Home

945P7AA-8EKRS2

Contents

1. Power on By Mouse Default Disabled This option is used to set the power on method of your PC The available setting values are Disabled Mouse Move Mouse Click FOXCONN Chapter 3 BIOS Description lt Power On By Keyboard Default Disabled This option is used to set the power on method of your PC The available setting values are Disabled Password Hot KEY Any Key Keyboard 98 lt KB Power On Password Default Enter When the Power On By Keyboard is set as Password use this item to set the keyboard password that powers on the system Hot Key Power On Default Ctrl F1 When the Power On By Keyboard is set as Hot KEY use this item to set the hot key combination that awakes the system The available setting values are Ctrl F 1 F12 Foxconn Chapter 3 BIOS Description PnP PCI Configurations Phoenix AwardBIOS CHOS Setup Utility PoP PCl Configurations Heset Configuration Data Disabled ltem Help Resources Controlled By AwtofESCD Meno Level x IRQ Resources Press Ente Default is Disabled PELUCA Palette Snoop Qisabled Select Enabled ta IHT Pin 1 Assignment Auta reset Extended System IHT Pin 2 Assignment Auta Configuration Data IAT Pin 3 Assignment Auto ESCO when you exit IHT Pin 4 amp Assignment Setup if you have IHT Pin 5 Assignment installed a new add on IHT Pin amp Assignment i and the system IHT Pin 7 Assignment reconfiguration has IHT Pin
2. S PDIF Coaxial Out Port This port connects to external audio output devices with coaxial cable connectors Foxconn Chapter 2 Installation Instructions 1394 Port optional This digital interface supports electronic devices such as digital cameras scanners and printers USB 2 0 Ports These four Universal Serial Bus USB ports are available for connecting USB 2 0 1 1 devices LAN Ports optional These ports allow connection to a Local Area Network LAN through a network hub Line in Line out Microphone Jacks for 6 models When using a 2 channel sound source the Line out jack is used to connect to speaker or headphone the Line in jack connects to an external CD player tape player or other audio device The Microphone jack is used to connect to the microphone When using a 6 channel sound source connect the front speaker to the green audio output connect the surround sound speaker to the blue audio output connect the center speaker subwoofer to the red Microphone output Line in Line out Microphone Rear LEF CEN Side Jacks for 8 models When using an 8 channel sound source connect the front speaker to the green audio output connect the rear sound speaker to the black audio output con nect the center speaker subwoofer to the orange audio output connect the side sound speaker to the grey audio output FOXCONN Chapter2 Installation Instructions Other Connectors This motherboard incl
3. 5 Previous Values F Fail Safe Defaults F7 Optinized Defa Power Management Events Menu lt Wake Up by PCI card Default Enabled This option is used to set the system to wake up by PCI card The setting values are Disabled and Enabled Power On by Ring Default Enabled If this item is enabled it allows the system to resume from a software power down or power saving mode whenever there is an incoming call to an installed fax This function needs to be supported by the relevant hardware and software The setting values are Disabled and Enabled lt USB KB Wake Up From S3 Default Disabled This option is used to set the system to wake up by USB equipment when it is in S3 Suspend to RAM mode The setting values are Disabled and Enabled Resume by Alarm Default Disabled This option is used to set the timing of the start up function In order to use this function the start up password function must be cancelled Also the PC power source must not be turned off The setting values are Disabled and Enabled lt Date of Month Alarm When the Resume by Alarm set as Enabled this option will be modified It is used to set the timing for the start up date The setting values contain 0 31 lt Time hh mm ss Alarm When the Resume by Alarm set as Enabled this option will be modified It is used to set the timing for the start up time The setting values contain hh 0 23 mm 0 59 ss 0 59
4. ET To BIDS Proti t SuperBl05 Protect Hisabled L eg trfecouerg Superfecovery Hotkey LSHIFT F12 iperSpeed t Super Speed Press Enter thee tMouve EmtertSelect PUSPOSValoe Fil ave ESClExit FirtGeneral Help FS Previous Values F Fail Safe Defaults Fi Optimized Defaults Hard Disk Selection The hard disk selection menu will be displayed after you press the hotkey listing all the IDE HDDs installed in your system You can switch the highlight bar to make a selection and press lt Enter gt to confirm it Attention 1 Make sure that you have selected a HDD before entering the main menu 2 Make sure that the HDD you selected is ATAS or higher For HDDs lower than ATA S there will be a No Support message in the HDD list menu listing beside the name of it 3 Only one HDD can be operated at a time SuperRecovery X XXX Senet an IDE Driver LPrimary lave l Ho Hard Desk Secondary Haster Ho Hard Dork Secondary Slave Hoard Dick Use UpeDown Key for noving Light bar and press ENTEH key to nelect an IDE driver Note If you have assigned a password to the selected HDD you will be prompted to provide it before proceeding superkecovery X ANN Select an IDE Driver Primary Haster MAXTOR 4AKA4AHZ 36182 AB Frimary amp 1 Secondary Secondary Slave Hone Use Up Down key For moving Light bar and press ENTER key ta select an BE driver cFoxconn Chapter6 Spec
5. Suspend Type Default Stop Grant This option is used to set sleep mode The setting values are Stop Grant saves the status of the whole system and then turns off power and PwrOn Suspend CPU and core system go to low power mode keeps power supply lt MODEM Use IRQ Default 3 This option is used to set the IRQ in which the modem can use The system will automatically wake up when the modem receives an incoming call lt Suspend Mode Default Disabled This option is used to set the idle time before the system enters into sleep status The setting values are Disabled and 1 Min 1 hour lt HDD Power Down Default Disabled This option is used to turn off hard disk power if the hard disk is idle for a given period of time The setting values are Disabled and 1 Min 15 Min Soft Off by PWR BTTN Default Instant Off This option is used to set the power down method This function is only valid for systems using an ATX power supply When Instant Off is selected press the power switch to immediately turn off power When Delay 4 Sec is selected press and hold the power button for four seconds to turn off power lt CPU THRM Throttling Default 50 0 This option is used to specify the CPU speed at percentage to slow down the CPU when it reaches the predetermined overheat temperature The setting values are 75 0 50 0 25 0 FOXCONN Chapter 3 BIOS Description lt PWRON After PWR Fail Default
6. elle E elle EE Appendix Using 8 channel Audio Optional ccccccseeeeeseeeeecaeeeeeeeeeeseeeeesseeeeesaaeees Warning 1 Attach the CPU and heatsink using silica gel to ensure full contact 2 It is suggested to select high quality certified fans in order to avoid damage to the motherboard and CPU due high temperatures 3 Never turn on the machine if the CPU fan is not properly installed 4 Ensure that the DC power supply is turned off before inserting or removing expansion cards or other peripherals especially when you insert or remove a memory module Failure to switch off the DC power supply may result in serious damage to your system or memory module Warning We cannot guarantee that your system will operate normally while over clocked Normal operation depends on the over clock capacity of your device i Attention Since BIOS programs are upgraded from time to time the BIOS description in this manual is just for reference We do not guarantee that the content of this manual will remain consistent with the actual BIOS version at any given time in the future i Attention The pictures of objects used in this manual are just for your reference Please refer to the physical motherboard This manual is suitable for motherboard of 945P7AA series Each motherboard is carefully designed for the PC user who wants diverse features L with onboard 10Mb 100Mb LAN K with onboard 1Gb L
7. Frese any key to cont inun Bachip the harddisk data to hidden part itin 4 Back to Main This item is used to exit the Backup interface Recovery select RECOVERY to enter the Recovery interface You will see the following sub function items RECOVER CMOS SETUP RECOVER PARTITION TABLE and RECOVER HARDDISK DATA You can switch the highlight bar by pressing the arrow keys to make a selection and press lt Enter gt to confirm your selection REGER 1 REGMER PART RECOVER HAP DCH T EOSCOnn Chapter6 Special BIOS Functions 1 Recover CMOS Setup This function is used to restore the latest backup of CMOS settings you made fire you really want to recover POP data Press ESC te exit or any ether key te continus ssa Recover the SETUP parapnptereCChHO data From the hidden partition Po 256 huptes of CHAOS data have been Pimished feenuery it canpleted Preza any bey Ea cont inis Recover the EETUP perometerc OAs datas From the hidden part itinn 2 Recover Partition Table This function is used to recover all partition tables including extended partitions fire you really want to recover partition table Prese ESC te exit or any other key te continue ow Recover Hanter Boot Record SDR gt from the hidden partition SaiperRecovery AMAR REGOWER PARTITION TABLE Partition table have been reenvered LA completed becou tai 7 i mm be tea Piet and Bev EG C
8. WK Duplex Mode LHa Lf J Onboard Parallel Port 37871 RQF Parallel Port Hode SPF EGP Rode Use One 3 Move Enter Select PU PD Ualue FIRiSave ESCSExit Fi General welp Sa Freu ious Melu ae Fail Safe llefanite F7 Optimized Defaults Super IO Device Menu lt Onboard Serial Port 1 2 Default 3F8 IRQ4 2F8 IRQ3 This option is used to assign the I O address and interrupt request IRQ for the onboard serial port 1 2 The onboard serial port 2 I O address and IRQ is for IrDA using lt UART Mode Select Default Normal Use this option to select the UART mode Setting values include Normal IrDA ASKIR The setting value is determined by the infrared module installed on the board lt UR2 Duplex Mode Default Half This option is available when UART 2 mode is set to either ASKIR or IrDA This item enables you to determine the infrared function of the onboard infrared chip lt Onboad Parallel Port Default 378 IRQ7 This item allows you to determine onboard parallel port controller I O address and interrupt request IRQ Setting values include Disabled 378 IRQ 7 278 IRQ5 and 3BC IRQ7 lt Parallel Port Mode Default SPP Select an address and corresponding interrupt for the onboard parallel port Setting values include SPP EPP ECP ECP EPP FOXCONN Chapter 3 BIOS Description Power Management Setup Phoenix AwardBIOS CHOS Setup Utility ower Hanagement Setup ACPI hett Enabled ACP
9. and click to enter the install driver screen You can select the driver that you want to install and begin the setup steps FOXCONN 345series Chipset Software IHH Driver ITE RAID Driver DirectX o gr Audio Driver LAH 1000H Driver LAN 100 Driver USB2 0 Drive a Back N Exit Follow the screen order to install the drivers Foxconn Chapter 4 Driver CD Introduction Install Accessories From the main menu screen select lt Accessories gt shown as below then follow the screen sequence to install the accessry software FOXCONN s sseries Superutility Click to Adobe Reader install the Horton Internet Security accessory Word Perfect software Office 1 fa Back H Exit f 7 eg N F i eS a Ly C pte j This chapter will introduce how to use attached software This chapter includes the following information SuperStep SuperUpdate SuperLogo Foxconn Chapter 5 Directions for Bundled Software superstep SuperStep is a utility that allows users to change the frequency of the CPU It also displays system health introduction including CPU temperature CPU voltage and PCI PCI Express clock SuperStep features 1 Supports Win2000 and WinXP 2 Automatic alarm mechanism when system runs irregularly 3 Adjusts the CPU frequency to speed up your system and achieve better system performance 4 Simple and easy to operate with a user friendly graphics interf
10. to confirm your input As the average rate of compression is 50 or so you are suggested to divide 30 of the total as the capacity of the hidden partition B The system will then prompt you to Enter lt Y gt or lt N gt for confirmation Press lt Y gt to restart the computer and the division for hidden partition will go into effect after the system is restarted Foxconn Chapter6 Special BIOS Functions Attention 1 All the HDD data will be cleared by the partitioning process so it is better to do the division on an empty HDD 2 At the same time the overall HDD capacity will decrease in order to make space for the hidden partition which will be come unavailable for normal use Superkecovery E EA DIVIDE HIDDEN PARTITIOW HDD Total Capacity 38182 AR Hidden Partition Size in Decimal AB For dividing hidden partition to make protect area on current driver This will lost all of HOD data and need to adjust HDD agqecan DIVIDE HIDDEN PARTITION HDD Total Capacity RK AE KA AE Hidden Partition size is 7620 AB 2z This will lost all of HDD data to set Dip youn Sue hidden partitionfCN Ni Cyatem will auto restart en pu choice Y TET For dividing hidden partition to make protect area on current deiver This will lost all of HOD data and need ta adjust HOD again Release Hidden Partition This is used to release the hidden partition If you choose this item and press lt Y gt to confirm the system will
11. 1 and 2 together using the jumper cap 1 2 3 2 Return the jumper setting to the default setting pins 2 and 3 Clear CMOS together with the jumper cap 3 Turn the AC power supply back on CLR CMOS OH Warning 1 Disconnect the power cable before adjusting the jumper settings 2 Do not clear the CMOS while the system is turned on Foxconn Chapter 2 Installation Instructions BIOS TBL Jumper TBL_EN Refer to Item 18 on motherboard layout in Chapter 1 for detailed locations The system cannot boot if the BIOS failed to be flashed ae Lee in conventional flash BIOS process But you will have D no such worry when using the BIOS TBL function which is used to protect BIOS Top Boot Block By using this BIOS TBL function the system still can boot even if the BIOS fails Disable Ge to flash To utilize this function you can short pin 2 and 1 2 3 TBL_EN 3 with the jumper cap apter This chapter tells how to change system settings through the BIOS Setup menus Detailed descriptions of the BIOS parameters are also provided You have to run the Setup Program when the following cases occur 1 An error message appears on the screen during the system POST process 2 You want to change the default CMOS settings This chapter includes the following information Enter BIOS Setup Main Menu Standard CMOS Features BIOS Features Advanced BIOS Features Advanced Chipset Features Si Ze
12. 16A per phase IV EN 61000 3 3 A1 2001 Electromagnetic compatibility EMC Part 3 Limits Section 2 Limits of voltage fluctuations and flicker in low voltage supply systems for equipment with rated current lt 16A Wl EN 55024 A1 2001 Information technology equipment Immunity characteristics limits and methods of measurement Signature anos ot W Place Date TAIPEI 2005 d e VW as Printed Name James Liang Position Title Assistant President Declaration of conformity Trade Name Model Name Responsible Party Address Telephone Facsimile Equipment Classification Type of Product Manufacturer Address Supplementary Information FOXCONN 945P7AA PCE Industry Inc 458 E Lambert Rd Fullerton CA 92835 714 738 8868 714 738 8838 FCC Class B Subassembly Motherboard HON HAI PRECISION INDUSTRY COMPANY LTD 66 CHUNG SHAN RD TU CHENG INDUSTRIAL DISTRICT TAIPEI HSIEN TAIWAN R O C This device complies with Part 15 of the FCC Rules Operation is subject to the following two conditions 1 this device may not cause harmful interference and 2 this device must accept any interference received including interference that may cause undesired operation Tested to comply with FCC standards rg Signature le lt E e Pa d e Date 2005 Table of Contents Chapter C Product Introduction Main Features oo occ cc ccc cccccccecececuccccucccuceeaceuc
13. 6 channel audio set ups 8 channel surround sound is already a standard feature for premium consumer audio devices so it only makes sense that as users increasingly use their PCs to listen to the latest multimedia content that 8 channel support makes the migration as a standard PC feature In the 8 channel surround sound configuration there are the standard front center LFE bass speakers but also two surround speakers are placed at the sides of a listener and two speakers directly behind the listener Some formats also support a 6 channel audio configuration wherein there is only one speaker behind the listener However since audio connections always come in stereo pairs most PC hardware will automatically support the 8 channel configuration It is also fully sup ported in the Windows XP operating system 2 Using 8 channel Audio STEP 1 Connect the front channels to green jack the rear channels to orange jack the Center Subwoofer channels to black jack and Side channels to grey jack Please refer to below figure Foxconn Appendix STEP 2 You need to install the driver for the audio chip before you can use the 8 channel audio function FOXCONN j45series O Chipset Software D IHH Driuer D ITE RAID Driver D Direct o gr Q Audio Driver D Lon 1000H Driver D LAN 100M Driver TRHA 8 Driver fq Back N Exit Click here Foxconn Appendix STEP 5 Make sure you select 8CH Speaker from the a
14. 8 Assignment CUTI caused such a serious conflict that the 0S ive i cannot boot emg e KOR KS POEL Express rela Haximam Payload Size ti iMove Enter elect PUSPD Value FIOSave ESC Exit FiiGeneral Help FS Previous Values F Fail Safe Defaults Fi Optimized Defaults PnP PCI Configurations Menu lt Reset Configuration Data Default Disabled This option is used to set whether the system is permitted to automatically distribute IRQ DMA and I O addresses when each time the machine is turned on The setting values are Disabled and Enabled Resources Controlled By Default Auto ESCD This option is used to define the system resource control scheme If all cards you use support PnP then select Auto ESCD and the BIOS will automatically distribute interruption resources If the ISA cards you installed do not support PnP you will need to select Manual and manually adjust interruption resources in the event of hardware conflicts However since this motherboard has no ISA slot this option does not apply IRQ Resources Only when the Resoureces Controlled By is set as Manual can this option be modified Press the lt Enter gt key then manually set IRQ resources lt PCI VGA Palette Snoop Default Disabled lf you use a nonstandard VGA card use this option to solve graphic acceleration card or MPEG audio card problems e g colors not accurately displayed The setting values are Disabled and Enab
15. ASUS EN5750 A Geforce PCX5750 ATI X800 RADEON X800SE DOOM3 Geforce 6600GT MSI RX600XT VTD128E RADEON X600XT NVIDIAGeForce PCX5750 Geforce PCX5750 WinFast PX6600TD Geforce 6600 WinFast PX6600GT TDH Geforce 6600GT WinFast PX6800GT Geforce 6800GT WinFast PX68000 Ultra Geforce 6800 Ultra Si Note Make sure to use the tested and qualified PCI Express x16 graphics cards listed above FOXCONN Chapter2 Installation Instructions Jumpers The users can change the jumper settings on this motherboard if needed This section explains how to use the various functions of this motherboard by chang ing the jumper settings Users should read the following contents carefully prior to modifying any jumper settings Description of Jumpers 1 For the jumpers on this motherboard pin 1 can be identified by the silk screen printed A next to it However in this manual pin 1 is simply labeled as 1 2 The following table provides some explanation of the jumper pin settings User should refer to this when adjusting jumper settings Diagram Set pin2 and pin3 closed Set the pin closed e Open Set the pin opened Clear CMOS Jumper CLR_CMOS Refer to tem 15 on motherboard layout in Chapter 1 for detailed locations This motherboard uses the CMOS RAM to store all the set parameters The CMOS can be cleared by removing the CMOS os jumper Normal How to clear CMOS Default 1 Turn off the AC power supply and connect pins
16. POWER GND POWER SENSE CONTROL SENSE GND CPU_FAN SYS_FAN1 USB Connectors F_USB1 F_USB2 Refer to Item 8 on motherboard layout in Chapter 1 for detailed location Besides four USB ports on the rear panel the series of motherboards also have two 10 pin connectors on board which may connect to front panel USB cable optional to provide additional four USB ports NC Empty NC Empty GND GND GND GND D5 D4 D7 D6 D5 D4 D7 D6 VCC VCC VCC VCC F_USB 1 F USB 2 FOXCONN Chapter2 Installation Instructions IrDA Connector IR Refer to Item 21 on motherboard layout in Chapter 1 for detailed location This connector supports wireless transmitting and re Ge ceiving device Before using this function configure the IRRX settings of IR Mode from the Integrated Peripherals Empty 5V section of the CMOS Setup 7 IR 1394 Connector optional F_1394 Refer to Item 7 on motherboard layout in Chapter 1 for detailed location The 1394 expansion cable can be connected to either 0 9 the front provided that the front panel of your chassis Se SE is equipped with the appropriate interface or rear pp TPB panel of the chassis GND GND TPA TPA 2 1 F 1394 S ATA Connectors optional SATA_1 SATA_2 SATA_3 SATA_4 Refer to tem 11 on motherboard layout in Chapter 1 for detailed location The S ATA connector is used to connect the S ATA de vice to the motherboard These connectors support the thin Serial ATA
17. S i Ze Si Ze Si Ze Si Ze Si Ze Si Ze Integrated Peripherals Power Management Setup PnP PCI Configurations PC Health Status Load Fail Safe Defaults Load Optimized Defaults Ze do Ze Si Ze a Ze Si Ze Si Ze Set Supervisor User Password save amp Exit Setup Exit Without Saving Si Ze Si Ze Foxconn Chapter 3 BIOS Description Enter BIOS Setup The BIOS is the communication bridge between hardware and software correctly setting up the BIOS parameters is critical to maintain optimal system performance Power on the computer when the following message briefly appears at the bottom of the screen during the POST Power On Self Test press lt Del gt key to enter the AWARD BIOS CMOS Setup Utility Press TAB to show POST screen DEL to enter SETUP RI Note We do not suggest that you change the default parameters in the BIOS Setup and we shall not be responsible for any damage that result from any changes that you make Main Menu The main menu allows you to select from the list of setup functions and two exit choices Use the arrow keys to select among the items and press lt Enter gt to accept or go to the sub menu Phoenix AwardBIOS CHOS Setup Utility t Standard CMOS Features PC Health Status BIOS Features Load Fail Safe Defaults Advanced BIOS Features Load Optimized Defaults Advanced Chipset Feature Set Supervisor Password I
18. Setup Save and exit then boot the operating INTR system once to make sure this function takes effect FOXCONN Chapter2 Installation Instructions Expansion Slots This motherboard includes three 32 bit Master PCI bus slots two PCI Express x1 slots and one PCI Express x16 slot PCI Slots Refer to Item 5 on motherboard layout in Chapter 1 for detailed location The expansion card can be installed in the PCI slot When you install or take out such card you must make sure that the power plug has been pulled out Please carefully read the instructions provided for such card and install and set the necessary hardware and software for such card such as the jumper or BIOS setup PCI Express Slots Refer to Item 6 amp 27 on motherboard layout in Chapter 1 for detailed locations PCI Express will offer the following design advantages over the PCI and AGP interface Compatible with existing PCI drivers and software and Operating Systems High Bandwidth per Pin Low overhead Low latency PCI Express supports a raw bit rate of 2 5 Gb s on the data pins This results in a real bandwidth per pair of 250 MB s A point to point connection allows each device to have a dedicated connec tion without sharing bandwidth Ability to comprehend different data structure Low power consumption and power management features PCI Express will take two forms x16 and x1 PCI Express slots Whereas the x16 slot is reserved for graphic video
19. cards the x1 slots are designed to accommo date less bandwidth intensive cards such as a modem or LAN card The difference in bandwidth between the x16 and x1 slots are notable to be sure with the x16 slot pushing 4GB sec 8GB sec concurrent of bandwidth and the x1 PCI Express slot offering 250 MB sec z Note lf a performance graphics card was installed into x16 PCI Express slot 2X12 pin power supply was strongly recom mended since that card may be drawn 75W power Foxconn Chapter 2 Installation Instructions Installing an expansion card 1 Before installing the expansion card please make sure that the power sup ply is switched off or the power cord is unplugged Please read the docu mentation that came with it and make the necessary hardware settings for the card 2 Remove the bracket facing the slot that you intend to use Keep the screws for later use 3 Align the card connector with the slot and press firmly until the card is completely seated on the slot 4 Secure the card to the chassis with the screw you removed earlier Qualified PCI Express x16 Graphics Cards Vendor List The following table lists the PCI Express x16 graphics cards that have been tested and qualified for use with this motherboard PCI E VGA Card VGA Chip ASD II 6600 Geforce 6600 ASD II 6200 EVGA Geforce 6200 ASUS RADEON X300 ASUS EN6600GT TD128M A Geforce 6600GT ASUS EAX600XT A1814TD RADEON X600 XT ASUS EAX600Pro 128 RADEON X600Pro
20. current BIOS SuperUpdate ke g cy File te bad MR Look jm te Local Disk CC WW Fiss of hpa Bin Fis f SR 1 pan se adoi RE GN 2 Click lt OK gt to finish the backup process Update BIOS from local image 1 Click lt Load gt to load the BIOS file SuperUpdate e Cu File to ipad Wl Files ood bape BIN Fike f Sm Open ss padomi Foxconn Chapter 5 Directions for Bundled Software 2 Click lt Update gt the following message will appear SuperUpdate Current BIOS un ture BERN un Types ER Versione KS SuperUpdate IE BIOS to be Updated Date Size d bl K Do you ant bo backup the current Bod Flash Pare SST Yes Ko Progress es ee aper pts ZE wa Ek 3 Click lt Yes gt to backup the current BIOS then the following picture will appear SuperUpdate W s E a o Current BIOS BIOS to be Updated MB Type MR Types SuperUpdate Sire aM A rt Flash Part EERE Sire IN Progress LS er Om GA TTT e TT lt IIL IC E 4 Click lt OK gt then click lt Update gt SuperUpdate w Current BIOS BIOS to be Updated ME Type vr pe ES Version Update Hoot Block Kl Date V I ii Sire 3 amp Flash BIOS with Boot Block update Flash Part Update Cancel Keess Gene EN TC GE EERE Aa e a a o FOXCONN Chapter Directions for Bundled Software 5 Now is updating E eg SuperUpdate e mme ae el
21. partition EOSCOnn Chapter6 Special BIOS Functions 3 Backup Hard disk Data A If there are active partitions system partition you can choose to backup an active partition or the whole disk But only one can be taken between the two choices Old data will be replaced by the newly backed up data Ki upei Recovery N XYN OOOO O O men Prezat number key 1 or 2 For cenpress method 1 Save surten partition active partition only Zu Saws all of partitions in this hard disk Backup the harddisk data te hidden partitien Women OOOO fre you ture to berkun HDD data te hidden part A bon ZC Feess ERC to exit or any other key to continue ee Backup the harddisk data to hidden partition B Backing up with the progress bar showing Ki mech erover KENN Peoceeding backup now please wait E LH cenpleted Backup the harddisk data te hidden partiti Foxconn Chapter6 Special BIOS Functions C Areport with all the critical data on this operation will be displayed after the backup is completed Original Size The data size loaded in selected partition Valid Size The size of valid data Elapsed Time How long the procession cost Compressed Size The size of data after compression Compressed Rate Compressed Size Valid Size eT od Pr tl oe ee e Super Recien AANA Original Fize 20AJ73795HH Walid Size 1VRL4HE Elapsed Time 856 Canpreaaed Size 1851HB Conpresced Rate Sx Backup is completed
22. second gt format IDE Channel 0 1 2 Master Slave These categories identify the HDD types of 1 IDE channel installed in the com puter system There are three choices provided for the Enhanced IDE BIOS None Auto and Manual None means no HDD is installed or set Auto means the system can auto detect the hard disk when booting up by choosing Manual and changing Access Mode to CHS the related information should be entered manually Enter the information directly from the keyboard and press lt Enter gt Cylinder number of cylinders number of heads Precomp write pre compensation Landing Zone FOXCONN Chapter 3 BIOS Description Award Phoenix BIOS can support 3 HDD modes CHS LBA and Large or read Auto mode CHS For HDD lt 528MB LBA For HDD gt 528MB amp supporting LBA Logical Block Addressing Large For HDD gt 528MB but not supporting LBA Auto Recommended mode Drive A B This option allows you to select the kind of FDD to be installed including None B60K 5 25 in 1 2M 5 25 in 720K 3 5 in 1 44M 3 5 in and 2 88 M 3 5 in Video The following table is provided for your reference in setting the display mode for your system VGA SEGA SVGA or PGA monitor adapters Halt On This category determines whether or not the computer will stop if an error is detected during powering up All Errors Whenever the BIOS detects a nonfatal error the system T in stop a
23. set a password for each HDD 2 Data Protection Hidden partitions can only be accessed during data back up or recovery Even reformatting the disk using FDISK or PQMAGIC will not allow access to the disk This means that data backed up in a hidden partition is very secure 3 Intelligent Menu Unavailable items will be displayed in gray For example if you haven t divided a hidden partition items like Release Hidden Partition Back up and Recov ery will be displayed in gray and can t be selected And when you select an item the related information will appear on the bottom of the screen Disclaimer Please study this software program s specification carefully before using it The vendor should not be liable for any damage arising out of or in connection with the use of this program including liability for lost profit or data or any other damage whatsoever System Requirements 1 ATAS or above compliant IDE HDD 2 FAT16 FAT32 NTFS files system 3 PS 2 keyboard or USB keyboard Hotkey Selection You should enter the CMOS setup interface first by pressing lt DEL gt during POST Power On Self Test Then select the SuperRecovery Hotkey option to adjust the hotkey settings in the BIOS Features menu There are 12 options LSHIFT Left Shift F1 F12 LSHIFT F12 is the default EOSCOnn Chapter6 Special BIOS Functions Phoenix a H HOS Setup Utility 108 Features Boot SuperBoot Disabled
24. spend Type E Al x Fun T CARI Re sume Power Manne SS Ae es Def ine l Video OFF Method DPMS Video OFF Tn Suspend Yes Suspend Type Stop Grant ER Disabled Disabled LE wri Soft OfFF by PWR BTTH LInstant OFf J CPU THA TIe rott ling 54 8 PVR Fail OFF Power Management Events Fress Enter He Keload Global Timer Events E Primary IDE H Disabled Secondary IDE A Disabled FDD CON LPT Port Disabled tl e ove Enter Select PU PD Ualue oe lk aE Exit Fi General He lp FS Previous Values Fo Fail Safe Defaul F7 Optimized Defaults Power Management Setup Menu lt ACPI Function Default Enabled ACPI stands for Advanced Configuration and Power Interface ACPI is a standard that defines power and configuration management interfaces between an operating system and the BIOS In other words it is a standard that describes how computer components work together to manage system hardware In order to use this function the ACPI specification must be supported by the OS for example Windows2000 or WindowsXP The available setting values are Enabled and Disabled lt ACPI Suspend Type Default S1 POS This option is used to set the energy saving mode of the ACPI function When you select S1 POS mode the power will not shut off and the power supply status will remain as it is In S1 mode the computer can be resumed at any time When you select S3 STRY mode the power will be
25. tRAS Default depend on memory This item allows you to set the precharge delay time The available setting values are Auto 4 15 System BIOS Cacheable Default Enabled Select Enabled to allow caching of the system BIOS which may improve performance If any other program writes to this memory area a system error may result The available setting values are Enabled and Disabled Foxconn Chapter 3 BIOS Description Video BIOS Cacheable Default Disabled Select Enabled to allow caching of the Video BIOS which may improve performance If any other program writes to this memory area a system error may result The available setting values are Enabled and Disabled lt Memory Hole At 15M 16M Default Disabled This option is used to determine whether the 15M 16M address field of memory is reserved for the ISA expansion card The available setting values are Enabled and Disbled PCI Express Root Port Func Press lt Enter gt to enter the following screen Phoenix wardBIOS CHOS Setup Utility PEL Express Root Port Fune PCI Express Port 1 Auta PEL Express Port DER PCI E Compliancy Mode EAR EN tive tMove Enteri elect PUSPOIValue FIDISaeve ESEIExit Fiibeneral Help FS Previous Values F Fail Safe Defaults F7 Optimized Defaults PCI Express Root Port Func Menu PCI Express Port 1 2 Default Auto This option is used to enable or disable PCI Express port 1 2 The available setting va
26. whether the USB Controller is enabled The available setting values are Disabled and Enabled lt USB 2 0 Controller Default Enabled This option is used to set whether the USB 2 0 Controller is enabled The available setting values are Disabled and Enabled lt USB Keyboard Support Default Disabled This option is used to set whether the USB keyboard controller is enabled in a legacy operating system such as DOS The available setting values are Disabled and Enabled lt USB Mouse Support Default Disabled This option is used to set whether the USB mouse controller is enabled in a legacy operating system such as DOS The available setting values are Disabled and Enabled Azalia AC97 Audio Select Default Auto This option is used to set whether onboard Azalia AC97 Audio is enabled The available setting values are Disabled and Auto PCI LAN Controller Default Enabled This option is used to set whether the PCI LAN controller is enabled The available setting values are Disabled and Enabled lt Onboard Lan Boot ROM Default Disabled This option is used to decide whether to invoke the boot ROM of the onboard LAN chip The available setting values are Disabled and Enabled Foxconn Chapter 3 BIOS Description Phoenix ae CHOS Setup Utility upe Onboard FDC Controller Enabled Item Help Onboard Serial Port i 3FR 1 R Onboard Bariai Port 2 2FR 1 RQ3 UART Hode Select Horna 1
27. will appear an error message The available setting values are Disabled and Enabled lt Boot Up NumLock Status Default On This item defines if the keyboard Num Lock key is active when your system is started The available setting values are On and Off Gate A20 Option Default Fast This option is used to set up the A20 signal control necessary for access to the 1MB memory The available setting values are Normal and Fast Typematic Rate Setting Default Disabled If this item is enabled you can use the following two items to see the typematic rate and the typematic delay settings for your keyboard The available setting values are Disabled and Enabled Typematic Rate Chars Sec Default 6 Use this item to define how many characters per second a held down key generated lt Typematic Delay Msec Default 250 Use this item to define how many milliseconds must elapse before a held down key begins generating repeated characters lt Security Option Default Setup When it is set to Setup a password is required to enter the CMOS Setup screen When it is set to System a password is required not only to enter CMOS Setup but also to startup your PC lt APIC Mode Default Enabled This option is used to enable or disable APIC function lt MPS Version Control For OS Default 1 4 This option is used to set up the version of MPS Table used in NT4 0 OS OS Select For DRAM gt 64MB Defau
28. A Enhanced Model PATA IDE Mode Primary SALTH Port WA VERT EK tlee Move Enter Select PU PD Ualue Fi Sauve F C kEvit Fi General Help FS Previous Values F Fail Safe Defaults F7 Optimized Defaults Onchip IDE Device Menu IDE HDD Block Mode Default Enabled This option is used to set whether the IDE HDD block mode is allowed The available setting values are Disabled and Enabled lt IDE DMA transfer access Default Enabled This option is used to set the IDE transfer access with it set to Enabled the IDE Transfer Access uses the DMA mode with it set to Disabled the IDE Transfer Access uses the PIO mode On Chip Primary Secondary PCI IDE Default Enabled Use this item to enable or disable the Primary Secondary PCI IDE channel that is integrated on the motherboard FOxconn Chapter 3 BIOS Description lt IDE Primary Secondary Master Slave PIO Default Auto These four items let you assign which kind of PIO Programmed Input Output is used by IDE devices Choose Auto to let the system auto detect which PIO mode is best or select a PIO mode from 0 4 lt IDE Primary Secondary Master Slave UDMA Default Auto UltraDMA technology provides faster access to IDE devices If you install a device that supports UltraDMA change the appropriate item on this list to Auto The available setting values are Disabled and Auto lt SATA Mode Default IDE This option is used to set the Serial ATA Mode The a
29. AN 6 with 6 Channel audio 8 with 8 Channel audio E with 1394 function S with SATA function R with RAID function You can find PPID label on the motherboard It indicates the functions that the motherboard has For example ON DUON AION IN OOO STAT OON MUUA UI OUUU MN UL B sibaOp Po BSiMO1 PE 8ELS 1 ee On the blue mark of the PPID label it means the motherboard supports 6 channel audio 6 1394 port E onboard 10Mb 100Mb LAN L SATA function S Chapter Thank you for purchasing FOXCONN 945P7AA series motherboard This series of motherboard is one of our new products and offers superior performance reliability and quality at a reasonable price This motherboard adopts the advanced Intel 945P ICH7 ICH7R chipset providing users a computer platform with a high integration compatibility performance price ratio This chapter includes the following information Main Features Motherboard Layout Foxconn Chapter 1 Product Introduction Main Features Size e ATX form factor of 12 inch x 9 6 inch Microprocessor e Supports Intel Pentium 4 processor in an LGA775 package e Supports FSB at 533MHz 800MHz 1066 MHz e Supports Hyper Threading technology e Supports FSB Dynamic Bus Inversion DBI Chipset e Intel 945P North Bridge ICH7 ICH7R South Bridge System Memory e Four 240 pin DDR2 DIMM slots e Supports Dual Channel DDR2 533 667 DIMMs e Available band
30. Cs 4 Whenever you uninstall a component place it on a grounded anti static pad or into the anti static bag that it came in FOXCONN Chapter2 Installation Instructions CPU This motherboard supports Smithfield Pentium 4 Celeron D Processor in an LGA775 package It also supports Hyper Threading Technology and FSB Dynamic Bus Inversion DBI Installation of CPU Below is the CPU socket illustration Follow these procedures to install a CPU Load plate Protective cover Load stiffener 1 Use thumb and forefinger to hold the hook of the load lever and pull the lever down and away from socket to unlock it Lift the load lever 2 Push down the rear tab with your forefinger to bring the front end of the load plate up slightly Open the load plate with thumb Be careful not to touch the contacts FOXCONN Chapter2 Installation Instructions 3 Hold CPU with thumb and forefinger Ensure fingers align to socket cutouts Match the CPU triangle marker to Pin 1 position as shown below The alignment key also provides the orientation directed function Lower the CPU straight down without tilting or sliding the CPU in the socket Pin 1 position Socket Cutouts 4 After installing the CPU remove the protective cover from load plate The protective cover is used to protect the contacts of the socket Do not discard the protective cover Always replace the socket cover if the CPU is removed from the sock
31. L2 cache The available setting values are Disabled and Enabled lt CPU L3 Cache Default Enabled optional This option is used to turn on or off the CPU L3 cache The available setting values are Disabled and Enabled lt Hyper Threading Technology Default Enabled This option is used to turn on or off the Hyper Threading function of the CPU The available setting values are Disabled and Enabled Note This function will not be displayed until a CPU that supports Hyper Threading has been installed First Second Third Boot Device Default Floppy Hard Disk CDROM This option allows you to set the boot device sequence The available setting values are Floppy LS120 Hard Disk CDROM ZIP100 USB FDD USB ZIP USB CDROM LAN and Disabled lt Boot Other Device Default Enabled With this function set to Enabled the system will boot from some other devices if the first second third boot devices failed The available setting values are Disabled and Enabled e Swap Floppy Drive Default Disabled lf you have two floppy diskette drives in your system this item allows you to swap the assigned drive letters The available setting values are Disabled and Enabled FOXCONN Chapter 3 BIOS Description lt Boot Up Floppy Seek Default Disabled This option controls whether the BIOS checks for a floppy drive while booting up If it cannot detect one either due to improper configuration or physical unavailability it
32. Off This option is used to set what action the PC will take with the power supply when it resumes after a sudden power failure The available options are Off remain in turn off status On auto power on and Former Sts resume with the previous status Power Management Events Press lt Enter gt to set the items of power management events Please refer to page 49 s Primary IDE 0 1 Secondary IDE 0 1 Default Disabled When these items are enabled the system will restart the power saving timeout counters when any activity is detected on any of the drives or devices on the primary or secondary IDE channels The setting values are Disabled and Enabled FDD COM LPT Port Default Disabled When this item is enabled the system will restart the power saving timeout counters when any activity is detected on the floppy disk drive serial port or the parallel port lt PCI PIRQ A D Default Disabled When this option is disabled any PCI device set as the Master will not power on the system Foxconn Chapter 3 BIOS Description Phoenix AwardBIO amp CHOSE GEET Utility ower Hanagement Event SE ey R Ki card Enabled Item Help Boy Ji NW ng Jo v WER Wak Ip From 53 enu Level ER une ll dE Disabled sf ol ith Ala HIN it La D app On By Mouse Disabled Pover On Hy Keyboard Disabled KR Power OH Paseword Enter Hot Key Power OW Ctrl Fi Tas eck Enter elect z PUzPD V0alue Fi Save ESC Exit Fi ES
33. SE e Current BIOS BIOS to be Updated MiType Fo ME Type Version Version segs Date Date Slee Mk rr O O Size hb D Fiash Part BOND ZMHMDEGb File Path ee IAGO Progress EN E be 6 Click lt Restart gt SuperUpdate A gt Current BIOs Toros to be Updated MIE I Update Success Versi o a WG R 8 p iia 4 Your new DIOS has been successfully downloaded and installed Please shot down and restart for it bo take efiert and load CMOS optimized defaults after mesian Do you wish to restart now Besun Verifying TT HK SES RN es Co Foxconn Chapter 5 Directions for Bundled Software SuperLogo SuperLogo is a Windows utility that allows users to change the BIOS sign on logo The utility is able to replace and backup the BIOS logo and update and backup the BIOS image within the Windows environment SuperLogo features 1 Supports Win2000 and WinXP 2 Supports 4Mb size flash parts flash write method is independent with flash type 3 Simple and easy to operate with a user friendly graphics interface 4 Supports BMP and JPEG graphic format files The best color is 16 or 256 colors The best resolution is 136 x 84 for top right logo and 640 x 480 or 800 x 600 for full screen logo Using SuperLogo Display the Flash Information SuperLogo 3 g ege E Minimize Window BIOS Write d BIOS Tiformation Exit Program Protect Status Proce Status Sa ROM Sikes _ a K About S
34. Statement This manual is the intellectual property of FOXCONN Inc Although the information in this manual may be changed or modified at any time FOXCONN does not obligate itself to inform the user of these changes Trademark All trademarks are the property of their respective owners Version User s Manual V1 0 in English for 945P7AA series motherboard P N 91 181 945 A1 0E Symbol description ct Note refers to important information that can help you to use motherboard better OH Attention indicates that it may damage hardware or cause data loss and tells you how to avoid such problems Warning means that a potential risk of property damage or physical injury exists More information If you want more information about our products please visit FOXCONN website www foxconnchannel com Declaration of conformity HON HAI PRECISION INDUSTRY COMPANY LTD 66 CHUNG SHAN RD TU CHENG INDUSTRIAL DISTRICT TAIPEI HSIEN TAIWAN R O C declares that the product Motherboard 945P7AA series is in conformity with reference to the specification under which conformity is declared in accordance with 89 336 EEC EMC Directive Wl EN 55022 A1 2000 Limits and methods of measurements of radio disturbance characteristics of information technology equipment V EN 61000 3 2 A14 2000 Electromagnetic compatibility EMC Part 3 Limits Section 2 Limits for harmonic current emissions equipment input current lt
35. ace Using SuperStep CPU Fan System Fani System Fan2 speed speed speed F _ SuperStep Adjust System Ss E Fan warning Seay ae Minimize Window criteria Q FRY Am GER i Exit Program d i ee e Tei Zum Zu x About SuperStep Adjust CPU E E SYS2 RPM SuperStep Help Fan warning SE E E criteria SEA Link to FOXCONN SE Vi EA st oo Website Go to Fan lees oe i SE warning criteria page Reset the Apply the warning criteria adjust to default ments settings Foxconn Chapter 5 Directions for Bundled Software Adjust voltages warning criteria upper limit page VEAT SuperStep WS A A i E 8 H EL hun St gt Current voltage lunes 7 g sev ae readings HIV lt ee ae 1s p 5 Go to Voltage ESCH EI rea H TF Reset the warning Apply the Adjust voltages criteria to default adjustments warning criteria settings Lower limit SupersStep CPU Temperature 7 5 L ii ek S b Current CPU mnn GD OD Adjust CPU tem Upper Temperature Threshold d e Temperature aa e perature warning Ee Ge criteria Current system Ltr 20 OC Temperatu re Upper Temperature Threshold 0 Adjust system temperature oan bn menge warning criteria Reset the warn A Apply the adjustments ing criteria to o to Temperature default settings page Foxconn Chapter 5 Directions for Bundled Software SuperStep E Ts Current PCI Express clock Current PCI clock Current CPU Clo
36. be automatically detected by the system lt Voltage Battery optional This option is used to show the voltage of battery Foxconn Chapter 3 BIOS Description lt CPU Temperature The current CPU temperature will be automatically detected by the system System Temperature The current system temperature will be automatically detected by the system e CPU Fan Speed The current speed of the CPU fan will be automatically detected by the system System Fan Speed The current speed of the system fan will be automatically detected by the system FOXCONN Chapter 3 BIOS Description Load Fail Safe Defaults Press lt Enter gt to select this option A dialogue box will pop up that allows you to load the default BIOS settings Select lt Y gt and then press lt Enter gt to load the defaults Select lt N gt and press lt Enter gt to exit without loading The defaults set by BIOS set the basic system functions in order to ensure system stability But if your computer cannot POST properly you should load the fail safe defaults to restore the original settings then carry out failure testing If you only want to load the defaults for a specific option you can select the desired option and press the lt F6 gt key Load Optimized Defaults Select this option and press lt Enter gt and a dialogue box will pop up to let you load the optimized BIOS default settings Select lt Y gt and then press lt Enter gt to loa
37. be restarted to release the hidden partition But the released partition is still unavailable for you after the system is restarted It s necessary for you to enable it by using FDISK PQMAGIC or some other tools SuperRecovery X XXX DIVIDE HIDDEN PARTITION RELEASE HIDDEN PARTITION u supe to release hidden partition Cap N3 Press key to release hidden partition and auto restart Foxconn Chapter6 Special BIOS Functions Backup select BACKUP to enter the Backup interface where you can find the following three sub function items BACKUP CMOS SETUP BACKUP PARTITION TABLE and BACKUP HARDDISK DATA Switch the highlight bar by pressing the arrow keys to make a selection and then press lt Enter gt to confirm your choice BACKUP GAUS SETUP BACKUP PARTITION TABLE BACKUP HARDDISK DATA CK TO HATH Backup the SETUP parametera CHOE data to hidden partition 1 Backup CMOS Setup A Support backing up of the CMOS data B The backing up or recovery of CMOS data should be done on a motherboard of the same type Backup is completed Press any hey to continue ache the SETIP parameters CHOS data ta liiian pana it titit 2 Backup Partition Table This function can help to backup all partition tables including extended partitions iHa Backup i completed Press any key to continue Backup partition table te hidden
38. bove picture Now you can enjoy the 8 channel audio function
39. cables for primary internal storage devices The current Serial ATA interface allows up to 150MB s data transfer rate GND SATA _1 SATA _2 SATA _3 SATA _4 SPDIF Out Connector optional SPDIF OUT Refer to Item 1 on motherboard layout in Chapter 1 for detailed location The SPDIF out connector is capable of providing digital 5V d audio to external soeak ers or compressed AC3 data to Bee an external Dolby digital decoder GND Note The empty pin of SPDIF cable should be aligned o empty pin of S PDIF out connector SPDIF_OUT Foxconn Chapter 2 Installation Instructions TPM Connector TPM Refer to Item 12 on motherboard layout in Chapter 1 for detailed location The TPM Trusted Platform Module provides the ability to the PC to run ee 2 applications more secure and to make 3 NC 4 Empty 5 N transactions and communication more NC trustworthy To utilize this function you o SERIRQ 7 17 GND should purchase addtional devices and Te CApn B ceN 9 3D3V_SYS_ 19 LPCPDJ a aeons 1 19 TPM 2 20 Front Audio Connector F_AUDIO Refer to Item 4 on motherboard layout in Chapter 1 for detailed location For 6 models optional The audio connector provides two kinds of audio output choices the Front Audio the Rear Audio Their priority is sequenced from high to low Front Audio to Rear Audio If headphones are plugged into the front panel of the chassis using the Front Audio then
40. ck Current CPU Ratio Exi CPU P Adjust the CPU External Frequency Reset to the default Go to Apply the settings Clock page adjustments SuperStep WI f oa r Check for the CPU Veore rUn 8 t VDDR gf SYS FANT system to auto 3 3V SYS FAN2 matically provide RN CPU Temp H 12V SYS Temp i warning mes 12V 5VSB sages SN VBAT Monitoring Interval E Adjust the _ Sep m monitoring M coset SSS Interval Go to Alarm page Reset to the Apply the default settings changes Foxconn Chapter 5 Directions for Bundled Software SuperUpdate SuperUpdate is a Windows utility that allows users to backup and upgrade the system BIOS SuperUpdate features 1 Supports Win2000 and WinXP 2 Supports 4Mb size flash parts flash write method is independent of flash type 3 Simple and easy to operate with a user friendly graphics interface Using SuperUpdate Browse BIOS bin file Perform the BIOS update from local HDD from local image le a SuperUndete b A cur Be e108 tone Updated Current ye ay a CG Minimize Window BIOS ee SE eS Exit Program ee gt About SuperUpdate Eating WE a SETS ne SuperUpdate Help Verifying messe eg e a Link to Foxconn Website Show the latest Backup system BIOS version BIOS to an image file Foxconn Chapter 5 Directions for Bundled Software Backup BIOS to local image 1 Click lt Backup gt and name your BIOS binary file to backup
41. cut off after a delay period The status of the computer before it enters STR will be saved in memory and the computer can quickly return to previous status when the STR function wakes When you select S1 amp S3 mode the system will automatically select the delay time Run VGABIOS if S3 Resume Default Auto This option allows the system to initialize the VGABIOS from S3 Suspend to RAM sleep state when you select S3 STRY mode in the above option The available setting values are Auto Yes and No lt Power Management Default User Define This option is used to set the power management scheme The available setting values are User Define Min Saving and Max Saving FOXCONN Chapter 3 BIOS Description Vdieo Off Method Default DPMS This option is used to define the video off method Blank Screen mode means that after the computer enters power saving mode only the monitor will close however the vertical and horizontal scanning movement of the screen continues When you select the V H SYNC Blank mode the vertical and horizontal scanning movement of screen stops when the computer enters power saving mode DPMS mode is a new screen power management system and it needs to be supported by the monitor you re using lt Video Off In Suspend Default Yes This option is used to determine whether the video is turned off when the system enters sleep mode The setting values are No and Yes
42. d the optimized defaults Select lt N gt and press lt Enter gt to exit without loading The defaults set by BIOS are the optimized performance parameters for the system to improve the performance of your system components However if the optimized performance parameters are not supported by your hardware devices it will likely cause system reliability and stability issues If you only want to load the optimized default for a specific option select the desired option and press the lt F7 gt key Set Supervisor User Password The access rights and permissions associated with the Supervisor password are higher than those of a regular User password The Supervisor password can be used to start the system or modify the CMOS settings The User password can also start the system While the User password can be used to view the current CMOS settings these settings cannot be modified using the User password When you select the Set Supervisor User Password option the following message will appear in the center of the screen which will help you to set the password Enter Password Enter your password not exceeding 8 characters then press lt Enter gt The password you enter will replace any previous password When prompted key in the new password and press lt Enter gt FOXCONN Chapter 3 BIOS Description If you do not want to set a password just press lt Enter gt when prompted to enter a password and in the screen the followi
43. eatures gt menu to set the CPU clock Save and exit BIOS Setup your system will now boot successfully Phoenix G wardBIOS CHOS Setup Utility Standard CMOS Features PE Health Status BIOS Features Load Fail Safe Defaults Advanced BIOS Features Load Optimized Defaults Advanced Chipset Features Set Supervisor Password Integrated Peripherals Set User Password Power Management Setup Save amp Exit Setup PoP PEL Configurations Exit Without Saving Ese Quit Select Item Fil Save amp Exit Setup Support Clone BIOS Innovation Phoenix Award l s CHOS Setup Utility BIOS Features Superfoot ter Help OUT Te TE Disabled Meng Level F Su j F dl IK I roti 1 Superb lO Protect Disabled Hi Hecer Super Recovery Hotkey LSHIFT F12 x D up E ch ed b SuperSpeed Press Enter Ti iMowe EmtersSelect 4 PU PDIValue FIOsSave ESC Ezit FirGeneral Help FS Previous Values F Faaul Safe Defaults Fz Optimized Defaults BIOS provides you with a set of basic values for your processor selection in stead of the jumper settings The processor speed can be manually set from the lt BIOS Features gt menu screen Warning Be sure your selection is right CPU overclock can be dangerous We will not be responsible for any damage caused Foxconn Appendix Using 8 channel Audio optional 1 Introduction 8 channel audio is the highest surround sound standard available adding two speakers over existing
44. ee Move Enter Select PU PD Ualue Fi Save ESC Exit Fi General Help FS Previous Values F Fail Safe Defaults F7 Optimized Defaults CPU Feature Menu Delay Prior to Thermal Default 16Min This option is used to set the delay time before the CPU enters auto thermal mode The setting values are 4 Min 8 Min 16 Min 32 Min lt Thermal Management Default Thermal Monitor 1 This option is used to manage Prescott CPU thermal s Limit CPUID MaxVal Default Disabled The option is used to set limit CPUID MaxVal The available setting values are Disabled and Enabled FOXCONN Chapter 3 BIOS Description Hard Disk Boot Priority This option is used to select the priority for HDD startup After pressing lt Enter gt you can select the HDD using the lt PageUp gt lt PageDn gt or Up Down arrow keys and change the HDD priority using lt gt or lt gt you can exit this menu by pressing lt Esc gt Virus Warning Default Disabled Allows you to choose the VIRUS warning feature for IDE hard disk boot sector protection If this function is enabled and someone attempts to write data into this area BIOS will show a warning message on screen and an alarm will beep The setting values are Disabled and Enabled Note Such function provides protection to the start up sector only it does not protect the entire hard disk CPU L1 amp L2 Cache Default Enabled This option is used to turn on or off the CPU L1 and
45. es with the level The higher the level goes up the higher frequency increases FOXCONN Advanced BIOS Features Chapter 3 BIOS Description Phoenix pe CHOE Setup Utility H CPU Feature t Hard Disk Boot Priority F Hetwork Boot Priority Virus Warning CPU Li amp L2 Cache GPU L3 Cache jduanced BIOS Features Fress Enter Item Help Press Enter Fress Enter Henu Leve F Disabled Enabled Enabled Hyper Threading Techno logy Enabled i Floppy Hard Disk CDROM First Boot Device Second Boot Device Third Boot Device Boot Other Device swap Floppy Drive Boot Up Floppy Seek Hoot Up NunLock Status Gate AZG Option Enabled Disabled Disabled Typematic Hate Setting DO GET ERT tat Char i I ypem 1c De 1 Leer S I Security Option Setup tie Move Enter Select PU PD UValue Fi Save ESC Exit Fi General Help FS Previous Values F Fail Safe Defaults F7 Optimized Defaults Advanced BIOS Features Menu lt CPU Feature Press lt Enter gt to enter the following screen Phoenix AwardBIO amp CHO Setup Utility CPU Feature Delay Prior to Thermal 16 Min Item Help Thermal Monitor i Thermal Management TH2 Hus Ratio B a TH2 Bus VID 0 83750 Limit CPUID axUal Disabled When enabled a UMM CLE Function Auto can utilize the Execute Disable Bit Enabled additional Virtualization Technology Enabled hardwarecapabilities provided by Vanderpool lechno logy tl
46. et FOXCONN Chapter2 Installation Instructions 5 Close the load plate and slightly push down the tongue side Warning Excessive temperatures will severely damage the CPU and system Therefore you should install CPU cooling fan and make sure that the cooling fan works normally at all times in order to prevent overheating and damaging to the CPU Please refer to your CPU fan user guide to install it properly FOXCONN Chapter2 Installation Instructions Qualified CPU Vendor List The following table lists the CPUs that have been tested and qualified for use with this motherboard Frequency Kernel Stepping FSB MHz C me 2s Peson o me 306 Prescot Do 800 Intel Intel o 106 o mie Intel Intel 800 800 800 800 533 800 800 800 800 800 800 00 8 Foxconn Chapter 2 Installation Instructions Memory This motherboard accomodates four 240 pin DDR2 DIMM slots These slots support 256 Mb 512 Mb and 1 Gb DDR2 technologies for x8 and x16 devices The available bandwidth is up to 5 3GB s DDR2 667 for Single Channel mode and 10 7 GB s DDR2 667 in Dual Channel Interleaved mode Before you install memory modules please make sure that all DIMMs in one system are of the same type To ensure normal operation you must install at least one memory bank Memory Qualified Vendor List The following table list is the memory modules that have been tested and qualified for use wit
47. h this motherboard Qualified DDR2 Memory Vendor List Vendor sze Type APACER APACER CORSAIR CORSAIR CORSAIR INFINEON INFINEON SAMSUNG SAMSUNG DDR2 533 DDR2 533 DDR2 533 DDR2 675 DDR2 675 DDR2 533 DDR2 533 DDR2 533 DDR2 533 DDR2 675 DDR2 533 DDR2 533 i Note Make sure to use the tested and qualified DDR2 modules listed above FOXCONN Chapter2 Installation Instructions Installation of DDR2 Memory 1 There is only one gap in the middle of the DIMM slot and the memory module can be fixed in one direction only Unlock a DIMM slot by pressing the module clips outward 2 Align the memory module to the DIMM slot and insert the module vertically into the DIMM slot 128 Pins 112 Pins 3 The plastic clips at both sides of the DIMM slot will lock automatically Warning Be sure to unplug the AC power supply before adding or removing expansion cards or other system peripherals especially the memory devices otherwise your motherboard or the system memory might be seriously damaged FOXCONN Chapter2 Installation Instructions Power Supply This motherboard uses an ATX power supply In order to avoid damaging any devices make sure that they have been installed properly prior to connecting the power supply 4 pin ATX _12V Power Connector PWR2 The ATX power supply connects to PWR2 and 4 pin ATX_12V power connector provides power to the CPU For detailed location p
48. he connector connects to the case s IDE indicator LED indicating the activity status of hard disks Reset Switch RESET Attach the connector to the Reset switch on the front panel of the case the system will restart when the switch is pressed Power LED Connector PWRLED Attach the connector to the power LED on the front panel of the case The Power LED indicates the system s status When the system is in SO status the LED is on When the system is in S1 status the LED is blink When the system is in S3 S4 S5 status the LED is off Power Switch Connector PWRSW Attach the connector to the power button of the case Pushing this switch allows the system to be turned on and off rather than using the power supply button FOXCONN Chapter2 Installation Instructions Audio Connectors AUX_IN optional CD_IN Refer to Item 2 3 on motherboard layout in Chapter 1 for detailed location respectively CD_IN AUX_IN are Sony standard CD audio connectors they can be connected to a CD ROM drive through a CD audio cable AUX L CD_R RK A B GND GND i we we AUS IN optional CD_IN Fan Connectors SYS_FAN1 CPU_FAN Refer to Item 16 23 on motherboard layout in Chapter 1 for detailed location respectively The fan speed of CPU_FAN and SYS_FAN can be detected and viewed in PC Health Status section of the CMOS Setup Connect the CPU fan system fan power cable to the CPU_FAN and SYS_FAN1 connectors respectively 1 CONTROL
49. ial BIOS Functions Main Menu select a HDD to enter main menu There are five function items Divide Hidden Partition Release Hidden Partition Backup Recovery and Change Password You can switch the highlight bar to make a selection on the opera tion which should be performed on the HDD and confirm your selection by pressing lt Enter gt The following operation will be performed on the disk you selected 77 DI 77 DI DIVIDE HIDDEN PARI ITIO RELEASE HI DDEM PARTITION RECOVERY CHANGE PASSWORD EXIT For dividing hidden partition to make protect area on On line help current LE Will lest all of HEP data and need to adjust HDD aga message Divide Hidden Partition 1 What is a Hidden Partition SuperRecovery can be used to divide a hidden partition which is to be reserved for backing up HDD data The partitioning will erase all the old data saved in the HDD to make sure that the following operations can be continued Once the division is done any future variation to the HDD will never affect the hidden partition such as virus causing turbulence windows system breaking down or data loss SuperRecovery can recover all the data backed up in hidden partition letting you easily get your computer on track again 2 Divide Hidden Partition A Enter a percentage of the HDD total capacity or an actual size in MB as the size of the hidden partition such as 30 or 3000 Press lt Enter gt
50. lease refer to Item 28 on the motherboard layout in Chapter 1 24 pin ATX power connector PWR1 PWR1 is the ATX power supply connector Make sure that the power supply cable and pins are properly aligned with the connector on the motherboard Firmly plug the power supply cable into the connector and make sure it is secure For detailed location please refer to Item 19 on the motherboard layout in Chapter 1 3 3V I GND GND IRSVD 5V 12V GND GND 5V GND PSON 5V align the connector Note We strongly recommended you use 24 pin power supply If you want to use 20 pin power supply you need to align the ATX power connector according to the right picture FOXCONN Chapter2 Installation Instructions Rear Panel Connectors This motherboard provides the ports as below 6 models optional 1394 Port 4 Parallel Port Printer Port O optional LAN Ports optional Q PS 2 Mouse Connector Line in Line out 2 PS 2 Keyboard Connector Microphone 6 Serial Port S PDIF Coaxial USB 2 0 Ports COM1 Out Port 8 models optional PS 2 Mouse Connector This green 6 pin connector is for a PS 2 mouse PS 2 Keyboard Connector This purple 6 pin connector is for a PS 2 keyboard Serial Port COM1 This 9 pin COM1 port is for pointing devices or other serial devices Parallel Port Printer Port This 25 pin port connects a parallel printer a scanner or other devices
51. led INT Pin 1 8 Assignment Default Auto This option is used to name the interrupt request IRQ line assigned to a device connected to the PCI interface on your system FOXxconn Chapter3 BIOS Description lt Maximum Payload Size Default 4096 This option is used to set maximum TLP payload size for PCI Express devices The unit is byte The available setting values are 128 256 512 1024 2048 4096 PC Health Status Phoenix AwardBIOs SE eet up Utility PC Health St se Open Warning Disabled Item Help Shu m Tenperatu Disabled en arning Tempera Euta Disabled CPU UC ti ea Smart Fan Control Enabled Select f fPUSPDsUValue Fi Save ESC Exit Fi Ge SE A Ip Ga SE Buet ZC CS Fail Safe ee F7 ptimized De fa PC Health Status Menu lt Case Open Warning Default Disabled This option is used to enable or disable case open warning function The setting values are Disabled and Enabled Shutdown Temperature Default Disabled This option is used to set the system temperature upper limit When the temperature exceeds the setting value the motherboard will automatically cut off power to the computer lt Warning Temperature Default Disabled This option is used to set the warning temperature for the system When the temperature of CPU is higher than setting value the motherboard will send off warning information e CPU Vcore Vddr 3 3 V 12 V 5 0V optional The current voltages will
52. lt Non OS2 This item is only required if you have installed more than 64 MB of memory and you are running the OS 2 operating system Otherwise leave this item at the default FOXCONN Chapter 3 BIOS Description Advanced Chipset Features Phoenix A wardBIOS CHOS Setup Utility Advanced Chipset Features BRAN Ti ini ag Se le ectable By SPD Item Help x i j i z BRAN nase be CASH ela ij x Do e Precharge i Precharge de aly ICH H Ser Gs CHE Cache able Enabled Video EIOS Cacheable Disabled Memory Hole At 154 16 Disabled t PEL Express Hoot Port Fune Press Enter tive iMove EnteriSelect PUSPOIValue FIOISave ESCIExit Fiibeneral Help FS Previous Values ee ee eet ee F7 Optimized Defaults Advanced Chipset Features Menu lt DRAM Timing Selectable Default By SPD This item determines DRAM clock timing using SPD or manual configuration The available setting values are By SPD and Manual CAS Latency Time Default depend on memory This item determines CAS Latency The available setting values are 3 2 5 2 and Auto lt DRAM RAS to CAS Delay Default depend on memory This item allows you to select a delay time between the CAS and RAS strobe signals The available setting values are 5 4 3 2 and Auto lt DRAM RAS Precharge Default depend on memory This item allows you to select the DRAM RAS precharge time The available setting values are 5 4 3 2 and Auto Precharge delay
53. lues are Auto Enabled Disabled PCI E Compliancy Mode Default v1 0a This option is used to select the PCI Express compliancy mode version The available setting values are v1 0a v1 0 FOXCONN Chapter 3 BIOS Description Integrated Peripherals Phoenix AwardBIOS CHOS Setup Utility Integrated Peripherals t OnChip IDE Device Press Enter Item Help t Onboard Device Press Enter t Super In Device Press Enter Menu Level V tive iMove EnteriSelect E TT dd HUTT HRC EW HIT Help FS Previous Values F Fail Safe Defaults F7 Optimized Defaults Integrated Peripherals Menu Use the arrow keys to select your options press the lt Enter gt key to enter the setup sub menu The options and setting methods are discussed below Phoenix AwardBIO amp CHOS Setup Utility OnChip IDE Device IDE HDD Block Mode Enabled Item Help IDE DHA transfer access Enabled On Chip Primary PCI IDE Enabled Menu Level kk IDE Primary Master PIO Auto J IDE Primary Slave PIO Auto If your IDE hard drive IDE Primary Master UDMA Auto supporte block mode IDE Peimary Slave UDMA Auta select Enabled for On Ghip Secondary PCI IDE LEnabled automatic detection of IDE Secondary Master PIO Auto the optimal number of IDE Secondary Slave PIO Auto block read writes per IDE Secondary Master UDMA Auto sector the drive can IDE Secondary Slave UDMA Auto Support ee On Chip Serial ATA Setting SATA Hode IDE On Chip Serial AL
54. nd you wi be promptads o No Errors The system boot will not stop for any errors that may be detected All But Keyboard The system boot will not stop for a keyboard error but it will stop for all other errors All But Diskette The system boot will not stop for a diskette error but it will stop for all other errors All But Disk Key The system boot will not stop for a keyboard or disk error but it will stop for all other errors Foxconn Chapter 3 BIOS Description Memory This is a Display Only Category determined by POST Power On Self Test of the BIOS conventional memory installed in the system Extended Memory The BIOS determines how much extended memory is rein aunta Me POST o TS FOXCONN Chapter 3 BIOS Description BIOS Features x AwardBIOS CHOS Setup Utility BIOS Features supertaot SuperBoot Disabled Supert I0s Frotect SuperB liS FProtect Disabled Superllecavery SuperRecovery Hotkey LSHIFT F 12 Item Help Superspeed SuperSpeed Press Enter tive Move EnteriSelect PUSPOIValue FIDISave ESEIExit Fiibeneral Help FS Previous Values F Fail Safe Defaults F7 Optimized Defaults BIOS Features Menu lt SuperBoot SuperBoot Default Disabled SuperBoot allows system relevant information to be stored in CMOS upon the first normal start up of your PC and the relevant parameters will be restored to help the system start up more quickly on each sub
55. ng message will appear If no password is keyed in any user can enter the system and view modify the CMOS settings PASSWORD DISABLED Press any key to continue Under the menu Advanced BIOS Features Setup if you select System from the Security Option you will be prompted to enter a password once the system is started or whenever you want to enter the CMOS setting program If the incorrect password is entered you will not be permitted to continue Under the menu Advanced BIOS Features Setup if you select Setup from the security Option you will be prompted to enter a password only when you enter the CMOS setting program Save amp Exit Setup When you select this option and press lt Enter gt the following message will appear in the center of the screen SAVE to CMOS and EXIT Y N Y Press lt Y gt to save your changes in CMOS and exit the program press lt N gt or lt ESC gt to return to the main menu Exit Without Saving If you select this option and press lt Enter gt the following message will appear in the center of the screen Quit Without Saving Y N N Press lt Y gt to exit CMOS without saving your modifications press lt N gt or lt ESC gt to return to the main menu Cha pte r a The utility CD that came with the motherboard contains useful software and several utility drivers that enhance the motherboard features This chapter includes the following informa
56. ntegrated Peripherals Set User Password Power Management Setup Save amp Exit Setup t PoPSPO Configurations Exit Without Saving Esc Quit Select Item ID Fil Save amp Exit Setup Main Menu The items in the main menu are explained below Standard CMOS Features The basic system configuration can be set up through this menu BIOS Features The special features can be set up through this menu FOXCONN Chapter 3 BIOS Description Advanced BIOS Features The advanced system features can be set up through this menu Advanced Chipset Features The values for the chipset can be changed through this menu and the system performance can be optimized Integrated Peripherals Onboard peripherals can be set up through this menu Power Management Setup All the items of Green function features can be set up through this menu PnP PCI Configurations The system s PnP PCI settings and parameters can be modified through this menu PC Health Status This will display the current status of your PC Load Fail Safe Defaults The fail safe default BIOS settings can be loaded through this menu Load Optimized Defaults The optimal performance settings can be loaded through this menu however the stable default values may be affected Set Supervisor User Password The supervisor user password can be set up through this menu Save amp Exit Setup save CMOS value settings to CMOS and exit setup Exit Without Saving Aband
57. on all CMOS value changes and exit setup Foxconn Chapter 3 BIOS Description Standard CMOS Features This sub menu is used to set up the standard CMOS features such as the date time HDD model and so on Use the arrow keys to select the item and set up and then use the lt PgUp gt or lt PgDn gt keys to choose the setting values Phoenix wardBIOS CHOS Setup Utility Standard CHOS Features Date Cmmacddiyy Mon Dee 13 2004 Time Chhimmiss 19 57 IDE Channel 0 Haster Hone e a IDE Channel O Slave Hone Change the day month t IDE Chansel 1 Master Hone year and century KK IDE Channel 1 Slave fane IDE Channel 2 Master Hone KK IDE Channel 3 Slave Hone Drive Ce 3 5 in Drive E Hone Hides EGa GA Halt On All But Keyboard Base Heroi d GIE Extended Henory a el 4 lotal Memaryg 102 ak Tiee Move Enteri elect PUSPOI Value FIOISave ESEIExit FiibGeneral Help FS Previous Values a eee et ee F7 Optimized Defaults Standard CMOS Features Menu Date This option allows you to set the desired date usually as the current date with the lt day gt lt month gt lt date gt lt year gt format Day weekday from Sun to Sat defined by BIOS read only Month month from Jan to Dec Date date from 1 to 31 can be changed using the keyboard Year year set up by users Time This option allows you to set up the desired time usually as the current time with lt hour gt lt minute gt lt
58. ont Lii fecover Hacter Doot Record CARRS from the hidden partition 3 Recover Hard disk Data Foxconn Chapter6 Special BIOS Functions This item is used to restore the backed up data from the hidden partition fire you ture to recover ADD data from hidden parc ition ZC Presse ERC to exit or any other key to continue a Becover harddisk image rom the hidden partition Original kizee 2079955448 Walid fisze a Flapoad Time Aird Conpresced Size 1A31L1HP Canpeesoed Rate Ei Recovery is campleted Press any bey to continue 4 Back to Main This item is used to exit the Recovery interface CHANGE PASSWORD Introduction A select CHANGE PASSWORD to enter the Change Password interface A Enter the old password first Press lt Enter gt if password is null B Enter the new password Then enter the same again to confirm it C Press lt Enter gt for null password D The password will be saved in the hidden partition Change or pet the partime for security of current driver EOSCOnn Chapter6 Special BIOS Functions SuperSpeed SuperSpeed is a powerful and efficient easy technology for PC DIY fans It offers a friendly interface Users can set the CPU Clock easily in the BIOS setup Procedures 1 oo IS Correctly install your CPU Plug in other configurations and restore the system Switch on power to the system and press the lt Del gt key to enter BIOS Setup Enter the lt BIOS F
59. oots up the first time and restores the parameters for the system thus letting the PC boot freely and rapidly Phoenix AwardBIOS CHOS Setup Utility t Standard CHOS Features PE Health Status BIOS Features Load Fail Safe Defaults t Advanced BIOS Features Load Optimized Defaults Advanced Chipset Features Set Supervisor Password t Integrated Peripherals Set User Password Power Management Setup Save amp Exit Setup t PoPYPO Configurations Exit Without Saving Ese Quit Select Item Fil Sawe amp Exit Setup Support Clone BIOS Innovation Phoenix AwardBIOS CHOS Setup Utility BIOS Features Lsp nont item Help SuperBoot Disabled Hi erh US Proiec SuperBlOs Protect Disabled ET erh COVEY SuperRecovery Hotkey LSHIFT F 12 ET er Spe d l SuperSpeed Press Enter ti sMove Inter Select PU PD Value Fi Sange ESC Exit FirGeneral Help FS Previous Values F Farl sate Defaults Fil Optimized Defaults Notes 1 If the previous boot was not completed then the BIOS will perform a normal POST even if SuperBoot is enabled 2 No matter whether SuperBoot is enabled or not the BIOS will perform a normal POST if the CMOS fails EOSCOnn Chapter6 Special BIOS Functions SuperBlOS Protect The BIOS of the motherboard is contained inside the Flash ROM Severe viruses such as the CIH virus are so dangerous that they may overwrite the BIOS If the BIOS has been damaged the system will be unable to boot We provide
60. per 19 24 pin ATX Power Connector 20 FDD Connector 21 IrDA Connector 22 DIMM Slots 23 CPU Fan Connector 24 South Bridge ICH7 7R 29 North Bridge 945P 26 CPU Socket 27 PCl Express x16 Slot 28 4 pin 12V ATX Power Connector RI Note The above motherboard layout is provided for reference only please refer to the physical motherboard e Chapter This chapter introduces the hardware installation process including the installation of the CPU memory power supply slots rear panel and pin headers and the mounting of jumpers Caution should be exercised during the installation of these modules Please refer to the motherboard layout prior to any installation and read the contents in this chapter carefully This chapter includes the following information CPU Memory Ze Ze Ze Si Ze Power supply Rear Panel Connectors Ze Other Connectors Expansion Slots Ze Ze Jumpers FOXCONN Chapter2 Installation Instructions Attention Take note of the following precautions before you install components or change settings 1 Use a grounded wrist strap or touch a safely grounded object such as an attached power supply before handling components to avoid damaging them due to static electricity 2 Unplug the power cord before opening your chassis or touching any component 3 Hold components by their edges to avoid touching any exposed integrated circuits I
61. put e Supports Intel High Definition Audio e Supports high quality differential CD input PCI Express x16 Support e Supports 4 GB sec 8 GB sec concurrent bandwidth e Low power consumption and power management features Green Function e Supports ACPI Advanced Configuration and Power Interface e Supports SO normal S1 power on suspend S3 Suspend to RAM S4 Suspend to disk depends on OS and S5 soft off Foxconn Chapter 1 Product Introduction Expansion Slots e Three PCI slots e Two PCI Express x1 slots e One PCI Express x16 graphics slot Advanced Features e PCI 2 3 specification compliant e Supports Windows 2000 XP soft off e Supports Wake on LAN function optional e Supports PC Health function capable of monitoring system voltage CPU system temperature and fan speed EOSCODD Chapter1 Product Introduction Motherboard Layout 98909998 O QO 98999999 ODO 1 SPDIF OUT Connector optional 2 AUX IN Connector optional 3 CD IN Connector A Front Audio Connector 5 PCI Expansion Slots 6 PCI Express x1 Slots 7 1394 Connector optional 8 USB Connectors 9 ATA 133 100 66 33 IDE Connectors 10 ATA 100 66 33 IDE Connector 11 Serial ATA Connectors optional 12 TPM Connector 13 Front Panel Connector 14 Chassis Intruder Connector 9 AAAA OQ 20 15 Clear CMOS Jumper 16 System Fan Connector 17 COM2 Connector 18 BIOS TBL Jum
62. s option is used to set whether the clock of an unused PCI slot will be disabled to reduce electromagnetic interference lt Spread Spectrum Default Disabled lf you enable spread spectrum it can significantly reduce the EMI Electro Magnetic Interference generated by the system lt Overclock Default Default This option is used to configure the overclocking and performance setting The available setting value are Default Manual Optimal Reference 1 Default indicates non overclocking 2 If Manual is selected the following options will be activated and user can set it personally System Memory Frequency Default Auto This option is used to set system memory frequency lt CPU Clock Default Depend on CPU This option is used to set CPU clock PCI Express Clock Default 100 This option is used to set PCI Express clock FOXCONN Chapter 3 BIOS Description lt PCI Bus Clock Default 33 33Mhz This option is used to set PCI Bus clock lt CPU Voltage Regulator Default Default The option is used to adjust the CPU voltage lt Memory Voltage Default Default This option is used to set memory voltage System Core Voltage Default Default This option is used to set system core voltage 3 If it is set as Optimal Reference Super Level will be enabled and shown Super Level Default L1 This option is used to set the overclock level Frequency setting vari
63. sequent start up The available setting values are Disabled and Enabled SuperBlOS Protect SuperBlOS Protect Default Disabled SuperBlOS Protect function protects your PC from viruses e g CIH The available setting values are Disabled and Enabled lt SuperRecovery SuperRecovery Hotkey Default LSHIFT F12 SuperRecovery provides the users with an excellent data protection and HDD recovery function There are 12 optional hotkeys and the default hotkey is LSHIFT F 12 SuperSpeed SuperSpeed Press lt Enter gt to set the items of SuperSpeed Setting these items are good for overclocking Please refer to the next page Warning Be sure your selection is right Overclocking will be dangerous We will not be responsible for any damage caused Foxconn Chapter 3 BIOS Description Bear gdBIOS CHOS Setup Utility ltem He lp CPU Clock Eatio i ha Auto Detect PCI Clk Spread Spectrum Disabled Overclock Default thee Move Enter Select PU PD Value FIG Seve ESC Ewit Fil General Help FS Previous Values F6 Fail Safe Defaults Fir Optimized Defaults SuperSpeed Menu Ratio Free Default Disabled This option is used to limit CPU ratio to minimum if CPU supports then user can furthest overclock external frequency to improve performance lt e CPU Clock Ratio Default Depend on CPU This option is used to set the ratio of an unlocked CPU lt Auto Detect PCI Clk Default Enabled Thi
64. the following solution which protects the system BIOS from being attacked by such viruses Phoenix GwardBIOS CHOS Setup Utility Standard CMOS Features PE Health Status BIOS Features Load Fail Safe Defaults Advanced BIOS Features Load Optimized Defaults Advanced Chipset Features Set Supervisor Password Integrated Peripherals Set User Password Power Management Setup Save amp Exit Setup Paf PCI Configurations Exit Without Saving Ese Quit Fil Save amp Exit Setup Select Item Support Clone BIOS Innovation Phoenix Awardh IOS CMOS Setup Utility BIOS Features Superfoot ien Help SuperBboot Disabled I reper US Froterct Superb I0S Protect Disabled i AWE H GAYE ry Superhecovery Hotkey LSHIFT F 12 OTT TT TT i SuperSpeed Fress Enter Tac age Enter Select PU PD Ualue F10 Save ESC Exit FirGeneral Help FS Previous Values F Farl ate Defaults Fit Optimized Defaults The way to implement this function Set SuperBlOS Protect as Enabled the BIOS will be protected FOXCONN Chapter 6 Special BIOS Functions SuperRecovery SuperRecovery is an easy to operate tool for backing up or recovering your hard disk data It offers simplified user interfaces with hotkey access and allows you to experience unprecedented high security and reliability with extra functions such as hotkey launch and powerful anti virus protection Features 1 Password Protection You can
65. the Line out Rear Audio 1 on the rear panel will not work If you do Sech nN MIC_PWR 5VA not want to use the Front Audio pin 5 and AUD_OUT R AUD_RET R 6 pind and 10 must be SHORT and then NA Empty AUD_OUT L AUD_RET L the signal will be sent to the rear audio port F AUDIO For 8 models optional e 1 The audio connector provides two kinds PORT1 L AUD GND of audio output choices the Front Audio PORT1_R PRESENCEJ the Rear Audio Front Audio supports re ER SENSE1_RETURN oe SENSE_SEND Empty tasking function Their priority is the same PORT2 L Er N F AUDIO Foxconn Chapter 2 Installation Instructions Addtional COM Connector COM2 Refer to Item 17 on motherboard layout in Chapter 1 for detailed location This motherboard provides an additional serial COM RTS SOUT header for your machine Connect one side of a switching cable to the header then attach the serial COM device to the other side of the cable Empty DSR SIN crs DTR COM2 Chassis Intruder Connector INTR Refer to Item 14 on motherboard layout in Chapter 1 for detailed location The connector connects to the chassis security switch on the case The system can detect the chassis intru INTRUDERJ sion through the status of this connector If the connec tor has been closed once the system will send a 1 2 message To utilize this function set Case Open Warn ing to Enabled in the PC Health Status section of the CMOS
66. tion Utility CD content Start to install drivers Foxconn Chapter 4 Driver CD Introduction Utility CD content This motherboard comes with one Utility CD To begin using the CD simply insert the CD into your CD ROM drive The CD will automatically displays the main menu screen FOXCONN os d sseries fq Install Driver O Accessories DI Browse CH fq Hanual fq HomePage 1 Install Drivers Using this choice you can install all the drivers for your motherboard You should install the drivers in order and you need to restart your computer after the driv ers are all installed A Chipset Software C ITE RAID Driver optional E Audio Driver G LAN 100M Driver optional IMSM Driver optional DirectX 9 0c LAN 1000M Driver optional USB2 0 Driver ee E 2 Accessories Use this option to install additional software programs A SuperUtility B Adobe Reader C Norton Internet Security D Word Perfect Office 12 3 Browse CD Click here to browse CD content 4 Manual Click here to view multilingual user manual amp RAID manual content 5 Homepage Click here to visit Foxconn motherboard homepage FOxconn vil Note 1 Install the latest patch first if your OS is Windows XP or Win dows 2000 Start to install drivers Install Drivers Chapter 4 Driver CD Introduction 2 Follow the CD screen order to install your motherboard drivers Select lt Install Driver gt
67. u perLogo BIOS Flash Rom Free Space SuperLogo Help Link to Foxconn website Go to ROM Info page Foxconn Chapter 5 Directions for Bundled Software Logo Step it Selecttbego Position E Full screen mode Gi Top Right mode E Boot without logo ss Follow the ri Wizard to complete the logo update SsuperLogo Select Backup Object Backup whole Nr fod cy Backup Logo BIOS image Follow the Wizard to complete the backup function SuperLogo Step 1 Select a B N File BIOS image BIN File Browse a BIN file file location for updating BIOS Go to Update BIOS page Chapter This chapter will introduce special functions of BIOS and how to use them in detail It can further exert the max potential of motherboard to bring you super value enjoyment This chapter introduces the following special functions of BIOS SuperBoot SuperBlOS Protect SuperRecovery Ze KL Ze Ze SuperSpeed Foxconn Chapter6 Special BIOS Functions SuperBoot SuperBoot technology greatly reduces the long boot process time of computers A BIOS without SuperBoot has to perform many routines every time when the system starts such as checking the system core and initializing system peripherals Now with SuperBoot a PC can bootup without any unnecessary SuperBoot is quite easy to use choose the right option in CMOS setup refer to BIOS features SuperBoot saves the information when the PC b
68. uceeavauauseeeeaeaesessueeatateeeeeeneeas Motherboard Layout 20 0 0 0c ccc cccccccececaccecececucuceceuccacaeeueuseceeavaueetevavauaenens Chapter gt Installation Instructions Expansion Slots 0 ccc cscs ccecececccccccccecucccucccccacacacacacacacacaeacucacacacaeaeateaeas JUMpeErS ee EE EE Chapter 3 BIOS Description Enter BIOS S tup ooo ccc c ccc cc ccececaccccccccecucaucuceceacauseseeataeaeeueesaeaeaeeenenaees Mammen Standard CMOS Features ccccececececececececececececaceuecacaucueueuenenenanenenass BIOS GEI Advanced BIOS Features ccccceccccsececeeeeeeececeeeeeseeeseseeaeeeeseeeeseeeesenees Advanced Chipset Features A Integrated Peripherals ccccsccssecceececeeeceeeseeeesseeseseeceeeseeeseeeseseesseesees Power Management Setup cccceccecseeeceeeeceeeeeeeeesseeeeseeeeseeeeseeseseeeessees PAP PC CONMGUPATONS seenen PO Reali StatUS EE Load Fail Safe Defaults 2 0 0 0 cccccecccsecceeeeeeeeeeeeeseeeseeeseuesseeeseeseeeeaeess Load Op mized Defaults siessen E Set Supervisor User Password cccccceccceeeceeeeeceeeeceeceeeeeeseuseseeesseeeeas Save amp Exit Setup eebe eg XIE VVITNOULE SAVING emgeet EE Table of Contents Chapter Driver CD Introduction BI OL COMES E Start to install divers Chapter Directions for Bundled Software BIO peie EE UID SI al NEE BU OTL Le BEE Chapter O Special BIOS Functions elle Ee EE EIERE EE deet
69. udes connectors for floppy devices IDE HDD devices Serial ATA devices USB devices IR module and others FDD connector FLOPPY Refer to Item 20 on motherboard layout in Chapter 1 for detailed location This motherboard includes a standard FDD connector supporting 360 K 720 K 1 2 M 1 44 M and 2 88 M FDDs HDD connectors PIDE SIDE1 SIDE2 Refer to Item 10 9 on motherboard layout in Chapter 1 for detailed location respectively This motherboard includes one Ultra DMA 100 66 33 IDE connector PIDE and two Ultra DMA 133 100 66 33 IDE connectors SIDE1 SIDE2 These connec tors support the provided Ultra DMA IDE ribbon cables We suggest you con nect the cable s blue connector to the IDE connector then connect the black connector to the master device and connect the grey connector to the slave device The two Ultra DMA 133 100 66 33 IDE connectors support IDE RAID You can reference the RAID MANUAL to install the IDE RAID OH Attention Ribbon cables are directional therefore make sure to always con nect with the cable on the same side as pin 1 of the PIDE SIDE1 SIDE2 or FDD connector on the motherboard Foxconn Chapter 2 Installation Instructions Front Panel Connector FP1 Refer to tem 13 on motherboard layout in Chap ter 1 for detailed location This motherboard includes one connector for connecting the front panel switch and LED indicators PWRLED PWRSW HD LED ResETN IDE LED Connector HD LED T
70. vailable setting values are IDE RAID AHCI lt On Chip Serial ATA Default Enhanced Mode This option is used to set the On chip Serial ATA function When it is set to Disabled the function will be disabled when it is set to Combined Mode four HDDs at most will be supported with it set to Enhanced Mode six HDDs at most will be supported for those under Windows 2000 and Windows XP only with it set to SATA Only only the S ATA HDD can be used PATA IDE Mode Default Primary When On Chip Serial ATA set as Combined Mode this option will be modified It is used to set the PATA IDE Mode The available setting values are Primary secondary lt SATA Port Default P2 P4 is Secondary This option is used to set the Serial ATA Port FOXCONN Chapter 3 BIOS Description Phoenix AwardBIOE CHOS Setup Utility Onboard Device USE Controller Enabled Item Help USE 2 0 Controller Enabled USE Keyboard Support Disabled enu Level USE House Support Disabled Il NK udio Select Auto ITE8 2l2 RAID Controller IDE Mode J Detecting D se Ti Quick Hodel 1394 Controller LEnabled l PCI Lan Controller S leg Onboard L Hoot ROM Disabled PCI E Lan rier lar Enabled Tas Seck Enter elect PU PD Ualue Fif Save C Exit Fi GE eo 5 Previous Values F Fail Safe Defaults T Ontiniz ed Defa Onboard Device Menu lt USB Controller Default Enabled This option is used to set
71. width up to 5 3GB s DDR2 667 for Single Channel mode and 10 7 GB s DDR2 667 in Dual Channel Interleaved mode e Supports 256 Mb 512 Mb and 1 Gb DDR2 technologies for x8 and x16 devices e Supports up to 4GB memory capacity e Supports non ECC DIMMs only USB 2 0 Ports e Supports hot plug e Eight USB 2 0 ports four rear panel ports two onboard USB connectors providing four extra ports e Supports wake up from S1 and S3 mode e Supports USB 2 0 Protocol up to 480 Mbps transmission rate Onboard Serial ATA optional e 300 MBps transfer rate e Supports up to four S ATA devices e Supports RAID 5 RAID 0 RAID 1 RAID 10 Matrix RAID Supported on ICH7R EOSCODD Chapter1 Product Introduction Onboard IDE RAID Controller 1T8212 optional e Two Ultra DMA 133 100 66 IDE connectors e Supports RAID 0 RAID 1 RAID 0 1 and JBOD configuration Onboard LAN L K optional e Supports 10 100 1000 K optional Mbit sec Ethernet e LAN interface built in on board Onboard 1394 E optional e Support hot plug e With rate of transmission at 400Mbps e Self configured addressing e Can connect with 2 independent 1394 units synchronously at most Onboard Audio 6 optional e AC 97 2 3 Specification Compliant e Supports SPDIF output e Onboard Line in jack Microphone jack Line out jack e Supports 6 channel audio setting via software Onboard Audio 8 optional e Supports 8 channel audio e Supports SPDIF out

Download Pdf Manuals

Related Search

945P7AA 8EKRS2

Related Contents

Manual do usuário  Hardinge B160A DD100 Direct  Huawei S3700-52P-PWR-SI  Cuisinart CCJ-100C User's Manual    Patent pending  Broil King FS-10 User's Manual    Samsung SyncMaster  6056 - Oster  

Copyright © All rights reserved. Failed to retrieve file