High resolution melting analysis for gene scanning
Contents
1. if no variants detected report within 3 h E Cycle sequence preparation PCR product dilution master mix preparation and plate loading in 30 min followed by cycle sequencing in 45 min Bio Rad C1000 F Capillary electrophoresis preparation ABI 3130x and product clean up in 30 min with capillary electrophoresis in 45 min G Sequencing data analysis in 45 min gt report variant s within 6 h The hatched area indicates overlap of cycle sequencing and capillary electrophoresis preparation 4 4 1 Detailed example The plate layout for CYBB is shown in Table 3 and allows the analysis of six samples per plate two columns per sample After primer deposition the plates are sealed centrifuged uncovered and then dried in a 37 C oven When reconstituted with 10 uL of PCR master mix and DNA the final concentration of each primer is 0 5 uM 4 4 2 Additional materials 1 Liquid handling instrument Nanodrop Express Innovadyne Technologies 2 Aluminum sealing tape VWR 82028 086 4 4 3 Procedure 1 Program the Nanodrop Express to dispense 2000 nL 2 uL of 2 5 uM primer pair solutions according to the plate pattern shown in Table 3 2 Label 14 sterile 1 5 mL microfuge tubes with the target gene and exon 3 Add 380 uL of water to each tube 4 Add 10 uL of 100 uM stock forward primer and 10 uL of 100 uM stock reverse primer to the tubes for a final primer concentration of 2 5 uM each One plate requires 12 uL of2. After an initial denaturation at 95 C for 10 s use 40 cycles of 94 C for 10 s the annealing gradient for 10 s and 75 C for 10 s followed with 1 cycle at 95 C for 10 s and a final hold at 15 C 3 Prepare PCR solutions with 1x master mix 0 5 uM each pri mer and 5 ng uL wild type DNA On the Bio Rad C1000 the annealing gradients are down microplate columns 8 wells so an appropriate mixture would be 40 uL of 2 5x LightScan ner Master 20 uL of 5x primer pair solution 10 uL of 50 ng uL DNA and 30 uL of water 4 Dispense 10 uL of the PCR solution into each well of a col umn on the 96 well microplate Up to 12 amplicons can be run on one plate at the same time 5 Add 12 uL mineral oil to each well seal the plate with opti cally clear sealing tape and spin for 30 s at 1600g 4650 rpm on the Eppendorf 5430 6 Place the plate in the gradient cycler and run the gradient PCR 7 Following PCR remove the plate from the thermal cycler and spin for 30 s at 1600g 8 Plates may be scanned immediately stored at room temper ature for less than a day or stored at 4 C for up to a month before analysis If plates have been refrigerated spin for 30 s at 1600g before analysis 9 Obtain melting curves on the LightScanner as detailed below in Section 5 2 10 Use the predicted melting curve profiles as a guide to ana lyze the melting curves generated from each primer pair on LightScanner software Determine the annealing
3. Although the optimal amplicon length and number of domains remains contro versial amplicons are typically kept below 400 base pairs with 3 or 252 M Erali CT Wittwer Methods 50 2010 250 261 branch site lt 20 50 bases splice site upstream intron NNCT SAY 15 14 13 12 11 10 9 8 7 6 NNYYYYYYYYYYYNCAGIGN exon MAG splice site downstream intron G GTRAGINN exon Fig 1 Consensus sequences for splicing and branch sites of human exons The branch site is typically 20 50 bases upstream of the exon Splice sites bracket each exon with consensus bases reaching at least 15 bases upstream and 6 bases downstream The colored bars indicate the proportion of each nucleotide at the position given A E C E T W G E Primers should be designed to avoid consensus bases where variation is likely to effect splicing fewer melting domains Large exons may require multiple ampli cons for full coverage 3 3 1 Detailed example Primers are designed to amplify the 13 exons of CYBB the gene responsible for the X linked form of chronic granulomatous dis ease OMIM 300481 accessible from http www ncbi nlm nih gov The reference sequence gene of CYBB is formatted and downloaded from the UCSC Genome Browser Then LightScanner primer design software Idaho Technology is used to simulta neously design primers for multiple exons This software automat ically breaks up large exons
4. DNA is added di rectly to the wells containing primers and mixed before amplification 256 Table 2 Format options for a 96 well plate M Erali C T Wittwer Methods 50 2010 250 261 Number of Number of Format options SEUUMIBLES ZLorplugertts Each amplicon goes Each sample goes into into 49 96 1 The entire plate 33 48 2 Four rows or six columns 25 32 3 Four columns 17 24 4 Two rows or three columns 13 16 5 6 Two columns 9 12 7 8 One row One column 7 8 9 12 One column One row 5 6 13 16 Two columns 4 17 24 Two rows or three columns 3 25 32 Four columns 2 33 48 Four rows or six columns 1 49 96 The entire plate Time hours 0 1 2 3 4 5 6 scan analysis cycle capillary analysis sequencing electrophoresis Variants identified gt Report within 6 hrs No variants detected gt Report within 3 hrs Fig 3 Workflow diagram for CYBB mutation scanning by high resolution melting analysis Wild type samples containing no variants can be reported within 3 h Rare samples with aberrant melting profiles are sequenced for variant identification and can be reported within 6 h A DNA preparation from whole blood in 60 min Roche MagNA Pure Compact with quantification and dilution in 15 min NanoDrop ND 8000 Spectrophotometer B PCR preparation in 15 min with PCR cycling in 45 min Bio Rad C1000 C Mutation scanning in 15 min Idaho Techonology LightScanner 96 D Scanning data analysis in 30 min
5. confirmation by sequenc ing unless more than one common cluster is present 4 3 1 Detailed example Melting curves are generated from the DNA of 95 healthy fe males for each CYBB primers pair DNA plates containing 95 differ ent DNA samples and a single no template control are first prepared Then PCR master mix containing one primer pair and all PCR reagents is added to all wells After PCR amplification the samples are melted and analyzed Results for CYBB exon 1 using 95 different DNA samples are shown in Fig 2 both as a normal ized overlaid melting plot and as a difference plot When no vari ants are present all curves should cluster tightly on the normalized plot as shown Difference plots magnify any variance between samples showing the single wild type cluster spread out over a fluorescence difference of about 1 A fluorescence dif ference of 5 has been suggested as a cutoff for identifying variant samples 41 4 3 2 Additional materials 1 DNA isolated from 96 random healthy females at 50 ng uL see Section 4 1 2 5x 2 5 uM primer pair solutions for the 13 CYBB exons with M13 tails see Section 4 2 3 1 4 3 3 Procedure 1 Prepare DNA microplates by adding 1 uL of DNA 50 ng uL to each well from 95 different healthy females Let the DNA solu tions evaporate 2 For each target combine 400 uL of 2 5x LightScanner Master Mix 200 uL of 5x primer pair solution and 400 uL water M Erali CT Wittwer M
6. in the Sequence menu 16 Append the appropriate M13 sequencing primers onto the 5 end of each primer to facilitate sequencing and synthesize the primers The complete amplicons with M13 tails should be considered when evaluating length and melting characteristics The primer se quences and sizes of the resulting PCR products are shown in Table 1 Primers to the amelogenin gene that amplify both the X and Y chromosomes are included to provide an amplification control and to identify male vs female DNA All primers are prepared by standard phosphoramidite synthesis and resuspended in 10 mM Tris pH 8 0 0 1 mM EDTA at 100 uM A260 2 0 3 4 Melting profile prediction Before any PCR is performed predict all amplicon melting curves in silico Although the mathematics is complex Poland s algorithm 38 as modified by Fixman and Freire 39 and imple mented by Steger 3 is freely available on public web sites Know ing what the melting curves should look like aids PCR optimization Although the absolute temperatures are seldom accurately pre dicted the shape and number of domains are usually correct The number of predicted domains is less important than matching the overall shape of the predicted curve to observation 3 4 1 Detailed example Access http www biophys uni duesseldorf de local POLAND Cut and paste an amplicon sequence including the M13 tails into the Sequence box on the website For thermodynamic par
7. population screening 4 4 Primer plate preparation 5 Performance 5 1 PCR 5 2 Scanning 5 3 Cycle sequencing 5 4 Capillary electrophoresis 3 Design Gene scanning assays usually need to cover multiple exons and or genes For simultaneous analysis all primer pairs need to be amplified under identical conditions preferably on one plate with a layout that is straightforward and convenient Following the above outline the gene s of interest 3 1 and known variants 3 2 are first identified Subsequent steps beginning with primer design and melting profile prediction are detailed below 3 3 Primer selection Primers are designed to bracket each region of interest Usually this includes exonic coding segments and adjacent intronic splicing regions Based on the consensus sequence associated with splicing 37 at least 15 bases upstream from the 5 end of the exon and 6 bases downstream from the 3 end of the exon should be included Fig 1 Probable splice branching sites can also be identified 10 50 bases upstream from the 5 end of each exon Regulatory and or promoter regions may be included if warranted by mutation frequency Both freely available http frodo wi mit edu primer3 and commercial software are useful in primer design Design criteria Should include a similar melting temperature Tas within 4 C of each other for all primers Primers with significant hairpins homodimers or heterodimers should be excluded
8. 0 5 C below the Tm The PCR products are evaluated by melting anal ysis as detailed below in Section 5 2 and compared to predicted melting curves Each primer pair is analyzed across the gradient and the annealing temperature range over which the product is pure is determined Most PCR products lt 200 bp will melt com pletely in one transition between 76 C and 94 C Some products especially those gt 300 bps melt in more than one transition multi ple domains If nonspecific products are present they usually ap pear on derivative plots as small melting peaks with low Tms Gel electrophoresis is only performed if the observed melting curves do not match the predicted profiles A final common annealing temperature is selected that is within the acceptable temperature windows of all primer pairs to produce specific PCR products Wide temperature windows indicate more robust designs Optimization of parameters beyond the annealing temperature including primer and Mg concentrations can be performed although it is often easier to replace difficult primer sets If a product melts at greater 254 M Erali C T Wittwer Methods 50 2010 250 261 than 92 C additives such as 5 10 DMSO and or 1 2 M betaine can be included to lower its melting temperature Evaporation dur ing cycling and potential contamination are prevented by both an oil overlay and sealing tape 4 2 1 Detailed example Annealing temperature optimization for the 1
9. 1 circled suggested a heterozygous sequence in the mixed sample The traces for the other 12 exons were normal Additional analysis of exon 11 for this unknown male sample is shown in Fig 5 258 M Erali CT Wittwer Methods 50 2010 250 261 samples trace each other very closely except for exon 11 where al tered curve shape of an unknown male sample indicates a variant Fig 5 compares the individual curves for exon 11 in more detail contrasting a normal sample to an unknown male specimen with a variant sequence 5 2 2 Procedure 1 Program the LightScanner as follows Hold Temp 67 C Start Temp 70 C End Temp 94 C Exposure Auto 2 Load the plate into the LightScanner inserting the notched edges first and start the run 3 When the run finishes about 10 min open the data folder for the scan just completed 4 Observe the tif screen image for even bright fluorescence Some signal attenuation on the plate edges is normal but very low or absent fluorescence in wells indicates likely deletion of entire exons Wild Type Sequence 0 8 5 Open the LightScanner software click on Scanning Analysis 6 Open the mlt Analysis File to analyze a run Follow either a or b a Ifyou have analyzed the same primer plate configura tion before same PCR products and plate layout import the previously saved subsets and cursor set tings by selecting Import and Scanning Analysis Find and load you
10. 3 exons of CYBB and a control gene are performed on a gradient cycler Results are compared to predicted melting curves and optimal tempera ture zones for the annealing temperature of each target are deter mined A common annealing temperature for all products must be found for co amplification on the same plate 4 2 2 Materials 1 Primers with M13 tails for the 13 CYBB exons and the amelo genin control target 100 uM 2 PCR master mix with heteroduplex detecting dye LightScanner Master Mix Idaho Technology containing Taq polymerase anti Taq antibody dNTPs magnesium chloride and LCGreen Plus dye 3 Hard shell thin walled 96 well microplates with white wells and a black shell Bio Rad HSP 9665 4 Light mineral oil Sigma M5904 5 Optically clear real time sealing tape for plates Bio Rad 223 9444 or equivalent 6 Gradient PCR instrument 96 well Bio Rad C1000 7 Plate centrifuge Eppendorf 5430 8 High resolution melting instrument Idaho Technology LightS canner 96 4 2 3 Procedure 1 Prepare 5x 2 5 uM primer pair solutions for each target by combining 5 uL of one primer stock with 5 uL of its paired primer stock each at 100 uM and diluting with 190 uL of water 2 Program the thermal cycler with an annealing temperature gradient 10 15 C above and 0 5 C below the predicted Tma of the primers use the Tas previously calculated by the LightScanner primer design program without the M13 tails
11. 30s at 1600g before analysis 9 Perform melting analysis on the LightScanner as detailed below in Section 5 2 Analyze the melting curves by normalization curve overlay temperature shifting and difference plots to identify heterozygous variants Common variants will cluster together and representative samples within any cluster can be sequenced as described below in Sections 5 3 and 5 4 4 4 Primer plate preparation The plate layout should maximize the number of samples that can be analyzed per plate Multiple amplicons on a single DNA sample can be analyzed in one or more columns or in one or more rows For ease of use and simplicity of design some wells may be left empty Table 2 provides options for formatting plates based on the number of samples and amplicons An example plate design for CYBB is shown in Fig 3 When multiple amplicons are analyzed the complexity of pri mer placement can be simplified by preparing primer plates with all primer sets robotically dispensed and dried into appropri ate wells Automated liquid handling instruments can be used to add primers to the appropriate wells After dispensing the plates are air dried in an oven and then stored at room temperature for as long as 8 months Alternatively the plates may be dried during centrifugation in a Speed Vac concentrator PCR setup is greatly simplified because the primer matrix is prepared before the assay is performed The PCR master mix with sample
12. C T Wittwer J Mol Diagn 11 2009 93 101 5 MJ Lay C T Wittwer Clin Chem 43 1997 2262 2267 6 K M Ririe R P Rasmussen C T Wittwer Anal Biochem 245 1997 154 160 7 S Pornprasert A Phusua S Suanta R Saetung T Sanguansermsri Eur J Haematol 80 2008 510 514 8 E P Price H Smith F Huygens P M Giffard Appl Environ Microbiol 73 2007 3431 3436 9 J Worm A Aggerholm P Guldberg Clin Chem 47 2001 1183 1189 10 V E Dujols N Kusukawa J T Mckinney S F Dobrowolski C T Wittwer in M T Dorak Ed Real Time PCR Garland Science New York 2006 pp 157 171 11 J S Farrar G H Reed C T Wittwer in G P Patrinos W J Ansorge Eds Molecular Diagnostics Elsevier London 2010 pp 229 245 12 M G Herrmann J D Durtschi L K Bromley C T Wittwer K V Voelkerding Clin Chem 52 2006 494 503 13 M G Herrmann J D Durtschi L K Bromley C T Wittwer K V Voelkerding Clin Chem 53 2007 150 152 14 M G Herrmann J D Durtschi C T Wittwer K V Voelkerding Clin Chem 53 2007 1544 1548 15 R Palais C T Wittwer in M L Johnson L Brand Eds Methods in Enzymology vol 454 Academic Press New York 2009 pp 323 343 16 M Liew R Pryor R Palais C Meadows M Erali E Lyon C Wittwer Clin Chem 50 2004 1156 1164 17 G H Reed C T Wittwer Clin Chem 50 2004 1748 1754 18 C N Gundry S F Dobrowolski Y R Mar
13. CR products may melt in multiple stages or domains with AT rich regions melting at lower temperatures than GC rich regions Typically melting do mains range from 50 to 500 bps 2 When more than one domain exists the Tm is not defined and melting curve prediction requires more complex recursive calculations 3 Thermal melting of DNA is conventionally monitored by UV absorbance For high quality melting curves ug amounts of DNA and rates of 0 1 1 0 C min are typically employed In contrast to absorbance monitoring DNA melting with fluorescence is more Corresponding author Address Department of Pathology University of Utah Medical School Salt Lake City UT 84132 USA Fax 1 801 581 6001 E mail address carl wittwer path utah edu C T Wittwer 1046 2023 see front matter 2010 Elsevier Inc All rights reserved doi 10 1016 j ymeth 2010 01 013 sensitive and only ngs are required conveniently provided by PCR amplification Fluorescent DNA melting in the context of real time PCR was introduced with the LightCycler in 1997 4 Small sample volumes and enhanced heat transfer allowed much faster melting rates of 0 1 1 0 C s Both probe melting for geno typing 5 and product melting with SYBR Green I 6 are widely used on real time instruments today Because DNA melting is such a simple process that requires no more than PCR and a generic DNA dye efforts to increase its infor mation content eventually led t
14. GTTAGACAC Ex9F GGCAAGTATTTAGGAAAAATGTCAT 401 ExOR GCTATTTAGTGCCATITTITCCTG Ex10F GAGCAAGACATCTCTGTAACT 276 Ex10R CTCTAAGGCCCTCCGAT Ex11F AGGGCCTGCCAAATATAAT 274 Ex11R CTGTACACTATGGGAAGGACC Ex12F GTATGTGCTTTTACAGAATGTCTC 260 Ex12R GCAGATGCAAGCCTCAA Ex13F ATCCCAAAGCTTGAAATIGTC 251 Ex13R CATTTGGCAGCACAACC amel F CCCTGGGCTCTGTAAAGAATAGTG 106 X amel R ATCAGAGCTTAAACTGGGAAGCTG 112 Y The following M13 sequencing tails were added 5 ACGACGTTGTAAAACGAC 3 to each forward and 5 CAGGAAACAGCTATGACC 3 to each reverse primer 4 Optimization High resolution melting analysis depends on comparing the melting curves of multiple samples Sequence differences are iden tified by subtle deviations in the melting profiles It is therefore critical to optimize the process by 1 reducing sample to sample variation in DNA preparation 2 developing robust specific PCR amplification of all products 3 demonstrating tight clustering of wild type samples and 4 obtaining consistent primer plates by automation 4 1 DNA preparation DNA extraction and purification should be standardized so that all samples are prepared in the same buffers to minimize ionic strength differences that affect melting curves Additionally spec trophotometric quantification and dilution of sample DNA to a standard concentration for input into PCR is recommended Although advanced instruments with curve overlay temperature shifting software options can
15. Methods 50 2010 250 261 journal homepage www elsevier com locate ymeth Contents lists available at ScienceDirect METHODS Methods High resolution melting analysis for gene scanning Maria Erali Carl T Wittwer P ARUP Institute for Clinical and Experimental Pathology Salt Lake City UT 84108 USA gt Department of Pathology University of Utah Medical School Salt Lake City UT 84132 USA ARTICLE INFO Article history Accepted 14 January 2010 Available online 18 January 2010 Keywords High resolution melting Heteroduplex scanning Genotyping LCGreen Plus LightScanner ABSTRACT High resolution melting is a new method of genotyping and variant scanning that can be seamlessly appended to PCR amplification Limitations of genotyping by amplicon melting can be addressed by unla beled probe or snapback primer analysis all performed without labeled probes High resolution melting can also be used to scan for rare sequence variants in large genes with multiple exons and is the focus of this article With the simple addition of a heteroduplex detecting dye before PCR high resolution melting is performed without any additions processing or separation steps Heterozygous variants are identified by atypical melting curves of a different shape compared to wild type homozygotes Homozygous or hemizygous variants are detected by prior mixing with wild type DNA Design optimization and perfor mance co
16. TR 2 Formamide HiDi ABI 3 Capillary sequencer ABI 3130xl 4 36 cm capillary array ABI 5 POP 7 Polymer ABI 6 Mutation Surveyor DNA Variant Analysis Software SoftGenetics 5 4 2 Procedure 1 Prepare the gel filtration cartridges by centrifuging for 2 min at 750g to remove storage water 2 Add each cycle sequencing reaction to a prepared gel filtra tion cartridge 3 Spin 2 min at 750g and collect the eluted material in a 96 well plate Proceed to electrophoresis or store at 4 C 4 Add 10 uL formamide to each product to be sequenced 5 Cover plate with the ABI septum and spin for 30 s at 1600g 6 Denature the solutions for 2 min at 95 C on a thermal cycler 7 Load the solution onto the ABI 3130xl with a 36 cm capillary array and POP 7 polymer 8 Perform electrophoresis using the UltraSeq_POP7_1 instru ment protocol and the 3130POP7_BDTv1 1 analysis protocol 9 Analyze the data with the Sequencing Analysis program according to the ABI protocol 10 Continue analysis with Mutation Surveyor software v 3 4 as follows 11 Open Mutation Surveyor and click on the Open Files icon 12 Add the appropriate GenBank reference file in GBK format to the top window and the experimental data Sample Files in AB1 format to the bottom window 13 Click OK to return to the main screen and click on the Run icon to initiate the analysis 14 Use the Graphic Display of Mutations icon to check that the sequenc
17. Table 3 Location of CYBB and amelogenin primers on X linked chronic granulomatous disease primer plates Sample 1 Sample2 Sample3 Sample4 Sample5 Sample 6 each primer pair solution plus 13 uL dead volume The Inno vadyne 8 well dispensing strips hold up to 250 uL well so up to 10 plates can be dispensed in one run 5 Dispense the appropriate volume of 2 5 uM primer pair solu tion into two 8 well strips as shown in Table 4 Add water for any empty wells 6 Place the 8 well strips on the Nanodrop Express 7 Place a 96 well microplate on the instrument 8 Run the Nanodrop Express to dispense each primer pair solution into the appropriate wells 9 When the dispensing is complete remove the first plate and repeat with any subsequent plates 10 Cover the plates and centrifuge them for 30 s at 1600g to get the primers to the bottom of the wells 11 Dry the plates uncovered in a single layer in a 37 C oven 12 Seal the plates with aluminum sealing tape and place them in individual zip lock bags removing excess air 13 Store at room temperature for up to 8 months 5 Performance Although high resolution melting for gene scanning is often used for high throughput research studies it can also be used for rapid clinical diagnostics targeting only a few patient samples at one time If primer plates are available it is completely feasible starting from whole blood to complete screening of negative sam ples in 3 h and to ide
18. ameters select DNA 75 mM NaCl Blake and Delcourt 40 Enter in tem perature limits of 65 and 90 C with a step size of 0 2 C and leave all other parameters at their defaults Select melting curve graphics and click Submit The predicted absorbance melting curve is dis played Click on Bunch of numbers x y values and find the melting curve data temperature and Azgo hypochromicity near the end of the data file This data gives the melting curve x as increasing absorbance with temperature and can be inverted 1 x to simulate fluorescent melting curve data The observed melting curve shapes using the reagents and conditions given be low closely follow the predicted curves although they are shifted 5 6 C higher than predicted M Erali C T Wittwer Methods 50 2010 250 261 253 Table 1 Primers and product sizes for the 13 exon gene CYBB Primer Sequence 5 3 Product size name bps Ex1F AGAAGCATAGTATAGAAGAAAGGC 180 Ex1R CCCGAGAAGTCAGAGAATTTATAAC Ex2F CTACTGTGGAAATGCGGA 214 Ex2R AGCCAATATIGCATGGGAT Ex3F GGACAGGGCATATTCTGTG 249 Ex3R GCCTTTGAAAATTAGAGGAACTTAGTA Ex4F CTTTCCTGTTAACAATTACTATTCCAT 202 Ex4R TCCCTGGTTCCAAGTTTTCTITAATA Ex5F TCATACCCTTCATTCTCTTIGTIT 281 Ex5R AGTCCTCAATTGTAATGGCCTA Ex6F TGTGTGTGTGTGTGTTTATATTTTAC 309 Ex6R CTGCCTAGAAATTGAGGGAC Ex7F TTAATTTCCTATTACTAAATGATCTGGACTT 255 Ex7R TGTCAGTAATGAAACTGTAATAACAAC Ex8F CCTCTGAATATTTTGTTATCTATTACCACTTA 252 Ex8R ACTTGTCCATGATATA
19. at 95 C for 10s 40 cycles of 94 C for 10s 64 C for 10 s 75 C for 10 s followed by 1 cycle at 95 C for 10s and a final hold at 15 C 8 After PCR remove the plate from the thermal cycler and spin for 30s at 1600g 9 Plates may be scanned immediately stored at room tempera ture for less than a day or stored at 4 C for up to a month before analysis If plates are refrigerated spin for 30s at 1600g before analysis Ji 5 2 Scanning High resolution melting is the only scanning method that does not require physical processing or separation steps Samples can be melted immediately after PCR and changes in melting curve shape identify samples that vary from wild type 5 2 1 Detailed example The frequency of CYBB variants is very low The disease is rare and benign variants are uncommon Six samples were PCR ampli fied at all 13 exons and melted The normalized and overlaid fluo rescence curves are shown in Fig 4 Within an exon the different Male sample mixed uL Control sample uL 75 75 75 60 60 60 7 5 15 15 7 5 150 150 150 exon 12 exon 11 mixed unknown amp WT 86 88 90 92 Temperature C Fig 4 Normalized and overlaid high resolution melting curves for all 13 CYBB exons All traces were generated on a single 96 well plate using 3 samples run in duplicate The samples analyzed were an unknown male a wild type male WT and a mixed sample containing both unknown and WT The traces for exon 1
20. d wild type and unknown DNA adjusted to 50 ng uL Section 4 1 2 CYBB primer plates Section 4 4 3 Plate mixer Eppendorf MixMate 5353 000 014 5 1 3 Procedure 1 Prepare sufficient master mix for a volume of 10 uL per well for the 13 CYBB exons and the control amelogenin 2 Refer to Table 5 to determine the component volumes to add for master mix preparation This table assumes samples are run in singlet and includes 1 well dead volume Male DNA is analyzed both mixed 1 1 with wild type DNA and without mixing Table 5 Master mix components for gene scanning of X linked chronic granulomatous disease Component Each well uL Female sample not mixed uL Water 5 75 2 5x LightScanner Master 4 60 Wild type DNA 1 Unknown DNA 15 Total 10 150 O o exon 8 exon 13 rey exon 1 exon 2 o P exon 4 exon 5 N exon 7 Normalized and Overlaid Fluorescence 78 80 82 84 Male sample not mixed uL 3 Add 10 uL per well of the master mix including DNA into the appropriate wells according to the plate map shown in Table 3 4 Seal the plate lightly with sealing tape and place on the plate mixer for 30s at 1650rpm to dissolve the primers with the master mix Remove the tape and add 12 uL mineral oil to each well 6 Seal the plate firmly with sealing tape and centrifuge for 30 s at 1600g 7 Place the plate in the C1000 thermal cycler and amplify using the following program 1 cycle
21. e unknown can also be distinguished from wild type by difference curves The unknown male sample had a T duplication at c 1456 by sequencing M Erali C T Wittwer Methods 50 2010 250 261 259 8 In the top window select the exon 1 subset go to the Neg ative Filter tab check that fluorescence levels are adequate for all wells and that negative samples are excluded Note any sharp drops or increases in fluorescence that can result from bubble or film artifacts If present spin and melt the plate again and resume at step 3 above 9 Click on the Normalize tab and adjust the vertical cursors on the top graph to encompass all predicted melting domains Section 3 4 10 Select the Curve Shift tab and adjust the horizontal cursor on the top graph to optimize clustering of the curves 11 Enter the Grouping tab and click on Select Baseline Choose one or more wild type control wells for the baseline and click on Finish Selection 12 Record any aberrant results by sample and exon An exon with an unexpected melting pattern should be genotyped or sequenced 13 Repeat steps 8 12 for all exons subsets 14 Retain the cursor settings and subsets for future analysis by saving a mat file 5 3 Cycle sequencing Targeted sequencing is performed using dideoxy terminator chemistry on any exon with an abnormal scan The PCR product from the exon of interest is recovered from the plate and diluted 1 50 in water Cycle sequencing is perf
22. e covers the area of interest 15 Return to the main window and manually check the calls that Mutation Surveyor has made Double click on the Muta tion Surveyor call to move the chromatogram view to the call site Confirm or delete the variations called by the software 16 Click on Reports on the main menu then select Custom Report Go to the Nomenclature tab click on Custom and under Reference click on Relative to CDS and Intronic Muta tions Relative to Nearest CDS Click OK 17 A Custom Report Table will be generated that lists any vari ants identified 6 Concluding remarks High resolution melting analysis provides a sensitive homoge neous scanning method using controlled heating at a fast rate and high data density Heterozygous variants are easily identified be cause they distort the melting curve shape compared to wild type When a PCR product scans as negative there is no need for further analysis Therefore scanning is most useful when the frequency of variants is low No sequencing is needed for wild type samples For samples with variants only the PCR products that scan positive need to be further analyzed Common variants can often be recog nized by characteristic melting patterns 42 or small amplicon 260 M Erali C T Wittwer Methods 50 2010 250 261 genotyping 43 but definitive genotyping requires unlabeled probe 23 or snapback primer 24 analysis convenient because they use the same platforms and r
23. eagents reported here or other means of genotyping Rare variants whether associated with dis ease or not are best identified by sequencing In order to streamline turnaround in a clinical laboratory the following protocols were implemented 1 Primers were designed with tools that automatically select primers bracketing each exon including likely splice sites with consideration of high resolution melting e g PCR product size 2 Melting curves were predicted by recursive algorithms to provide the relative position and number of melting domains expected These predicted curves were used to ver ify PCR specificity and to select the temperature region to analyze for each product 3 Primer pairs were optimized on a gradient PCR instrument Analysis by high resolution melting and optional agarose gel electrophoresis provides a window of acceptable anneal ing temperatures for each PCR product The final annealing temperature selected must be within these windows for all PCR products on the plate The wider the window the more robust the reaction 4 Microtiter plates with dried primer pairs were robotically prepared in batches The primer plates can be used for at least 8 months after preparation without degradation of per formance Instead of manually pipetting 26 different primers into selected wells the assay complexity is handled roboti cally requiring only the addition of a PCR reagent DNA mix ture at the time of testin
24. ethods 50 2010 250 261 255 100 80 60 40 Fluorescence 20 Fluorescence Difference O 79 80 81 82 83 Temperature C Fig 2 Ninety five melting curves of CYBB exon 1 after PCR from the DNA of 95 healthy individuals After exponential background subtraction melting curves are shown normalized and overlaid top and as a difference from the average bottom No sequence variations were detected in the 146 bp product with two domains typical of the low variation found in CYBB Melting curves were acquired on the LightScanner in the presence of the saturating DNA dye LCGreen Plus The overall reproducibility of PCR and melting analysis can be assessed from the tightness of such clusters typically 1 on difference plots 3 Add 10 uL of the PCR solution to each well of the DNA microplate 4 Add 12 uL of mineral oil to each well 5 Seal the plate with optically clear sealing tape and centrifuge for 30s at 1600g 6 Place the plate in the C1000 thermal cycler and cycle using the following program 1 cycle at 95 C for 10s 40 cycles of 94 C for 10s 64 C for 10s and 75 C for 10s followed by 1 cycle at 95 C for 10s and a final hold at 15 C 7 Following PCR remove the plate from the thermal cycler and spin for 30s at 1600g 8 Plates may be scanned immediately stored at room tempera ture for less than a day or stored at 4 C for up to a month before analysis If plates are refrigerated spin for
25. g 5 An initial screen for common polymorphisms is performed by analyzing 95 random individuals across all exons Identi fying variants as common polymorphisms can significantly reduce the need for sequencing Common polymorphisms can be identified by melting curve identity 42 mixing 44 small amplicon genotyping 16 unlabeled probes 23 or snapback primers 24 either in separate reactions or simultaneously in the same reaction 26 All of these methods are based on melting and use the same dyes and instrumentation as heterozygote scanning avoiding labeled probes and sequencing 6 Only rare heterozygous PCR products are sequenced In the case of CYBB analysis 1 out of 13 8 of the PCR products from positive samples requires sequencing This percentage is further reduced proportionally by the percentage of sam ples that are negative For example if half of the samples are positive only 4 of exons require sequencing Furthermore once a variant is identified within a family inheritance can be determined by melting alone further reducing the need for sequencing 7 Turnaround time is minimized with rapid protocols Nega tive samples are identified after DNA preparation 60 min quantification 15 min PCR 60 min using previously pre pared primer plates high resolution melting 15 min and analysis 30 min When a positive product is identified by melting targeted sequencing of only that product is per formed Co
26. ied Science 4 NanoDrop 1000 or Scientific 8000 Spectrophotometer Thermo 4 1 3 Procedure Mix the specimen well by inversion in the original tube Transfer 500 uL of whole blood to a 1 5 mL conical tube and place the tube in the sample rack 3 Load the MagNA Pure Compact with the sample rack and appro priate cartridges and disposables 4 Program the instrument to process 400 uL of specimen and elute in 100 uL of elution buffer 5 Proceed with the extraction according to the automated protocol 6 When the process is complete remove the tubes containing the extracted nucleic acid and shut down instrument 7 Measure the Azgo of the sample nucleic acid on the NanoDrop 1000 8 Dilute the nucleic acid to 50 ng uL A260 1 0 using 10 mM Tris pH 8 0 0 1 mM EDTA Store short term at 4 C or long term at 20 C 9 For male DNA prepare both mixed and unmixed samples for CYBB X linked analysis To generate the mixed sample mix the unknown test DNA with known wild type male DNA 1 1 v v resulting in a 50 ng uL A260 1 0 mixture Female DNA is processed without mixing N 4 2 PCR optimization There are many methods for PCR optimization If a gradient thermal cycler is available PCR optimization of multiple primer sets is easily accomplished with an annealing temperature gradi ent The predicted Tm of each primer pair is bracketed with an annealing temperature range extending 10 15 C above and
27. into multiple amplicons based on a maximum amplicon size Finally to simplify sequencing primers are tailed with M13 sequencing primers 3 3 2 Protocol 1 Open the UCSC genome browser http genome ucsc edu 2 Click Genomes on the top toolbar 3 Enter CYBB as the position or search term and click submit 4 Click on the CYBB RefSeq Gene 5 In the browser window click on the CYBB label of the Ref Seq Gene track 6 Click on Genomic Sequence from assembly 7 Check boxes for only a CDS exons b One FASTA record per region with 200 bases on each side c CDS in upper case UTR in lower case 8 Click Submit 9 Copy the FASTA text file into notepad 10 Open LightScanner primer design software and click on Scanning Primers 11 Import the notepad FASTA file and convert uppercase regions to exons 12 Open Common Settings adjust as follows a Max Amplicon Size 400 bps Primer Tm between 62 and 66 C c Primer size between 18 and 35 bases d 5 exclusion buffer 15 bases e 3 exclusion buffer 6 bases f Minimum overlap 5 bases g Primer concentrations 0 5 uM under the Settings menu and YY b 13 Press OK and click Search All 14 Inspect the primers by clicking on the tabs for each exon Alternative primers may be selected if current ones overlap known variants 15 Select Export to CSV
28. mask some sample differences it is best to minimize these differences before melting analysis Gene scanning depends on detecting heterozygotes by shape differences of the melting curves not on homozygous differences that primar ily affect Tma Accuracy of variant detection is increased by overlay ing the curves to focus only on shape differences not on Tm differences that are influenced by sample and instrument variance Homozygous or hemizygous X linked variants are best detected by mixing normal and unknown DNA so that any homozygous var iant in the unknown will be detected as a heterozygote in the mix ture Scanning of X linked targets in males is performed by mixing with wild type male DNA to generate heterozygotes for detection of base substitutions and small insertions deletions Large dele tions encompassing entire exons of X linked genes can also be de tected in male samples by directly analyzing samples that are not mixed Mixing is not necessary to detect heterozygous variants in females 4 1 1 Detailed example Several rapid automated methods of DNA extraction from whole blood are now available that can provide high quality DNA in less than 1 h The specific method used is less important than consistency within the chosen method 4 1 2 Materials 1 Whole blood anti coagulated with sodium heparin 2 MagNA Pure Compact Instrument Roche Applied Science 3 MagNA Pure Compact Nucleic Acid Isolation Kit I Roche Appl
29. mmon sequencing primers are used that were introduced during PCR as 5 tails Sequencing requires an additional 2h and 15 min of rapid cycle sequencing with 45 min allowed for analysis Negative samples are easily completed in less than 3 h and the variants in positive sam ples are identified in 6 h 8 Throughput can be increased by multiplying the number of inexpensive standard PCR machines while using a single dedicated high resolution melting instrument For example plates from up to 4 thermal cyclers can be analyzed with 1 dedicated melting instrument because it takes 60 min to amplify but only 15 min to melt This avoids a linear increase in instrument cost with volume when using more expensive real time instruments Disclosure statement Development of high resolution melting was supported by Grants GM060063 GM072419 GM073396 and GM082116 from the NIH High resolution melting analysis is licensed from the Uni versity of Utah to Idaho Technology and Idaho Technology has sub licensed Roche and Qiagen C T W is an inventor on high resolution melting patents and holds equity interest in Idaho Technology M E has nothing to declare References 1 J Santalucia Jr D Hicks Annu Rev Biophys Biomol Struct 33 2004 415 440 2 L S Lerman K Silverstein in R Wu Ed Methods in Enzymology vol 155 Academic Press New York 1987 pp 482 501 3 G Steger Nucleic Acids Res 22 1994 2760 2768 4 E Lyon
30. nsiderations for high resolution scanning assays are presented for rapid turnaround of gene scanning Design concerns include primer selection and predicting melting profiles in silico Optimization includes temperature gradient selection of the annealing temperature random population screening for common variants and batch preparation of primer plates with robotically deposited and dried primer pairs Performance includes rapid DNA preparation PCR and scanning by high resolution melting that require in total only 3 h when no variants are present When variants are detected they can be identified in an additional 3 h by rapid cycle sequencing and capillary electrophoresis For each step in the protocol a general overview of principles is provided followed by an in depth analysis of one example scanning of CYBB the gene that is mutated in X linked chronic granulomatous disease 2010 Elsevier Inc All rights reserved 1 Introduction Melting is a fundamental property of DNA As the double helix is heated its strands separate If the duplex region is short as for most synthesized probes melting occurs in one transition all or none without intermediate states and the melting tempera ture Tm is defined as the temperature at which half of the du plexes have dissociated The T of short duplexes can usually be estimated to within 2 C by considering the thermodynamics of neighboring bases 1 In contrast longer P
31. ntify any variants by sequencing is less than 6 h Fig 3 As more and more rare genetic diseases are found effi cient testing of such orphan genes can be rapidly performed by high resolution melting 5 1 PCR Using previously prepared primer plates bulk master mix con taining sample DNA but without primers is added to each well When all wells are filled the plate is covered with sealing tape Table 4 Location of the 2 5 uM working CYBB primer pair solutions in 8 well strips for robotic dispensing H0O Exon Exon6 Exon5 Exon4 Exon3 Exon Exon 7 2 1 AMEL X H20 Exon Exon Exon Exon Exon Exon Y 13 12 11 10 9 8 M Erali CT Wittwer Methods 50 2010 250 261 257 and mixed to dissolve the primers Each well is then overlaid with mineral oil re sealed securely and centrifuged PCR is performed using conditions determined during PCR optimization Section 4 2 and validated on healthy controls Section 4 3 5 1 1 Detailed example PCR is performed using the CYBB primer plates prepared in Sec tion 4 4 Each plate can analyze six samples typically one wild type control one variant control and two unknown male samples analyzed both with and without mixing Mixing with a known wild type male sample allows sensitive detection of hemizygous small variants including single base variants and small deletions and insertions Analyzing the samples without mixing will detect large deletions 5 1 2 Additional materials 1 Purifie
32. nts Careful design and optimization enable performance of gene scan ning in less than an 8h workday and most sequencing is elimi nated by identifying normal samples and normal coding regions of variant samples Because scanning accuracy depends on high quality PCR optimization is critical Optimization success often de pends on design and informed design requires knowledge of the gene to be scanned The following outline lists steps in the design optimization and performance of scanning assays Web sites useful in naming and cataloging genes and variants are listed below in 3 1 and 3 2 but these preliminary steps are not further detailed here 3 Design 3 1 Identify genes and regions of interest Use HUGO nomenclature http www genenames org Review prior studies Scientific http www ncbi nlm nih gov pubmed OMIM http www ncbi nlm nih omim Genes http www ncbi nlm nih gov gene 3 2 Search for identify and catalog known variants including pathogenicity and frequency Use HGVS variant c nomenclature http www hgvs org mutnomen Gene or disease specific database Human mutations http www hgmad cf ac uk ac dbSNP http www ncbi nlm nih gov SNP Genome browser http genome ucsc edu Homology http blast ncbi nlm nih gov CNVs http projects tcag ca variation 3 3 Primer selection 3 4 Melting profile prediction 4 Optimization 4 1 DNA preparation 4 2 PCR optimization 4 3 Random
33. o high resolution melting curve analysis sometimes abbreviated as HRM HRMA or HRMCA among others High resolution melting was made possible by pro gress along three fronts dye chemistry instrument resolution and data analysis Although SYBR Green I can differentiate many homo zygous variants that differ in Tm e g large deletions 7 complex repeat regions 8 and methylation analysis 9 it is difficult to de tect heteroduplexes with SYBR Green I Most high resolution melt ing applications depend on saturating DNA dyes that detect heteroduplexes a new functional class of dyes either synthesized de novo or identified from existing dyes 10 Some saturating dyes that are available outside of commercial master mixes reveal dif ferences in their ability to detect heteroduplexes 11 Similarly melting instruments vary in their resolution as shown in a series M Erali CT Wittwer Methods 50 2010 250 261 251 of studies 12 14 Finally targeted software is necessary to iden tify the small melting curve differences that identify a variant or genotype 15 The sensitivity and specificity of high resolution melting depends on the dye instrument and software used Like high fidelity music compromise in one component can spoil the end result The two major applications of high resolution amplicon melting are targeted genotyping 16 and gene scanning 17 Most single base variants can be genotyped by high resolution melting beca
34. ormed with both forward and reverse M13 primers 5 3 1 Additional materials 1 M13 sequencing primers 5puM forward 5 ACGACGTTGT AAAACGAC 3 reverse 5 CAGGAAACAGCTATGACC 3 2 BigDye Terminator v1 1 Cycle Sequencing Kit Applied Biosystems 5 3 2 Procedure 1 Dilute the PCR product from the exon of interest 1 50 by adding 2 uL of PCR product to 98 uL of water 2 Prepare the cycle sequencing reactions with 1 6th of the recom mended concentration of BigDye terminator and a primer con centration of 0 5 uM as follows Master mix component 1x uL BigDye Terminator v1 1 2 0 5x Sequencing buffer 5 0 1 50 diluted PCR product 3 0 Water 17 0 Dispense 9 uL of the master mix into each of two wells of a 96 well plate and add 1 uL of 5 uM forward M13 primer into one well and 5 uM reverse M13 primer into the other well 3 Seal the plate place it in the C1000 thermal cycler and run the following program 1 cycle at 96 C for 10s 25 cycles of 96 C for 5 s 50 C for 10 s and 60 C for 20 s followed by a final hold at 4 C 5 4 Capillary electrophoresis After cycle sequencing unincorporated terminator dyes and salts are removed by gel filtration Formamide is added and the solution denatured briefly at 95 C Capillary electrophoresis is per formed using a 36 cm capillary array and an ultrafast protocol for short PCR products 5 4 1 Additional materials 1 Gel Filtration Cartridges Edge Performa D
35. r previously saved mat file with the desired subsets and cursor settings b Build subsets for each exon and the XY amelogenein target according to the User Manual for the LightScan ner instrument These subsets can be stored at any time for future reference by saving Save as an Anal ysis mat file 7 Choose the amelogenin subset go to the Negative Filter Tab and examine the melting peaks 2 peaks one at 76 C and one at 84 C are present in male specimens Only one peak at 84 C is present in females Variant Sequence Normalized Melting Curves 0 6 0 4 Normalized 0 2 0 8 0 6 Unknown WT and Mixed Fluorescence 0 4 Normalized amp Overlayed 0 2 0 08 0 04 Unknown WT and Mixed A Normalized amp Overlayed 0 04 85 86 87 88 89 90 91 92 Overlaid Melting Curves Difference Curves Mixed unk WT Unknown and WT Mixed unk WT Unknown WT EEE ee 85 86 87 88 89 90 91 92 Temperature C Fig 5 High resolution melting analysis of CYBB exon 11 in wild type DNA left panels and variant DNA right panels Melting curves are displayed normalized top normalized and overlaid middle and as difference curves bottom In X linked disorders variants are best detected after heteroduplex formation by mixing unknown DNA with wild type WT DNA Less reliable is detecting the unknown sample without mixing although in this case the unmixed hemizygous sampl
36. ress doi 10 1167 iovs 09 4518 30 L S Chou F Gedge E Lyon J Mol Diagn 7 2005 111 120 31 J L Montgomery L N Sanford C T Wittwer Expert Rev Mol Diagn 10 2010 in press 32 M Erali K V Voelkerding C T Wittwer Exp Mol Pathol 85 2008 50 58 33 J F Mackay C T Wittwer in PCR Optimization and Troubleshooting Horizon Scientific Press Norwich 2010 in press M Erali C T Wittwer Methods 50 2010 250 261 261 34 J T Mckinney L M Nay D De Koeyer G H Reed M Wall R A Palais R L Jarret 40 R D Blake S G Delcourt Nucleic Acids Res 26 1998 3323 3332 C T Wittwer in K Meksem G Kahl Eds The Handbook of Plant Mutation 41 A D Laurie M P Smith P M George Clin Chem 53 2007 2211 2214 Screening Wiley VCH Weinheim 2010 in press 42 J G Vandersteen P Bayrak Toydemir R A Palais C T Wittwer Clin Chem 53 35 G H Reed J O Kent C T Wittwer Pharmacogenomics 8 2007 597 608 2007 1191 1198 36 C T Wittwer Hum Mutat 30 2009 857 859 43 S F Dobrowolski C Ellingson T Coyne J Grey R Martin E W Naylor R Koch 37 M Q Zhang Hum Mol Genet 7 1998 919 932 H L Levy Mol Genet Metab 91 2007 218 227 38 D Poland Biopolymers 13 1974 1859 1871 44 L Zhou J Vandersteen L Wang T Fuller M Taylor B Palais C T Wittwer 39 M Fixman J J Freire Biopolymers 16 1977 2693 2704 Tissue Antigens 64 2004 156 164
37. shed 25 Both probe genotype using unlabeled probes or snapback primers and amplicon scanning can be per formed in the same reaction simultaneously 26 In such cases with a broad range of analyzed temperatures software with expo nential background removal is necessary 15 With such software single base genotyping in up to four amplicons with two tempera ture controls is possible in a single color multiplex PCR 27 28 High resolution melting is the method of choice for gene scan ning of multiple exons based on simplicity cost sensitivity and specificity 29 30 Over 60 genes have been analyzed by this meth od and for one BRCA1 2 six reports have been published 31 The protocols detailed below are based on the most common instru ment LightScanner and dye LCGreen Plus reported for genetic scanning in the literature 31 At each step different procedures and or instruments are possible with the caveat that gene scanning results strongly depend on the dye instrument and software used For additional information on high resolution melting applications including gene scanning small amplicon genotyping unlabeled probe genotyping snapback primer genotyping methylation anal ysis sequence matching and repeat typing several recent reviews are available 11 25 31 36 2 Outline of approach High resolution melting analysis for gene scanning is an attrac tive option for laboratories with time and resource constrai
38. temper ature range for specific amplification of each product 11 If the observed melting curves do not fit the predicted curves perform gel electrophoresis on the PCR products Standard 1 5 agarose slab gels in 0 5x TBE 45 mM Tris borate 1 mM EDTA 0 5 ug ml ethidium bromide are ade quate Alternatively an automated microelectrophoresis system can be used Assess the amount and purity of the PCR products and determine the annealing temperature range over which each PCR product is pure 12 If extraneous products are present increase the specificity by decreasing the concentration of primers to 0 10 0 25 uM or add 5 10 DMSO and or 1 2 M betaine to lower primer Tms If the yield is low or no PCR products are obtained decrease the specificity by increasing the Mg concentration Repeat the optimization It may be easier to choose alternative primers than to perform extensive opti mization with difficult primer sets 4 3 Random population screening Once PCR optimization of all primer pairs is accomplished and a common annealing temperature is selected analyze random DNA samples from healthy individuals to screen for common variants Set up one 96 well plate for each primer pair and analyze 95 indi vidual DNA samples and one no template control Any variants in healthy people detected by high resolution melting analysis are typically identified by sequencing The most common variant is as sumed to be wild type and does not need
39. tin T C Robbins L M Nay N Boyd T Coyne M D Wall C T Wittwer D H Teng Nucleic Acids Res 36 2008 3401 3408 19 C Rigon A Andrisani M Forzan D D antona A Bruson E Cosmi G Ambrosini G M Tiboni M Clementi Fertil Steril 2009 in press doi 10 1016 j fertnstert 2009 05 025 20 J Montgomery C T Wittwer J O Kent L Zhou Clin Chem 53 2007 1891 1898 21 R A Palais M A Liew C T Wittwer Anal Biochem 346 2005 167 175 22 M Erali R Palais C T Wittwer in O Seitz A Marx Eds Molecular Beacons Signalling Nucleic Acid Probes Methods and Protocols vol 429 Humana Press Totowa 2008 pp 199 206 23 L Zhou A N Myers J G Vandersteen L Wang C T Wittwer Clin Chem 50 2004 1328 1335 24 L Zhou R J Errigo H Lu M A Poritz M T Seipp C T Wittwer Clin Chem 54 2008 1648 1656 25 R H Vossen E Aten A Roos J T Den Dunnen Hum Mutat 30 2009 860 866 26 J Montgomery C T Wittwer R A Palais L Zhou Nat Prot 2 2007 59 66 27 M T Seipp J D Durtschi K V Voelkerding C T Wittwer J Biomol Technol 20 2009 160 164 28 M T Seipp D Pattison J D Durtschi M Jama K V Voelkerding C T Wittwer Clin Chem 54 2008 108 115 29 J Aguirre Lamban R Riveiro Alvarez M Garcia Hoyos D Cantalapiedra A Avila Fernandez C Villaverde M J Trujillo Tiebas C Ramos C Ayuso Invest Ophthalmol Vis Sci 2009 in p
40. use many homozygotes differ in Tm However the homozygotes of some single base variants and many insertions and deletions have similar or identical T s and cannot be differentiated Specifically the homozygous genotypes of class 3 and class 4 single base vari ants 16 also known as base pair neutral variants 18 are dif ficult to distinguish by Tm In the human genome 84 of single base variants are class 1 or 2 with homozygous Tm differences around 1 C that are easy to differentiate Class 3 and class 4 vari ants have T differences around 0 25 C 12 of human single base variants except when nearest neighbor symmetry predicts no dif ference at all 4 Even under the best conditions and with the best instruments some loci cannot be genotyped by simple ampli con melting 18 20 Problematic loci for amplicon genotyping should be identified in silico by T calculations and alternative methods employed Robust solutions can be found in related melting methods that although not quite as simple use the same dyes and instruments For exam ple quantitative heteroduplex analysis mixes the unknown with a known genotype 21 Alternatively melting analysis can be per formed on smaller duplexes formed with unlabeled probes 22 23 or the hairpin formed after PCR using snapback primers 24 Unlabeled probe and snapback primer genotyping detect all single base variants within the duplex and allow many genotypes to be distingui
Download Pdf Manuals
Related Search