Home

BaseSpace Onsite v2.1 LT System Guide - Support

1. y suo soedseseg esn oL MoH FASTQ File Upload Requirements The FASTO file is a text format file used to represent sequences Each record has 4 lines The 4 lines of data are an identifier read descriptor the sequence and the quality scores For a detailed description of the FASTQ format see FASTQ Files on page 38 Make sure that the FASTQ file adheres to the following upload requirements The uploader only supports gzipped FASTQ files generated on Illumina instruments The name of the FASTQ files conforms to the following convention SampleName SampleNumber Lane Read FlovCellIndex fastq gz For example SampleName S1 L001 R1 001 fastq gz SampleName S1 L001 R2 001 fastq gz The read descriptor in the FASTQ files conforms to the following convention Instrument RunID FlowCellID Lane Tile X Y ReadNum FilterFlag 0 SampleNumber For example a Read 1 descriptor could look like this line M00900 62 000000000 A2CYG 1 1101 18016 2491 1 N 0 13 And the corresponding Read 2 would have a 2 in the ReadNum field M00900 62 000000000 A2CYG 1 1101 18016 2491 2 N 0 13 Quality considerations The number of base calls for each read equals the number of quality scores The number of entries for Read 1 equals the number of entries for Read 2 The uploader determines whether files are paired end based on matching file names in which the only difference is the ReadNum For paired end reads the descriptor must match for every entry for
2. Index 1 17 The sequence for the first Index Read Index 2 15 The sequence for the second Index Read Reads Identified The number of reads only includes Passing Filter reads mapped PF to this index This information is also displayed in graphical form In the graphical display indexes are ordered according to the unique Index Number assigned by BaseSpace Onsite View Run Charts The Charts page shows charts with run metrics 1 Click the Runs icon 2 Click the desired run 3 There are 2 methods to go to the Charts page From the Run Overview page click the Charts link From the Run Overview page click the Charts icon from the left navigation menu Flow Cell Chart The Flow Cell chart shows color coded graphical quality metrics per tile for the entire flow cell Use the Flow Cell chart to judge local differences per cycle per lane or per read in sequencing metrics on a flow cell It is also an easy way to see the Q30 metric which is an excellent single metric to judge a run Do not use the Flow Cell chart to look at downstream analysis metrics The Flow Cell chart has the following features You can select the displayed metric surface cycle and base through the drop down lists The color bar to the right of the chart indicates the values that the colors represent The chart is displayed with tailored scaling by default Tiles that have not been measured or are not monitored are gray Document 1000000002666 v00
3. You can monitor the following quality metrics using the Flow Cell chart Intensity This chart shows the intensity by color and cycle of the 90 percentile of the data for each tile FWHM The average full width of clusters at half maximum in pixels Used to display focus quality Base The percentage of clusters for which the selected base A C T or PQ gt 20 Q gt 30 G has been called The percentage of bases with a quality score of gt 20 or gt 30 respectively These charts are generated after the 25 cycle and the values represent the current scored cycle Median Q Score The median Q Score for each tile over all bases for the current cycle These charts are generated after the 25 cycle This plot is best used to examine the Q scores of your run as it progresses Bear in mind that the Q30 plot can give an over simplified view due to its reliance on a single threshold Density The density of clusters for each tile in thousands per mm Density PF The density of clusters passing filter for each tile in thousands per mm Clusters The number of clusters for each tile in millions Clusters PF The number of clusters passing filter for each tile in millions Error Rate The calculated error rate as determined by a spiked in PhiX control sample If no PhiX control sample is run in the lane this chart is not available Phasing The estimated percentage of molecules in a cluster for which Prephasing sequen
4. assuming nonvariant position BaseSpace Onsite v1 0 LT System Guide 3 D y suo soedseseg esn O MoH DP Filtered base call depth used for site genotyping DPF Base calls filtered from input before site genotyping AD Allelic depths for the ref and alt alleles in the order listed For indels this value only includes reads that confidently support each allele posterior probability 0 999 or higher that read contains indicated allele vs all other intersecting indel alleles DPI Read depth associated with indel taken from the site preceding the indel SAMPLE Sample fields as defined by the header VCF Files What is it VCF is a text file format that contains information about variants found at specific positions in a reference genome The file format consists of metainformation lines a header line and then data lines Each data line contains information about a single variant When to use it Use it for direct interpretation or as a starting point for further analysis with downstream analysis that is compatible with VCF such as IGV or the UCSC Genome Browser When not to use it Do not use it with tools that are not compatible with the VCF format NOTE i Windows recognizes VCF files as an Outlook contact file Do not open VCF files in Outlook How to use it If you use an app in BaseSpace that uses VCF files as input the app locates the file when launched If using VCF files in other tools download the file t
5. Furthermore anyone who previously accepted the link still has access to the run even when the link is deactivated Use the Get Link option when you do not want to assign a project to a specific person However do not use this option if you want to confine the list of who has access to the project yy NOTE If you want more control use the email share option to specify who can view the project SeeShare a Project Using the Email Option on page 42 To use the Get Link option perform the following steps 1 Click the Projects icon Click the desired project Click the Get Link button Click the Activate button a AeA W N Copy the URL to share with collaborators The link is active until the Deactivate option is selected To deactivate a link perform the following steps 6 Navigate to the shared item 7 Click the Get Link button 8 Click the Deactivate button Share a Project Using the Email Option Use the Share Project option to share a Project using an email link The specified collaborators receive an email with a link to the Project and only that person can view the corresponding data The email option allows greater control over who can view your data Sharing using the Get Link options gives anyone access to your data as long as the link is left activated To email a link perform the following steps 1 Click the Projects icon 2 Click the desired project 3 Click Share Project Document 1000000002666 v00
6. HighSNVHPOL SNV contextual homopolymer length SNVHPOL exceeds 6 HighREFREP Indel contains an allele that occurs in a homopolymer or dinucleotide track with a reference repeat greater than 8 HighDepth Locus depth is greater than 3x the mean chromosome depth INFO Additional information INFO fields are encoded as a semicolon separated series of short keys with optional values in the format lt key gt lt data gt data gVCF files use the following values END End position of the region described in this record BLOCKAVG_min30p3a nonvariant site block All sites in a block are constrained to be nonvariant have the same filter value and have all sample values in range xy y lt max x 3 x 1 3 All printed site block sample values are the minimum observed in the region spanned by the block SNVSB SNV site strand bias SNVHPOL SNV contextual homopolymer length CIGAR CIGAR alignment for each alternate indel allele RU Smallest repeating sequence unit extended or contracted in the indel allele relative to the reference If longer than 20 bases RUs are not reported REFREP Number of times RU is repeated in reference IDREP Number of times RU is repeated in indel allele FORMAT Format of the sample field FORMAT specifies the data types and order of the subfields gVCF files use the following values GT Genotype GQ Genotype Quality GQx Minimum of Genotype quality assuming variant position Genotype quality
7. Selecting the samples allows you to launch it in an app copy to a different project or combine with another result i NOTE You can access these panes through the left navigation bar Project Toolbar The Project toolbar provides the follovving actions Launch app Run apps on your sample Clicking the app name leads to a page with more information about launching that app including access permissions See Analyze Samples Further on page 28 Download Project Download all files in a project See Download Project or Analysis Package on page 1 Import Upload files to a project See Upload Files on page 45 Share project Manage sharing a project with a particular collaborator See Share a Project Using the Email Option on page 42 Get link Forward the sharing link to any number of collaborators See Share a Project using the Get Link option on page 42 Edit project Edit the name and description of the project See Edit Project Details on page 44 Transfer Owner Hand control of data over to a collaborator or customer See Transfer Owner on page 46 Move to Trash Move the project to the trash Deleting a project deletes all associated data including samples and analyses See Delete Project on page 47 View Trash View all deleted runs projects analyses and samples See Delete Items on page 47 Options that are not available for the particular analysis or sample are grayed out If you have selected samples in the Samples
8. sheet starting with 1 In this example S1 indicates that this sample is the first sample listed in the sample sheet 4 NOTE Reads that cannot be assigned to any sample are written to a FASTQ file for sample number 0 and excluded from downstream analysis L001 The lane number Document 1000000002666 v00 R1 The read In this example R1 means Read 1 For a paired end run there is at least one file with R2 in the file name for Read 2 When generated index reads are I1 or 12 001 The last segment is always 001 Compression FASTQ files are saved compressed in the GNU zip format an open source file compression program indicated by the gz file extension Format Each entry in a FASTQ file consists of 4 lines Sequence identifier Sequence Quality score identifier line consisting only of a Quality score lt instrument gt lt run number gt lt flowcell ID gt lt lane gt lt tile gt lt x pos gt lt y pos gt lt UMI gt lt read gt lt is filtered gt lt control number gt lt index gt The following table describes the elements Element Requirements Description Each sequence identifier line starts with lt instrument gt Characters Instrument ID allowed a z A Z 0 9 and underscore lt run number gt Numerical Run number on instrument lt flowcell Characters ID gt allowed a z A Z 0 9 lt lane gt Numerical Lane number lt tile gt Numerical Tile number lt x_pos gt N
9. to active storage as described in Restore Analysis From Archive on page 52 The maximum speed for archiving is 25 Mb s so it does not interfere with other BaseSpace Onsite tasks Restore Analysis From Archive To restore an analysis from archive to active status perform the following steps 1 On the Storage page go to the Archive Storage tab 2 Select the analysis 3 Click Unarchive If there is sufficient free space BaseSpace Onsite restores the analysis If there is not enough space BaseSpace Onsite displays an error message Se restore an archived item that has been deleted and purged from BaseSpace Onsite Set Up Archive Location To set up an archive location perform the following steps 1 On the Storage page go to the Archive Storage tab 2 Click Mount 3 Fill out the form You can set up 1 archive location per BaseSpace Onsite system Restore Deleted Item To restore a deleted item to active status perform the following steps 1 On the Storage page go to the Deleted Items tab 2 Select the analysis 3 Click Unarchive If there is sufficient free space BaseSpace Onsite restores the item If there is not enough space BaseSpace Onsite displays an error message Document 1000000002666 v00 Purge Deleted Items To purge deleted items from BaseSpace Onsite permanently perform the following 1 On the Storage page go to the Deleted Items tab 2 Click Purge This action removes all items in the trash from BaseSp
10. 4 In the Share Settings dialog box enter the collaborators email address and then click Invite NOTE i The invitation email address must match your BaseSpace Onsite login email address Otherwise your collaborator is not able to view the project 5 Click Save Settings Share a Run with Get Link Sharing using the Get Link option allows you to share a run with any collaborator who has access to the link The hyperlink can be turned on or off by setting the activate or deactivate option Anyone can access the project or run when the link is activated Furthermore anyone who previously accepted the link still has access to the run even though the link is deactivated Sharing runs with the Get Link option is similar to sharing projects with the Get Link option z NOTE If you want more control use the email share option to specify who can view the project See Share a Run Using the Email Option on page 43 To share a run using the Get Link option perform the following steps 1 Click the Runs icon Click the desired run Click the More button and select the Get Link option Click the Activate button a AeA wow N Copy the URL to share with collaborators The link is active until the Deactivate option is selected To deactivate a link perform the following steps 6 Navigate to the run 7 Click the Get Link button 8 Click the Deactivate button a NOTE Runs and projects have separate permissions If you share a run
11. F2 F3 ES F4 F4 F5 F5 PS_ C IFS GC PS_ C PS_ C PS_ C IES C PS_ C PS C Item Name Fan number C Fan number C System Board Temperature System Board Temperature BMC Firmware Health Fan 1 Fan 1 Fan 2 Fan 2 Fan 3 Fan 3 Fan 4 Fan 4 Fan 5 Fan 5 Power supply number C Power supply number C Power supply number C Power supply number C Power supply number C Power supply number C Power supply number C Power supply number C BaseSpace Onsite v1 0 LT System Guide Message The fans are no longer redundant due to fan number C failing The fans are redundant again The system board temperature has exceeded the normal range The system board temperature is back within normal range The BMC board has detected a sensor failure Fan number 1 is not functioning Fan number 1 is functioning Fan number 2 is not functioning Fan number 2 is functioning Fan number 3 is not functioning Fan number 3 is functioning Fan number 4 is not functioning Fan number 4 is functioning Fan number 5 is not functioning Fan number 5 is functioning The number C AC power supply is no longer available The number C AC power supply has been connected The number C AC power supply has recovered from failure The number C AC power supply has detected a failure The number C AC power supply has recovered from a predictive failure The number C AC power supply has
12. and compress the results gVCE is a text file format stored as a gzip compressed file genome vcf gz Compression is further achieved by joining contiguous nonvariant regions with similar properties into single block VCF records To maximize the utility of gVCF especially for high stringency applications the properties of the compressed blocks are conservative Block properties like depth and genotype quality reflect the minimum of any site in the block The gVCF file can be indexed creating a tbi file and used with existing VCF tools such as tabix and IGV making it convenient both for direct interpretation and as a starting point for further analysis For more information see sites google com site gvcftools home about gvcf When to use it Use it for direct interpretation or as a starting point for further analysis with downstream analysis that is compatible with gVCF such as tabix and IGV When not to use it Do not use it with tools that are not compatible with the gVCF format How to use it Apps that use gVCF files find it when kicked off and directed to the sample If using gVCF files in other tools download the file to use it in the outside tool Document 1000000002666 v00 Detailed Description The following conventions are used in the variant caller gVCF files Samples per File There is only one sample per gVCF file Nonvariant Blocks Using END Key Contiguous nonvariant segments of the genome can be
13. app executes alignment and variant calling an analysis is created that contains the app results for each sample App results generally contain BAM and VCF files but they can also contain other file types App results can also be used as inputs to apps Finally projects are simple containers that store samples and analyses BaseSpace Onsite v1 0 LT System Guide T Figure 1 BaseSpace Onsite Data Model Sequencing Runs Sequencing Monitor and check v a a a b wh wy why s pbb bb amp i i i Samples Samples Projects Manage and Analyze Project your data ee T m T Fr Pa Am Pa Amplicon Resequencing Amplicon Resequencing Apps lal ll ll ll App result App result App result App result Document 1000000002666 v00 BaseSpace Onsite Apps BaseSpace Onsite supports the following apps App Ilumina Core Apps VariantStudio Integrative Genomics Viewer BaseSpace Labs Apps Third Party Apps BaseSpace Onsite v1 0 LT System Guide Description UOIONPOANU The following Ilumina Core Apps are available e Isaac Whole Genome Sequencing v4 e Isaac Enrichment v1 0 e Isaac Enrichment v2 1 e BWA Whole Genome Sequencing v1 e BWA Enrichment v1 0 e BWA Enrichment v2 1 e TopHat Alignment v1 multilaunch feature not available e Cufflinks Assembly and Differential Expression v1 e TruSeq Amplicon v1 1 e Amplicon DS v1 1 e 165 Metagenomics v1 0 1 e MethylSeq v1 0 e Small RNA
14. been error rated using PhiX starting at cycle 1 Aligned The percentage that aligned to the PhiX genome Error Rate The calculated error rate as determined by the PhiX alignment Subsequent columns display the error rate for cycles 1 35 1 75 and 1 100 Intensity Cycle 1 The average of the A channel intensity measured at the first cycle averaged over filtered clusters View the Project Sample List The Project Sample List contains the list of samples in a project Use this option when you want to see a list of all the samples in the project or navigate to details regarding a specific sample To view the Project Sample List perform the following steps 1 Click the Projects icon 2 Click the desired project 3 Click the Samples link from the left navigation menu You can now click a sample to see the sample overview for more information see Sample Overview Page on page 19 View the Analyses List The Analyses List contains a list of app sessions in a project Use this option when you want to navigate to details regarding a specific app session BaseSpace Onsite v1 0 LT System Guide 2 P4 y suo soedseseg esn OL MOH To view the Analyses List perform the following steps 1 Click the Projects icon 2 Click the desired project You can now click an Analysis to see the results for more information see Analyses Page on page 19 Analyze Samples Further 28 The following topics describe how to analyze samples further
15. can permanently delete it from trash by emptying all items in the trash see Empty Trash on page 49 You can also restore the project to its original location see Restore Trash on page 49 Note the following items about deleting a project If you received the project as a share the deleted project does not appear in the trash If you want to restore a project shared with you click the previously sent share link or contact the owner Do not perform this action if you want to archive a project Delete Analysis To move an analysis out of your Analysis Results list into the trash perform the following steps 1 Click the Projects icon Click the desired project Select the analysis results to be deleted Click Move to Trash Click Confirm The analysis is now in the trash You can permanently delete the analysis from BaseSpace Onsite by emptying all items in the trash see Empty Trash on page 49 You can also restore the analysis to its original location see Restore Trash on page 49 a AeA W N Note the following items about deleting an analysis result You cannot delete an analysis that is in a nonterminal state eg pending execution or running Deleting an analysis from a project that is in ownership transfer can cause a delay until the transfer has completed Do not perform this action if you want to archive an analysis result Delete Sample To move a sample out of your Samples list into the trash perform the following step
16. navigation menu You can now click a sample to see the sample overview for more information see Sample Overview Page on page 19 View Run Summary The Run Summary page has the overall statistics about the run Use this option when you want to view information about the run such as percent alignment cycles and densities To view the Run Summary page perform the following steps 1 Click the Runs icon 2 Click the desired run 3 There are 2 methods to go to the Run Summary From the Run Overview Page select Run Summary button From the Run Overview Page select the Run Summary icon from the left navigation menu The following metrics are displayed in the top table split out by read and total Level The sequencing read level Yield Total The number of bases sequenced which is updated as the run progresses Projected Total The projected number of bases expected to be sequenced at the Yield end of the run Aligned The percentage of the sample that aligned to the PhiX genome which is determined for each level or read independently Error Rate The calculated error rate of the reads that aligned to Phix Intensity Cycle 1 The average of the A channel intensity measured at the first cycle averaged over filtered clusters For the NextSeq 500 System the red channel is used Q 30 The percentage of bases with a quality score of 30 or higher respectively This chart is generated after the 25th cycle and the values r
17. numbers Part Nomenclature Material Number Power Supply PSU 750W 1U CRPS 80PLUS PLATINUM 10535S Hard drive Hard Drive 2 TB SATA 6GB S 15049450S Hard Drive 4 TB SATA 6GB S 20000882 Document 1000000002666 v00 Replace Power Supply Module To replace the power supply module perform the following steps 1 Remove the power cord from the power supply 2 Press the green and black tab and slide the power supply out SYSE UILUDY Figure 2 Slide Power Supply Out 3 Push the new power supply into the slot and make sure that it is seated properly Figure 3 Reseat Power Supply 4 Attach the power cord to the power supply Replace Hard Drive To replace the hard drive perform the following steps 1 Lift the green tab on hard drive tray and then pull out the drive Figure 4 Lift Tab BaseSpace Onsite v1 0 LT System Guide D D Figure 5 Pull Drive Out Look at the label on the drive and check whether it is a 2 TB or 4 TB drive Remove the 3 screws on each side of the carrier then remove the old drive from the carrier Figure 6 Remove Drive From Carrier ae Attach the new drive to the carrier Insert the new drive into the bay and make sure the tray latches closed The new drive is automatically rebuilt Go to the Settings page in the Admin Panel and click Enable Alarm Data Recovery To recover data contact Illumina Technical Support Error Codes 56 If there is an issue with your system Ba
18. represented as single records in gVCF These records use the standard END INFO key to indicate the extent of the record Even though the record can span multiple bases only the first base is provided in the REF field to reduce file size The following is a simplified segment of a gVCF file describing a segment of nonvariant calls starting with an A on chromosome 1 from position 51845 to 51862 INFO lt ID END Number 1 Type Integer Description End position of the variant described in this record gt CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA19238chr1 51845 A PASS END 51862 Any field provided for a block of sites such as read depth using the DP key shows the minimum value that is observed among all sites encompassed by the block Each sample value shown for the block such as the depth DP is restricted to a range where the maximum value is within 30 or 3 of the minimum For example for sample value range x y y lt xtmax 3 x 0 3 This range restriction applies to each of the sample values printed in the final block record Indel Regions Sites that are filled in inside deletions have additional changes All deletions Sites inside any deletion are marked with the deletion filters in addition to any filters that have already been applied to the site Sites inside deletions cannot have a genotype or alternate allele quality score higher than the corresponding value from the enclosing i
19. the project associated with that run is not shared automatically Therefore samples and app results are not accessible to collaborators of the run Share a Run Using the Email Option Use the Share Project option to share a Run with a specified collaborator via an email link The specified collaborators receive an email with a link to the Run and only that person can view the corresponding data The email option allows greater control over who can view your data Sharing using the Get Link options gives anyone access to your data as long as the link is left activated To email a link perform the following steps 1 Click the Runs icon 2 Click the desired run 3 Click Share BaseSpace Onsite v1 0 LT System Guide 4 3 DJISUQ soedseseg esn oL MOH 4 In the Share Settings dialog box enter the collaborators email address and then click Invite z NOTE The invitation email address must match your BaseSpace Onsite login email address Otherwise your collaborator is not able to view the project 5 Click Save Settings i NOTE Runs and projects have separate permissions If you share a run the project associated with that run is not shared automatically Therefore samples and app results are not accessible to collaborators of the run Project and Sample Management 44 The following topics describe how to manage projects and samples in BaseSpace Onsite Combine Samples on page 44 Transfer Owner on page 46 Edit Project Det
20. which sequencing falls behind phasing or jumps ahead prephasing the current cycle within a read The percentage of reads from clusters in each tile that aligned to the Phix genome You can expand a chart by clicking the expand button 2 Q score Heat Map The Q score heat map shows plots that allow you to view the Q score by cycle View the Q score heat map for a quick overview of the Q scores over the cycles Do not use the Q score heat map to look at metrics other than quality scores These plots have the following features The color bars to the right of each chart indicate the values that the colors represent The charts are displayed with tailored scaling the scale is always 0 to 100 of maximum value The symbol in the top right hand corner toggles the plot between pane view and full screen view You can expand a chart by clicking the expand button 2 BaseSpace Onsite v1 0 LT System Guide 2 D y suo soedseseg esn oL MoH 20 View Run Samples List The Run Samples List contains a list of all the samples in the run Use this option when you want to see a list of all the samples in the run or to navigate to details regarding a specific sample To view the Run Samples List perform the following steps 1 Click the Runs icon 2 Click the desired run 3 There are 2 methods to go to the Run Samples List From the Runs Overview page click the Samples link From the Runs Overview page click the Samples icon from the left
21. AM files are suitable for viewing with an external viewer such as IGV or the UCSC Genome Browser BaseSpace Onsite v1 0 LT System Guide 31 y suo soedseseg esn oL MoH 32 When not to use it Do not use it with tools that are not compatible with the BAM format Do not use with applications that cannot handle large files as BAM files can get large depending on the application and data How to use it If you use an app in BaseSpace that uses BAM files as input the app locates the file when launched If using BAM files in other tools download the file to use it in the external tool Detailed Description Go to samtools sourceforge net SAM1 pdf to see the exact SAM specification gVCF Files What is it This application also produces the Genome Variant Call Format file gVCF gVCF was developed to store sequencing information for both variant and nonvariant positions which is required for human clinical applications gVCF is a set of conventions applied to the standard variant call format VCF 4 1 as documented by the 1000 Genomes Project These conventions allow representation of genotype annotation and other information across all sites in the genome in a compact format Typical human whole genome sequencing results expressed in gVCF with annotation are less than 1 Gbyte or about 1 100 the size of the BAM file used for variant calling If you are performing targeted sequencing gVCF is also an appropriate choice to represent
22. AMAGE TO THE PRODUCT S INJURY TO PERSONS INCLUDING TO USERS OR OTHERS AND DAMAGE TO OTHER PROPERTY ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT S DESCRIBED HEREIN INCLUDING PARTS THEREOF OR SOFTWARE 2015 Illumina Inc All rights reserved Illumina 24sure BaseSpace BeadArray BlueFish BlueFuse BlueGnome cBot CSPro CytoChip DesignStudio Epicentre ForenSeq Genetic Energy GenomeStudio GoldenGate HiScan HiSeq HiSeq X Infinium iScan iSelect MiSeq MiSeqDx MiSeq FGx NeoPrep NextBio Nextera NextSeq Powered by Illumina SureMDA TruGenome TruSeq TruSight Understand Your Genome UYG VeraCode verifi VeriSeq the pumpkin orange color and the streaming bases design are trademarks of Illumina Inc and or its affiliate s in the U S and or other countries All other names logos and other trademarks are the property of their respective owners Read Before Using this Product This Product and its use and disposition is subject to the following terms and conditions If Purchaser does not agree to these terms and conditions then Purchaser is not authorized by Illumina to use this Product and Purchaser must not use this Product 1 Definitions Application Specific IP means Illumina owned or controlled intellectual property rights that pertain to this Product and use thereof only with regard to specific field s or specific application s Application Specific IP excludes
23. BaseSpace Onsite v1 0 LT system Guide For Research Use Only Not for use in diagnostic procedures Revision History 6 Introduction 7 Getting Started 12 BaseSpace Onsite User Interface 14 How To Use BaseSpace Onsite 21 51 Admin Tasks Technical Assistance a A A A aS Dome tad He SS cr me ay P Meso TF P Sue a lt tecr al ILLUMINA PROPRIETARY i u m N na Document 1000000002666 v00 September 2015 This document and its contents are proprietary to Illumina Inc and its affiliates Illumina and are intended solely for the contractual use of its customer in connection with the use of the product s described herein and for no other purpose This document and its contents shall not be used or distributed for any other purpose and or otherwise communicated disclosed or reproduced in any way whatsoever without the prior written consent of Illumina Illumina does not convey any license under its patent trademark copyright or common law rights nor similar rights of any third parties by this document The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order to ensure the proper and safe use of the product s described herein All of the contents of this document must be fully read and understood prior to using such product s FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT IN D
24. ERFORMANCE HEREUNDER OR ANY OF THESE TERMS AND CONDITIONS HOWEVER ARISING OR CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT TORT INCLUDING NEGLIGENCE STRICT LIABILITY OR OTHERWISE ILLUMINA S TOTAL AND CUMULATIVE LIABILITY TO PURCHASER OR ANY THIRD PARTY ARISING OUT OF OR IN CONNECTION WITH THESE TERMS AND CONDITIONS INCLUDING WITHOUT LIMITATION THIS PRODUCT INCLUDING USE THEREOF AND ILLUMINA S PERFORMANCE HEREUNDER WHETHER IN CONTRACT TORT INCLUDING NEGLIGENCE STRICT LIABILITY OR OTHERWISE SHALL IN NO EVENT EXCEED THE AMOUNT PAID TO ILLUMINA FOR THIS PRODUCT Limitations on Illumina Provided Warranties TO THE EXTENT PERMITTED BY LAW AND SUBJECT TO THE EXPRESS PRODUCT WARRANTY MADE HEREIN ILLUMINA MAKES NO AND EXPRESSLY DISCLAIMS ALL WARRANTIES EXPRESS IMPLIED OR STATUTORY WITH RESPECT TO THIS PRODUCT INCLUDING WITHOUT LIMITATION ANY IMPLIED WARRANTY OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE NONINFRINGEMENT OR ARISING FROM COURSE OF PERFORMANCE DEALING USAGE OR TRADE WITHOUT LIMITING THE GENERALITY OF THE FOREGOING ILLUMINA MAKES NO CLAIM REPRESENTATION OR WARRANTY OF ANY KIND AS TO THE UTILITY OF THIS PRODUCT FOR PURCHASER S INTENDED USES Product Warranty All warranties are personal to the Purchaser and may not be transferred or assigned to a third party including an affiliate of Purchaser All warranties are facility specific and do not transfer if the Product is moved to another facility of
25. Fan number C Message The hardware monitor has detected that the system is restarting The hardware monitor has detected a timer interrupt The system cover has been opened The system cover has been closed The system has been unplugged from the network The system network connection has been restored The front panel board has detected a critical interrupt error The system board has detected a timeout The system board has recovered from a timeout There was a PEF Action detected The system board has detected that the power button has been pressed The system board has detected that the reset button has been pressed The voltage sensor has detected that the voltage is not within normal range The voltage sensor has detected that the voltage is back within normal range The fans are no longer redundant due to fan number C failing The fans are no longer redundant due to fan number C failing The fans are no longer redundant due to fan number C failing The fans are no longer redundant due to fan number C failing The fans are no longer redundant due to fan number C failing The fans are no longer redundant due to fan number C failing Document 1000000002666 v00 Status Error Error Error OK Error OK Error Error OK Error OK OK Error OK Error Error Error Error Error Error Error Code Item ID E_ C F_ C TEMP TEMP BMC_ FW F1 F1 F2
26. Library Prep Kits page shows all the available library prep kits in Sample Prep To enter a custom kit click New Custom kits allow you to define nonstandard index combinations and to define your own default layout for the indexes on a plate Storage The Storage page shows the total amount of storage used owned by you and shared and the amount of storage used in Runs Projects and Trash Admin Panel The Admin Panel allows you to manage analysis notifications storage users system health planned runs software updates and alarms See Admin Tasks on page 51 for a description M NOTE f You need administrator privileges to see and work in the admin panel Dashboard Tab After login the first tab you see is the dashboard The dashboard provides access to storage information the developers page the newsfeed notifications latest runs and latest analyses The dashboard is always accessible in BaseSpace Onsite from the top ribbon selector i NOTE If a run or project is not showing on BaseSpace Onsite it is possible your data has not been sent to BaseSpace Onsite Set the BaseSpace Onsite option on your sequencing instrument For more information see the system guide for your instrument Storage The storage pane shows the total amount of storage used used by you and shared Click the Details button to open the Storage page under My Account Developers Click the Details button on the Developers pane to go to the BaseSp
27. PH files Double click a file to load it as an IGV track First load VCF files before BAM files because read tracks can take up an entire IGV screen which requires scrolling to see variants Additional Reference Genomes IGV contains several installed reference genomes Homo sapiens Human hg19 Mus musculus Mouse mm9 Saccharomyces cerevisiae S cerevisiae sacCer2 Arabidopsis thaliana A thaliana TAIR10 Run the VariantStudio App The Ilumina VariantStudio data analysis software application enables researchers to identify and classify disease relevant variants quickly and then communicate significant findings in concise and actionable reports This application provides an intuitive framework for nonexpert users and offers the following features Flexible filtering options Streamlined variant classification Rapid and rich annotations Customizable reporting Use VariantStudio if you want to perform the following Explore and isolate key variants Categorize variants and determine biological impact To launch the VariantStudio app perform the following steps 1 Click the Apps button Select the VariantStudio app from the list and click Launch Select the project you want to run the app on You can only select projects you own Click Continue a A W N If you use the app for the first time install VariantStudio BaseSpace Onsite v1 0 LT System Guide 2 Q y suo soedseseg esn oL MoH a Click the Install VariantStudi
28. Purchaser unless Illumina conducts such move a Warranty for Consumables Illumina warrants that Consumables other than custom Consumables will conform to their Specifications until the later of i 3 months from the date of shipment from Illumina and ii any expiration date or the end of the shelf life pre printed on such Consumable by Illumina but in no event later than 12 months from the date of shipment With respect to custom Consumables i e Consumables made to specifications or designs made by Purchaser or provided to Illumina by or on behalf of Purchaser Illumina only warrants that the custom Consumables will be made and tested in accordance with Illumina s standard manufacturing and quality control processes Illumina makes no warranty that custom Consumables will work as intended by Purchaser or for Purchaser s intended uses Warranty for Hardware Illumina warrants that Hardware other than Upgraded Components will conform to its Specifications for a period of 12 months after its shipment date from Illumina unless the Hardware includes Illumina provided installation in which case the warranty period begins on the date of installation or 30 days after the date it was delivered whichever occurs first Base Hardware Warranty Upgraded Components means Illumina provided components modifications or enhancements to Hardware that was previously acquired by Purchaser Illumina warrants that Upgraded Components will conform to their Spe
29. ace Onsite permanently Storage Check BaseSpace Onsite has limited storage capacity and checks the free space available before uploading a run or starting an app The necessary space is then reserved until the process completes If there is not enough space you see an error message and the run or app does not start If the space check fails before starting FASTQ generation the run gets into Needs Attention state To manage available space see Archive or Backup Analysis on page 52 Manage Users On the Users page you see a list of current BaseSpace Onsite accounts and their roles You can sort the users by the column headers To set up a new user click Add User and fill out the form The new user gets an email with a link to set up a new password If the user does not get an email the user can go to the BaseSpace Onsite login page and click Forgot Password to resend the email If you did not configure SMTP during install be aware of the following items You enter the password for the new user BaseSpace Onsite does not enforce usernames to be in the form of an email which can cause a problem with HiSeq integration Make sure to enforce that all users create a username in the format of an email If you enable the SMTP support after using BaseSpace Onsite without SMTP support all users that are logged in must log out and then log back in Otherwise they do not receive notifications by email or on the dashboard Monitor System Hea
30. ace developer portal Access to the BaseSpace developer portal requires an external internet connection outside of your local network Newsfeed The Newsfeed pane shows the most recent posts from the BaseSpace blog Click an article name to open the article or click the Read more link at the bottom of the pane to open the BaseSpace blog The Newsfeed pane requires an external internet connection outside of your local network to show content Access to the BaseSpace blog also requires an external internet connection BaseSpace Onsite v1 0 LT System Guide 1 D geu u JOST 8JISU 89edseseg Notifications This pane shows invitations to shared projects along with other notifications and alerts The most recent notifications listed first There are multiple types of notifications Runs Run in progress Run completed Run error Collaborators Collaborator joined a project run of which you are a member Collaborator invited you to a project run optionally collaborator has included a personal message Collaborator recommended an App Collaborator accepted your offer to transfer ownership Collaborator offered to transfer ownership to you Analyses by you Analysis in progress Analysis completed Analysis error Analyses by collaborators Analysis in progress Analysis completed Analysis error Uploads additions or deletions to from a project of which you are a member By you By a collaborator iy NOTE If you did not configure SMTP during i
31. age 48 Empty Trash on page 49 Restore Trash on page 49 Delete Run To move a project out of your Runs list into the trash perform the following steps 1 Click the Runs icon 2 Click the desired run 3 Click Move to Trash 4 If there are analyses or samples associated with this run BaseSpace Onsite asks if you also want to delete those analyses and samples Select the checkbox if you want to delete the associated items 5 Click Confirm If you are the owner of the run the run now appears in the trash You can permanently delete the run from trash by emptying all items in the trash see Empty Trash on page 49 You can also restore the run to its original location see Restore Trash on page 49 Note the following items about deleting a run If you received the run as a share the deleted run does not appear in the trash If you want to restore a run shared with you click the previously sent share link or contact the owner Runs cannot be removed if they are in a nonterminal state eg running uploading or analyzing Do not perform this action if you want to archive a run Delete Project To move a project out of your Projects list into the trash perform the following steps 1 Click the Projects icon BaseSpace Onsite v1 0 LT System Guide 47 y suo soedseseg esn oL MoH 48 2 Click the desired project 3 Click Move to Trash 4 Click Confirm If you are the owner of the project the project now appears in the trash You
32. ails Use the Edit Project option to change details regarding the project such as the description or project name To edit a project perform the following steps 1 Click the Projects icon 2 Click the desired project 3 Click Edit Project 4 Change project details in the Edit Project dialog box 5 Click Save Set Up a New Project The following list includes reasons to set up a new project To analyze a sample in the context of 2 different projects To transfer ownership of samples to a collaborator but still keep a copy yourself To split a project into multiple projects To set up a new project perform the following steps 1 Click the Projects icon 2 Click New Project in the top left corner 3 Enter a new name and description 4 Click Create To copy samples into the new project see Copy Samples on page 45 Combine Samples Use the following method to combine the data from 2 or more different sequencing runs on the same sample You can only combine samples that have the same read lengths To combine samples perform the following steps Document 1000000002666 v00 SS oO FF WO N m Click the Projects icon Click the desired project Click the Samples link from the left navigation menu Select the checkboxes of the samples you want to combine Click Combine Click Combine in the pop up screen Copy Samples You can copy samples from a project to another project for the following reasons To analyze a
33. all Illumina owned or controlled intellectual property that cover aspects or features of this Product or use thereof that are common to this Product in all possible applications and all possible fields of use the Core IP Application Specific IP and Core IP are separate non overlapping subsets of all Illumina owned or controlled intellectual property By way of non limiting example Illumina intellectual property rights for specific diagnostic methods for specific forensic methods or for specific nucleic acid biomarkers sequences or combinations of biomarkers or sequences are examples of Application Specific IP Consumable s means Illumina branded reagents and consumable items that are intended by Illumina for use with and are to be consumed through the use of Hardware Documentation means Illumina s user manual for this Product including without limitation package inserts and any other documentation that accompany this Product or that are referenced by the Product or in the packaging for the Product in effect on the date of shipment from Illumina Documentation includes this document Hardware means Illumina branded instruments accessories or peripherals Illumina means Illumina Inc or an Illumina affiliate as applicable Product means the product that this document accompanies e g Hardware Consumables or Software Purchaser is the person or entity that rightfully and legally acquires this Product from Illumina or an Illum
34. ave a compatible desktop computer BaseSpace Onsite is compatible with Internet Explorer 10 or higher Chrome 43 or higher Firefox 88 or higher and Safari 8 or higher Hardware requirements for these browsers can be found on the developer website A PC running Windows 7 or greater is required to access the BaseSpace Onsite NOTE When connecting your instrument to BaseSpace Onsite you are asked to enter the full path to your BaseSpace Onsite server Your BaseSpace Onsite IP address can be found in the broker configuration file of the sequencing system that you want to connect BaseSpace Onsite to The BaseSpace Onsite IP address is included as part of the API URL value Using BaseSpace Onsite with MiSeq The MiSeq System features an option to send instrument health and sequencing data to BaseSpace Onsite in real time to streamline both instrument quality control and analysis Real time monitoring of runs enables fast troubleshooting Free alignment and variant calling provide many easy to use workflows that tailor analysis for diverse biological applications When you set up the run on the MiSeq select the option to log in to BaseSpace Onsite For more information see MiSeq Connection on page 12 NOTE f Raw data from the run is also stored on the instrument or in the location of the output folder that you specified in the Storage screen BaseSpace Onsite automatically disconnects from the MiSeq at the end of the run or when a
35. both reads 1 and 2 Each read has passed filter The uploader rejects any upload session containing files that do not meet the requirements If a file is rejected a message is provided This message states why the upload failed and what to do to remedy the problem Transfer Owner You can use the Transfer Owner option to hand control of data over to a collaborator or customer You can use this option for the following reasons To give control of your data to a collaborator You can only transfer data to collaborators who have an account on BaseSpace Onsite NOTE i If items from a project are in the trash you cannot transfer ownership of the project To use this option perform the following steps 1 Select the project or run you want to transfer To transfer a project perform the following steps a Click the Projects icon b Click the desired project c Click the Transfer Owner button Document 1000000002666 v00 To transfer a run perform the following steps a Click the Runs icon b Click the desired run c Click the More button and then select Transfer Ownership 2 Enter new owner email and an optional message in the Transfer Ownership dialog box 3 Click Continue Delete Items You can delete items in a 2 step process 1 Move the item to trash 2 Clean up the trash For more information see the following topics Delete Run on page 47 Delete Project on page 47 Delete Analysis on page 48 Delete Sample on p
36. cifications for a period of 90 days from the date the Upgraded Components are installed Upgraded Components do not extend the warranty for the Hardware unless the upgrade was conducted by Illumina at Illumina s facilities in which case the upgraded Hardware shipped to Purchaser comes with a Base Hardware Warranty Exclusions from Warranty Coverage The foregoing warranties do not apply to the extent a non conformance is due to i abuse misuse neglect negligence accident improper storage or use contrary to the Documentation or Specifications ii improper handling installation maintenance or repair other than if performed by Illumina s personnel iii unauthorized alterations iv Force Majeure events or v use with a third party s good not provided by Illumina unless the Product s Documentation or Specifications expressly state such third party s good is for use with the Product Procedure for Warranty Coverage In order to be eligible for repair or replacement under this warranty Purchaser must i promptly contact Illumina s support department to report the non conformance ii cooperate with Illumina in confirming or diagnosing the non conformance and iii return this Product transportation charges prepaid to Illumina following Hlumina s instructions or if agreed by Illumina and Purchaser grant lllumina s authorized repair personnel access to this Product in order to confirm the non conformance and make repairs Sole Remedy
37. cing falls behind phasing or jumps ahead prephasing the current cycle within a read Aligned The percentage of reads from clusters in each tile that aligned to the PhiX genome Perfect Reads The percentage of reads that align perfectly as determined by a spiked in PhiX control sample If no PhiX control sample is run in the lane this chart is all gray Corrected Intensity The intensity corrected for cross talk between the color channels by the matrix estimation and phasing and prephasing Called Intensity The intensity for the called base Signal to Noise The signal to noise ratio is calculated as mean called intensity divided by standard deviation of noncalled intensities Note the variable scales used on these different parameters Data By Cycle Plot The Data by Cycle plot shows the progression of quality metrics during a run as a line graph Use the Data By Cycle plot to judge the progression of quality metrics during a run on a cycle by cycle basis Do not use the Data By Cycle plot to look at downstream analysis metrics or aggregate analysis for a whole lane regardless of cycle BaseSpace Onsite v1 0 LT System Guide 2 3 y suo soedsSeseg esn O MoH 24 The Data by Cycle plots have the following features You can select the displayed metric and base through the drop down lists The symbol in the top right hand corner toggles the plot between pane view and full screen view You can monitor the following qual
38. core When using Q score binning this plot reflects the subset of Q scores used Data by Lane Plot The Data by Lane plots allow you to view quality metrics per lane Use the Data By Lane plot to judge the difference in quality metrics between lanes Do not use the Data By Lane plot to look at alignment or variant calling analysis metrics The Data by Lane plots have the following features You can select the displayed metric through the drop down lists The symbol in the top right hand corner toggles the plot between pane view and full screen view The plots share several characteristics The plots show the distribution of mean values for a given parameter across all tiles in a given lane The red line indicates the median tile value for the parameter displayed Blue boxes are for raw clusters green boxes for clusters passing filter The box outlines the interquartile range the middle 50 of the data for the tiles analyzed for the data point The error bars delineate the minimum and maximum without outliers The outliers are the values that are more than 1 5 times the interquartile range below the 254 percentile or more than 1 5 times the interquartile range above the 75 percentile Outliers are indicated as dots You can monitor the following quality metrics with this plot The density of clusters for each tile in thousands per mm The number of clusters for each tile in millions The estimated percentage of molecules in a cluster for
39. detected a predictive failure The number C AC power supply has been lost The number C AC power supply has been restored Status Error OK Error OK Error Error OK Error OK Error OK Error OK Error OK Error OK OK Error OK Error Error OK 59 SE UIWPY Error Code Item ID PS_ C PS C PS C PS 9C PS_ C PS_ C PS_ C PS_ C CBPB CBPB P_ C P_ C P_ C P_ C P_ERR_ C PAERRS C SO Item Name Power supply number C Power supply number C Power supply number C Power supply number C Power supply number C Power supply number C Power supply number C Power supply number C Chassis Back Panel Board Chassis Back Panel Board Processor number C Processor number C Processor number C Processor number C Processor number C digital state error Processor number C digital state error Message The number C AC power supply has resolved the configuration error for a vendor mismatch The number C AC power supply has detected a configuration error for a vendor mismatch The number C AC power supply has resolved the configuration error for a revision mismatch The number C AC power supply has detected a configuration error for a revision mismatch The number C AC power supply has resolved the configuration error for a missing processor The number C AC power supply has detected a configuration error for a missing
40. ding the version a link to the developer and their app support contact details Clicking the Launch button leads you through the launch pages which allow you to set up the app session Specify parameters like the project sample or output folder used by the app depending on the app and accept access permissions You can search for apps using Search Document 1000000002666 v00 How To Use BaseSpace Onsite The following topics describe how to run different functions in BaseSpace Onsite View Files and Results on page 21 Download Files on page 30 Project and Sample Management on page 44 Search for Runs Projects Samples Files and Apps on page 50 View Files and Results The following topics describe how to view files and results in BaseSpace Onsite View Files from a Run BaseSpace Onsite gives you an option to view your run files or download them individually To view files perform the following steps 1 Click the Runs icon 2 Click the desired run 3 From the Run Overview Page select the Files icon O from the left navigation menu 4 Select the desired file to view See BaseSpace Onsite Files on page 31 for a description of the available files View Indexing QC Page The Indexing QC page lists count information for indexes used in the run The Indexing QC is only available if the run is an index run By viewing the indexing QC results you can see unexpected results for a sample with a particular index and use the
41. e an external network from the UCSC connection hg19 genome On node analysis This option is a localized version of Illumina Annotation Service RefSeq or Ensembl provided with the BaseSpace Onsite v2 1 software update It provides annotations for known variants as provided by Illumina Annotation Service and can also predict novel variants This option does not require an external network connection None No annotation is performed with this option The reports generated for analyses using this option shows either a 0 or N A for the various annotations 10 Document 1000000002666 v00 The following apps provide either the Illumina Annotation Service or None options Amplicon DS v1 0 BWA Enrichment v2 1 Isaac Enrichment v2 1 TruSeq Amplicon v1 1 The following apps provide the Illumina Annotation Service Basic or None options BWA Enrichment v1 0 BWA Whole Genome Sequencing v1 0 Isaac Enrichment v1 0 Isaac Whole Genome Sequencing v2 The Isaac Whole Genome Sequencing v4 0 application can perform annotation on node without the need for an external network connection to the Illumina Annotation Service All other applications on BaseSpace Onsite do not provide annotation options To perform annotation on the results of these analyses you can use the VariantStudio application which also performs annotation using the lumina Annotation Service BaseSpace Onsite v1 0 LT System Guide 1 1 UOIONPOANU Getting Started Make sure to h
42. e sharing a project with a particular collaborator See Share a Project Using the Email Option on page 42 Get Link Forward the sharing link to any number of collaborators See Share a Project using the Get Link option on page 42 Transfer Owner Hand control of data over to a collaborator or customer See Transfer Owner on page 46 Move to Trash Delete a project This button is visible if a project is selected See Delete Project on page 47 View Trash View the deleted items in the trash so you can restore them or empty the trash See Delete Items on page 47 iy NOTE Runs and projects have separate permissions If you share a project you do not share the runs contained within the project Project Overview Page The Project Overview page provides access to 3 panes with information about the project About Provides summary information about the project including the project owner shared status date created and collaborators Document 1000000002666 v00 Analyses Provides a list of all the App Sessions in the project This tab can be sorted based on analysis name last modified date created status or application used to generate the analysis Clicking the analysis links to the app results for that sample For more information see Analyses Page on page 19 Samples Provides a list of all the samples in the project Clicking a sample links to the page for that sample For more information see Sample Overview Page on page 19
43. ect the items you want to restore 3 Click Restore Trash The item is now restored to its original location Restored items keep all their original attributes except for the share recipients Fix Sample Sheet Rerun Workflow The Fix Sample Sheet page lets you correct errors in your sample sheet for HiSeq runs or set up a new analysis to requeue Use this feature for the following reasons To fix errors in the sample sheet Errors in the sample sheet can prevent BaseSpace Onsite from processing a run This option allows BaseSpace Onsite to finish the analysis To change analysis parameters If first analysis is suboptimal you can resubmit the sample sheet and requeue the run with new analysis parameters one time To change indexing details If index settings for samples were wrong you can correct the settings L NOTE You can only submit a corrected sample sheet and requeue the run 1 time To fix a sample sheet and rerun a workflow perform the following steps 1 Open the Fix Sample Sheet page using 1 of the following methods If a run has a Needs Attention state open the run and click Fix Sample Sheet Go to a run click the More drop down list and then select Fix Sample Sheet The Fix Sample Sheet page opens If BaseSpace Onsite has detected an error it shows the issue above the black sample sheet editor 2 Make changes depending on the complexity of the change BaseSpace Onsite v1 0 LT System Guide A Q y suo soedsSese
44. epresent the current cycle The following metrics are available in the Read tables split out by lane Document 1000000002666 v00 Tiles The number of tiles per lane Density The density of clusters in thousands per mm detected by image analysis 1 standard deviation Clusters PF The percentage of clusters passing filtering 1 standard deviation Phas Prephas The value used by RTA for the percentage of molecules in a cluster for which sequencing falls behind phasing or jumps ahead prephasing the current cycle within a read For MiSeq and NextSeq RTA generates phasing and prephasing estimates empirically for every cycle The value displayed here is therefore not used in the actual phasing prephasing calculations but is an aggregate value determined from the first 25 cycles For most applications the value reported is very close to the value that is applied For low diversity samples or samples with unbalanced base composition the reported value can diverge from the values being applied because the value changes from cycle to cycle Reads The number of clusters in millions Reads PF The number of clusters in millions passing filtering Q 30 The percentage of bases with a quality score of 30 or higher respectively This chart is generated after the 25th cycle and the values represent the current cycle Yield The number of bases sequenced which passed filter Cycles Err Rated The number of cycles that have
45. er for both variant and nonvariant sites Filtering on this value corresponds to a conservative assumption appropriate for applications where reference genotype calls must be determined at the same stringency as variant genotypes ie An assertion that a site is homozygous reference at GQX gt 30 is made assuming the site is variant An assertion that a site is a nonreference genotype at GQX gt 30 is made assuming the site is nonvariant Section Descriptions The gVCF file contains the following sections Metainformation lines start with and contain metadata config information and define the values that the INFO FILTER and FORMAT fields can have The header line starts with and names the fields that the data lines use These fields are CHROM POS ID REF ALT QUAL FILTER INFO FORMAT followed by one or more sample columns Data lines that contain information about one or more positions in the genome If you extract the variant lines from a gVCF file you produce a conventional variant VCF file Field Descriptions The fixed fields CHROM POS ID REF ALT QUAL are defined in the VCF 4 1 standard provided by the 1000 Genomes Project The fields ID INFO FORMAT and sample are described in the metainformation CHROM Chromosome an identifier from the reference genome or an angle bracketed ID String lt ID gt pointing to a contig POS Position The reference position with the first base having position 1 Positi
46. er s or licensor s indemnity Upon written request Illumina will attempt to pass through such indemnity if any to Purchaser Revision History Part Date Description of Change Document October Initial release 1000000002666 2015 v00 BaseSpace Onsite v1 0 LT System Guide AJO3SIH UOISIASH Introduction The BaseSpace Onsite LT System is a genomics analysis platform that is a directly integrated end to end solution for the MiSeq System using MiSeq Control Software MCS v2 6 or later BaseSpace Onsite has the following features The instrument seamlessly pushes the base call bcl files and associated files to BaseSpace Onsite for automatic analysis and storage There is no need for a manual and time consuming data transfer step UOIONPOANU BaseSpace Onsite provides a mechanism to share data with others and easily scale storage and computing needs BaseSpace Onsite runs locally no need to connect to the cloud Workflow Model Processing a flow cell on a sequencing instrument produces various files collectively referred to as a run A run contains log files instrument health data run metrics sample sheet and base call information bcl files The base call information is demultiplexed in BaseSpace Onsite to create the samples used in secondary analysis The result files from an app session are stored in an analysis Analyses are created to record every time an app is launched For example when a resequencing
47. erver software and upload additional genome content perform the following steps 1 Plug the external USB drive with the software update into the BaseSpace Onsite head node server 2 Go to the Updates page 3 Click Detect Drive The Updates wizard leads you through the update System Logs The System Logs page provides a download of the log files You can download all log files or packages that contain the system state log files active analysis log files or delete log files If an issue arises with your BaseSpace Onsite Illumina support uses these files to troubleshoot your system To speed up troubleshooting download the appropriate package before calling lumina support About Page Licenses The About page provides a download containing the licenses for third party software components Manage Alarms on the Settings Page If there are problems with the hard drive BaseSpace Onsite sounds a loud alarm The Disable Alarm button on the Settings page allows you to turn off a current alarm See Replace Hard Drive on page 55 to continue x CAUTION Do not disable the alarm and ignore the warning Failure to address the warning could lead to irretrievable data loss Replacement Procedures 54 You have received a spare hard drive and power supply module with the instrument If needed you can perform the replacement without calling Illumina using the instructions in this section To order more use the following material
48. es not apply if the Specifications or Documentation state otherwise or g is the transfer to a third party of or sub licensing of Software or any third party software All Software whether provided separately installed on or embedded in a Product is licensed to Purchaser and not sold Except as expressly stated in this Section no right or license under any of Illumina s intellectual property rights is or are granted expressly by implication or by estoppel Purchaser is solely responsible for determining whether Purchaser has all intellectual property rights that are necessary for Purchaser s intended uses of this Product including without limitation any rights from third parties or rights to Application Specific IP Ilumina makes no guarantee or warranty that purchaser s specific intended uses will not infringe the intellectual property rights of a third party or Application Specific IP Regulatory This Product has not been approved cleared or licensed by the United States Food and Drug Administration or any other regulatory entity whether foreign or domestic for any specific intended use whether research commercial diagnostic or otherwise This Product is labeled For Research Use Only Purchaser must ensure it has any regulatory approvals that are necessary for Purchaser s intended uses of this Product Unauthorized Uses Purchaser agrees a to use each Consumable only one time and b to use only Illumina consumables reagents wit
49. es on page 56 provides a list of possible codes and descriptions to help you troubleshoot Manage BaseSpace Onsite If you have admin privileges the Account drop down list provides access to the Admin Panel The Admin Panel allows you to manage analysis notifications storage users system health planned runs software updates and alarms Manage Analysis On the Analysis page you see the analyses that are currently running and the analyses that are queued You can sort the analyses by the column headers You can perform the following actions Select an active analysis and click Stop to stop the analysis Select a queued analysis and click Remove to remove the analysis from the queue Click Settings to set the administrator notifications you get through email Manage Storage The Storage page contains 3 tabs Active Storage Provides an overview of the total amount of active storage used and free and the storage by user Active samples runs and analyses are stored on the BaseSpace Onsite system and can be used for analysis At the bottom you see the list of active samples runs and analyses stored you can sort this list by clicking the column headers Any changes that add or remove data usually take 3 5 minutes to be reflected in the pie chart Active samples runs and analyses are stored on the BaseSpace Onsite system and can be used for analysis di NOTE If there are many merged samples and copied samples on the system t
50. failure The power supply is no longer redundant due to power unit number C failing The power supply is no longer redundant due to power unit number C failing The power supply is no longer redundant due to power unit number C failing The power supply is no longer redundant due to power unit number C failing The power supply is no longer redundant due to power unit number C failing The power supply is no longer redundant due to power unit number C failing The power supply is no longer redundant due to power unit number C failing The power supply is redundant again The hardware monitor has detected an expired timer The hardware monitor has detected hard reset of the system The hardware monitor has detected that the system is shutting down Status Error OK Error OK Error OK Error Error Error Error Error Error Error OK Error Error Error of syse UIWPY 58 Error Code Item ID IPMI IPMI Phy_Sec Phy_Sec Phy_Sec Phy_Sec FPB SMI SMI SE SB SB VR VR F_ C F_ C IE RC F C F C F C Item Name IPMI Watchdog IPMI Watchdog Physical Security Physical Security Physical Security Physical Security Front Panel Board System Board Timeout System Board Timeout System Event System Board System Board Voltage Watchdog Voltage Watchdog Fan number C Fan number C Fan number C Fan number C Fan number C
51. g esn o 1 MoH 3 4 Easy fix Edit the sample sheet in the sample sheet editor BaseSpace Onsite keeps validating the sample sheet as you edit any remaining issues are displayed above the sample sheet editor Complex Fix Use Illumina Experiment Manager IEM to create a sample sheet a If necessary install IEM and open the program b Import the original sample sheet from your system in IEM and edit it or generate a new sample sheet For more information see the Illumina Experiment Manager User Guide part 15031335 c Copy and paste the sample sheet into the Sample Sheet Editor in BaseSpace Onsite BaseSpace Onsite validates the sample sheet any issues are displayed above the sample sheet editor When you are done editing and the sample sheet is valid click the Queue Analysis button BaseSpace Onsite starts analyzing the run using the new sample sheet You can only resubmit a sample sheet and requeue the run 1 time NOTE If your edits result in an invalid sample sheet the Queue Analysis button is not available You can return to the original using the Load Original button Common Sample Sheet Fixes If a sample sheet is invalid it could be because the genome path is not set up correctly This situation is indicated through the Genome Path Unknown Genome warning as in the example The paths of the standard BaseSpace Onsite genomes have to conform to the following relative paths Arabidopsis thaliana NCBI build9 1 Se
52. g to or arising out of i Purchaser s breach of any of these terms and conditions ii Purchaser s use of this Product outside of the scope of research use purposes iii any use of this Product not in accordance with this Product s Specifications or Documentation or iv any Excluded Claim Conditions to Indemnification Obligations The parties indemnification obligations are conditioned upon the party seeking indemnification i promptly notifying the other party in writing of such claim or action ii giving the other party exclusive control and authority over the defense and settlement of such claim or action iii not admitting infringement of any intellectual property right without prior written consent of the other party iv not entering into any settlement or compromise of any such claim or action without the other party s prior written consent and v providing reasonable assistance to the other party in the defense of the claim or action provided that the party reimburses the indemnified party for its reasonable out of pocket expenses incurred in providing such assistance Third Party Goods and Indemnification Illumina has no indemnification obligations with respect to any goods originating from a third party and supplied to Purchaser Third party goods are those that are labeled or branded with a third party s name Purchaser s indemnification rights if any with respect to third party goods shall be pursuant to the original manufactur
53. h Illumina Hardware The limitations in a b do not apply if the Documentation or Specifications for this Product state otherwise Purchaser agrees not to nor authorize any third party to engage in any of the following activities i disassemble reverse engineer reverse compile or reverse assemble the Product ii separate extract or isolate components of this Product or subject this Product or components thereof to any analysis not expressly authorized in this Product s Documentation iii gain access to or attempt to determine the methods of operation of this Product or iv transfer to a third party or grant a sublicense to any Software or any third party software Purchaser further agrees that the contents of and methods of operation of this Product are proprietary to lumina and this Product contains or embodies trade secrets of Illumina The conditions and restrictions found in these terms and conditions are bargained for conditions of sale and therefore control the sale of and use of this Product by Purchaser Limited Liability TO THE EXTENT PERMITTED BY LAW IN NO EVENT SHALL ILLUMINA OR ITS SUPPLIERS BE LIABLE TO PURCHASER OR ANY THIRD PARTY FOR COSTS OF PROCUREMENT OF SUBSTITUTE PRODUCTS OR SERVICES LOST PROFITS DATA OR BUSINESS OR FOR ANY INDIRECT SPECIAL INCIDENTAL EXEMPLARY CONSEQUENTIAL OR PUNITIVE DAMAGES OF ANY KIND ARISING OUT OF OR IN CONNECTION WITH WITHOUT LIMITATION THE SALE OF THIS PRODUCT ITS USE ILLUMINA S P
54. he usage per user values are overestimated in the Storage Use By Ovvners pie chart The Total Active Storage is not affected Archive Storage Provides an overview of the archived analyses Archived samples runs and analyses are stored on the archive system and cannot be used for analysis on BaseSpace Onsite without restoring At the bottom you see the list of archived samples runs and analyses you can sort this list by clicking the column headers Deleted Items Provides an overview of the items that have been deleted At the bottom you see the list of deleted samples runs and analyses you can sort this list by clicking the column headers You can restore these items to active storage or purge them from BaseSpace Onsite which deletes them permanently BaseSpace Onsite v1 0 LT System Guide 5 SYSE UILUPY 52 L NOTE Illumina highly recommends that you set up an archive location Archive or Backup Analysis To archive or backup an analysis perform the following steps 1 On the Storage page go to the Archive Storage tab 2 Select the analysis 3 Click Archive 4 A dialog box appears asking you if you want to keep the data in active storage If you keep the data in active storage you can keep working with the analysis while making a backup in the archive If you do not keep the analysis in active storage the data are archived and you cannot work with the analysis in BaseSpace Onsite You can always move it back
55. in BaseSpace Onsite Launch Apps on page 28 Launch the IGV App on page 28 Run the VariantStudio App on page 29 Launch Apps You can launch apps that perform additional analysis visualization or annotation of data To launch an app perform the following steps 1 There are 2 ways to start an app Navigate to the project sample or analysis that you want to run the app on click the Launch Apps button and select the desired app from the drop down list Go to the Apps button select the desired app from the list and click Launch If you are running BWA Enrichment v2 1 or Isaac Enrichment v2 1 read Enrichment v2 1 Apps Adapter Trimming on page 30 2 Read the End User License Agreement and permissions and then click Accept The app now guides you through the start up process BaseSpace Onsite has limited storage capacity and checks the free space available before starting an app If there is not enough available space BaseSpace Onsite displays an error message For more information see Storage Check on page 53 Launch the IGV App The Integrative Genomics Viewer IGV of the Broad Institute is a fully featured genome browser that allows you to visualize your sequence data in great detail Ilumina has modified IGV to display alignment and variant data from BaseSpace Onsite BAM and VCF files IGV enables you to perform variant analysis after launching Resequencing or Amplicon workflows in BaseSpace Onsite IGV is run on a project
56. ina authorized dealer Software means Illumina branded software e g Hardware operating software data analysis software All Software is licensed and not sold and may be subject to additional terms found in the Software s end user license agreement Specifications means lllumina s written specifications for this Product in effect on the date that the Product ships from Illumina 2 Research Use Only Rights Subject to these terms and conditions and unless otherwise agreed upon in writing by an officer of Illumina Purchaser is granted only a non exclusive non transferable personal non sublicensable right under Illumina s Core IP in existence on the date that this Product ships from Illumina solely to use this Product in Purchaser s facility for Purchaser s internal research purposes which includes research services provided to third parties and solely in accordance with this Product s Documentation but specifically excluding any use that a would require rights or a license from Illumina to Application Specific IP b is a re use of a previously used Consumable c is the disassembling reverse engineering reverse compiling or reverse assembling of this Product d is the separation extraction or isolation of components of this Product or other unauthorized analysis of this Product e gains access to or determines the methods of operation of this Product f is the use of non Illumina reagent consumables with Illumina s Hardware do
57. information for troubleshooting purposes You can also use this feature to confirm that all indexed samples were represented properly To view indexing QC results perform the following steps 1 Click the Runs icon 2 Click the desired run 3 There are 2 methods to go to the Indexing QC page From the Run Overview page click the Indexing QC link From the Run Overview page click the Indexing QC icon from the left navigation menu You can select the displayed lane through the drop down list The first table provides an overall summary of the indexing performance for that lane including the following information Total Reads The total number of reads for this lane PF Reads The total number of passing filter reads for this lane BaseSpace Onsite v1 0 LT System Guide 2 1 y suo soedseseg esn OL MOH 2 Reads Identified The total fraction of passing filter reads assigned to an index PF CV The coefficient of variation for the number of counts across all indexes Min The lowest representation for any index Max The highest representation for any index Further information is provided regarding the frequency of individual indexes in both table and graph form The table includes the following columns Index Number A unique number assigned to each index by BaseSpace Onsite for display purposes Sample ID The sample ID assigned to an index in the sample sheet Project The project assigned to an index in the sample sheet
58. ion the missing value is used The possible entries in the INFO column e AD Entry of the form X Y where X is the number of reference calls Y the number of alternate calls e CD A flag indicating that the SNP occurs within the coding region of at least 1 RefGene entry e DP The depth number of base calls aligned to this position e GI A comma separated list of gene IDs read from RefGene e NL Noise level an estimate of base calling noise at this position e TI A comma separated list of transcript IDs read from RefGene e SB Strand bias at this position e VF Variant frequency The number of reads supporting the alternate allele The 1 based position of this variant in the reference chromosome The convention for VCF files is that for SNPs this base is the reference base with the variant For indels or deletions this base is the reference base immediately before the variant Variants are in order of position BaseSpace Onsite v1 0 LT System Guide 3 F y suo soedseseg esn O MoH 38 Setting Description QUAL A Phred scaled quality score assigned by the variant caller Higher scores indicate higher confidence in the variant and lower probability of errors For a quality score of Q the estimated probability of an error is 10 Q 10 For example the set of Q30 calls has a 0 1 error rate Many variant callers assign quality scores based on their statistical models which are high relative to the erro
59. ist of all the app results in the run the associated projects and the number of samples in that analysis Charts Shows an intensity by cycle chart Clicking the header takes you to the Charts page which contains 5 charts with run metrics Run Summary Shows tables with basic data quality metrics Clicking the header takes you to the Run Summary page Indexing QC Lists count information for indexes used in the run Clicking the header takes you to the Indexing QC page In addition the Side Navigation ribbon provides easy navigation in the Run Details area Run Samples List The samples list allows you to sort the samples in your run based on sample ID app date created and project If you want to look at a sample app result or project in detail click the links to get to the following pages Sample Overview Page on page 19 Analyses Page on page 19 Project Overview Page on page 18 In addition the Side Navigation ribbon provides easy navigation in the Run Details area Projects Tab 18 The Projects button opens a list of your projects You can sort the list by name last update or owner Clicking a project provides access to the app results and samples within that project You manage the projects by using the buttons above the list New Project Generate a new project See Set Up a New Project on page 44 Edit project Edit the name and description of the project See Edit Project Details on page 44 Share Project Manag
60. ity metrics with this plot Intensity This chart shows the intensity by color and cycle of the 90 percentile of the data for each tile FWHM The average full width of clusters at half maximum in pixels Used to display focus quality Base The percentage of clusters for which the selected base A C T or G has been called Q gt 20 Q gt 30 The percentage of bases with a quality score of gt 20 or gt 30 respectively These charts are generated after the 25 cycle and the values represent the current scored cycle Median Q Score The median Q Score for each tile over all bases for the current cycle These charts are generated after the 25 cycle This plot is best used to examine the Q scores of your run as it progresses Bear in mind that the Q30 plot can give an over simplified view due to its reliance on a single threshold Error Rate The calculated error rate as determined by a spiked in PhiX control sample If no PhiX control sample is run in the lane this chart is not available Perfect Reads The percentage of reads that align perfectly as determined by a spiked in PhiX control sample If no PhiX control sample is run in the lane this chart is all gray Corrected Intensity The intensity corrected for cross talk between the color channels by the matrix estimation and phasing and prephasing Called Intensity The intensity for the called base Signal to Noise The signal to noise ratio is calculated as mean cal
61. led intensity divided by standard deviation of noncalled intensities You can expand a chart by clicking the expand button 2 Q score Distribution The Q score Distribution plot shows a bar graph that allows you to view the number of bases by quality score The quality score is cumulative for current cycle and previous cycles and only bases from reads that pass the quality filter are included Use it to judge the Q score distribution for a run which is an excellent indicator for run performance Do not use the Q score Distribution plot to look at metrics other than quality scores The Q score Distribution pane shows plots that allow you to view the number of reads by quality score The quality score is cumulative for current cycle and previous cycles and only reads that pass the quality filter are included These plots have the following features You can select the displayed read and cycle through the drop down lists The symbol in the top right hand corner toggles the plot between pane view and full screen view Document 1000000002666 v00 The Q score is based on the Phred scale The following list shows Q scores and the corresponding chance that the base call is wrong Q10 10 chance of wrong base call Q20 1 chance of wrong base call Q30 0 1 chance of wrong base call Q40 0 01 chance of wrong base call You can slide the threshold set at 2 Q30 by default to examine the proportion of bases at or above any particular Q s
62. ll RTA analysis files have finished uploading If the internet connection is interrupted analysis files continue uploading after the connection is restored from the point when the interruption occurred When the last base call file is uploaded to BaseSpace Onsite secondary analysis of your data begins For information about how to run tasks see How To Use BaseSpace Onsite on page 21 i NOTE Unlike BaseSpace BaseSpace Onsite does not have a MiSeq Reporter app BaseSpace Onsite directs all workflow types uploaded from MiSeq through the GenerateF ASTQ app To perform additional secondary analysis manually launch the relevant app or apps on the resulting FASTQ samples MiSeq Connection Perform the following steps to connect MiSeq to BaseSpace Onsite 1 Make sure that you have MCS version 2 6 or later If you do not upgrade your MCS 2 Make sure that you have a stable internet connection of at least 10 Mbps upload speed from the MiSeq 3 During run configuration enter the full path to your BaseSpace Onsite server 12 Document 1000000002666 v00 4 Select or clear When using BaseSpace or BaseSpace Onsite replicate analysis locally on MiSeq The Replicate Analysis Locally setting specifies analysis processing locations when using BaseSpace Onsite The setting provides the option to perform analysis both locally on the instrument and in BaseSpace Onsite Consider the following items when selecting or deselecting this option If you selec
63. lth On the System Health page you see the BaseSpace Onsite system health alerts You can sort the alerts by the column headers Many sensors are monitored for health in the BaseSpace Onsite server If a sensor indicates a failure BaseSpace Onsite sends an alert to the administrator When you receive an alert contact Illumina Support to diagnose the error and if necessary arrange a site visit to correct the problem Some of these errors such as a failure of a disk drive or 1 of the power supplies you can resolve See Replacement Procedures on page 54 for instructions lumina Support can also guide you through the process of replacing the faulty component If you want to remove an alert select the alert and click Dismiss Unlock Planned Runs On the Planned Runs page you see the runs that are currently planned You can sort the runs by the column headers BaseSpace Onsite v1 0 LT System Guide D 3 SYSE UILUDY The sequencing system locks planned runs when they are selected In rare instances the sequencing system leaves the run in locked state without starting the run These runs must be manually unlocked to access again Unlocking runs allows the users to edit the run in the Prep tab and makes the run available for selection on other sequencing systems Unlocking also frees up the reserved run storage space on the BaseSpace Onsite system To unlock a run select the planned run and click Unlock Updates To update the s
64. ly fan number C has been restored The thermal sensor at memory location C has exceeded its threshold The thermal sensor at memory location C is back within normal range Disk rebuild in progress at slot C Disk rebuild at slot C has completed Disk at slot C is no longer online Disk at slot C is back online Disk at slot C is no longer working Disk at slot C is no functioning correctly again The logical volume at B size C D is not currently active Status Error OK Error OK Error OK Error OK Error OK Error 61 Sse L UIWIPWY Notes Technical Assistance For technical assistance contact Illumina Technical Support Table 2 Ilumina General Contact Information Website www illumina com Email techsupport illumina com Table 3 Illumina Customer Support Telephone Numbers Region Contact Number Region Contact Number North America 1 800 809 4566 Italy 800 874909 Australia 1 800 775 688 Netherlands 0800 0223859 Austria 0800 296575 New Zealand 0800 451 650 Belgium 0800 81102 Norway 800 16836 Denmark 80882346 Spain 900 812168 Finland 0800 918363 Sweden 020790181 France 0800 911850 Switzerland 0800 563118 Germany 0800 180 8994 United Kingdom 0800 917 0041 Ireland 1 800 812949 Other countries 44 1799 534000 Safety data sheets SDSs Available on the Illumina website at support illumina com sds html Product documentation Available for download in PDF from the Illumina website Go to sup
65. mina Health runs help Illumina diagnose issues and improve our products The information consists of InterOp files and log files and is not tied to any user account This option is on by default Share Data Data in BaseSpace Onsite can be shared with collaborators in a couple of different ways You can either share data at a run or project level via an email invitation or through a hyperlink With the email invitation option only the accounts with the specified email can view shared data Sharing via a hyperlink option allows anyone with access to the hyperlink to be able to view the shared data as long as the hyperlink is still active BaseSpace Onsite v1 0 LT System Guide 41 42 Sharing is for read only access If you want a collaborator to have write access see Transfer Owner on page 46 NOTE i Runs and projects have separate permissions If you share a run the project associated with that run is not shared automatically Therefore samples and app results are not accessible to collaborators of the run The following topics describe how to share data Share a Project using the Get Link option on page 42 Share a Project Using the Email Option on page 42 Share a Run with Get Link on page 43 Share a Run Using the Email Option on page 43 Share a Project using the Get Link option The hyperlink can be turned on or off by setting the activate or deactivate option Anyone can access the project or run when the link is activated
66. mosomes appear in the same order as the reference FASTA file generally karyotype order If all filters are passed the PASS is written The possible filters are as follows e q20 The variant score is less than 20 Configurable using the VariantFilterQuality Cutoff setting in the config file e r8 For an Indel the number of repeats in the reference of a 1 or 2 base repeat is greater than 8 Configurable using the IndelRepeatFilterCutoff setting in the config file The format column lists fields separated by colons for example GT GQ The list of fields provided depends on the variant caller used The available fields are as follows AD Entry of the form X Y where X is the number of reference calls Y the number of alternate calls GQ Genotype quality GT Genotype 0 corresponds to the reference base 1 corresponds to the first entry in the ALT column 2 corresponds to the second entry in the ALT column and so on The indicates that there is no phasing information NL Noise level an estimate of base calling noise at this position SB Strand bias at this position Larger negative values indicate more bias values near 0 indicate little strand bias VF Variant frequency The percentage of reads supporting the alternate allele The rs number for the SNP obtained from dbSNP If there are multiple rs numbers at this location the list is semicolon delimited If no dbSNP entry exists at this posit
67. ndel Heterozygous deletions Sites inside heterozygous deletions are altered to have haploid genotype entries eg 0 instead of 0 0 1 instead of 1 1 Heterozygous SNV calls inside heterozygous deletions are marked with the SiteConflict filter and their genotype is unchanged Homozygous deletions Homozygous reference and no call sites inside homozygous deletions have genotype Sites inside homozygous deletions that have a nonreference genotype are marked with a SiteConflict filter and their genotype is unchanged un Site and genotype quality are set to The described modifications reflect the notion that the site confidence is bound within the enclosing indel confidence On occasion the variant caller produces multiple overlapping indel calls that cannot be resolved into 2 haplotypes If this case all indels and sites in the region of the overlap are marked with the IndelConflict filter BaseSpace Onsite v1 0 LT System Guide 3 3 y suo soedseseg esn oL MOH 34 Genotype Quality for Variant and Nonvariant Sites The gVCF file uses an adapted version of genotype quality for variant and nonvariant site filtration This value is associated with the key GOX The GQX value is intended to represent the minimum of Phred genotype quality assuming the site is variant Phred genotype quality assuming the site is nonvariant The reason for using this value is to allow a single value to be used as the primary quality filt
68. nel on page 15 Dashboard Tab on page 15 Prep Tab on page 16 Runs Tab on page 17 Projects Tab on page 18 Apps Tab on page 20 Toolbar The BaseSpace Onsite toolbar elements are listed in the following table Icon Element Tab Prep Tab Runs Tab Projects Tab Apps Tab Page Search Account MyAccount Settings Support Description Dashboard See Dashboard Tab on page 15 See Prep Tab on page 1 See Runs Tab on page 17 See Projects Tab on page 18 See Apps Tab on page 20 The BaseSpace Onsite Support page provides access to the BaseSpace Onsite Knowledge Base User Guide and Illumina Technical Support The Search box allows you to find runs projects samples files or apps For more information see Search for Runs Projects Samples Files and Apps on page 50 The Account drop down list provides access to e MyAccount See MyAccount on page 14 e Trash See Delete Items on page 47 e Terms Leads to the User Agreement e Blog Leads to the blog which includes latest news developments and updates e Sign out On the Settings page you can edit your notifications settings edit your profile or update your profile picture 14 Document 1000000002666 v00 Transfer History The Transfer History page allows you to review projects or runs that have been transferred For more information see Transfer Owner on page 46 Library Prep Kits The
69. nification Obligations Section 9 b below the Conditions to Indemnification Obligations Section 9 d below Illumina shall i defend indemnify and hold harmless Purchaser against any third party claim or action alleging that this Product when used for research use purposes in accordance with these terms and conditions and in accordance with this Product s Documentation and Specifications infringes the valid and enforceable intellectual property rights of a third party and ii pay all settlements entered into and all final judgments and costs including reasonable attorneys fees awarded against Purchaser in connection with such infringement claim If this Product or any part thereof becomes or in Illumina s opinion may become the subject of an infringement claim Illumina shall have the right at its option to A procure for Purchaser the right to continue using this Product B modify or replace this Product with a substantially equivalent non infringing substitute or C require the return of this Product and terminate the rights license and any other permissions provided to Purchaser with respect this Product and refund to Purchaser the depreciated value as shown in Purchaser s official records of the returned Product at the time of such return provided that no refund will be given for used up or expired Consumables This Section states the entire liability of Ilumina for any infringement of third party intellectual property righ
70. nstall all notifications show up on the dashboard No notifications are sent through email Latest Runs The Latest Runs pane shows the 3 most recent runs with their dates and status and is updated automatically Click All Runs to open the Runs tab Clicking a run opens the Runs tab with the run loaded For more information see Runs Tab on page 17 Latest Analyses The Latest Analyses pane shows the 3 most recent analysis with their dates and status and is updated automatically Click All Analyses to open the Analyses page which lists all analysis results along with the application used project name date updated size of the result and status Clicking an analysis on the dashboard pane opens the specific analysis report For more information see Analyses Page on page 19 Prep Tab The Prep tab is not supported on the BaseSpace Onsite LT System 16 Document 1000000002666 v00 Runs Tab The Runs button leads to the runs list which allows you to sort your runs based on experiment name state workflow created date machine and owner The following run states are possible The blue boxes indicate final states Instrument is running Instrument run paused Stopped Instrument run stopped Uploading BaseSpace waiting for data i Pending Analysis BaseSpace getting by user or by fault ready to analyze Y D9LJU9JUJ JOST 8JISU eoedSeseg Needs Attention Analyzing Failed BaseSpace needs atte
71. ntion BaseSpace is working BaseSpace analysis failed Complete BaseSpace finished If you want to look at a run in detail click the name to view metrics in more detail For more information see Run Overview Page on page 17 You manage the runs by using the buttons above the list Share Manage sharing a run with a particular collaborator See Share a Run Using the Email Option on page 43 Get Link Forward the sharing link to any number of collaborators See Share a Run with Get Link on page 43 Download Run Download files from this run See Download Run File Package on page 31 Transfer Owner Hand control of data over to a collaborator or customer This button is visible if a run is selected See Transfer Owner on page 46 Move to Trash Delete a project This button is visible if a run is selected See Delete Project on page 47 View Trash View the deleted items in the trash so you can restore the items or empty the trash See Delete Items on page 47 iy NOTE Runs and projects have separate permissions If you share a project you do not share the runs contained within the project Run Overview Page The Run Overview page provides 5 panes Run Details Provides a summary of the run with links to view files and download and share options For more information see Share Data on page 41 View Files and Results on page 21 or Download Files on page 30 BaseSpace Onsite v1 0 LT System Guide 1 Fi Samples Provides a l
72. o button b Run the setup exe file Your web browser can ask you to save the file first After the download has completed double click the setup file c If you are prompted with a security warning click Install 6 Click the Launch VariantStudio The VariantStudio application opens on your desktop with the requested project loaded For instructions on how to run VariantStudio see the VariantStudio User Guide Enrichment v2 1 Apps Adapter Trimming BWA Enrichment v2 1 and Isaac Enrichment v2 1 Apps do not support adapter trimming in this BaseSpace Onsite release Here are some notes on the use of these apps NextSeq You do not need to use adapter trimming for NextSeq data in any of the secondary analysis apps Adapter trimming is performed automatically in FASTQ generation based on the library prep kit type selected during run setup in the Prep Tab workflow HiSeq You can go back to the uploaded run and requeue FASTQ generation by fixing the sample sheet To fix the sample sheet add the adapter sequences to the Settings subsection and then requeue the analysis For more information see Fix Sample Sheet Rerun Workflow on page 49 MiSeg You can only upload MiSeq FASTQ files through BaseSpace Onsite Import Trim the adapters from the FASTQ files before import Download Files 30 The following topics describe how to download files in BaseSpace Onsite Download Individual Files on page 30 Download Multiple FASTQ Files on page 30 D
73. o use it in the external tool Detailed Description The file naming convention for VCF files is as follows SampleName_S vcf where is the sample number determined by ordering in the sample sheet The header of the VCF file describes the tags used in the remainder of the file and has the column header fileformat VCFv4 1 fileDate 20120317 source SequenceAnalysisReport vshost exe reference phasing none INFO lt ID DP Number 1 Type Integer Description Total Depth gt INFO lt ID TI Number Type String Description Transcript ID gt INFO lt ID GI Number Type String Description Gene ID gt INFO lt ID CD Number 0 Type Flag Description Coding Region gt FILTER lt ID q20 Description Quality below 20 gt FORMAT lt ID GT Number 1 Type String Description Genotype gt FORMAT lt ID GO Number 1 Type Integer Description Genotype Quality gt CHROM POS ID REF ALT QUAL FILTER INFO FORMAT SAMPLI El Document 1000000002666 v00 A sample line of the VCF file with the data that is used to populate each column described chr22 16285888 rs76548004 T C 17 d15 q20 DP 11 TI NM_ 001136213 GI POTEH CD GT GQ 1 0 17 Setting ALT CHROM FILTER FORMAT ID INFO POS Description The alleles that differ from the reference read For example an insertion of a single T could show reference A and alternate AT The chromosome of the reference genome Chro
74. ons are sorted numerically in increasing order within each reference sequence CHROM There can be multiple records with the same POS Telomeres are indicated by using positions 0 or N 1 where N is the length of the corresponding chromosome or contig ID Semicolon separated list of unique identifiers where available If this ID is a dbSNP variant it is encouraged to use the rs number No identifier is present in more than 1 data record If there is no identifier available then the missing value is used REF Reference bases A C G T N there can be multiple bases The value in the POS field refers to the position of the first base in the string For simple insertions and deletions in which either the REF or 1 of the ALT alleles would otherwise be null empty the REF and ALT strings include the base before the event This modification is reflected in the POS field The exception is when the event occurs at position 1 on the contig in which case they include the base after the event If any of the ALT alleles is a symbolic allele an angle bracketed ID String lt ID gt the padding base is required In that case POS denotes the coordinate of the base preceding the polymorphism Document 1000000002666 v00 ALT Comma separated list of alternate nonreference alleles called on at least 1 of the samples Options are Base strings made up of the bases A C G T N Angle bracketed ID String lt ID gt Break end replacement string as desc
75. ownload Run File Package on page 31 Download Project or Analysis Package on page 1 Download Individual Files BaseSpace Onsite allows you to download data as a package individually or as a group of FASTQ files Use this option when you want to download individual files and do not need all files for a run sample project or analysis To download multiple FASTQ files perform the following steps 1 Click the Runs icon or Projects icon 2 Navigate to the file you want to download 3 Click the file 4 Click the Download button BaseSpace Onsite now downloads the files to the desired location Download Multiple FASTQ Files BaseSpace Onsite allows you to download data as a package individually or as a group of FASTQ files If you want to download FASTQ files per sample use this option to save time To download multiple FASTQ files perform the following steps Document 1000000002666 v00 Click the Runs icon or Projects icon Click the desired run or project Click the desired sample in the Samples pane In the Files pane select the checkboxes for the desired FASTQ files Click the Download Selected button The BaseSpace Onsite Downloader guides you through the download process and starts the download of the files to the desired location a A WO N e Download Run File Package BaseSpace Onsite allows you to download data as a package individually or as a group of FASTQ files This topic describes how to download a
76. package of files in a run The packages available depend on your workflow packages that are grayed out are not available for download There are 4 types of data packages Variant Data containing VCF files with variant calls Aligned Data containing BAM files with aligned reads Unaligned Data containing FASTQ files with unaligned reads SAV Data containing files describing the set up of the run and InterOp files For more information about file types see BaseSpace Onsite Files on page 31 To download a run file package perform the following steps 1 Click the Runs icon 2 Click the desired run BaseSpace Onsite Files BaseSpace Onsite uses and produces various files See the topics in this section for details BAM Files on page 31 gVCF Files on page 32 VCF Files on page 36 FASTQ Files on page 38 Health Runs on page 41 BAM Files What is it The Sequence Alignment Map SAM format is a generic alignment format for storing read alignments against reference sequences supporting short and long reads up to 128 Mb produced by different sequencing platforms SAM is a text format file that is human readable The Binary Alignment Map BAM keeps the same information as SAM but in a compressed binary format that is only machine readable When to use it Allows you to see alignments Use it for direct interpretation or as a starting point for further analysis with downstream analysis tools that are compatible with BAM B
77. pane you can perform additional actions Copy to Copy samples from this project to another See Copy Samples on page 45 Combine Combine samples See Combine Samples on page 44 The app session states are defined as follows State Description Running The app is processing or uploading data Complete Processing and file upload has finished and the data are now available to use Aborted This AppResult or Sample has been aborted and cannot be resumed Needs Cannot continue without user intervention Attention Analyses Page Sample Overview Page The Sample Overview page provides 2 panes BaseSpace Onsite v1 0 LT System Guide 1 Q gu u JOST 8JISU eoedSeseg Apps Tab The Apps button leads to the Apps page which provides an overview of the custom BaseSpace Onsite apps that you can run 210 Sample Details Provides a summary of the run with a links to launch a custom BaseSpace Onsite app on your sample Clicking the app name leads to a page with more information about that app including access permissions Running apps can incur a charge Files Provides a list of files associated with that sample You can either look at all FASTQ files or look at files specific for an app session For more information see View Files and Results on page 21 You can also download selected files see Download Multiple FASTQ Files on page 30 Clicking the app name leads to a page with more information about that app inclu
78. portillumina com select a product then select Documentation amp Literature BaseSpace Onsite v1 0 LT System Guide SOUEISISSY 091UU99 Illumina San Diego California 92122 U S A 1 800 809 ILMN 4566 1 858 202 4566 outside North America techsupport illumina com www illumina com
79. probability P A 10 0 1 20 0 01 30 0 001 i NOTE On the systems we currently support Q scores are automatically binned The specific binning applied depends on the current Q table See the white paper Reducing Whole Genome Data Storage Footprint for more information available from www illumina com Quality Scores Encoding In FASTO files quality scores are encoded into a compact form which uses only 1 byte per quality value In this encoding the quality score is represented as the character with an ASCII code equal to its value 33 The following table demonstrates the relationship between the encoding character its ASCII code and the quality score represented z NOTE i When Q score binning is in use the subset of Q scores applied by the bins is displayed Document 1000000002666 v00 Table 1 ASCII Characters Encoding Q scores 0 40 Symbol ASCII Code 33 34 35 36 37 amp 38 39 40 41 42 43 7 44 45 46 47 0 48 1 49 2 50 3 51 4 52 5 53 Health Runs Q Score 0 1 10 11 12 13 14 15 16 17 18 19 20 Symbol mM uo alw gt EI gt a ASCII Code 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 Score 21 22 23 24 25 26 27 28 29 DJISUQ soedseseg esn oL MOH 30 31 32 33 34 35 36 37 38 39 40 A user can choose whether to send anonymous system health information to Illu
80. processor The number C AC power supply has resolved an unexpected configuration error The number C AC power supply has detected an unexpected configuration error The panel board in the back of the chassis has changed to being offline The panel board in the back of the chassis is back online The processor number C has exceeded the normal range The processor number C is back within the normal range The processor number C has been detected The processor number C is not being detected The processor number C has detected a digital state error The processor number C has recovered from a digital state error Status OK Error OK Error OK Error OK Error Error OK Error OK OK OK Error OK Document 1000000002666 v00 Error Code Item ID TEMP_ C TEMP C FAN_ C FAN_ C M_ C M_ C HD_ C HD_ C HD_ C HD_ C HD_ C HD_ C LV_ B Item Name System temperature System temperature Power Supply Fan C Power Supply Fan C Memory Sensor number C Memory Sensor number C Disk in slot C Disk in slot C Disk in slot C Disk in slot C Disk in slot C Disk in slot C Logical volume B with capacity C D BaseSpace Onsite v1 0 LT System Guide Message The system temperature has exceeded its threshold The system temperature is back within normal operating range The power supply fan number C has failed The power supp
81. quence WholeGenomeFASTA Bos_taurus Ensembl UMD3 1 Sequence WholeGenomeFASTA Escherichia coli K 12 DH1OB NCBI 2008 03 17 Sequence WholeGenomeFASTA Homo _sapiens UCSC hg19 Sequence WholeGenomeFASTA us musculus UCSC mm9 Sequence WholeGenomeFASTA PhiX Illumina RTA Sequence WholeGenomeFASTA Rattus norvegicus UCSC rn4 Sequence WholeGenomeFASTA Saccharomyces cerevisiae UCSC sacCer2 Sequence WholeGenomeFASTA Staphylococcus aureus _NCTC_8325 NCBI 2006 02 13 Sequence WholeGenomeFASTA Search for Runs Projects Samples Files and Apps The Search function allows you to find runs projects samples files and apps 1 2 3 50 Clich the search icon Type in the run project or sample name in the search field and hit enter Select the desired run project sample file or app in the search results You can also filter the search results by these categories using the drop down list at the right of the results page Document 1000000002666 v00 Admin Tasks The admin of BaseSpace Onsite has the following tasks Manage analysis notifications storage users system health planned runs software updates and alarms using the Admin Panel For more information see Manage BaseSpace Onsite on page 51 Replace hard drive or power supply For more information see Replacement Procedures on page 54 In addition BaseSpace Onsite sends an email alert if there is an issue with your system Error Cod
82. r rate observed in practice REF The reference genotype For example a deletion of a single T can read reference TT and alternate T SAMPLE The sample column gives the values specified in the FORMAT column One MAXGT sample column is provided for the normal genotyping assuming the reference For reference a second column is provided for genotyping assuming the site is polymorphic See the Starling documentation for more details FASTQ Files What is it BaseSpace Onsite converts bcl files into FASTQ files which contain base call and quality information for all reads passing filtering When to use it FASTQ files can be used as sequence input for alignment and other secondary analysis software When not to use it Do not use it with tools that are not compatible with the FASTQ format How to use it BaseSpace Onsite automatically generates FASTQ files in sample sheet driven workflow apps Other apps that perform alignment and variant calling also automatically use FASTO files Naming FASTQ files are named with the sample name and the sample number which is a numeric assignment based on the order that the sample is listed in the sample sheet Example SampleName The sample name provided in the sample sheet If a sample name is not provided the file name includes the sample ID which is a required field in the sample sheet and must be unique S1 The sample number based on the order that samples are listed in the sample
83. ribed in the section on break ends If there are no alternative alleles then the missing value is used QUAL Phred scaled quality score for the assertion made in ALT ie 10log_10 probability call in ALT is wrong If ALT is no variant this score is 10log_10 p variant If ALT is not this score is 10log_10 p no variant High QUAL scores indicate high confidence calls Although traditionally people use integer Phred scores this field is permitted to be a floating point to enable higher resolution for low confidence calls if desired If unknown the missing value is specified Numeric FILTER PASS if this position has passed all filters ie a call is made at this position Otherwise if the site has not passed all filters a semicolon separated list of codes for filters that fail gVCF files use the following values PASS position has passed all filters IndelConflict Locus is in region with conflicting indel calls SiteConflict Site genotype conflicts with proximal indel call which is typically a heterozygous SNV call made inside a heterozygous deletion LowGQX Locus GQX minimum of Genotype quality assuming variant position Genotype quality assuming nonvariant position is less than 30 or not present HighDPFRatio The fraction of base calls filtered out at a site is greater than 0 3 HighSNVSB SNV strand bias value SNVSB exceeds 10 High strand bias indicates a potential high false positive rate for SNVs
84. s Click the Projects icon Click the desired project Click the Samples tab on the left navigation bar Select the samples to be deleted Click Move to Trash Click Confirm The sample is now in the trash You can permanently delete the sample from BaseSpace Onsite by emptying all items in the trash see Empty Trash on page 49 You can also restore the analysis to its original location see Restore Trash on page 49 SS oO A WO N m Document 1000000002666 v00 Note the following items about deleting a sample If you received the sample as a share the deleted sample does not appear in the trash If you want to restore a sample shared with you click the previously sent share link or contact the owner Do not perform this action if you want to archive a sample Empty Trash After you have deleted an item it is present in the Trash if you are the owner of that item With this method you can delete all items in the trash from BaseSpace Onsite permanently To delete an item from BaseSpace Onsite permanently perform the following steps 1 Click View Trash 2 Click Empty Trash 3 Click Confirm The items are now ready to be purged from BaseSpace Onsite by the admin see Purge Deleted Items on page 53 Restore Trash After you have deleted an item it is present in the Trash if you are the owner of that item To restore an item from the trash to its original location perform the following steps 1 Click View Trash 2 Sel
85. sample in the context of 2 different projects To transfer ownership of samples to a collaborator but still keep a copy yourself To assign a sample to the correct project To copy samples perform the following steps N DBD GF A WO N FR Click the Projects icon Click the desired project Click the Samples link from the left navigation menu Select the checkboxes of the samples you want to copy Click Copy Select the new project in the drop down list Click the Copy button Upload Files Some apps need additional files generated outside of BaseSpace Onsite Some appls also provide downstream analysis for results generated outside of BaseSpace Onsite To upload files perform the following steps 1 2 Click the Projects icon Go to the project you want to add the file to 2 NOTE You can only upload files to projects you own Click Import Select the file to upload using 1 of the following methods Drag and drop the file in the Drag and Drop box Browse to the file through the select file link and click Open BaseSpace Onsite now uploads the file to your project Enter the analysis name in the Name of analysis box Optional Associate the file you are importing with the samples used as inputs By making this association the analysis is listed on the sample detail page You can also locate these uploaded files later by navigating to 1 of the samples Click Complete Import BaseSpace Onsite v1 0 LT System Guide A D
86. seSpace Onsite sends an email alert The possible codes and descriptions are listed in this topic to help you troubleshoot Error cone Item Name Message Status Item ID Pwr_ Power Unit The power unit has detected a shutdown Error Unit_ Status Status Pwr_ Power Unit The power unit has detected that the system OK Unit_ Status has been turned on Status Document 1000000002666 v00 Error Code Item ID Pwr_ Unit_ Status Pwr_ Unit_ Status Pwr_ Unit_ Status Pwr_ Unit_ Status Pwr_ Unit_ Status Pwr_ Unit_ Status PU_ C PU_ C PU_ C RURE PU_ C DUR CE PU C PU C IPMI IPMI IPMI Item Name Povver Unit Status Povver Unit Status Povver Unit Status Povver Unit Status Povver Unit Status Povver Unit Status Power supply unit number C Power supply unit number C Power supply unit number C Power supply unit number C Power supply unit number C Power supply unit number C Power supply unit number C Power supply unit number C IPMI Watchdog IPMI Watchdog IPMI Watchdog BaseSpace Onsite v1 0 LT System Guide Message The power unit has detected a loss of AC power The power unit has detected that the AC power has been restored The power unit has detected a soft power failure The power unit has recovered from a soft power failure The power unit has detected an unexpected failure The power unit has recovered from an unexpected
87. t this option MiSeq Reporter launches automatically after the run and performs analysis locally If you do not select this option MiSeq Reporter does not launch automatically after the run and analysis is performed in BaseSpace Onsite only If performing the VeriSeq PGS workflow with BlueFuse Multi select this option 5 Click Save and Return poue s 6ui80 6 When starting a sequencing run select Use BaseSpace Onsite for storage and analysis on the BaseSpace Options screen L NOTE i To use BaseSpace Onsite load a sample sheet at the start of your run For more information see the MiSeq System Guide document 15027617 When you begin your sequencing run on the MiSeq the BaseSpace Onsite icon changes to indicate that the MiSeq is connected to BaseSpace Onsite and data files are being transferred Getting Shared Data If you receive a link to shared data in BaseSpace Onsite click the link If someone shares data with you you receive a notification The shared data show up in your project list Now you can use the BaseSpace Onsite tools to look at and download the data For information about how to run tasks see How To Use BaseSpace Onsite on page 21 1 NOTE The ovvner of the data can disable the sharing feature at any time BaseSpace Onsite v1 0 LT System Guide 1 3 BaseSpace Onsite User Interface This section describes the various aspects of the BaseSpace Onsite UI Toolbar on page 14 MyAccount on page 14 Admin Pa
88. ts Exclusions to Illumina Indemnification Obligations Illumina has no obligation to defend indemnify or hold harmless Purchaser for any Illumina Infringement Claim to the extent such infringement arises from i the use of this Product in any manner or for any purpose outside the scope of research use purposes ii the use of this Product in any manner not in accordance with its Specifications its Documentation the rights expressly granted to Purchaser hereunder or any breach by Purchaser of these terms and conditions iii the use of this Product in combination with any other products materials or services not supplied by Illumina iv the use of this Product to perform any assay or other process not supplied by Illumina or v Illumina s compliance with specifications or instructions for this Product furnished by or on behalf of Purchaser each of i v is referred to as an Excluded Claim Indemnification by Purchaser Purchaser shall defend indemnify and hold harmless Illumina its affiliates their non affiliate collaborators and development partners that contributed to the development of this Product and their respective officers directors representatives and employees against any claims liabilities damages fines penalties causes of action and losses of any and every kind including without limitation personal injury or death claims and infringement of a third party s intellectual property rights resulting from relatin
89. umerical X coordinate of cluster lt y_pos gt Numerical Y coordinate of cluster lt UMI gt Restricted Optional appears when UML is specified in sample sheet characters UMI sequences for Read 1 and Read 2 seperated by a A T G C N plus lt read gt Numerical Read number 1 can be single read or Read 2 of paired end lt is YorN Y if the read is filtered did not pass N otherwise filtered gt lt control Numerical 0 when none of the control bits are on otherwise it is an number gt even number lt index gt Restricted Index of the read characters A T G C N An example of a valid entry is as follows note the space preceding the read number element SIM 1 FCX 1 15 6329 1045 GATTACT GTCTTAAC 1 N 0 ATCCGA TCGCACTCAACGCCCTGCATATGACAAGACAGAATC lt gt gt lt 9 AAAAAAAAAA IE lt lt lt lt lt BaseSpace Onsite v1 0 LT System Guide 3 Q suo soedseseg esn oL MoH 40 Quality Scores A quality score or Q score expresses an error probability In particular it serves as a convenient and compact way to communicate small error probabilities Given an assertion A the quality score Q A expresses the probability that A is not true P A according to the relationship Q A 10 log P A where P A is the estimated probability of an assertion A being wrong The relationship between the quality score and error probability is demonstrated with the following table Quality score Q A Error
90. under Warranty Illumina will at its option repair or replace non conforming Product that it confirms is covered by this warranty Repaired or replaced Consumables come with a 30 day warranty Hardware may be repaired or replaced with functionally equivalent reconditioned or new Hardware or components if only a component of Hardware is non conforming If the Hardware is replaced in its entirety the warranty period for the replacement is 90 days from the date of shipment or the remaining period on the original Hardware warranty whichever is shorter If only a component is being repaired or replaced the warranty period for such component is 90 days from the date of shipment or the remaining period on the original Hardware warranty whichever ends later The preceding states Purchaser s sole remedy and lllumina s sole obligations under the warranty provided hereunder Third Party Goods and Warranty Illumina has no warranty obligations with respect to any goods originating from a third party and supplied to Purchaser hereunder Third party goods are those that are labeled or branded with a third party s name The warranty for third party goods if any is provided by the original manufacturer Upon written request Illumina will attempt to pass through any such warranty to Purchaser 9 Indemnification a Infringement Indemnification by Illumina Subject to these terms and conditions including without limitation the Exclusions to Illumina s Indem
91. v1 0 e TruSeq Targed RNA v1 0 For documentation see the Illumina support page for BaseSpace Illumina VariantStudio enables you to view annotation information for variants and transcripts and filter to the variants of interest in one easy to use application See Run the VariantStudio App on page 29 for instructions on launching this app and the BaseSpace VariantStudio User Guide for instructions on using the software application Illumina has generated an app with the Integrative Genomics Viewer IGV of the Broad Institute for visualizing your sequence data in great detail See Launch the IGV App on page 28 for instructions on using this app The following apps are developed using an accelerated development process Illumina provides limited support for BaseSpace Labs Apps and are provided without a warranty e FastQC v1 0 e FASTQ Toolkit v1 0 e Kraken Metagenomics v1 0 e Variant Calling Assessment Tool VCAT v 2 0 Currently BaseSpace Onsite provides SPAdes Genome Assembler 3 5 For more information see the SPAdes App page on the Apps tab Note The NovoAlign app is no longer available However legacy analysis results are still viewable App Description BaseMount BaseMount is a tool that allows command line read access to your BaseSpace Onsite data The BaseMount app is a stand alone installable application that you can install on your own computer Then you can connect BaseMount to the data on your BaseSpace Onsite ser
92. ver or servers For more information see the following links e BaseMount Web Page e BaseMount Help e BaseSpace Blog Note BaseSpace is the default API endpoint for BaseMount Make sure to launch BaseMount using the correct server configuration option for BaseSpace Onsite basemount config config file prefix api server http BSO windows IP 8080 mount point folder path e The config parameter is optional Use this parameter to mount against multiple user accounts e The BSO mindous IP is the IP address that you enter in your browser to access your BaseSpace Onsite account The API url is at port 8080 e Themount point folder path is the path to a user created directory on the system where BaseMount is running Annotation Options Depending on the application used the following annotation options are available Option Description Illumina This option utilizes the Ilumina Annotation Service hosted at Annotation annotation basespace illumina com to provide annotation of Service variants SNPs insertions and deletions in the sample VCF files RefSeq or Ensembl This service requires an external network connection and also requires you to whitelist the IP address of your BaseSpace Onsite system Basic This option utilizes a basic set of annotations including SNPs and Annotation with indels using the genome files hosted locally on the BaseSpace local genome files Onsite system This option does not requir
93. which is the highest level directory and contains one or more AppResults IGV retains all its native functions including loading data from your local computer i NOTE Make sure that the Java Runtime Environment is installed on the computer in order for IGV to work properly Download Java here java com en Perform the following steps to launch the IGV app 1 Click the Projects icon 2 Click desired project 3 Click the Launch Apps button and select the IGV application from the drop down list Document 1000000002666 v00 4 Select the Accept button 5 Depending on your browser it asks you to open or save the jnip file For Internet Explorer click the Open button For Chrome click the Keep button and then click file to open For Firefox select the Open with Java TM Web Start Launcher default option The IGV App opens on your desktop with the requested project loaded BaseSpace Onsite Data in IGV The BaseSpace Onsite file browser shows data in BaseSpace Onsite that is available for viewing in IGV The directory structure shown is according to how data are organized in BaseSpace Onsite A project is the highest level directory and it contains one or more AppResults If an AppResult was the result of analyzing a single sample then the sample name is appended to the AppResult name Each AppResult contains zero or more files The file browser shows alignment BAM and variant VCF files and if produced BED GTF and BEDGRA

BaseSpace Onsite v2.1 LT System Guide - Support

Contents

Download Pdf Manuals

Related Search

Related Contents