PyroMark-Q24 Quick G..
Contents
1. ill o 50 ML OF 70 ETOH ON Note Sepharose beads sediment Move to beyond sla ee sbi a minute Carefully capture all ai 90 vertical for as passed since the plate was fai p 7 agitated agitate it for one more beads 15 seconds oOo oF a few seconds minute before capturing the beads PCR PRODUCT Parking ON i Flush with 7o ml water and repeat step 8 Vacuum switch on the tool Agitate 10 seconds k 70 ML oF HO 50 ML oF HO l 9 D ON OFF Release beads by shaking the tool from side to side 0 3 UM SEQUENCING PRIMER IN 25 UL ANNEALING BUFFER WARNING Irritant _ proguct mom Pyrosequencing The Denaturation Solution contains sodium hydroxide Milli Q 18 2 MQ x cm Millipore Corporation or equivalent MSDS can be downloaded at www biotagebio com Quick Guide for PyroMark Q24 Instrument Start the Instrument Turn on I the instrument using the power switch at the rear of the instrument A light indicator in the left corner of the screen is lit when the instrument is turned on The screen is blank during start up which may take up to one minute The instrument shall be connected to properly grounded mains outlets using the supplied power supplies see the Installation and Safety document MO Jig Label 1 Filla reagent cartridge according to the Pre Run Information report and the instructions supplied with the reagents PyroMark Q24 G2. United States PyroMark Q24 System is designed for Laboratory Use Only which means it may be used for either research purposes or by high complexity CLIA certified laboratories Europe PyroMark Q24 System is available for research and in certain European countries for in vitro diagnostic applications PyroMark Q24 System meets the requirements of Annex III of the Oo European Directive for In Vitro Diagnostic Medical Devices 98 79 EC 2 For more information see www biotagebio com PYROSEQUENCING AB US TECHNICAL SUPPORT EU AND GLOBAL TECHNICAL SUPPORT a subsidiary of Biotage AB Phone 1 800 446 4752 press 3 Phone 46 0 18 56 59 11 Kungsgatan 76 SE 753 18 Uppsala Sweden 1 pointsupport biotage com 1 pointsupport eu biotage com Switchboard 46 18 56 59 oo Fax 46 18 59 19 22 e info biotage com www biotage com R O a Pyrosequencing site www biotagebio com ll Separate the DNA Strands and Release the Samples in PyroMark Q2 4 Plate 1 Filla plate PyroMark Q24 Plate with 0 3 UM sequencing primer in 25 ul Annealing Buffer in each well 2 Open the vacuum switch on the tool ON and wash the filter probes by flushing them with approximately 70 ml water Use the trough to the left of Parking 3 Fill the troughs with indicated volumes 6 ON Flush 5 seconds fo ON ON OFF 5 ON Flush 10 seconds JMP e ll 40 ML oF DENATURATION a Flush 5 seconds SOLUTION 50 ML OF WASHING BUFFER
3. Finished 1 When the instrument confirms that the run has been finished press Close 2 Remove the USB memory stick If it was removed before the run was finished insert avaiable on the U the memory stick and select Administration and then Copy Unsaved Runs 3 Remove and discard the plate 4 Remove the cartridge by opening the gate and lifting the cartridge up and pulling it out and discard or clean it Refer to PyroMark Q24 User Manual for cleaning instructions 5 Analyze the run on an office computer running PyroMark Q24 Software When You Have Finished the Day s Work 1 Shut down the instrument 2 At the rear of the instrument press the light button and check that the coolant level is visible in the window If not please contact 1 Point Support see footer 3 Ifthe instrument needs to be cleaned see instructions in PyroMark Q24 User Manual Shut Down the Instrument 1 Select Shutdown in the main menu and press Ok Run Administration About Shuto jm 2 When the message It is now safe to turn off the instrument appears turn off O the instrument The power switch is located at the rear of the instrument It is now safe to turn off the instrument g Biotage United States PyroMark Q24 System is designed for Laboratory Use Only which means it may be used for either research purposes or by high complexity CLIA certified laboratories Europe PyroMark Q24
4. is not supported by the software e g SNP when in the CpG mode or the variable position has been deselected by the user Methylation Levels When in the CpG mode a methylation bar at the Overview tab shows the methylation level for each CpG site in the well L_ Below the defined range I Within the defined range MB Above the defined range Sample ID Note Quality Mean Analysis Reports CpG Ana 4Q Analysis Statistics CpG 4na CpG Pyre CpG Full To generate a report select the desired report from the Reports menu 40 Analysis Results AQ Pyrogram Report 4Q Full Report For more information ee about the reports see the SNP Pyragram Report online help SNP Full Report SNP Overview Report More Information Context sensitive help is accessed by pressing the Fa key when in a dialog or window in the software United States PyroMark Q24 System is designed for Laboratory Use Only which means it may be used for either research purposes or by high complexity CLIA certified laboratories Europe PyroMark Q24 System is available for research and in certain European countries for in vitro diagnostic applications PyroMark Q24 System meets the requirements of Annex IIl of the European Directive for In Vitro Diagnostic Medical Devices 98 79 EC For more information see www biotagebio com PYROSEQUENCING AB US TECHNICAL SUPPORT EU AND GLOBAL TECHNICAL
5. Quick Guide for PyroMark Q24 Software Start PyroMark Q24 Software In the Windows Start menu select All Programs Biotage Pyromark Q24 Context sensitive help can be accessed at any time by pressing the Fa key Set Up an Assay 1 oe ee In the shortcut browser right click the folder you want to place the assay file in and select New Assay and then AQ Assay or CpG Assay from the context menu Enter the file name and press the Enter key Type or paste the Sequence to Analyze Click the Generate Dispensation Order button Click lal in the toolbar Before running your samples validate your assay using reference samples see the Assay Design and Validation section in PyroMark Q24 User Manual Optional If desired enter a Note about the assay and set up the variable positions at the Variable Positions tab If creating a CpG assay we recommend that you add bisulfite treatment controls by left clicking a bold orange T or Ain the histogram Preferable in the beginning of the sequence 1 Add Bisulfite Treatment Control Before Dispensation Add Bisulfite Treatment Control After Dispensation Note In the sequence before bisulfite treatment can be entered in the assay check whether the suggested bisulfite controls are Cs converted to Ts read as Gs and As in a reverse assay or not 1 To add a shortcut to a folder in the shortcut browser click Add Folder Shortcut 2 The more frequentl
6. SUPPORT a subsidiary of Biotage AB Phone 1 800 446 4752 press 3 Phone 46 0 18 56 59 11 Kungsgatan 76 SE 753 18 Uppsala Sweden 1 pointsupport biotage com 1 pointsupport eu biotage com Switchboard 46 18 56 59 oo Fax 46 18 59 19 22 info biotage com www biotage com Pyrosequencing site www biotagebio com Quick Guide for PyroMark Q24 Vacuum Prep Workstation Detailed instructions are available in PyroMark Q24 User Manual I Immobilize the PCR Product to Beads ll Separate the DNA Strands and Release the 1 Gently shake the bottle with Sepharose beads Samples in PyroMark Q24 Plate from side to side until a homogenous solution is obtained i 2 Beads Binding Buffer Milli Q 18 2 MQ x cm 2ul sample 4o ul sample or equivalent J 18 28 ul sample MIX l 60 70 ul well JN WARNING Hot surface Heat at 80 C for 2 minutes and cool to room temperature for at least 5 minutes Add 10 20 ul of PCR product well The plate can now be processed in PyroMark Q24 Instrument Total volume 80 uL well IV When You Have Finished the Day s Work At the end of a working day liquid waste and any solutions left in the troughs should be discarded see instructions in PyroMark Q24 User Manual 3 Seal using strip caps 4 Agitate constantly for 5 10 minutes 1400 rpm Streptavidin Sepharose High Performance 34 um 5 ml GE Healthcare t A product from Pyrosequencing lt lt ON
7. System is available for research and in certain European countries for in vitro diagnostic applications PyroMark Q24 System meets the requirements of Annex III of the European Directive for In Vitro Diagnostic Medical Devices 98 79 EC For more information see www biotagebio com PYROSEQUENCING AB US TECHNICAL SUPPORT EU AND GLOBAL TECHNICAL SUPPORT a subsidiary of Biotage AB Phone 1 800 446 4752 press 3 Phone 46 0 18 56 59 11 Kungsgatan 76 SE 753 18 Uppsala Sweden 1 pointsupport biotage com 1 pointsupport eu biotage com Switchboard 46 18 56 59 oo Fax 46 18 59 19 22 info biotage com www biotage com Pyrosequencing site www biotagebio com
8. icking the run file in the shortcut browser 3 At the Overview tab either analyze all wells ora selection of wells with a valid analysis setup for the selected analysis mode Analysis Modes AQ assays are analyzed in the AQ mode and CpG assays are analyzed in the CoG mode SNP genotyping can be accessed through the AQ mode To toggle between the modes select AQ or CpG in the toolbar Note How the analysis is performed can be modified at the Analysis Setup tab View the Analysis Results Select an analyzed well at the Overview tab and the following information is shown e Well information Assay name sample ID note and any analysis warnings are listed in the Well Information area e Pyrogram The analysis results the allele frequencies or the methylation percentages are displayed above the variable positions in Pyrogram for example 25 AS YGGATAGYGATTTTTAAYGYGTAAGYGTATA 2 400 300 200 100 0 E S GTCGACTATGTCGATTGATCAGTCGTATGTCGTA 5 10 15 20 25 30 Variable positions are highlighted with a blue gray background color and bisulfite treatment controls with a light yellow background color Quality Assessments The quality assessments for the variable positions are displayed by e Quality bars in the plate overview at the Overview tab e The background color of the analysis results in Pyrogram _ Not analyzed Passed Check I Failed 1 Either analysis
9. old Reagents 2 When the instrument is not processing open the instrument lid An audible warning signal will alert you if the lid is opened when it is not safe 3 Open the cartridge gate and insert the cartridge Push it the whole way in and then down 4 Ensure that the line is visible in front of the cartridge and close the gate O the plate holding frame and place the plate on the heating block ae eee ot a WARNING Pinch and impact hazards 6 Close the frame and the instrument lid due to moving parts Keep the instrument lid closed while the instrument is processing WARNING Sharp nedles at the bottom of the reagent cartridge 60 0277 AA Biotage Start and Monitor a Run UN Administration f Directory ae alidation run 080214 Run files are transferred to the instrument using the USB memory sticks supplied with the system 1 Plug the USB memory stick containing the run file into the USB port Environment Pressure 2 Select Run in the main menu using the and screen buttons and press Ok pizat Running 3 Select the run file and press Select The instrument will start dispensing reagents when the pressure in the dispensing unit the speed of the mixer and the temperatures of the heating block process chamber lid and the coolant liquid have reached their preset levels may take several minutes To show Pyrogram of another well use the and screen buttons When the Run is
10. y a file is saved the more information is recovered if there is a power failure or similar problem while the file is open To secure the data a backup of PyroMark Q24 files should be performed frequently Set Up a Run I In the shortcut browser right click the folder you want to place the run file in and select New Run from the context menu Enter the file name and press the Enter key Select Instrument Method see the instructions supplied with the used reagents and cartridge Set up the plate a Add an assay to each used well e g drag an assay in the shortcut browser to a well or a selection of wells A well is colored according to the assay loaded to the well b To enter a sample ID or note select the cell and enter the text A selected cell is highlighted with a blue background color Click la in the toolbar Print a list of required volumes of reagents and the plate setup select Pre Run Information from the Tools menu and when the report appears click 3 Close the run file and copy it to one of the USB memory sticks supplied with the system Optional If desired enter the Reagent ID i e the lot number for PyroMark Q24 Gold Reagents a Plate ID a Barcode number for the plate and a Run Note Biotage 60 0278 AA Analyze the Run 1 Move the processed run file from the USB memory stick to a computer running PyroMark Q24 Software 2 Open the run file by double cl
Download Pdf Manuals
Related Search