PCR templates 3 10 to 3 14 dye primer chemistries 3 33 procedures 3 46 to 3 49 dye terminator troubleshooting poor quality chemistries 3 33 template 7 16 procedures 3 34 to 3 45 dRhodamine terminators ethanol precipitation chemistry description 2 3 to 2 5 BigDye primers 3 47 cycle sequencing 3 27 to 3 29 BigDye dye spectra 2 12 terminators 3 38 dye base relationships 2 14 to 3 40 preparing sequencing fluorescein rhodamine reactions 3 21 dye primers 3 46 dye peaks excess dye peaks at the ethanol MgCl gt beginning of the precipitation 3 43 to sequence 7 42 3 45 dye primer chemistries ethanol sodium acetate precipitation 3 41 to cycle sequencing 3 29 to 3 30 cycle sequencing kits 2 8 to 2 11 3 42 BigDye primers 2 9 to 2 11 express load for fluorescein rhodamine dye 36 lane 3 49 primers 2 8 to 2 9 isopropanol dye spectra 2 12 precipitation 3 36 to dye base relationships 2 14 3 38 false stops in dye primer methods table of 3 33 shrimp alkaline phosphatase digestion 3 45 spincolumn purification 3 34 to 3 35 gel electrophoresis preparing and loading samples 3 50 to chemistry 7 30 to 7 31 ways to obtain the sequence 7 31 Peak 1 Location for data analysis 6 16 to 6 18 preparing sequencing reactions 3 24 to 3 26 3 52 secondary structure 7 33 loading troubleshooting stop peaks in dye recommendations 3 primer chemistry 7 43 50 dye set primer files loading samples 3 52 preparing loading
235. oughly Cast gel carefully Remove bubble by tapping plates while pouring Well shape not flat Assure that no air bubbles are trapped by casting comb at gel surface Do not push the sharktooth comb too far into the gel Old gel Use gels within 2 6 hours of casting for the ABI PRISM 377 DNA Sequencer Use gels within 18 24 hours of casting for the ABI 373 DNA Sequencer IMPORTANT Do not refrigerate Variation in spacers Use spacers and comb sets that are equal thickness Temperature of room gel solution or glass too warm or cool during polymerization 20 23 C is optimal Visible non homogeneity Schlieren pattern or swirl in gel Excessive TEMED or APS Check reagents Prepare new solutions using fresh reagents Temperature too high Polymerize at 20 23 C Insufficient reagent mixing Mix reagents gently but thoroughly Data Evaluation and Troubleshooting 7 53 Troubleshooting Gel Electrophoresis continued Observation Possible Causes Recommended Actions Polymerization too slow gels should polymerize within 15 20 minutes Excessive dissolved oxygen Keep vacuum filter strength time constant Stir and pour gel gently Filter and pour gel at 20 23 C Not enough TEMED or APS or degraded Check reagents Prepare new solutions using fresh reagents Temperature too low during casting Polymerize at 20 23 C
236. plied Biosystems sequencing chemistries Refer to the Using the ABI 373 BigDye Filter Wheel User Bulletin P N 4304367 for more information The ABI PRISM 377 DNA Sequencer is a medium to high throughput automated instrument for analyzing fluorescently labeled DNA fragments by gel electrophoresis You can use two sizes of gel plates for sequencing applications 36 cm and 48 cm well to read lengths The 48 cm well to read plates are used to obtain longer read lengths Sequencing reaction products labeled with four different fluorescent dyes are loaded into each lane of a 0 2 mm vertical slab gel made of polymerized acrylamide or acrylamide derivatives You can run up to 36 lanes simultaneously on one gel The dye labeled DNA fragments migrate through the acrylamide gel and separate according to size At the lower portion of the gel they pass through a region where a laser beam scans continuously across the gel The laser excites the fluorescent dyes attached to the fragments and they emit light at a specific wavelength for each dye The light is collected in 194 channels during each scan and separated according to wavelength by a spectrograph onto a cooled charge coupled device CCD camera so all four types of fluorescent emissions can be detected with one pass of the laser The data collection software collects the light intensities from the CCD at particular wavelength bands virtual filters and stores them on a Power Macintosh computer a
237. ppendix E for universal primer sequences This allows any PCR product to be sequenced with universal primers Universal tailed PCR primers enable the use of commercially available dye labeled sequencing primers This technique is also useful with dye terminator chemistries because universal sequencing primers have good annealing characteristics However the longer PCR primers add to the overall cost of the reactions Using universal tailed primers sometimes results in primer oligomerization As these products have priming sites present they can result in noisy data for the first 20 100 bases see page 7 24 Redesigning the PCR primer optimizing the PCR amplification further and employing Hot Start methods can help overcome this situation Excess Primers and dNTPs After PCR amplification the resulting PCR product is in solution along with PCR primers dNTPs enzyme and buffer components The method used to prepare the PCR product for sequencing depends on the amounts of these components that are carried over and on the chemistry used for sequencing Excess PCR primers carried over from the amplification reaction compete with the sequencing primer for binding sites and reagents in the sequencing reaction This carryover of PCR primers presents more of a problem in dye terminator chemistries because the dye label is incorporated into the extension product after the primer anneals to the template If more than one primer is present multiple
238. r Matrix and Taq Terminator Matrix Click Update File A dialog window appears Choose dRhod_BigDye from the ABI folder within the System folder and click Open The Make Matrix dialog box should look like that shown below Note The numbers in the Start at and Points boxes are default values Your numbers may vary Make Matrix 1 7 dR66 matrix std Start at 19 dTAMRA matrix std Start at 6 23 dROHK matrix std Start at T 21 dR110 matrix std Start at dRhod_BigDye Update File Instrument Comment Dye Primer Matrix Taq Terminator Matrix T Terminator Matrix a Click OK The computer makes the matrix When finished a dialog window appears with the message Make matrix successfully completed b Click OK 6 12 Optimizing Software Settings To check the instrument file Step Action 1 From the Utilities menu choose Copy Matrix 2 Under Source select Instrument file and choose dRhod_BigDye from the ABI folder within the System folder The three matrix files within the dRhod_BigDye instrument file appear as shown below Copy Matrix Instrument Comment Destination No Destination File Instrument I Comment EJ Copy Primer Matrix EJ Copy Taq Term Matrix 1 000 0 12 0 011 0 000 1 000 0 12 0 011 0 000 0 455 1 000 0 183 0 000 0 455 1 000 0 183 0 000 0 248 0 483 1 000 0 151 0 248 0 483 1
239. r light is scattered back to the detector causing the gel image to appear blue and green and obscuring data On the ABI PRISM 377 DNA Sequencer there is a filter to keep out most of the scattered laser light Data quality still suffers because the scattering results in less excitation of the dyes by the laser Always use high quality gel plates Figure 7 58 Effect of warped gel plates on ABI 373 sequencing data 7 52 Data Evaluation and Troubleshooting Troubleshooting Gel Electrophoresis Observation Possible Causes Recommended Actions Gel runs too quickly Total polymer concentration too low Bisacrylamide concentration too low Buffer concentration too high Check reagents Prepare new solutions using fresh reagents Note Do not use TBE buffer if it has precipitate in it Gel runs too slowly Total polymer concentration too high Bisacrylamide concentration too high Buffer concentration too low Check reagents Prepare new solutions using fresh reagents Old gel Use gels within 2 6 hours of casting for the ABI PRISM 377 DNA Sequencer Use gels within 18 24 hours of casting for the ABI 373 DNA Sequencer IMPORTANT Do not refrigerate Poor resolution caused by gel Poor quality reagents especially acrylamide see Figure 7 50 on page 7 44 APS and TEMED Use fresh reagents from a reliable source Small bubble between load and read region Clean plates thor
240. r mobility file The C G and T bases are called incorrectly and the As overlap with the following peaks Figure 7 64 on page 7 63 shows the same sample file reanalyzed with the correct mobility file TTTCCCC NTTIGTGAWAGTC T TGCT ACC TAGCT AC TGGC ACG AGGTG AGA 40 50 60 70 60 Figure 7 63 BigDye terminator data analyzed with a BigDye primer dye set primer mobility file 7 62 Data Evaluation and Troubleshooting Note Mobility shifts and dye set primer file names for the dRhodamine Terminators are similar to those for the BigDye Terminators If a mobility file for the wrong sequencing chemistry is used C and T bases will be miscalled because of differences in which terminators are labeled with which dyes see page 2 14 CCEGGGGATECTCTAGAGTECGACCTGCAGGCATGCUAAGETIGAGTATTCTA 40 50 60 70 60 Incorrect or Poor Quality Instrument Matrix File Figure 7 64 BigDye terminator data analyzed with the correct dye set primer file If you use the wrong instrument file but the correct run module the data can be reanalyzed with the correct instrument file Figure 7 65 shows BigDye terminator data collected on an ABI PRISM 377 DNA Sequencer with specific peaks under peaks throughout the run For example every black peak has a smaller red peak underneath it An incorrect instrument file one for Filter Set A instead of Filter Set E was used to analyze the data If your data looks like this you should check that the correct run
241. rative sequencing N R germline mutations 50 50 heterozygotes Comparative sequencing N R somatic mutations 30 70 heterozygotes Comparative sequencing N S somatic mutations 10 90 heterozygotes Gene walking custom primers R N Shotgun sequencing universal primers M13 R R Deletion clone sequencing universal primers R R Gap closure custom primers R N DNA Sequence Context GC rich gt 65 R S AT rich gt 65 R R GT rich regions S R Homopolymer A or T gt 25 bp S R Template Plasmid lt 15 kb R R M13 R R BAC cosmid lambda large PCR product S S Bacterial genomic DNA N N PCR amplicon R R PCR amplicon heterozygous 50 50 N R PCR amplicon heterozygous 30 70 N R PCR amplicon heterozygous 10 90 N R a R recommended S satisfactory N not recommended b All cycle sequencing chemistries can have difficulties with homopolymers gt 40 bp 2 16 ABI PRISM DNA Sequencing Chemistries Performing DNA Sequencing Reactions Overview Factors That Affect With careful template preparation and sequencing techniques you can obtain reliable Data Quality sequence data for both dye primer and dye terminator chemistries This section describes the factors affecting data quality how they can be controlled during sample preparation and the sequencing reactions and how some fundamental errors can be avoided and corrected Topic See page DNA Template Preparation 3 2 Sequencing
242. re the result of poor template quality or sequencing reaction failure We recommend M13mp18 as a single stranded control and pGEM 3Zf as a double stranded control All PE Applied Biosystems DNA sequencing kits provide pGEM control DNA All dye terminator cycle sequencing kits include a 21 M13 control primer Sequencing Standards The Cycle Sequencing Standards provide an additional control to help in troubleshooting electrophoresis runs These standards contain lyophilized sequencing reactions that only require resuspension and denaturation before use There are four standards available Dye Primer Cycle Sequencing Standard P N 401920 Dye Terminator Cycle Sequencing Standard P N 402830 dRhodamine Terminator Cycle Sequencing Standard P N 4303120 BigDye Terminator Cycle Sequencing Standard P N 4304154 Poor template quality is the most common cause of sequencing problems Always follow recommended procedures to prepare templates see DNA Template Preparation on page 3 2 The following are characteristics of poor quality templates Noisy data or peaks under peaks see page 7 11 No usable sequence data see Figure 7 9 on page 7 10 Weak signal see Figure 7 10 on page 7 11 Potential contaminants include Proteins RNA Chromosomal DNA Excess PCR primers dNTPs enzyme and buffer components from a PCR amplification used to generate the sequencing template Residual salts Residual
243. red T peak at base 130 resulted in all other red peaks appearing very small Figure 7 68 Incorrect Peak 1 Location and Start Point both set to 963 scans In this case the Start Point can be set after the terminator peaks and the data reanalyzed When this was done the T peaks were scaled normally Figure 7 69 eTeTGc TacaaTacaatTacc Gaga atc CNNNNTGS 447 TAGGGGGC C CATCTTAAAGTTGGAaC Cac C TACAGCE TaGCC TAACAS AGGGAATAAC CAC AG A ACI 20 70 Figure 7 69 Better Peak 1 Location 1260 scans and Start Point 2020 scans In this example the Start Point value is greater than the Peak 1 Location value The Peak 1 Location value should still be set to the beginning of the sequence This ensures that the mobility corrections and spacing are applied properly Data Evaluation and Troubleshooting 7 65 Gel Preparation Introduction Gel Formulations There are several choices of sequencing gel formulations for 34 and 36 cm well to read wtr lengths The 29 1 polyacrylamide Long Ranger and PAGE PLUS gels perform similarly on both the ABI 373 and ABI PRISM 377 instruments These gels generally perform better than 19 1 polyacrylamide gels For 48 cm gels the 5 25 PAGE PLUS gels generally provide the longest read lengths For 2400 scan hr runs on the ABI PRISM 377 DNA Sequencer the best gel to use is the 4 5 29 1 polyacrylamide This type of gel performs the best under these extreme run conditions
244. red 95 ethanol rather than absolute 100 ethanol Acetate Precipitation Absolute ethanol absorbs water from the atmosphere gradually decreasing its concentration This can lead to inaccurate final concentrations of ethanol which can affect some protocols Precipitation in 96 Well MicroAmp Trays Reagents and equipment required Variable speed table top centrifuge with microtiter plate tray capable of reaching at least 1400 x g Strip caps or adhesive backed aluminum foil tape 3M Scotch Tape 425 3 Sodium acetate NaOAc 3 M pH 4 6 P N 400320 95 Ethanol ACS reagent grade non denatured To precipitate extension products in MicroAmp Trays Step Action 1 Remove the MicroAmp Tray from the thermal cycler Remove the caps from each tube Add the following 2 0 uL of 3M sodium acetate NaOAc pH 4 6 50 uL of 95 ethanol EtOH The final ethanol concentration should be 65 Seal the tubes with strip caps or by applying a piece of 3M Scotch Tape 425 3 adhesive backed aluminum foil tape Press the foil onto the tubes to prevent any leakage Invert the tray a few times to mix Leave the tray at room temperature for 15 minutes to precipitate the extension products Note Precipitation times lt 15 minutes will result in the loss of very short extension products Precipitation times gt 24 hours will increase the precipitation of unincorporated dye terminators Place the tray in a tab
245. remain on the plates for 5 minutes CAUTION Longer times can harm the plates Rinse the plates thoroughly with distilled deionized water Allow plates to dry Note Avoid other cleaning procedures or solutions that may reintroduce contaminants to the plates An alcoholic KOH wash can also be used to remove buffer chamber gasket marks from the plates Step Action 1 Perform steps 1 5 above 2 Pour approximately 15 mL of the cleaning solution onto the area of the plate where the gasket mark is Allow the solution to remain on the plates for 10 minutes CAUTION Longer times can harm the plates Repeat steps 2 and 3 Rinse thoroughly with deionized water Clean plates as usual To perform a 3 M HCI wash Step Action 1 Place some uncolored absorbent towels or other covering in the hood to catch spills Pour 10 mL of concentrated HCI 12 N 37 carefully into 30 mL of water and mix thoroughly WARNING Hydrochloric acid HCI is a very corrosive liquid Always work in a fume hood to avoid inhalation Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves 4 8 Optimizing Gel Electrophoresis Gel Extrusion Temporary Loss of Signal To perform a 3 M HCI wash continued Step Action 3 Place the plates on the towels with the inside surfaces facing up Note The pl
246. reparation A 15 Deionized IMPORTANT Always use deionized formamide to prepare loading buffers Over time Formamide formamide hydrolyzes to formic acid and formate Deionized formamide stock lasts for 3 months at 15 to 25 C Step Action 1 Mix 50 mL of formamide and 5 g of AG501 X8 ion exchange resin WARNING CHEMICAL HAZARD Formamide is a teratogen and is harmful by inhalation skin contact and ingestion Use in a well ventilated area Use chemical resistant gloves and safety glasses when handling Stir for 30 minutes at room temperature Check that the pH is greater than 7 0 using pH paper If the pH is not greater than 7 0 decant the formamide into a beaker containing another 5 g of ion exchange resin and repeat 30 minute stirring at room temperature 4 When the pH is greater than 7 0 allow the beads to settle to the bottom of the beaker Remove the supernatant formamide taking care not to disturb the beads 5 Dispense the deionized formamide into aliquots of 500 uL and store for up to 3 months at 15 to 25 C 6 Use one aliquot per set of samples Discard any unused deionized formamide A 16 Gel Preparation IUB Codes IUB Codes Complements A adenosine S G or C Strong 3 H bonds A T U R Y C cytidine W A or T Weak 2 H bonds C G Y R G guanosine Y C or T pYrimidine G C K M T thymidine B C G orT T A M K U uracil D
247. repared and or old buffer or polymer solutions Replace buffer and polymer with fresh solutions Injection time too long broad peaks Decrease injection time Incorrectly prepared and or degraded sample Prepare new sample Incorrect buffer formulation Check if buffer formulation matches protocol requirements Incorrect polymer composition Check if polymer composition matches protocol requirements Electrophoresis voltage too high Decrease electrophoresis voltage by as much as 4 kV Note Increase electrophoresis time accordingly Sample concentrated by evaporation leaving excess salt behind Do not concentrate sample by evaporation Use an Amicon Centricon 100 column if necessary Incomplete strand separation due to insufficient heat denaturation Make sure the samples are heated at 95 C for 2 minutes prior to loading onto autosampler Wrong capillary Verify that you are using the correct capillary see Table 5 2 on page 5 8 Oil in sample from DNA Thermal Cycler 480 Carefully pipette sequencing reactions without oil carryover Remove oil by organic extraction Poor quality water Use freshly autoclaved distilled deionized water Syringe empty or incorrect Syringe Max Travel value Fill syringe if necessary and recalibrate Syringe Max Travel value Data Evaluation and Troubleshooting 7 61 Troubleshooting Software Settings Overview
248. rix file See your instrument user s manual for instructions on creating a new instrument file or follow the instructions on page 6 8 for creating an instrument file for Filter Set E dRhodamine based chemistries Incorrect Peak 1 During analysis the software assigns the Peak 1 Location and the Start Point to the Location same scan number Occasionally the value assigned is incorrect This happens more commonly with dye terminator chemistries than with dye primer chemistries Correct assignment of the Peak 1 Location value is important for mobility corrections to be applied properly With dye primer chemistries the large primer peak helps the software to assign the Peak 1 Location and Start Point values With dye terminator chemistries there is no primer peak so the software must detect the small sequence data peaks If these sequence peaks are obscured by peaks from unincorporated dye terminators and or other fluorescent peaks are present before the start of the real sequence the software can assign the Peak 1 location and Start Point too early Figure 7 68 on 7 64 Data Evaluation and Troubleshooting page 7 65 If the sequence data is weak the Peak 1 location and Start Point can be assigned too late See Setting the Data Analysis Range on page 6 15 for the procedures to change the Peak 1 Location and Start Point Large peaks can also cause problems in scaling the analyzed data For example in Figure 7 68 a very large
249. rming DNA Sequencing Reactions To purify PCR fragments by ultrafiltration continued Step Action 5 Remove the waste receptacle and attach the collection vial 6 Invert the column and spin it at 270 x g for 2 minutes to collect the sample This should yield approximately 40 60 uL of sample 7 Add deionized water to bring the purified PCR fragments to the original volume QlAquick PCR Purification Kits QIAGEN P N 28104 50 reactions 28106 250 reactions These kits work well for PCR products ranging from 100 bp 10 kbp QlAquick Gel Extraction Kits QIAGEN P N 28704 50 reactions 28706 250 reactions These kits are used to purify PCR fragments from agarose gels The kits work well for DNA ranging from 70 bp 10 kbp Fragments larger than this should be extracted with the QIAEX II Gel Extraction Kits QIAGEN P N 20021 150 reactions 20051 500 reactions Refer to the manufacturer s instructions for the procedures The recommended DNA quantities for sequencing reactions are shown in Table 3 1 on page 3 17 Shrimp Alkaline Phosphatase and Exonuclease I Treatment An alternative to one of the more stringent purification methods listed above is treatment of PCR products with shrimp alkaline phosphatase SAP and exonuclease Exo I before sequencing The SAP Exo procedure degrades nucleotides and single stranded DNA primers remaining after PCR Werle et al 1994 This procedure
250. rporated dye terminators but adds additional time and expense Digestion Step Action 1 At the end of thermal cycling add 2 uL of SAP 1 U uL and 18 uL of 1X SAP buffer to each tube Seal each tube and incubate at 37 C for 30 minutes 2 For precipitation in 96 Well MicroAmp Trays a Add 150 uL of 70 EtOH 0 5 mM MgCl to each tube Alternatively add 40 uL of 2 mM MgCl and then 110 uL of 95 ethanol b Proceed to step 3 of Precipitation in 96 Well MicroAmp Trays on page 3 43 For precipitation in microcentrifuge tubes a Transfer the contents of each tube to a 1 5 mL microcentrifuge tube b Add 150 uL of 70 EtOH 0 5 mM MgCl to each tube Alternatively add 40 uL of 2 mM MgCl and then 110 uL of 95 ethanol c Proceed to step 3 of Precipitation in Microcentrifuge Tubes on page 3 44 Performing DNA Sequencing Reactions 3 45 Preparing Dye Primer Reaction Products for Electrophoresis Ethanol Reagents and equipment required for these methods Precipitation for 4 Fluorescein Rhodamine Dye Primers 1 5 mL microcentrifuge tubes Benchtop microcentrifuge capable of reaching at least 14000 x g Vacuum centrifuge 95 Ethanol ACS reagent grade non denatured Note These procedures do not use salt IMPORTANT Use non denatured 95 ethanol rather than absolute 100 ethanol Absolute ethanol absorbs water from the atmosphere gradually decreasing
251. rsion 2 1 Step Action 1 Launch the Sequencing Analysis software if it is not already open 2 In the Sample File Queue display double click the first file to be analyzed to view the raw data Zoom in completely From the Window menu choose Actual Size or use the keys on the keyboard 3 Starting at the beginning of the raw data file scroll along the data by clicking and holding the right direction arrow at the bottom of the window Continue scrolling until the fist data peak is approximately in the center of the window 4 a Click and drag in the window to change the cursor to a cross hair b Move the cursor along the data until the vertical dotted line is aligned at the left edge of the first data peak Figure 6 2 c Read the scan number data point that is reported at the top of the dialog box 960 in the example shown in Figure 6 2 Use this number as the Primer Peak Location of the file Optimizing Software Settings 6 19 Using Sequencing Analysis Version 2 1 continued Step Action 5 Return to the Sample File Queue display a Highlight the name of the file just inspected and click the Custom Settings window b Select the Change Primer Peak check box The Use Start Point and Change Primer Peak radio buttons become active The Use Start Point radio button is selected by default since the Primer Peak Location and the Start Point are the same in most cases c
252. s digital signals for processing The Sequencing Analysis software see page 1 16 interprets the result calling the bases from the fluorescence intensity at each data point Refer to the ABI PRISM 377 DNA Sequencer User s Manual P N 903433 for more information 377 18 The ABI PRISM 377 18 DNA Sequencer is a lower cost lower throughput version of the ABI PRISM 377 DNA Sequencer It can run up to 18 lanes on a single gel XL Upgrade The ABI PRISM 377 DNA Sequencer with XL Upgrade increases the number of samples that can be analyzed simultaneously This increased throughput is made possible by reengineering the instrument to collect data from 388 channels instead of 194 during each scan The XL Upgrade also includes new combs For sequencing applications 48 well and 64 well shark s tooth combs are available You can still use 36 well or other lower lane density combs if desired Refer to the ABI PRISM 377 DNA Sequencer XL Upgrade User s Manual P N 904412 for more information 96 Lane Upgrade The ABI PRISM 377 DNA Sequencer with 96 Lane Upgrade increases the number of samples that can be run on each gel The increased throughput is made possible by reengineering the instrument to collect data from 480 channels instead of 388 for the ABI PRISM 377 DNA Sequencer with XL Upgrade or 194 for the ABI PRISM 377 DNA Sequencer The 96 lane upgrade includes new combs and new notched front glass plates You can still use lower lane de
253. s make sure that the plates are clamped correctly and that the upper buffer chamber gasket makes a proper seal Do not spill buffer behind the upper buffer chamber as wicking can occur Figure 7 53 Buffer leak in the read region of the plates Buffer leaks or evaporation also can cause electrophoresis failure if there is not enough buffer for electrophoresis Note that electrophoresis fails at the same point in each sample Figure 7 54 on page 7 48 causing diffuse bands to appear throughout the rest of the run Data Evaluation and Troubleshooting 7 47 Figure 7 54 Electrophoresis failure caused by a buffer leak To prevent this from happening Clean the front plate well so the gasket will make a good seal Use the lid on the upper buffer chamber Take care when filling the upper buffer chamber not to spill buffer behind it Do not fill the upper buffer chamber to the top because buffer will wick over the ears of the notched plate and run down the sides or back of the gel plates Check gasket for leaks before starting the run 7 48 Data Evaluation and Troubleshooting Red Rain Gel destruction in the read region of the gel can cause red streaks in the data often near the end of the run and therefore near the top of the gel image This effect shown in Figure 7 55 is known as red rain Gel destruction often results from drying out of the gel and is exacerbated by extreme run conditions e g high volt
254. s for specific types of templates No single chemistry works with every template While you can choose a single kit for most work a second chemistry or modifications to the standard protocol of the main sequencing chemistry may be necessary See Troubleshooting DNA Sequence Composition Problems on page 7 30 for more information ABI PRISM 310 We generally recommend the BigDye terminators because of their optimal ABI 373 with BigDye signal to noise characteristics ease of use and versatility Table 2 6 shows the Filter Wheel and chemistry recommendations for various applications ABI PRISM 377 Table 2 6 ABI PRISM 310 ABI 373 with BigDye Filter Wheel and ABI PRISM 377 Chemistry Recommendations dRhodamine BigDye BigDye Terminator Terminator Primer DNA Sequencing Application De novo sequencing high throughput S Ra R De novo sequencing mid to low throughput S R S Comparative sequencing S R R germline mutations 50 50 heterozygotes Comparative sequencing N S R somatic mutations 30 70 heterozygotes Comparative sequencing N N S somatic mutations 10 90 heterozygotes Gene walking custom primers S R N Shotgun sequencing universal primers M13 S R R Deletion clone sequencing universal primers S R R Gap closure custom primers S R N DNA Sequence Context GC rich gt 65 S R S AT rich gt 65 R R R GT rich regions R N R Homopolymer A or T gt 25 bp R
255. s shadowed by a smaller G underneath the A at base 62 see arrow No additional peak is seen at position 61 because the extension products from both the full length primer and the N 1 primer have an A at this position N 1 sequence can be detected in a sequencing reaction if the N 1 primer is present at the level of 5 10 of the correct primer concentration However somewhat higher levels can be tolerated depending on the particular chemistry used In the sequence data shown in Figure 7 28 the contamination by N 1 primer is 40 This results in ambiguities Ns in the basecalling In a high quality synthesis the N 1 contamination should be slight The concentration of N 1 sequence in the primer can be further reduced by HPLC purification Figure 7 28 pGEM control DNA sequenced with BigDye terminator chemistry and 21 M13 primer contaminated by 40 N 1 primer The presence of more than one primer in a sequencing reaction can be a problem when sequencing PCR products Since two primers are present in the PCR reaction failure to completely remove the unincorporated primers from the PCR product will result in the carryover of some of these primers into the sequencing reaction When using dye primer chemistries fragments that extend from these residual PCR primers will be unlabeled If the concentration of these fragments is not too high there should not be a significant impact on the reaction With dye terminator chemistr
256. s voltage is 4 6 A The time required for a 600 base fragment to reach the detector window is about 120 minutes with these run conditions For sequencing samples using POP 6 and rapid sequencing the standard run voltage is 320 volts cm For a 47 cm capillary this translates to 15 kV The current at this voltage is 5 8 pA The time required for a 400 base fragment to reach the detector window is about 35 minutes with these run conditions Changing Run Time You can change the data collection time for special requirements For example you can shorten the data collection time if you only need information about short extension products e g in PCR sequencing Protocols for sequencing applications with POP 6 specify a 50 C electrophoresis temperature For templates that do not denature readily the run temperature can be increased by 1 2 C however there is a tradeoff between run temperature and resolution The laboratory temperature should be maintained between 15 and 30 C It should not fluctuate more than 6 C during a run for optimal results The ABI PRISM 310 Genetic Analyzer can tolerate up to 80 non condensing relative humidity Avoid placing the instrument near heaters cooling ducts or windows For information on setting electrophoresis parameters refer to the ABI PRISM 310 Genetic Analyzer User s Manual Optimizing Capillary Electrophoresis 5 7 Run Parameters for Specific Sequencing Chemistries Table 5 2 R
257. sfer the filtrate to a graduated cylinder and bring the total volume to 150 mL with distilled deionized water Store at 2 6 C Note 40 acrylamide stock lasts for 1 month at 2 6 C Ingredients and Run For 36 cm WTR Runs 4 5 29 1 Polyacrylamide Gel 6 M Urea Conditions for the This is the best formulation to use for 2400 scans hr runs ABI PRISM 377 Ingredient For 50 mL Run Conditions urea 18 0g For 1200 scans hr runs 40 acrylamide stock 5 63 mL Use standard 36 cm deionized water 25 mL 1200 scans hr run 7 modules Mixed bed ion 0 5g exchange resin Increase run time to f F 9 hours Filter and degas the above ingredients before adding TBE For 2400 scans hr runs 10X TBE 5 0 mL Use standard 36 cm 10 APS 250 uL 2400 scans hr run modules TEMED 30 uL Bring to final volume 50 mL with deionized water Increase run time to 4 hours A 6 Gel Preparation For 48 cm WTR Runs 4 25 29 1 Polyacrylamide Gel 6 M Urea Ingredient For50mL Run Conditions urea 18 0g Use standard 48 cm run 40 acrylamide stock 5 31 mL modules deionized water 25 mL Increase run time to A 11 hours Mixed bed ion 0 5g exchange resin Filter and degas the above ingredients before adding TBE 10X TBE 5 0 mL 10 APS 250 uL TEMED 30 uL Bring to final volume 50 mL with deionized water Ingredients an
258. sible then spin the tubes for 2 minutes more immediately before performing the next step 7 Without disturbing the precipitates remove the adhesive tape and discard the supernatant by inverting the tray onto a paper towel folded to the size of the tray 8 Place the inverted tray with the towel into the table top centrifuge and spin at 700 x g for 1 minute 9 Remove the tray and discard the paper towel Note Pellets may or may not be visible Vacuum drying of the samples is not necessary Precipitation in Microcentrifuge Tubes Reagents and equipment required for this method 1 5 mL microcentrifuge tubes Benchtop microcentrifuge capable of reaching at least 14000 x g Vacuum centrifuge 95 Ethanol ACS reagent grade non denatured Note This procedure does not use salt To precipitate extension products in microcentrifuge tubes Step Action 1 Pipet the entire contents of each extension reaction into a 1 5 mL microcentrifuge tube Note Ifthe TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 1 on page 3 37 2 Add the following 16 uL of deionized water 64 uL of non denatured 95 ethanol The final ethanol concentration should be 60 3 Performing DNA Sequencing Reactions 3 39 To precipitate extension products in microcentrifuge tubes continued Step Action 3 Close the tubes and vortex
259. standards E 3 reagent kit protocols E 4 user s manuals and software E 10 PCR sequencing setting Stop Point 6 21 to 6 23 Performance Optimized Polymer 6 POP 6 description of 5 2 plasmid DNA templates preparing 3 6 to 3 8 polyacrylamide gels 19 1 protocol and run conditions A 2 to A 5 for the ABI 373 A 3 for the ABI PRISM 377 A 2 preparing 40 acrylamide stock A 2 29 1 protocol and run conditions A 6 to A 9 for the ABI 373 A 7 to A 8 for the ABI PRISM 377 A 6 to A 7 preparing 40 acrylamide stock A 6 theory of 4 1 polymers capillary electrophoresis 5 2 poor mobility correction sequencing data 7 41 POP 6 description of 5 2 primer design effect on sequencing data 3 18 to 3 19 pull up peaks troubleshooting sequencing data 7 43 sequencing reactions 7 22 to 7 23 Q quantitation converting Azgo to concentration 3 17 R reagents gel electrophoresis 4 2 to 4 3 handling and storage 3 20 kit protocols part numbers E 4 red rain streaks avoiding problems with gel 4 5 gel electrophoresis troubleshooting 7 49 references literature C 1 to C 3 WWW sites C 3 rhodamine dye terminators See dye terminator chemistries run modules choosing a run module 6 2 introduction to 1 12 to 1 13 run parameters for capillary electrophoresis 5 8 run temperature capillary electrophoresis optimizing 5 7 run time capillary electrophoresis optimizing 5 7 S salt contamination from template preparation 7 25 to 7 26 sample fi
260. storage especially in water acrylamide breaks down into acrylic acid It decomposes more quickly at room temperature WARNING CHEMICAL HAZARD Urea is a potential mutagen Dangers cited in toxicity studies show reproductive and tumorigenic effects Urea can cause irritation to the skin eyes and respiratory tract Avoid inhalation and contact with skin eyes and clothing Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Urea NH2 2CO slowly decomposes in water forming ammonia and cyanate ions that can interfere with electrophoresis Avoid heating solutions containing urea as much as possible Cyanate formation is accelerated with increasing temperature Urea solutions can be pretreated with mixed bed resins to reduce the amount of ions in solution Prepare Tris borate EDTA buffer with Tris base see page A 15 for recipe If Tris HCI is used to prepare buffers the concentration of salt will be too high and nucleic acids will migrate anomalously yielding extremely diffuse bands WARNING CHEMICAL HAZARD Ammonium persulfate APS is harmful if swallowed inhaled or absorbed through the skin It is extremely destructive to mucous membranes eyes and skin Inhalation can be fatal Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves APS is very hygroscopic and r
261. t all known cases of gel extrusion have been resolved by alcoholic KOH washing see page 4 7 or acid washing see page 4 8 This problem manifests itself as a band of little or no signal across the entire width of the gel image It usually occurs between 150 and 250 bases see Figure 7 57 on page 7 51 Temporary loss of signal has been traced to contaminants on the gel plates These contaminants include surfactants fatty acids and long chain polymers Rinsing glass plates in a dishwasher with hot deionized water 90 C has been found in most cases to remove the contaminants that cause temporary loss of signal see page 4 6 In a few cases where a dishwasher did not work well soaking the plates overnight ina 5 solution of Multiterge detergent VWR Scientific P N 34171 010 eliminated the temporary loss of signal Optimizing Gel Electrophoresis 4 9 Optimizing Capillary Electrophoresis Introduction In This Chapter Capillary Electrophoresis This chapter describes the following Differences between capillary and gel electrophoresis Capillary electrophoresis consumables Optimizing capillary electrophoresis conditions Refer to page 7 55 for information on troubleshooting capillary electrophoresis The large surface area of a capillary allows heat generated during electrophoresis to be dissipated efficiently allowing high voltage electrophoresis The result is rapid high resolution separation of DNA fragments P
262. t collection regions These appear as the blue green black yellow on gel images and red peaks in the raw data The Sequencing Analysis Software uses the same four colors to color code analyzed data from all dye virtual filter set combinations The display colors represent the relative not the actual detection wavelengths For consistency the software always displays analyzed data with A as green C as blue G as black and T as red in the electropherogram view Table 1 2 shows the wavelengths of the windows in the virtual filter sets used in cycle sequencing applications Table 1 2 Wavelength Ranges of Virtual Filter Sets Virtual Wavelength Range of Filter Set Color Virtual Filter nm A blue 530 541 green 554 564 yellow black 581 591 red 610 620 E blue 535 545 green 565 575 yellow black 590 600 red 620 630 1 Includes the ABI PRISM 377 ABI PRISM 377 18 ABI PRISM 377 with XL Upgrade and the ABI PRISM 377 with 96 Lane Upgrade instruments 2 The ABI PRISM 310 Genetic Analyzer and ABI PRISM 377 DNA Sequencer have a long pass filter to prevent light from the instrument s argon ion laser from interfering with the detection of the dye signals Introduction 1 11 Data Collection and Analysis Settings Overview Run Modules 1 12 Introduction This section is intended to provide an introduction to the data collection and analysis settings which are dealt with in more de
263. t file is created for a specific filter set or virtual filter set when the instrument is installed Whenever a new filter set is used a new instrument file must be created for that filter set Refer to your instrument user s manual or the protocol for the sequencing chemistry you are using for instructions on creating instrument files The appropriate instrument file can be applied to data on subsequent capillary runs or gels on the same instrument as long as the same filter set is used This is because the spectral overlap between the four dyes is very reproducible Multicomponent analysis of sequencing data is performed automatically by the Sequencing Analysis software see below which applies a mathematical matrix calculation using the values in the instrument file to all sample data See page 6 7 for instructions for creating instrument files Introduction 1 15 Sequencing Analysis Software 1 16 Introduction What Is In a Matrix File The matrix files in an instrument file are used for specific types of chemistry and provide information to the Sequencing Analysis software to allow it to correct for spectral overlap Matrix files also contain the following Baselining algorithm for the chemistry being used Information that the Sequencing Analysis software uses to determine Peak 1 Locations and Start Points for data analysis The DNA Sequencing Analysis Software analyzes the raw data collected by the Data Collection so
264. tail in Chapter 6 Many users sequence DNA using more than one chemistry Take care when entering data collection and analysis settings in the software If your data is analyzed with the wrong software settings the resulting electropherograms will show overlapping peaks and gaps between peaks rather than the evenly spaced peaks characteristic of correctly analyzed data ABI 373 with XL Upgrade Arun module file contains all the parameters required for a particular function or application The parameters include the following Electrophoresis power Current and voltage settings Laser settings Scanner settings PMT settings gt gt gt There are three types of run module files Not all of the parameters listed above are in each module file Plate Check This module is for checking the cleanliness and alignment of the gel plates Laser scanning and PMT settings are associated with it Pre Run This module is for prerunning sequencing gels Laser scanning electrophoresis and PMT settings are associated with it Seq Run This module is for running sequencing gels Laser scanning electrophoresis and PMT settings are associated with it IMPORTANT When you select a run module the filter set is chosen automatically You must edit the run module to change the filter set used to collect the data Refer to the 373 DNA Sequencer With XL Upgrade User s Manual P N 904258 for more information Note The AB
265. tant by inverting the tray onto a paper towel folded to the size of the tray Place the inverted tray with the towel into the table top centrifuge and spin at 700 x g for 1 minute Remove the tray and discard the paper towel Note Pellets may or may not be visible Vacuum drying of the samples is not necessary Precipitation in Microcentrifuge Tubes Reagents and equipment required 1 5 mL microcentrifuge tubes Benchtop microcentrifuge capable of reaching at least 14000 x g Vacuum centrifuge To precipitate extension products in microcentrifuge tubes Step Action 1 Pipet the entire contents of each extension reaction into a 1 5 mL microcentrifuge tube Note Ifthe TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 1 on page 3 37 Add 74 uL of 70 EtOH 0 5 mM MgCl to each tube Alternatively add 20 uL of 2 mM MgCl and then 55 uL of 95 ethanol Close the tubes and vortex briefly Leave the tubes at room temperature for 15 minutes to precipitate the extension products Note Precipitation times lt 15 minutes will result in the loss of very short extension products Precipitation times gt 24 hours will increase the precipitation of unincorporated dye terminators Place the tubes in a microcentrifuge and mark their orientations Spin the tubes for 20 minutes at maximum speed IMPORTANT Proceed to the
266. tes With larger DNA targets such as bacterial artificial chromosomes BACs the quality of DNA template is important to the success of the sequencing reaction Two methods have given good sequencing results Alkaline lysis with extra phenol extraction and isopropanol precipitation if very clean DNA is desired Marra et al 1996 Cesium chloride CsCl banding Commercial kits are also available for BAC DNA preparation ProPrep BAC LigoChem http www ligochem com Individual reactions P N PLK 100 100 reactions PLK 1000 1000 reactions 96 well plates P N PLF 1000 1 plate PLF 1000 10 plates PLF 2500 25 plates QIAGEN tip 100 QIAGEN P N 10043 25 reactions 10045 100 reactions and QIAGEN tip 500 QIAGEN P N 10063 25 reactions 10065 100 reactions For other BAC DNA preparation protocols refer to the following Web sites Centre National de S quengage CNS or G noscope http www cns fr externe arabidopsis protoBAC html The Institute for Genome Research TIGR http www tigr org softlab T PFBACmultiprep 052397 html University of Oklahoma Advanced Center for Genome Technology ACGT http www genome ou edu DblAcetateProcV3 html Washington University School of Medicine Genome Sequencing Center http genome wustl edu gsc manual protocols BAC html Performing DNA Sequencing Reactions 3 9 Sequencing PCR Templates Overview This section provides information about preparing and sequ
267. the rhodamine dye terminator dRhodamine terminator and BigDye terminator chemistries These conditions work for a variety of templates and primers However if necessary these parameters can be changed to suit particular situations including the following For short PCR products you can use reduced numbers of cycles e g 20 cycles for a 300 bp or smaller fragment If the Tm of a primer is gt 60 C the annealing step can be eliminated If the Tm of a primer is lt 50 C increase the annealing time to 30 seconds or decrease the annealing temperature to 48 C For templates with high GC content gt 70 heat the tubes at 98 C for 5 minutes before cycling to help denature the template GeneAmp 9700 in 9600 Emulation Mode 9600 or 2400 Step Action 1 Place the tubes in a thermal cycler and set the volume to 20 uL 2 Repeat the following for 25 cycles Rapid thermal ramp to 96 C 96 C for 10 sec Rapid thermal ramp to 50 C 50 C for 5 sec Rapid thermal ramp to 60 C 60 for 4 min 3 Rapid thermal ramp to 4 C and hold until ready to purify 4 Spin down the contents of the tubes in a microcentrifuge a Rapid thermal ramp is 1 C sec Performing DNA Sequencing Reactions 3 27 DNA Thermal Cycler TC1 or DNA Thermal Cycler 480 Step Action 1 Place the tubes in a thermal cycler and set the volume to 20 uL 2 Repeat the following for 25 cyc
268. the single stranded DNA Reagents and equipment required 2XTY medium pH 7 2 7 4 Step Action 1 Combine the following Bactotryptone 16 0 g Yeast extract 5 0 g NacCl 5 0g Make up to 1 L in autoclaved water 2 Adjust the pH to 7 2 7 4 with NaOH PEG solution 20 PEG 2 5 M NaCl Make up fresh as needed from equal volumes of 40 PEG in deionized water and 5 M NaCl stocks TTE buffer 0 25 v v Triton X 100 10 mM Tris HCI 1 mM EDTA pH 8 0 Step Action 1 Combine the following Tris HCl pH 8 0 1 M 500 uL NasEDTA 0 5 M 10 pL Triton X 100 250 uL 2 Make up to 50 mL in deionized water 96 cap sealer Beckman Adhesive backed aluminum foil tape 3M Scotch Tape 425 3 3 2 Performing DNA Sequencing Reactions Centrifuge with 96 tube tray adapter Sterile 1 2 mL culture tubes 96 box Sterile toothpicks To grow M13 infected cells Step Action 1 Inoculate 250 mL of 2X TY with 1 mL of JM101 2 Transfer 0 8 mL of the JM101 culture to each of 96 1 2 mL mini tubes one box 3 Wearing clean gloves pick M13 plaques using sterile toothpicks Drop each toothpick into a culture tube Remove toothpicks after all 96 have been picked 4 Cover the rack of tubes with the provided cover Shake the tubes at 37 C for 18 19 hours To precipitate M13 phage particles with PEG
269. the use of a sequencing primer that binds internally semi nested or nested to one or both of the PCR primers This can be helpful if primer dimer primer oligomerization artifacts are a problem see Figure 7 31 on page 7 24 Nested and Semi Nested PCR If you encounter difficulty with more complex samples such as bacterial genomic DNA use a nested or semi nested PCR These techniques are useful when the target is present in small quantity They offer more specificity which provides superior sequencing data with reduced background signal Both nested and semi nested PCR require two amplifications The first amplification is identical for nested and semi nested but the second amplification differs as described in the following paragraphs Amplify with one set of PCR primers which converts a complex sample such as bacterial genomic DNA into a non complex sample consisting of the first PCR product and some side products Nested PCR Amplify 1 or less of the first PCR reaction product using a second set of PCR primers that hybridize at positions internal to the first set Semi nested PCR Only one primer of the second set of PCR primers is internal The other primer is one of the original PCR primers 3 10 Performing DNA Sequencing Reactions Contaminants That Affect PCR Sequencing Universal Tailed PCR Primers A PCR primer can be synthesized with a universal sequencing primer binding site added to the 5 end see A
270. tic and the run to run reproducibility will be greatly compromised Polymerization in a 20 25 C room is optimal In addition to the temperature of the room it is important that the gel solution and glass plates also be at a temperature of 20 25 C Gels formed at this temperature will be transparent less porous more elastic and more reproducible If the temperature is too high the polymer chains will be shorter and the resulting gel inelastic 4 4 Optimizing Gel Electrophoresis Using Fresh Gels Red Rain TEMED and APS Concentrations See page 4 3 for information about TEMED and APS concentrations Oxygen Oxygen acts as a free radical trap thereby inhibiting polymerization The result is a porous gel To prevent the problems caused by oxygen the following conditions should be met Polymerization must be fast enough to prevent too much oxygen from dissolving into the gel solution during polymerization As long as you use fresh high quality reagents and follow a standard protocol this should not be a problem Minimize the amount of oxygen dissolved in the gel solution prior to casting the gel since it can interfere with the rate of polymerization Partial degassing can be accomplished during the vacuum filter step of gel preparation It is important to keep the vacuum strength and time constant during this step for run to run reproducibility Since cold solutions have a greater capacity for dissolved oxygen vacuum fi
271. tide added to the extension product is selected by base pair matching to the template The extension product grows by the formation of a phosphodiester bridge between the 3 hydroxyl group at the growing end of the primer and the 5 phosphate group of the incoming deoxynucleotide Watson et al 1987 The growth is in the 5 3 direction Figure 1 1 DNA polymerases can also incorporate analogues of nucleotide bases The dideoxy method of DNA sequencing developed by Sanger et al 1977 takes advantage of this ability by using 2 3 dideoxynucleotides as substrates When a dideoxynucleotide is incorporated at the 3 end of the growing chain chain elongation is terminated selectively at A C G or T because the chain lacks a 3 hydroxyl group Figure 1 1 Extension product Template 5 i j H3C seia HN 5 3 o P 0 7 sy i __ 7 f N T A H N N O N N O i O ddC G H no 3 hydroxyl group Figure 1 1 DNA strand synthesis by formation of phosphodiester bonds The chain is terminated by the use of dideoxycytidine triphosphate ddC in place of deoxycytidine triphosphate dCTP The inset shows a schematic representation of the process 1 2 Introduction Fluorescent Sequencing In the PE Applied Biosystems strategy for automated fluorescent sequencing fluorescent dye labels are incorporated into DNA extension products using 5 dye labeled primers dye primers or
272. time d Press 2 to order up to five documents and have them faxed to you MSDS For extra copies of Material Safety Data Sheets MSDS contact Customer Service at D 2 Technical Support 1 800 345 5224 Regional Offices The Americas United States PE Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 Tel 650 570 6667 800 345 5224 Fax 650 572 2743 Canada Mississauga Ontario Tel 905 821 8183 800 668 6913 Fax 905 821 8246 Latin America Del A Obregon Mexico Tel 52 5 651 7077 Fax 52 5 593 6223 Europe Africa Austria Wien Tel 01 602 3101 Fax 01 602 5174 Norway Oslo Tel 0 22 02 1500 Fax 0 22 02 1501 Benelux Nieuwerkerk a d IJssel Netherlands Tel 31 0 180 331400 Fax 31 0 180 331409 Poland Warszawa Tel 223309 36 Fax 22 33 09 96 Chekia Rep Praha Tel 2 61 22 21 64 Fax 2 61 22 21 68 Russia Moskva Tel 095 935 8888 Fax 095 564 8787 Denmark Aller d Tel 48100 400 Fax 48100 401 South Africa Johannesburg Tel 27114780411 Fax 2711 478 0349 Finland Espoo Tel 09 751 72 700 Fax 09751 72701 Spain Madrid Tel 1 806 1200 Fax 1 804 0414 France Paris Tel 016959 85 85 Fax 016959 85 00 Sweden Sundbyberg Tel 4608 619 4400 Fax 4608 619 4401 Germany Weiterstadt Tel 0 6150 101 0 Fax 0 6150 101 101 Switzerland Rotkr
273. tion refer to the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit Protocol P N 402078 or the ABI PRISM Dye Terminator Cycle Sequencing Core Kit Protocol P N 402116 dRhodamine PE Applied Biosystems has designed new dichlororhodamine dRhodamine dye Terminators terminators to give more even peak heights than the rhodamine dye terminators Rosenblum et al 1997 The new dyes have narrower emission spectra giving less spectral overlap and therefore less noise Figure 2 7 on page 2 12 The new dRhodamine dye terminators have the following dye labels The dye terminator structures are shown in Figure 2 2 Terminator Dye Label A dichloro R6G Cc dichloro TAMRA G dichloro R1 10 T dichloro ROX ye o ddT EO dROX A ddG EO dR110 ddG ddC EO dTAMRA ddA ddA dR6G Figure 2 2 dRhodamine terminators ABI PRISM DNA Sequencing Chemistries 2 3 Three of the four dRhodamine terminators use the new ethylene oxide EO linker to attach the dye to the dideoxynucleotide This improves the incorporation of the dye labeled terminators by the AmpliTaq DNA Polymerase FS enzyme Data collected in PE Applied Biosystems laboratories shows more uniform signal intensities with the new dyes and a reduction of the weak G after A pattern that is a problem with the rhodamine dye terminators With less noise better signal uniformity and more even peak heights the new dRhodamine dye termina
274. tion List not completed or completed incorrectly Complete the Injection List as described in your user s manual Analysis preferences set incorrectly in data collection program Check the collection software preferences to make sure that Autoanalyze with Sequencing Analysis Software is selected under the Sequence Injection List Defaults Insufficient free RAM Restart the computer before collecting data Note You should always restart the computer before collecting data Conflicting extensions Choose Extensions Manager from the Control Panels Turn off any extensions that were not part of the original installation and restart computer No current Too little or no buffer in anode buffer reservoir Replenish buffer reservoir Too little or no buffer in position 1 of autosampler Replenish buffer in position 1 of autosampler Electrode bent Replace or straighten electrode and recalibrate autosampler Capillary bent away from electrode Tape capillary securely to heat plate to keep capillary from shifting position Place the tape on the heat plate just above the electrode holder Refer to the ABI PRISM 310 Genetic Analyzer User s Manual Unfilled capillary or bubbles in capillary Check system for leaks Replace capillary if necessary and rerun module Major leaks in system Polymer does not enter capillary Check system for leaks Note Filling the capillary should cause the
275. tion and Installation Kits training P N Kit 402089 ABI PRISM 310 Basic Install Kit Included with purchase of ABI PRISM 310 Genetic Analyzer Includes 310 Genetic Analyzer Buffer with EDTA Leak Test Capillary Sensitivity Standard Genetic Analyzer Buffer Vials Genetic Analyzer Septa Genetic Analyzer Capillary Cutters 5 mL Syringe 402090 ABI Prism 310 DNA Sequencing and GeneScan Install Kit Included when both the DNA Sequencing Analysis and GeneScan Modules 677 30 and 672 30 respectively are purchased Includes POP 6 polymer TSR 61 cm x 50 um i d Capillaries POP 4 polymer 47 cm x 50 um i d Capillaries 310 Genetic Analyzer Buffer with EDTA Fluorescent Genotyping Demonstration Kit B GeneScan 500 TAMRA Internal Lane Size Standard formamide Amberlite MB 1A Dye Primer Matrix Standards Dye Terminator Matrix Standards Fluorescent Amidite Matrix Standards NED Matrix Standard dRhodamine Matrix Standards BigDye Terminator Cycle Sequencing Standard 401820 ABI Prism 310 DNA Sequencing Install Kit Included with purchase of the DNA Sequencing Analysis Module 677 30 Includes POP 6 polymer TSR 61 cm x 50 um i d Capillaries Rhodamine Matrix Standards BigDye Terminator Cycle Sequencing Standard Part Numbers E 7 ABI PRISM 377 DNA Sequencer Plates and Spacers Combs E 8 Part Numbers P N Item 401878 48 cm Gl
276. tors can give better sequencing results than the rhodamine dye terminators Figure 2 3 ANACANNCAAGAGICAACTTASCAAGHIAGACAAT ATT ATT TAGAAGACAS ATAAAG GAA AAT ATATASATGAACA TAG ATATCCATGTAGA ASATGGCCASGGCACT CASATASTGAGAAAACASAT AATG AAS WAAGTCTGCAATGT TT CTASTACATGAASAAATCTCAACT TTATACTCTACATTA AT AAT CA AASAATCATGTGCAGGAGASCATTTAGAAST ASGATGTGT TASAG AGGGAGTGCT GASACCG CAGCAGCCCT ATGCC 1 160 1 130 19 200 210 220 230 240 25 260 270 230 nadl niat n Waa a N A a T wernleal JACACACAG GATT TCATGAGGCACCAGTGT CACATAACASCTTGGGGGCTGGTGCACACGTACTTAC CGGTGCATCTGCACAGGCGAGGTCTGCGTGAACAGITGG GTATTCA GACTGTCCCCTTCCCAGTGGTGTGAGCAGAAGAL VA Wea 3 3 MA A A 3 PA 0 AA 410 4m 4 la 4A AA 4m ARA AA PA 18 5 5 A 5 FA 5m A 30 600 610 620 630 649 65 CO 67 630 690 700 710 720 740 7 7o 7 720 70 300 810 820 330 340 850 360 87 Figure 2 3 Sequence data obtained from a plasmid with dRhodamine terminators Reactions were run on an ABI PRISM 377 DNA Sequencer with a 48 cm well to read gel dRhodamine The ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kits Terminator Ready combine AmpliTaq DNA Polymerase FS and the new dRhodamine dye terminators In Reaction Kits the Ready Reaction format the dye terminators deoxynucleoside triphosphates AmpliTaq DNA Polymerase FS r7th pyrophosphatase magnesium chloride and buffer are premixed into a single tube of Ready Reaction Mix and are read
277. tracking and assignment If necessary adjust the lane markers to correct lane numbering errors If necessary adjust the placement of the tracker lines Note The gel image can be magnified to aid in lane tracking The gel contrast also can be adjusted to make the lanes easier to see if necessary Ifyou change any of the gel file or sample sheet information after extracting the sample file data re extract the data from the edited lanes to regenerate the information in the sample files It is helpful to look at the gel image not only for correct lane assignment and tracking but also for the following information Anoverall impression of the run Background noise in the gel Buffer leaks Instrument problems such as a bad laser Smeared or streaked lanes Wavy lanes Pinched lanes near beginning of run bottom of gel image Band tilt when the gel image is magnified Gel resolution when the gel image is magnified Excess dye peaks from dye terminator reactions Signal strength of individual samples Failed reactions Weak reactions 7 2 Data Evaluation and Troubleshooting Figure 7 1 on page 7 4 shows a portion of a 96 lane gel with 52 lanes loaded The samples include the following Full length plasmids sequenced with BigDye terminator chemistry lanes 1 4 Short PCR products sequenced with BigDye terminator chemistry lanes 5 26 Long and short PCR products sequenced with dRhoda
278. trol DNA was sequenced using the T3 primer The pGEM control has no T3 annealing site For many failed reactions analyzed data is not present because the signal strength is below the threshold for analysis If excess dye peaks are present they can raise signal levels artificially above this threshold The data can be analyzed but will not have usable sequence The raw data for this sample shows flat lines Figure 7 5 on page 7 7 In the annotation view not shown signal strengths are very low G 20 A 21 T 20 C 23 Base spacing for this sample is 8 93 but in failed reactions is often set to the default value ccNrcat oNN atatt TT Aros cTaNr citcadNc oN or NNGHINNGNINNGCRE ac NT oT Nc T GadihTa aa cog TANNA ac taNrier ct Mor aNTa c TaTNemcac ac Rb Fs 7 T 30 2 aANT c Toor THMbe 2 0 00 TIN a Nb Te Aber Nb NAN mTraNo ce TIMING aT NINN NTT Hoa ToT c 2 cTe0lNb carico olNNT NE Be Tace T caca TeTNN TNNT No aaite TN 0 140 150 160 170 130 190 200 cio cco 230 ceo eso ceo Figure 7 9 Analyzed data from a reaction that had very low signal due to the absence of a priming site in the template for the primer that was used Possible causes of failed reactions Primer has no annealing site as in the example above Insufficient template Contaminated template Insufficient primer Poor primer design e g low melting temperature Old mishandled or missing reagents Thermal cycler failure gt gt oo o o o Extension
279. trophotometry If your data has a short read length odd peak shape and low signal strength the template may be contaminated by salt See Cleaning Up Dirty Templates on page 3 16 for information about removing salt from templates 7 26 Data Evaluation and Troubleshooting Excess Dye Peaks A common issue occurring with dye terminator cycle sequencing chemistries stems from incomplete removal of unincorporated fluorescently labeled ddNTPs during alcohol precipitation In the worst case residual unincorporated dye can obscure the entire sequence in the first 40 bases Figure 7 34 and cause scaling problems throughout the sequence Figure 7 68 on page 7 65 GGTGTNNNTTTTT ANCCOCCCCTACT ACTNTNGGGCGAATTCGA 10 20 30 40 Figure 7 34 Unincorporated dye terminator peaks from a BigDye terminator sequencing reaction There are several alcohol precipitation methods available for each chemistry see page 3 33 This is to provide as much flexibility as possible Use the method that gives the best results in your laboratory To avoid excess dye peaks Use only room temperature alcohol Cold alcohol will also precipitate unincorporated dye terminators Do not use denatured alcohol Denatured alcohol has inconsistent quality The concentration of the alcohol and purity of the additives can vary Use the correct concentration of alcohol recommended for the method you have chosen as described in Removing Unincorporated Dye Termi
280. ucture Many of the same approaches that are useful for sequencing GC rich templates are also useful for templates that have regions of strong secondary structure An approach that sometimes works is to use a primer that anneals close to the region of signal loss The use of short insert libraries has also been used to solve problems of secondary structure in a genome sequencing project McMurray et al 1998 Data Evaluation and Troubleshooting 7 33 Sequence ofa Figure 7 43 shows a portion of sequence data obtained with BigDye terminators The GT Rich Template insert in this clone is from Dityostelium japonicum The base composition is Obtained with approximately 30 GC However the distribution of bases is significantly different in BigDye Terminators he two strands In the strand from which the data shown here was obtained there is a higher proportion of Cs and As which results in a high proportion of Gs and Ts in the synthesized strand In particular in the region of bases 192 250 52 of 58 bases are either G or T i e 90 After this region the sequence data obtained with BigDye terminator chemistry dies Figure 7 43 GA NTGTAATACGAC TCACTAT AGG GCGAATTGGGTAC CGGGC CCCCCCT CGAGG TCGACG GTAT CGATAAGCTTGATATCGAAT TC CTTTTIT TT TT TTTTTTGTTTAGTT TATTT1 20 a 49 59 ag a ag 9g GAT TTGTAGT GAAAGGTT TGTT TTTTTTTTTTTT TT TT GTAT TGGAGAGGTTTATAGT TT TAATGAT TTGAAGTAGTT GIT GTTGTT GTAGT TGTGGT TGTGTTGTTAGT TGTTGATGS Nhl ih M l a e n
281. ugh a 0 2 um cellulose nitrate filter 4 Degas for 2 5 minutes Note Degas time for all gels should be constant to ensure a reproducible polymerization rate for all gels 5 Transfer the solution to a 100 mL graduated cylinder 6 Add filtered 10X TBE buffer IMPORTANT Always remove the mixed bed ion exchange resin by filtration step 3 above before adding the TBE buffer Resin will destroy the effectiveness of the buffer 7 Add deionized water to make the final volume 50 mL for a 36 cm or 48 cm gel for the ABI PRISM 377 DNA Sequencer 80 mL for a 24 cm or 34 cm gel for the ABI 373 DNA Sequencer 100 mL for a 48 cm gel for the ABI 373 DNA Sequencer IMPORTANT If the plates are not clean and ready for gel pouring prepare them before adding the polymerizing agents to your solution Adding the polymerizing reagents Step Action 1 Add freshly made 10 APS and swirl carefully to mix without introducing air bubbles Note Be as accurate and reproducible as possible when making the 10 APS solution Significant variation in this reagent can produce changes in data quality Add TEMED and swirl carefully to mix without introducing air bubbles WARNING CHEMICAL AND FIRE HAZARD TEMED is extremely flammable and can be very destructive to the skin eyes nose and respiratory system Keep it in a tightly closed container Avoid inhalation and contact with skin eyes and clothing Always work under a hood and
282. umbers E 9 Buffer Chambers P N Item 603750 Small Upper Buffer Assembly 603751 Large Upper Buffer Assembly 603410 Lower Buffer Assembly 200576 Gasket Silicone Foam Cord for Upper Buffer Chamber Seal 201410 Gasket Adhesive for use with P N 200576 Documentation and Software User s Manuals and Other Documents Software E 10 Part Numbers P N Item 903565 ABI PRISM 310 Genetic Analyzer User s Manual 902376 373 DNA Sequencing System User s Manual 904258 373 DNA Sequencer With XL Upgrade User s Manual 4304367 Using the ABI 373 BigDye Filter Wheel User Bulletin 903433 ABI PRISM 377 DNA Sequencer User s Manual 904210 ABI PRISM 377 18 DNA Sequencer User s Manual 904412 ABI PRISM 377 DNA Sequencer XL Upgrade User s Manual 4305423 ABI PRISM 377 DNA Sequencer 96 Lane Upgrade User s Manual 903939 CATALYST 800 Molecular Biology LabStation User s Manual 904414 ABI PRISM 877 Integrated Thermal Cycler User s Manual 904532 ABI PRISM DNA Sequencing Analysis Software Version 3 0 User s Manual 4304075 ABI Prism DNA Sequencing Analysis Software Version 3 2 User s Manual 770901 Comparative PCR Sequencing A Guide to Sequencing Based Mutation Detection 770905 Guide to PCR Enzymes 4304655 Precipitation Methods to Remove Residual Dye Terminators from Sequencing Reactions User Bulletin P N Item 4303032 ABI PRISM 310 Training CD 402089 Primer Expr
283. ure references C 1 to C 3 Long Ranger gels protocol and run conditions A 10 to A 14 for the ABI 373 A 12 to A 14 for the ABI PRISM 377 A 10 to A 12 M material safety data sheets MSDS how to obtain D 2 matrix files and sequencing standards part numbers E 3 creating 6 7 to 6 13 Data Utility software using to make file 6 7 making Filter Set E 6 8 to 6 13 making instrument file from sample file 6 14 overview 6 7 when to remake file 6 7 noise caused by incorrect or poor file 7 13 troubleshooting software settings 7 63 to 7 64 what s in the file 1 16 melting temperature Tm estimating 3 18 mobility correction described mobility files See dye set primer files molecular weights oligonucleotides 3 19 multicomponent analysis described 1 14 to 1 15 1 13 N no recognizable sequence troubleshooting 7 39 no usable sequence practical example 7 10 noise caused by incorrect or poor matrix file 7 13 throughout the sequence practical example 7 11 to 7 12 sequencing data 7 40 up to or after a point in sequence practical example 7 12 sequencing data 7 41 O oxygen avoiding gel problems 4 5 P PAGE PLUS gels protocol and run conditions A 10 to A 14 for the ABI 373 A 12 to A 14 for the ABI PRISM 377 A 10 to A 12 part numbers ABI 373 E 9 to E 10 ABI PRISM 310 E 5 to E 7 ABI PRISM 377 E 8 to E 9 ABI Prism DNA sequencing kits and reagents E 1 to E 4 dye labeled primers E 3 kits E 1 to E 2 matrix and sequencing
284. utes IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Without disturbing the precipitates remove the adhesive tape and discard the supernatant by inverting the tray onto a paper towel folded to the size of the tray Place the inverted tray with the towel into the table top centrifuge and spin at 700 x g for 1 minute 1 Contact 3M in the USA at 800 364 3577 for your local 3M representative Use of other tapes may result in leakage or contamination of the sample 3 36 Performing DNA Sequencing Reactions To precipitate extension products in MicroAmp Trays continued Step Action 9 Remove the tray and discard the paper towel Note Pellets may or may not be visible Vacuum drying of the samples is not necessary Precipitation in Microcentrifuge Tubes Reagents and equipment required for this method 1 5 mL microcentrifuge tubes Benchtop microcentrifuge capable of reaching at least 14000 x g Vacuum centrifuge 75 Isopropanol 2 propanol or 100 isopropanol anhydrous at room temperature Note This procedure does not use salt To precipitate extension products in microcentrifuge tubes Step Action 1 Pipet the entire contents of each extension reaction into a 1 5 mL microcentrifuge tube To remove reactions run on the TC1 or DNA Therma
285. want to analyze only a portion of the raw data in the file Peak 1 Location for The Peak 1 Location Primer Peak Location is the position of the first base peak In Dye Primer dye primer chemistries this peak is found on the downward slope of the primer peak Chemistries Figure 6 1 If you need to change the Peak 1 Location use one of the following procedures depending on which version of the Sequencing Analysis software you are using refer to Figure 6 1 during the procedure 11093 Figure 6 1 Electropherogram of raw data with the dashed vertical line showing the right edge of the primer peak which is the recommended position of the Peak 1 Location for this sample file i e 1109 scans 6 16 Optimizing Software Settings Using Sequencing Analysis Version 2 1 Step Action 1 Launch the Sequencing Analysis software if it is not already open 2 In the Sample File Queue display double click the first file to be analyzed to view the raw data Zoom in completely From the Window menu choose Actual Size or use the keys on the keyboard 3 Starting at the beginning of the raw data file scroll along the data by clicking and holding the right direction arrow at the bottom of the window Continue scrolling until the primer peak is approximately in the center of the window 4 a Click and drag in the window to change the cursor to a cross hair b Move the cursor along the data until the vertical dotted
286. were increased to G 481 A 241 T 181 and C 498 Figure 7 42 on page 7 33 7 32 Data Evaluation and Troubleshooting Secondary Structure in the Template GCCTGGTGGGCGCGAAGGCGCCGCCGGCGCCCAAGCCCGCGCCECAGCCGGGTICCCCAGCCGCCGECAGCCGCCGCAGCCGCAGY 100 0 130 150 160 170 110 12 140 Figure 7 42 GC rich template sequenced using BigDye terminators with a 98 C denaturation temperature Suggested Approaches for GC Rich Templates gt gt gt Increase the denaturation temperature to 98 C Add DMSO to a final concentration v v of 5 Burgett et al 1994 Landre et al 1995 Addition of a mixture of 5 DMSO and 5 glycerol has also been used successfully for some templates Incubate the reaction at 96 C for 10 minutes before cycling Add betaine to a final concentration of 1M Henke et al 1997 Baskaran et al 1996 Double all reaction components and incubate at 98 C for 10 minutes before cycling Add 5 10 formamide or 5 10 glycerol to the reactions Linearize plasmids with a restriction enzyme Shear the insert into smaller fragments lt 200 bp and subclone Amplify the DNA with substitution of 7 deaza dGTP for 75 of the dGTP in the PCR then sequence the PCR product Innis 1990 Fernandez Rachubinski et al 1990 The presence of secondary structure in the template strand often results in difficulty obtaining good sequence data beyond the region of secondary str
287. wide mouthed container Note Degas time for all gels should be constant to ensure a reproducible polymerization rate for all gels Gel Preparation A 11 Adding the polymerizing reagents Step Action 1 IMPORTANT If the plates are not clean and mounted in the gel cassette or other device clean and mount them now before adding the polymerizing agents to your solution 2 Add freshly made 10 APS and swirl carefully to mix without introducing air bubbles Note Be as accurate and reproducible as possible when making the 10 APS solution Significant variation in this reagent can produce changes in data quality 3 Add TEMED and swirl carefully to mix without introducing air bubbles Cast the gel using one of the methods described in the ABI PRISM 377 DNA Sequencer User s Manual 5 Allow the gel to polymerize for 2 hours before using Ingredients and Run For 34 cm WTR Runs sa h Conditions Toir thie 5 75 Long Ranger Gel 8 3 M Urea ABI 373 Ingredient For 80 mL Run Conditions urea 40 0 g Use the standard run time of 50 gel stock solution 9 2 mL 14 hours 10X TBE 8 0 mL deionized water to 80 mL 10 APS 400 uL TEMED 40 uL 5 75 PAGE PLUS Gel 8 3 M Urea Ingredient For 80 mL Run Conditions urea 40 0 g Use the standard run time of 40 gel stock solution 11 5 mL 14 hours 10X TBE 8 0 mL deionized water to 80 mL 10 APS 480
288. will affect DNA quantitation greatly Neither of these methods shows the presence of contaminating salts that can cause noisy data If you suspect that your DNA is contaminated with salt remove the salt before sequencing The most efficient method for salt removal is ultrafiltration with a Centricon 100 column see page 3 12 Spin columns and ethanol precipitation can also be used see page 3 33 Cleaning Up Dirty A dirty template preparation sometimes can be cleaned up with one of the following Templates methods Purify the DNA by ultrafiltration Use Centricon 100 Micro Concentrator columns see Preparing PCR Products for Sequencing on page 3 12 Purify by extraction Step Action 1 Extract the DNA twice with 1 volume of chloroform or chloroform isoamyl alcohol 24 1 v v 2 Add 0 16 volumes of 5M NaCl and 1 total volume of 13 PEG 3 Incubate on ice for 20 minutes then centrifuge at maximum speed in a microcentrifuge at 2 6 C for 20 minutes 4 Rinse the pellet twice with 70 ethanol 5 Dry the pellet in a vacuum centrifuge for 3 5 minutes or to dryness 3 16 Performing DNA Sequencing Reactions DNA Template Quantity Quantitating DNA DNA template quantitation is critical for successful sequencing reactions The most common way to determine DNA quantity is to measure the absorbance optical Amount to Use in Sequencing Reactions density or O D of a sample at 260 nm
289. y to use The dNTP mix includes dITP in place of dGTP to minimize band compressions These reagents are suitable for performing fluorescence based cycle sequencing reactions on single stranded or double stranded DNA templates or on polymerase chain reaction PCR fragments The cycle sequencing protocols are optimized for GeneAmp PCR Instrument Systems thermal cyclers the CATALYST 800 Molecular Biology LabStation and the ABI PRISM 877 Integrated Thermal Cycler For more information refer to the ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kit Protocol P N 403041 2 4 ABI PRISM DNA Sequencing Chemistries BigDye Terminators Instrument Platforms The ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kits are for use with the ABI PRISM 310 Genetic Analyzer and ABI PRISM 377 DNA Sequencer all models 1 These kits can also be used with ABI 373 DNA Sequencers on which the new ABI PRISM BigDye Filter Wheel has been installed Refer to the AB PRism BigDye Filter Wheel User Bulletin P N 4304367 for more information IMPORTANT This kit is not designed for use with ABI 373 DNA Sequencers and ABI 373 DNA Sequencers with XL Upgrade that do not have the ABI PRISM BigDye Filter Wheel PE Applied Biosystems has developed a set of dye terminators labeled with novel high sensitivity dyes Rosenblum et al 1997 The new dye structures contain a fluorescein donor dye e g 6 carboxyfluorescein 6 FAM linke
290. yringe 4304406 Upper Buffer Chamber new 4304409 Gasket Replacement Kit for Upper Buffer Chamber P N 4304406 604078 Upper Buffer Chamber obsolete 604524 Gasket Replacement Kit for Upper Buffer Chamber P N 604078 603875 Lower Buffer Chamber 603822 Upper Buffer Electrode Assembly 603823 Lower Buffer Electrode Assembly 603833 Front 36 cm Well to Read Heat Plate ABI 373 DNA Sequencer Combs and Spacers P N Item 401472 24 well Sharktooth Comb 0 4 mm thick 401580 32 well Sharktooth Comb 0 4 mm thick 401473 36 well Sharktooth Comb 0 4 mm thick 402179 48 well Sharktooth Comb 0 4 mm thick 402182 64 well Sharktooth Comb 0 4 mm thick 402214 Casting Comb for Sharktooth 0 4 mm thick 402048 Uni length Glass Plate Spacer 0 4 mm thick 401582 24 well Sharktooth Comb 0 3 mm thick 401581 32 well Sharktooth Comb 0 3 mm thick 401583 36 well Sharktooth Comb 0 3 mm thick 402178 48 well Sharktooth Comb 0 3 mm thick 402181 64 well Sharktooth Comb 0 3 mm thick 402215 Casting Comb for Sharktooth 0 3 mm thick 402047 Uni length Glass Plate Spacer 0 3 mm thick Plates P N Plate 401617 48 cm Notched Glass Plate Stretch Configuration 401618 48 cm Plain Glass Plate Stretch Configuration 401069 24 34 cm Notched Glass Plate Stretch Configuration 401498 24 34 cm Plain Glass Plate Stretch Configuration Part N
291. ysis software contains mobility files for the following sequencing primers 21 M13 Forward T7 M13 Reverse Pl 4 SP6 Pl T3 a Used with the Primer Island Transposition Kit IMPORTANT For correct data analysis the dye set primer file must be specified in the sample sheet before data collection and automatic analysis If you choose the wrong dye set primer file the data can be reanalyzed with a different file after automatic analysis The fluorescent dyes appear to interact with the first five bases on the 5 end of the oligonucleotide to which they are attached This interaction is responsible for their effect on primer mobility If you use custom dye labeled primers synthesize them so that their 5 ends contain the same five bases as the 5 end of the M13 Reverse primer CAGGA Analyze the sequence data with M13 Reverse dye set primer files This works well in most cases as long as the primers are made with the 5 FAM JOE TAMRA and ROX dyes Contact the PE Applied Biosystems Custom Oligonucleotide Synthesis Service see page 3 19 for contact information BigDye Primers 21 M13 Forward and M13 Reverse primers use the same dye set primer file on the ABI PRISM 377 DNA Sequencer This is possible because the mobility shifts are very similar for each primer Rhodamine Dye Terminators Rhodamine dye terminator chemistry uses a set of four rhodamine dyes see Figure 2 1 on page 2 2 Rhodamine dye labeled

Automated DNA Sequencing

Contents

Download Pdf Manuals

Related Search

Related Contents