Home

NativePure™ Lentiviral Expression System

1. Continued on next page Kit Contents and Storage Continued Gateway LR The Gateway LR Clonase II Enzyme Mix contains the following reagents amp Clonase li Reagent Composition Amount Enzyme Mix Gateway LR Clonase II Proprietary 40 uL Enzyme Mix Proteinase K Solution 2 ug pL in 40 uL 10 mM Tris HCI pH 7 5 20 mM CaCl pENTR gus Positive Control 50 ng L in TE buffer pH 8 0 20 pL Note The pENTR gus control included with the LR Clonase II Enzyme Mix may be used as a positive control for the LR recombination reaction only NativePu re The following reagents are included in the NativePure Binding and Purification Binding and Module supplied with Cat nos BN3005 and BN3007 only Store at 4 C Purification Module Reagent Composition Amount Streptavidin Agarose 10 mL of a 50 slurry containing 5 mL packed 5 mL of packed Streptavidin resin Agarose beads in 0 1 M sodium phosphate pH 7 5 0 1 M NaCl and 2 mM sodium azide 10 NP40 10 v v NP40 in deionized 8 mL water NativePure 5X 0 5 M Tris HCl pH 8 0 100 mL Lysis Binding Buffer 0 5 M KCl 1 mM EDTA 7 5 mM MgCl NativePure 10X TEV Buffer 0 1 M Tris HCl pH 8 0 40 mL 1 5 M NaCl 5mM EDTA NativePure Columns Polypropylene columns 10 each NativePure Concentrator Includes a concentrator fitted 10 each with a membrane and a filtration chamber Continued on next page vii Kit Content
2. The NativePure Lentiviral Gateway Vectors allow the creation of a lentivirus stock The number of infectious particles can be determined prior to delivery into mammalian cells by titering which allows the user to control expression of the in vivo biotinylated bait protein of interest The NativePure Affinity Purification System is based on the TAP Tandem Affinity Purification method used to purify native protein complexes Puig et al 2001 The purification of native protein complexes requires the use of a high affinity tag that allows rapid affinity purification of the tagged protein and associated protein complexes when present in low concentrations from cells without any prior information on the protein complex The purified protein complexes are released from the affinity resin using a highly specific protease under native conditions The streptavidin agarose included with the NativePure Affinity Purification Kit permits the rapid and efficient purification of the bait protein and associated complexes even when present at low concentrations Analyze the biotin tagged protein and associated protein complexes by native gel electrophoresis or other techniques such as mass spectrometry The NativePure Affinity Purification Kit when combined with mass spectrometry provides a novel experimental approach to identify interacting proteins for proteome analysis or examine protein complexes that are part of specific cellular pathways differ
3. Willingham M C Pastan I and Howard B H 1982 The Rous Sarcoma Virus Long Terminal Repeat is a Strong Promoter When Introduced into a Variety of Eukaryotic Cells by DNA mediated Transfection Proc Natl Acad Sci USA 79 6777 6781 Izumi M Miyazawa H Kamakura T Yamaguchi I Endo T and Hanaoka F 1991 Blasticidin S Resistance Gene bsr A Novel Selectable Marker for Mammalian Cells Exp Cell Res 197 229 233 Kimura M Takatsuki A and Yamaguchi I 1994 Blasticidin S Deaminase Gene from Aspergillus terreus BSD A New Drug Resistance Gene for Transfection of Mammalian Cells Biochim Biophys ACTA 1219 653 659 Kjems J Brown M Chang D D and Sharp P A 1991 Structural Analysis of the Interaction Between the Human Immunodeficiency Virus Rev Protein and the Rev Response Element Proc Natl Acad Sci USA 88 683 687 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Continued on next page 69 References Continued Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biology 115 887 903 Landy A 1989 Dynamic Structural and Regulatory Aspects of Lambda Site specific Recombination Ann Rev Bioche
4. 10 mM Tris HCl pH 8 0 1 mM EDTA see page 62 for ordering information Components supplied with the kits e pLenti6 capTEV NT DEST1 150 ng uL in TE pH 8 0 e pLenti6 capTEV CT DEST 150 ng uL in TE pH 8 0 Components supplied with the NativePure Lentiviral Expression Kit and the NativePure Lentiviral Expression and Affinity Purification System e Gateway LR Clonase II enzyme mix keep at 20 C until immediately before use e 2ug yL Proteinase K solution thaw and keep on ice until use e pENTR gus use as a control for the LR reaction 50 ng uL Continued on next page Performing LR Recombination Reactions Continued LR Reaction Follow this procedure to perform both LR reactions between each of your entry clones and pLenti6 capTEV DEST vectors To include a negative control set up a second sample reaction but omit the Gateway LR Clonase II enzyme mix 1 Add the following components to 1 5 mL microcentrifuge tubes at room temperature and mix Component NT tag CT tag Positive Entry Clone Entry Clone Control Entry clone without 1 7 uL stop 50 150 ng rxn Entry clone with stop 1 7 pL z 50 150 ng rxn pLenti6 capTEV NT 1uL 1 uL DEST1 150 ng L pLenti6 capTEV CT 1 pL DEST 150 ng uL pENTR gus 50 ng uL 2 pL TE Buffer pH 8 0 to 8 pL to 8 uL 5 pL 2 Remove the Gateway LR Clonase II enzyme mix from 20 C and thaw on ice 2 minutes
5. result of LTR recombination If Afl II and or Xho I sites are present in the insert you can use a restriction enzyme or a combination of enzymes that cut once in the vector and once in the insert The complete restriction enzyme maps of the pLenti6 capTEV DEST vectors are available at www invitrogen com LB medium containing 100 ug mL ampicillin e PureLink HQ Mini Plasmid Purification Kit page 62 or equivalent e Appropriate restriction enzymes see above e E Gels 1 2 agarose gels page 62 or equivalent e PureLink HiPure Plasmid DNA Purification MidiPrep Kit page 62 or equivalent 1 For each transformation pick 5 colonies from plates obtained after plating the transformation mix Step 8 page 18 Culture them overnight in LB medium containing 100 ug mL ampicillin 2 Isolate plasmid DNA using PureLink HQ Mini Plasmid Purification Kit or equivalent see Important above Perform restriction digests on plasmid DNA Analyze the digested DNA on 1 276 agarose gels to confirm N and C terminally tagged pLenti6 capTEV expression clones Continued on next page 21 Analyzing Transformants Continued Restriction Enzyme Digest Results Isolating Lentiviral Plasmid DNA DNA Isolation Guidelines Maintaining the Expression Clone 22 Depending on the restriction sites you are using you should be able to determine the number and size of bands you should obtain from your digestion Agarose g
6. 3 Briefly vortex the Gateway LR Clonase II enzyme mix twice 2 seconds each time 4 To each sample above add 2 uL of Gateway LR Clonase II enzyme mix Mix well by pipetting up and down Reminder Return Gateway LR Clonase II enzyme mix to 20 C immediately after use 5 Incubate reactions at 25 C for 1 hour Note Extending the incubation time to 18 hours typically yields more colonies 6 Add 1 pL of the Proteinase K solution to each reaction Incubate for 10 minutes at 37 C 7 Proceed to the next section to transform the LR recombination reaction into One Shot Stb13 Chemically Competent E coli Note You may store the LR reaction at 20 C for up to 1 week before transformation 17 Transforming One Shot StbI3 Competent E coli Introduction Follow the instructions in this section to transform the LR recombination reaction into One Shot Stbl3 Chemically Competent E coli supplied with Cat nos BN3004 and BN3007 only see page 62 to order separately The transformation efficiency of One Shot Stb13 Chemically Competent E coli is 2 1 x 10 cfu ug plasmid DNA Materials Needed LR recombination reaction from Step 6 previous page e LB Medium if performing the pUC19 control transformation e 42 C water bath e LB plates containing 100 pg mL ampicillin two for each transformation warm at 37 C for 30 minutes before use e 37 C shaking and non shaking incubators Components suppli
7. 3332 ccaB gene bases 3674 3979 attR2 site bases 4020 4144 capTEV tag bases 4200 4484 6X His tag bases 4200 4220 TEV cleavage site bases 4221 4241 TEV cleavage site bases 4248 4268 BioEase tag bases 4269 4484 V5 epitope bases 4500 4541 SV40 promoter bases 4596 4904 EM7 promoter bases 4959 5025 Blasticidin resistance gene bases 5026 5424 AU3 3 LTR bases 5510 5744 AU3 bases 5510 5563 3 LTR bases 5564 5744 SV40 polyadenylation signal 5816 6019 bla promoter bases 6807 6911 Ampicillin b a resistance gene bases 6906 7766 pUC origin bases 7911 8584 Continued on next page 53 Map and Features of pLenti6 capTEV CT DEST Continued Features pLenti6 capTEV CT DEST pLenti6 capTEV CT DEST 8 991 bp contains the following elements Features have been functionally tested and the vector has been fully sequenced Feature Benefit Rous Sarcoma Virus RSV enhancer promoter Allows Tat independent production of viral mRNA Dull et al 1998 HIV 1 truncated 5 LTR Permits viral packaging and reverse transcription of the viral mRNA Luciw 1996 5 splice donor and 3 acceptors Enhances the biosafety of the vector by facilitating removal of the Y packaging sequence and RRE such that expression of the gene of interest in the transduced host cell is no longer Rev dependent Dull et al 1998 HIV 1 psi y packaging signal Allows viral packaging Luciw 1996 HIV
8. K2100 04 E Gel 1 2 Starter Pak 6 gels Powerbase 1 kit G6000 01 E Gel 1 2 18 Pak 18 gels G5018 01 ViraPower Bsd Lentiviral Support Kit 20 reactions K4970 00 293FT Cell Line 3 x 106 cells frozen R700 07 pDONR 201 6ug 11798 014 pDONR 221 6ug 12536 017 pDONR Zeo 6 pg 12535 035 TE pH 8 0 500 mL AM9849 1L AM9858 Fetal Bovine Serum FBS Certified 500 mL 16000 044 Lipofectamine 2000 0 75 mL 11668 027 ViraPower Lentiviral Packaging Mix 60 reactions K4975 00 pLenti6 2 GW EmGFP Control Vector 1 vector V369 20 Opti MEM I Reduced Serum Medium 100 L 31985 062 Phosphate Buffered Saline PBS pH 7 4 500 mL 10010 023 Quant iT Protein Assay Kit 1 kit Q33210 62 Continued on next page Additional Products continued Selection Agents The table below lists ordering information for the selection agents required for use in the BLOCK iT Inducible H1 Lentiviral RNAi System For more information refer to www invitrogen com or contact Technical Support see page 65 Note Geneticin is required for maintenance of the 293FT cells Product Amount Cat no Blasticidin 50mg R210 01 Geneticin 1g 11811 023 5g 11811 031 25g 11811 098 20 mL 50 mg mL 10131 035 100 mL 50 mg mL 10131 027 Products for A complete range of products for analysis using SDS polyacrylamide gel SDS PAGE electrophoresis is available For more information refe
9. Polybrene during transduction Even in the absence of Polybrene cells should still be successfully transduced with your lentivirus Continued on next page 31 Titering Lentiviral Stocks Continued Preparing and Storing Polybrene Materials Needed 32 Follow the instructions below to prepare Polybrene Sigma Aldrich Cat no H9268 1 Prepare a 6 mg mL stock solution in deionized sterile water 2 Filter sterilize and dispense 1 mL aliquots into sterile microcentrifuge tubes 3 The working stock may be stored at 4 C for up to 2 weeks Store at 20 C for long term storage Stock solutions may be stored at 20 C for up to 1 year Do not freeze thaw the stock solution more than 3 times as this may result in loss of activity TM Your pLenti6 capTEV lentiviral stocks store at 80 C until use e Adherent mammalian cell line HT1080 human fibrosarcoma or other e Complete culture medium for your cell line e 6mg mL Polybrene if desired e 6 well tissue culture plates e Crystal violet Sigma Aldrich Cat no C3886 prepare a 1 crystal violet solution in 10 ethanol e Phosphate Buffered Saline PBS page 62 Components supplied with the NativePure Lentiviral Expression Kit and the NativePure Lentiviral Expression and Affinity Purification System e Blasticidin 10 mg mL stock for selection Remember that you will be working with media containing infectious virus Follow the rec
10. Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Boshart M Weber F Jahn G Dorsch Hasler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Buchschacher G L Jr and Wong Staal F 2000 Development of Lentiviral Vectors for Gene Therapy for Human Diseases Blood 95 2499 2504 Burns J C Friedmann T Driever W Burrascano M and Yee J K 1993 Vesicular Stomatitis Virus G Glycoprotein Pseudotyped Retroviral Vectors Concentration to a Very High Titer and Efficient Gene Transfer into Mammalian and Nonmammalian Cells Proc Natl Acad Sci USA 90 8033 8037 Chapman Smith A and J E Cronan J 1999 Molecular Biology of Biotin Attachment to Proteins J Nutr 129 477S 484S Ciccarone V Chu Y Schifferli K Pichet J P Hawley Nelson P Evans K Roy L and Bennett S 1999 Lipofectamine 2000 Reagent for Rapid Efficient Transfection of Eukaryotic Cells Focus 21 54 55 Dull T Zufferey R Kelly M Mandel R J Nguyen M Trono D and Naldini L 1998 A Third Generation Lentivirus Vector with a Conditional Packaging System J Virol 72 8463 8471 Emi N Friedmann T and Yee J K 1991 Pseudotype Formation of Murine Leukemia Virus with the G Protein of Vesicular Stomatitis Virus J Virol 65 1202 1207 Gorman C M Merlino G T
11. V5 Antibodies Southern et al 1991 Note V5 epitope will not be expressed in pLenti6 capTEV NT DESTI expression clones due to the stop codon at the end of the gene of interest SV40 early promoter and origin Allows high level expression of the selection marker and episomal replication in cells expressing the SV40 large T antigen EM7 promoter Synthetic prokaryotic promoter for expression of the selection marker in E coli Blasticidin bsd resistance gene Permits selection of stably transduced mammalian cell lines Kimura et al 1994 52 Map and Features of pLenti6 capTEV CT DEST Map of The figure below shows the features of the pLenti6 capTEV CT DEST vector pLenti6G CapTEV DNA from the entry clone replaces the region between bases 2 448 and 4 130 The CT DEST sequence is available at www invitrogen com or by contacting Technical Support see page 65 attR1 Cm ccdB attR2 capTEV Tag V5 Epitope pLenti6 capTEV CT DEST Comments for pLenti6 capTEV CT DEST 8991 nucleotides RSV 5 LTR hybrid promoter bases 1 410 RSV promoter bases 1 229 HIV 1 5 LTR bases 230 410 5 splice donor base 520 HIV 1 psi y packaging signal bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 3 splice acceptor base 1656 3 splice acceptor base 1684 CMV promoter bases 1808 2392 attR1 site bases 2440 2564 Chloramphenicol resistance gene Cm bases 2673
12. a broadened host range Yee et al 1994 e Efficiently delivers the gene of interest to mammalian cells in culture or in vivo Dull et al 1998 e Provides stable long term expression of a target gene beyond that offered by traditional adenoviral based systems Dull et al 1998 Naldini et al 1996 e Includes multiple features designed to enhance the biosafety of the system pLenti6 capTEV DEST Vectors Features of the Vectors TM The pLenti6 capTEV DEST vectors contain the following elements Rous Sarcoma Virus RSV enhancer promoter for Tat independent production of viral mRNA in the producer cell line Dull et al 1998 Modified HIV 1 5 and 3 Long Terminal Repeats LTR for viral packaging and reverse transcription of the viral mRNA Dull et al 1998 Luciw 1996 Note The U3 region of the 3 LTR is deleted AU3 and facilitates self inactivation of the 5 LTR after transduction to enhance the biosafety of the vector Dull et al 1998 HIV 1 psi Y packaging sequence for viral packaging Luciw 1996 HIV Rev response element RRE for Rev dependent nuclear export of unspliced viral mRNA Kjems et al 1991 Malim et al 1989 Human CMV promoter for constitutive expression of the gene of interest Two recombination sites attR1 and attR2 downstream of the CMV promoter for recombinational cloning of the gene of interest from an entry clone Chloramphenicol resistance gene Cm located between the two
13. insert as well as ensure the absence of any aberrant lentiviral vector recombination between the LTRs Screen colonies by performing miniprep and restriction analysis to validate the correct N and C terminal expression clones After verifying the correct clones use the miniprep DNA to re transform Stbl3 E coli Next isolate plasmid DNA for transfection and lentivirus production Plasmid DNA for transfection into 293FT cells must be very clean and free from contaminants and salts and should be isolated by midiprep or large scale DNA preparation Step Action 1 For each transformation pick 5 resistant colonies from plating the transformation mix Step 8 page 18 Culture cells overnight in LB medium containing 100 ug mL ampicillin 2 Isolate plasmid DNA for each colony using a miniprep kit see Important next page 3 Analyze the plasmids by restriction analysis to confirm the presence and orientation of your insert as well as the integrity of the vector 4 Re transform One Shot Stb13 Chemically Competent E coli separately with the validated clones 5 Inoculate LB ampicillin with a fresh colony and grow for 6 8 hours to generate a starter culture 6 Inoculate the starter culture 1 1 000 into at least 100 mL LB ampicillin and grow for 18 hours 7 Isolate plasmid DNA for the N and C terminally tagged TM pLenti6 capTEV clones using a midiprep kit or large scale DNA preparation see Important
14. lt un lt 0 Lane 3 Bet 3 NT 32 8 kDa Lane 4 Bet 3 CT 35 5 kDa Lane 5 LacZ NT 129 kDa a Lane 6 LacZ CT 131 6 kDa Lane 7 PSMB2 NT 35 3 kDa e WI Lane 8 PSMB2 CT 37 9 kDa bizia TM HiMark multicolored protein standard not shown see page 63 was used to determine the molecular weights of the N and C terminally tagged proteins The faint band detected in all lanes is endogenous biotinylation from the lysate The presence of multiple bands in lane 5 represents slight protein degradation These results show that the proteins of interest are biotinylated For some proteins there is a difference in expression level of the N and C terminally tagged proteins A difference exists in the amount of N and C terminally tagged versions of the same protein e g Lane 1 vs Lane 2 Lane 3 vs Lane 4 and Lane 7 vs Lane 8 However for LacZ Lane 5 vs Lane 6 both N and C terminally tagged constructs have similar levels of biotinylation Continued on next page 43 Expected Results Continued Native Complex Formation Results 44 N and C terminal tagged NT and CT human proteosome subunit beta 2 PSMB2 lentivirus stocks were constructed and produced as described in this manual GripTite 293 MSR cells were transiently transduced with the lentiviruses or with a control lentivirus APRC2 CT At 48 hours post transduction cells were harvested and lysed using the native protocol on page 41 Ten m
15. of the G glycoprotein gene from Vesicular Stomatitis Virus VSV G as a pseudotyping envelope thus allowing production of a high titer lentiviral vector with a significantly broadened host cell range Burns et al 1993 Emi et al 1991 Yee et al 1994 Once the lentivirus enters the target cell the viral RNA is reverse transcribed actively imported into the nucleus Lewis amp Emerman 1994 Naldini 1999 and stably integrated into the host genome Buchschacher amp Wong Staal 2000 Luciw 1996 After the lentiviral construct has integrated into the genome you may assay for transient expression of your recombinant protein or use antibiotic selection to generate a stable cell line for long term expression studies TM The human 293FT Cell Line is supplied with NativePure Lentiviral Expression kits Cat nos BN3004 and BN3007 only to facilitate optimal lentivirus production Naldini et al 1996 The 293FT Cell Line a derivative of the 293F Cell Line stably and constitutively expresses the SV40 large T antigen from pCMVSPORT6TAg neo and must be maintained in medium containing Geneticin For more information about this cell line refer to the 293FT Cell Line manual which is available from www invitrogen com or by contacting Technical Support see page 65 For ordering information about 293FT and Geneticin see pages 62 63 The NativePure Lentiviral Expression System is designed to help you create a lentivirus
16. the streptavidin biotin interaction is extremely strong removal of the bound protein complexes from the streptavidin agarose is achieved by cleavage with a protease The TEV Tobacco Etch Virus Protease is a site specific protease that allows efficient release of bound materials under native conditions Rigaut et al 1999 The NativePure Lentiviral Vectors are designed with two tandem TEV cleavage sites that promote gt 90 cleavage of the biotinylated recombinant protein and associated protein complexes from the streptavidin agarose during purification under native conditions AcTEV Protease an enhanced form of TEV protease that is highly active and specific Nayak et al 2003 is supplied with Cat nos BN3005 and BN3007 and is available separately page 64 Continued on next page pLenti6 capTEV DEST Vectors Continued The Gateway Technology pLenti6 capTEV CT GW ARPC2 Control Plasmid The Gateway Technology is a universal cloning method that takes advantage of the site specific recombination properties of bacteriophage lambda Landy 1989 Gateway Technology enables rapid and highly efficient transfer of DNA sequences into multiple vector systems for protein expression and functional analysis while maintaining orientation and reading frame You will 1 Clone your gene of interest with and without a stop codon into Gateway entry vectors to create two entry clones 2 Generate two expression clones by perf
17. to deliver and express a gene of interest in mammalian cells Although the system has been designed to help you express your recombinant protein of interest in the simplest most direct fashion use of the system is geared towards those users who are familiar with the principles of retrovirus biology and retroviral vectors We highly recommend that users possess a working knowledge of viral and tissue culture techniques For more information about these topics refer to the following published reviews e Retrovirus biology and the retroviral replication cycle Buchschacher amp Wong Staal 2000 Luciw 1996 e Retroviral and lentiviral vectors Naldini 1998 Naldini 1999 Pandya et al 2001 Yee 1999 Biosafety Features Introduction Biosafety Features of the NativePure Lentiviral System The NativePure Lentiviral Expression System is a system based on the ViraPower Lentiviral Expression System which includes a number of safety features designed to enhance its biosafety and to minimize its relation to the wild type human HIV 1 virus These safety features are discussed below TM The NativePure Lentiviral Expression System includes the following key safety features The pLenti6 capTEV DEST vectors contain a deletion in the 3 LTR AU3 that does not affect generation of the viral genome in the producer cell line but results in self inactivation of the lentivirus after transduction of the tar
18. 00 mM Tris HCl pH 8 0 100 mM KCl 200 uM EDTA 1 5 mM MgCl 1X 700 ng mL Pepstatin Roche Cat no 10253286001 or equivalent Complete protease inhibitor Roche Cat no 04693116001 or equivalent Store the buffer on ice until use Aliquot the buffer and store the aliquots at 20 C if needed For Cat nos BN3005 and BN3007 refer to the manual supplied with the NativePure Affinity Purification Kit for details Continued on next page Detecting Protein Biotinylation and Complex Formation Continued Preparing Cell 1 Lysate Under Native Conditions OTOT M 9 Harvest suspension cells by centrifugation We generally use cells from a 30 mL flask Wash the cells twice in phosphate buffered saline PBS Resuspend the cell pellet in 4 mL 1X Lysis Buffer see previous page for a recipe Proceed to Step 4 Wash adherent cells with PBS Remove the PBS and add 0 5 1 mL 1X Lysis Buffer 10 cm culture dish containing adherent cells For a T 175 flask use 2 mL 1X Lysis Buffer Harvest cells by pipetting up and down Transfer the cells to a sterile tube Perform 3 freeze thaw cycles to lyse the cells Centrifuge the lysate at 10 000 x g for 10 minutes at 4 C Transfer the post nuclear supernatant to a sterile tube Aliquot the supernatant and perform protein estimation on an aliquot of the lysate using the Quant iT Protein Kit page 62 or Bradford protein assay Store aliquots at 80 C until use Native Gel F
19. 1 Rev response element RRE Permits Rev dependent nuclear export of unspliced viral mRNA Kjems et al 1991 Malim et al 1989 CMV promoter Permits high level constitutive expression of the gene of interest Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 attR1 and attR2 sites Bacteriophage A derived DNA recombination sequences that permit recombinational cloning of the gene of interest from a Gateway entry clone Landy 1989 Chloramphenicol resistance gene Cm Allows counterscreening of plasmid ccdB gene Permits negative selection of the plasmid capTEV tag Allows in vivo biotinylation and affinity purification of recombinant proteins and associated complexes V5 epitope Allows detection of fusion protein by Anti V5 Antibodies Southern et al 1991 Note V5 epitope will not be present in pLenti6 capTEV CT DEST expression clones after TEV cleavage SV40 early promoter and origin Allows high level expression of the selection marker and episomal replication in cells expressing the SV40 large T antigen EM7 promoter Synthetic prokaryotic promoter for expression of the selection marker in E coli Blasticidin bsd resistance gene Permits selection of stably transduced mammalian cell lines Kimura et al 1994 54 Map of pLenti6 capTEV CT GW ARPC2 Map of The figure below shows the features of the pLenti6 capTEV CT GW ARP
20. 293FT cells plated too sparsely e Do not use mini prep plasmid DNA for transfection Use the PureLink HiPure Plasmid DNA Purification MidiPrep Kit or similar kit to prepare plasmid DNA e Use healthy 293FT cells under passage 20 do not overgrow e Although Geneticin is required for stable maintenance of 293FT cells do not add Geneticin to media during transfection as this reduces transfection efficiency and causes cell death e Use a DNA in pg Lipofectamine 2000 in pL ratio ranging from 1 2 to 1 3 e Plate cells such that they are 90 95 confluent at the time of transfection 46 Continued on next page Troubleshooting Continued Generating the Lentiviral Stock Continued Problem Reason Solution Low viral titer Transfected cells not cultured in One day after transfection remove media continued media containing sodium containing DNA lipid complexes and replace pyruvate with media containing sodium pyruvate Sodium pyruvate provides an extra energy source for the cells Viral supernatant harvested too early Viral supernatants can generally be collected 48 72 hours posttransfection If many cells are still attached to the plate and look healthy at this point wait an additional 24 hours before harvesting the viral supernatant Viral supernatant too dilute Concentrate virus using method of choice Yee 1999 Viral supernatant frozen and thawed multiple times Do n
21. 48 1994 71 74 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity For licensing information for use in other than research please contact Out Licensing Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail The Lentiviral Technology based upon the lentikat system is licensed from Cell Genesys Inc under U S Patent Nos 5 834 256 5 858 740 5 994 136 6 013 516 6 051 427 6 165 782 and 6 218 187 and corresponding patents and applications in other countries for internal research purposes only Use of this technology for gene therapy applications or bioprocessing other than for non human research use requires a license from Cell Genesys Cell Genesys Inc 342 Lakeside Drive Foster City California 94404 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity including non gene therapy research and target validation applications in laboratory animals Retroviral helper cell lines are licensed from Wisconsin Alumni Research Foundation under U S Patents and corresponding patents and applications in other c
22. 847 and 4 530 The NT DEST1 sequence is available at www invitrogen com or by contacting Technical Support see page 65 capTEV Tag Cm ccdB attR2 V5 Epitope capTEV NT DEST1 9087 bp Comments for pLenti6 capTEV NT DEST1 9087 nucleotides RSV 5 LTR hybrid promoter bases 1 410 RSV promoter bases 1 229 HIV 1 5 LTR bases 230 410 5 splice donor base 520 HIV 1 psi w packaging signal bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 3 splice acceptor base 1656 3 splice acceptor base 1684 CMV promoter bases 1873 2460 capTEV tag bases 2510 2815 BioEase tag bases 2510 2728 TEV cleavage site bases 2741 2761 TEV cleavage site bases 2768 2788 6X His tag bases 2795 2815 attR1 site bases 2840 2964 Chloramphenicol resistance gene Cm bases 3073 3732 ccaB gene bases 4074 4379 attR2 site bases 4420 4544 V5 epitope bases 4597 4638 SV40 promoter bases 4693 5001 EM7 promoter bases 5056 5122 Blasticidin resistance gene bases 5123 5521 AU3 3 LTR bases 5607 5841 AU3 bases 5607 5660 3 LTR bases 5661 5841 SV40 polyadenylation signal 5913 6043 bla promoter bases 6903 7007 Ampicillin bla resistance gene bases 7002 7862 pUC origin bases 8007 8680 Continued on next page 51 Map and Features of pLenti6 capTEV NT DEST1 continued Features of pLenti6 capTEV NT DESTI 9 087 bp contains the following elements Features pLenti6 capTEV have b
23. 95 confluent on the day of transfection i e 5 x 10 cells in 10 mL of growth medium containing serum 2 Onthe day of transfection Day 2 remove the culture medium from the 293FT cells and replace with 5 mL of growth medium or Opti MEM I Medium containing serum Do not include antibiotics in the medium For each transfection sample prepare DNA Lipofectamine 2000 complexes as follows a Inasterile 15 mL tube combine 9 ug of the ViraPower Packaging Mix and 3 ug of pLenti expression plasmid DNA 12 ug total in 1 5 mL of Opti MEM I Medium without serum Mix gently b Ina separate sterile 15 mL tube mix Lipofectamine 2000 gently before use then dilute 36 uL in 1 5 mL of Opti MEM I Medium without serum Mix gently and incubate for 5 minutes at room temperature c After the 5 minute incubation combine the diluted DNA with the diluted Lipofectamine 2000 Mix gently d Incubate for 20 minutes at room temperature to allow the DNA Lipofectamine 2000 complexes to form The solution may appear cloudy but this will not impede the transfection Add the DNA Lipofectamine 2000 complexes dropwise to each plate of cells Mix gently by rocking the plate back and forth Incubate the cells overnight at 37 C in a CO incubator The next day Day 3 remove the medium containing the DNA Lipofectamine 2000 complexes and replace with complete culture medium Incubate at 37 C in a CO incubator Note Expression of the VSV G gl
24. C2 pLentiG CapTEV control vector The sequence is available at www invitrogen com or by contacting CT GW ARPC2 Technical Support see page 65 attB1 ARPC2 attB2 capTEV Tag V5 Epitope pLenti6 capTEV CT GW ARPC2 Comments for pLenti6 capTEV CT GW ARPC2 8238 nucleotides RSV 5 LTR hybrid promoter bases 1 410 RSV promoter bases 1 229 HIV 1 5 LTR bases 230 410 5 splice donor base 520 HIV 1 psi y packaging signal bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 3 splice acceptor base 1656 3 splice acceptor base 1684 CMV promoter bases 1808 2392 attB1 site bases 2440 2464 ARPC2 gene bases 2467 3366 attB2 site bases 3368 3392 capTEV tag bases 3448 3732 6X His tag bases 3448 3468 TEV cleavage site bases 3469 3489 TEV cleavage site bases 3496 3516 BioEase tag bases 3517 3732 V5 epitope bases 3748 3789 SV40 promoter bases 3844 4152 EM7 promoter bases 4207 4273 Blasticidin resistance gene bases 4274 4672 AU3 3 LTR bases 4758 4992 AUS bases 4758 4811 3 LTR bases 4812 4992 SV40 polyadenylation signal 5064 5194 bla promoter bases 6054 6158 Ampicillin b a resistance gene bases 6153 7013 pUC origin bases 7158 7831 55 Map and Features of pLP1 pLP1 Map The figure below shows the features of the pLP1 vector Note that the gag and pol 56 genes are initially expressed as a gag pol fusion protein which is self cleaved by the viral protease into indivi
25. CTA AGA TGC GCA TGG CCA ATC ATT ACT CAAA 15 Performing LR Recombination Reactions Introduction E coli Host Gateway LR Clonase II Enzyme Mix Materials Needed 16 After obtaining the entry clones containing your gene of interest perform LR recombination reactions between the entry clones and pLenti6 capTEV DEST vectors and transform the reaction mixture into One Shot Stb13 Competent E coli to select for expression clones Include a negative control no Gateway LR Clonase II in the experiment to help evaluate results Transform the LR reactions into One Shot Stbl3 Competent E coli included with Cat nos BN3004 and BN3007 also available separately page 62 to reduce the likelihood of unwanted recombination Do not transform the LR reaction mixture into E coli strains that contain the F episome e g TOP10F These strains contain the ccdA gene and will prevent negative selection with the ccdB gene Gateway LR Clonase II enzyme mix catalyzes the LR recombination reactions included with Cat nos BN3004 and BN3007 also available separately see page 62 Use the protocol provided on the next page to perform the LR recombination reactions using the Gateway LR Clonase II enzyme mix e Purified plasmid DNA of your entry clone with stop codon 50 150 ng L in TE pH 8 0 e Purified plasmid DNA of your entry clone without stop codon 50 150 ng uL in TE pH 8 0 e TE Buffer pH 8 0
26. G AAG ATG GAA ACC GAA ATC MECHCACHCECNCCETACCCHCICHCNCECACHCACSTANICACEOCINTECCCETAG TTC UNE TETTE s SN COSTETUM AC In vivo biotinylation site Arg Ala Ala Gln Ala Gly Thr Val Arg Gly Ile Ala Val Lys Ala Gly Asp Ala Val Ala 2642 CGC GCC GCG CAG GCC GGG ACC GTG CGC GGT ATC GCG GTG AAA GCC GGC GAC GCG GTG GCG CCG CCG CEC ENC CCG CCC ee CAC CCE COA WAC CEC CAG UUL CEG CCE CIG CCC CAC CCC TEV Recognition Site Val Gly Asp Thr Leu Met Thr Leu Ala Gly Ser Gly Ser Glu Asn Leu Tyr Phe Gln Gly 2702 GTC GGC GAC ACC CTG ATG ACC CTG GCG GGC TCT GGA TCC GAG AAT CTT TAT TTT CAG GGT Cae CCE Cie MCG CAC mC UCG CAC CEC CCE ACA CEN ACE CIC IVA sA JAVA AVANA GIC COA TEV Cleavage Site A TEV Recognition Site 6X His Tag Gln Leu cGlu Asn Leu Tyr Phe Glin Gly Gin Leu His His His His His His Gly Glu Gly 2762 CAA TTG GAG AAT CTT TAT TTT CAG GGT CAA TTG CAT CAT CAT CAT CAT CAT GGT GAA GGC GDTCARCOCTOOPPASGAACATACRAACOTCOOORCODPOAACCOGTACODTACCGACGTASGTACGTA CCA CTT CCG TEV Cleavage Site A 4530 Arg Ile Leu Gln Ile Ser Thr Ser Leu T 2822 CGA ATT CTG CAG ATA TCA ACA AGT TI GCT TAA GAC GTC TAT AGT Ter TCA ANC ATG TTT attB1 Lys Lys Ala Gly yr C 2847 attB2 4531 TTGTACAAAG TGGTTGATAT CCAGCACAGT GGCGGCCGCT CGAGTCTAGA GGGCCCGCGG TTCGAAGGTA AACATETTTC ACCAACTATA GGTCGTGTCA CCGCCGGCGA GCTCAGATCT CCCGGGCGCC AAGCTTCCAT Continued on next page Creating N and C Terminal Tagged Expression Clones Continued R
27. Invitrogen by technologies NativePure Lentiviral Expression System Lentiviral system for expression and purification of N and C terminal biotinylated fusion proteins and associated complexes in mammalian cells Catalog nos BN3001 BN3004 BN3005 and BN3007 Rev date 27 October 2010 Manual part no 25 0891 MANDO000555 ii Contents Kit Contentsiand Storage eec erede tee HM iere er eben ee Prep hab e rep ne ertet iv Introduction tiere calscasdacdsdaelodaetdticcacvedlavcuncvaacevaa scacaseas fecaeluuaeiwadeiwecccunyeuabacsslavuccanneaceacs 1 System SUMM Arye C 1 pentis capl EV DEST VecGctofs a crt tbt tiit e tbc tee itd halide ede irte demise 4 Prod cing Lentivirus tee ie tete t ep RPM re he dr ti R ERR Eb E CEP Penn eee 7 Biosafety Features Experimental Outline eee et en te d e e n e d ufi reden E E R ED Certe 10 Methods E E urea reca iura act iraai real rae edenda Ves ani vr eo nde aanvesbaveb beens puabunvedi or gEa Fr ED CREE exO rad 11 Generating Entry Clones tee eter gon n ERR P Ere eee e etg br EPA t EP bnc rinde 11 Creating N and C Terminal Tagged Expression Clones seen rene nen nene nennen 13 Performing LR Recombination Reactions sesseseeeeeeeneeenen eene nnne nennen nnne tenente Transforming One Shot Stbl3 Competent E coli Analyzing Transformants a eclesie ettet e er ie A PEE AERE EE M DIRE ee Eee aH eH RA gehe ren
28. Medica plc The purchase of this product conveys to the purchaser the limited non transferable right to use the purchased amount of the product only to perform internal research for the sole benefit of the purchaser No right to resell this product or any of its components is conveyed expressly by implication or by estoppel This product is for internal research purposes only and is not for use in commercial services of any kind including without limitation reporting the results of purchaser s activities for a fee or other form of consideration For information on obtaining additional rights please contact outlicensing lifetech com or Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 67 Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions 68 The information supplied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading frames created using Invitrogen s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing attL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by non profit organizations and by for profit
29. Producing Lentivirus in 293FT Cells tice err AERE DEG DH pe e DU ede darte tete centri eeepc 24 Titering Lentiviral Stocks eet en E e e i iei er teret peines ER A aie EE 30 Transduction of Cells with Lentivirus steer lect tero tte epo dde ble pe eee eee 35 Detecting Protein Biotinylation and Complex Formation seen nen een nennen 38 Expected Res lts P M M 43 Stable Transduction of Cells with Lentivirus oeda EA netten R EEE E tt tetn trennt trennen 45 Troubleshooting P leiralp dee 50 Blasticidin ED 50 Map and Features of pLenti6 capTEV NT DEST1 issssssssssseseeeeeteente entente entente tentent teet teretes 51 Map and Features of pLenti6 capTEV CT DEST sssesssseeeeeententente tentent nter tentent trente tentent 53 Map of pLenti6 capTEV CT GW ARPQ2 isssssseeeeeeeeeeteente tette tenente tentent tentent tenente tentent E tenentes 55 Map and Features of pLP1 Map and Feat res ot pEP2 3e naene e airon Ea a RUP eb em RU aed n ai E Er RAER IRE i Map and Features of pLP VSWVQr ii e HO RHEIN P RERO EHE ER TA I eee ede 60 Additional Products uie temi eH ERE RE UR HR IR MEER RUE RR CURRERE ALES ER RR DERE ER RH EMGR 62 Technical Support ioo eei e ect e atre beatae E A pet dra tite aiite iia 65 Purchaser NotUficatioria i asini i REOR REB ER RR aae EUREN URN AURA HERR ERE EE REEL eti 66 Gateway Clone Distributio
30. The Journal of Antibiotics Series A 11 1 5 Yamaguchi H Yamamoto C and Tanaka N 1965 Inhibition of Protein Synthesis by Blasticidin S I Studies with Cell free Systems from Bacterial and Mammalian Cells J Biochem Tokyo 57 667 677 Yee J K Miyanohara A LaPorte P Bouic K Burns J C and Friedmann T 1994 A General Method for the Generation of High Titer Pantropic Retroviral Vectors Highly Efficient Infection of Primary Hepatocytes Proc Natl Acad Sci USA 91 9564 9568 Yee J K 1999 in The Development of Human Gene Therapy Friedmann T ed pp 21 45 Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Yee J K Moores J C Jolly D J Wolff J A Respess J G and Friedmann T 1987 Gene Expression from Transcriptionally Disabled Retroviral Vectors Proc Natl Acad Sci USA 84 5197 5201 Yu S F Ruden T v Kantoff P W Garber C Seiberg M Ruther U Anderson W F Wagner E F and Gilboa E 1986 Self Inactivating Retroviral Vectors Designed for Transfer of Whole Genes into Mammalian Cells Proc Natl Acad Sci USA 83 3194 3198 Zufferey R Dull T Mandel R J Bukovsky A Quiroz D Naldini L and Trono D 1998 Self inactivating Lentivirus Vector for Safe and Efficient in vivo Gene Delivery J Virol 72 9873 9880 2010 Life Technologies Corporation All rights reserved The trademarks mentioned herein are the property of Life Technol
31. age 33 Titering Lentiviral Stocks Continued Example of Expected Results Next Steps 34 In this experiment a control lentiviral stock was generated using the protocol on page 27 HT1080 cells were transduced with 10 fold serial dilutions of the lentiviral supernatant 10 to 10 dilutions or untransduced mock Forty eight hours post transduction the cells were placed under Blasticidin selection 10 pg mL After 10 days of selection the cells were stained with crystal violet see plate below and colonies were counted 10 10 mock 10 10 104 In the plate above the colony counts were e Mock no colonies e 10 dilution confluent undeterminable e 10 dilution confluent undeterminable e 10 dilution confluent undeterminable e 10 dilution 46 e 10 dilution 5 Thus the titer of this concentrated lentiviral stock is 4 8 x 10 TU mL i e average of 46 x 10 and 5 x 10 User experience the nature of the gene and vector backbone may affect virus titer If the titer of your unconcentrated virus is suitable i e 1 x 10 TU mL or higher proceed to Transducing Cells with Lentivirus next page If the titer of your concentrated lentiviral stock is less than 1 x 10 TU mL produce a new lentiviral stock See Troubleshooting page 46 for more tips and guidelines to optimize viral yield Transducing Cells with Lentivirus Introduction Important Transient vs Stable Expression Dete
32. alovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 Pandya S Klimatcheva E and Planelles V 2001 Lentivirus and foamy virus vectors novel gene therapy tools Expert Opinion on Biological Therapy 1 17 40 Puig O Caspary F Rigaut G Rutz B Bouveret E Brigado Nilsson E Wilm M and Seraphin B 2001 The Tandem Affinity Purification Method A General Procedure of Protein Complex Purification Methods 24 218 229 Continued on next page 70 References Continued Rigaut G Shevchenko A Rutz B Wilm M Mann M and Seraphin B 1999 A generic protein purification method for protein complex characterization and proteome exploration Nat Biotechnol 17 1030 1032 Robinson R Turbedsky K Kaiser D Marchand J B HIggs H Choe S and Pollard T 2001 Crystal Structure of the Arp2 3 Complex Science 294 1679 1684 Schwarz E Oesterhelt D Reinke H Beyreuther K and Dimroth P 1988 The Sodium Ion Translocating Oxalacetate Decarboxylase of Klebsiella pneumoniae J Biol Chem 263 9640 9645 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Takeuchi S Hirayama K Ueda K Sakai H and Yonehara H 1958 Blasticidin S A New Antibiotic
33. attR sites for counterscreening The ccdB gene located between the attR sites for negative selection N or C terminal capTEV tag for in vivo biotinylation and affinity purification of recombinant proteins and associated complexes consisting of e BioEase Tag for in vivo biotinylation and purification using streptavidin agarose e 2 Tobacco Etch Virus TEV protease recognition sites to remove bound protein complexes after affinity purification with streptavidin agarose e 6XHis tag for identification of bait protein Blasticidin Izumi et al 1991 Kimura et al 1994 Takeuchi et al 1958 Yamaguchi et al 1965 resistance gene for selection in E coli and mammalian cells Ampicillin resistance gene for selection in E coli pUC origin for high copy replication of the plasmid in E coli For plasmid map and features of the vectors see pages 51 55 Continued on next page pLenti6 capTEV DEST Vectors Continued capTEV Tag BioEase Tag TEV Protease Recognition Site The NativePure Lentiviral Vectors allow N or C terminal fusion of your recombinant protein of interest to the capTEV Tag The capTEV Tag consists of a BioEase in vivo biotinylation peptide two Tobacco Etch Virus TEV protease recognition sites and a 6XHis tag recombinant protein biotin 6XHis TEV TEV BioEase TEV cleavage sites TM The capTEV Tag facilitates in vivo biotinylation of the recombinant bait protein of inter
34. dded to media containing the DNA Lipofectamine 2000 complexes and allowed to attach Continued on next page 25 Producing Lentivirus in 293FT Cells Continued Materials Needed TM e pLenti6 capTEV N and C tagged expression clones 0 1 3 0 pg L in sterile water or TE pH 8 0 e Opti MEM I Reduced Serum Medium pre warmed to 37 C e Fetal bovine serum FBS e Complete growth medium containing sodium pyruvate i e DLMEM supplemented with 10 FBS 2 mM L glutamine 0 1 mM MEM Non Essential Amino Acids 1 penicillin streptomycin and 1 mM MEM Sodium Pyruvate Note D MEM already contains 4 mM L glutamine which is enough to support cell growth of the 293FT Cell Line However since L glutamine slowly decays over time supplement the medium with 2 mM L glutamine 293FT cells grow well in 6 mM L glutamine but higher concentrations of L glutamine may reduce growth e Sterile 10 cm tissue culture plates one each for the lentiviral construct positive control and negative control e Sterile tissue culture supplies e 15 mL sterile capped conical tubes e Millex HV 0 45 um PVDF filters or equivalent e Cryovials Components supplied with the kits e Control vector pLenti6 capTEV CT GW ARPC2 TM Components supplied with the NativePure Lentiviral Expression Kit and the NativePure Lentiviral Expression and Affinity Purification System only e ViraPower Packaging Mix e 293FT cells cultured in the appropr
35. din conjugate 7 Confirm complex formation with biotinylated recombinant protein by native gel electrophoresis and detection on a western blot using a streptavidin conjugate Optional Purify the biotinylated protein and associated protein complexes using NativePure Affinity Purification Kit 8 Analyze protein complexes using native electrophoresis SDS PAGE immunodetection or mass spectrometry 10 Methods Generating Entry Clones Introduction Creating Entry Clones Note Individual expression and in vivo biotinylation of the protein of interest in your mammalian cell line may vary depending on whether your protein of interest is fused to an N terminal or C terminal tag Recombine your gene of interest into both pLenti6 capTEV DEST vectors to create both N and C terminally tagged expression clones To recombine your gene of interest into both pLenti6 capTEV NT DESTI and pLenti6 capTEV CT DEST vectors you will generate two entry clones containing your gene of interest with and without a stop codon This section provides guidelines for generating entry clones Entry vectors are available to facilitate generation of entry clones We recommend pENTR D TOPO or pCR 8 GW TOPO for rapid cloning of your gene of interest using TOPO technology see page 62 for ordering information You may also perform a BP recombination reaction using a PCR product containing attB sites and an attP co
36. dual Gag and Pol polyproteins The sequence of pLP1 is available at www invitrogen com or by contacting Technical Support see page 65 Comments for pLP1 8889 nucleotides CMV promoter bases 1 747 TATA box bases 648 651 Human f globin intron bases 880 1320 HIV 1 gag pol sequences bases 1355 5661 gag coding sequence bases 1355 2857 gag pol frameshift base 2650 pol coding sequence bases 2650 5661 HIV 1 Rev response element RRE bases 5686 5919 Human B globin polyadenylation signal bases 6072 6837 pUC origin bases 6995 7668 C Ampicillin bla resistance gene bases 7813 8673 C bla promoter bases 8674 8772 C C complementary strand Continued on next page Map and Features of pLP1 Continued Features of pLP1 tested pLP1 8 889 bp contains the following elements Features have been functionally Feature Benefit Human cytomegalovirus CMV promoter Permits high level expression of the HIV 1 222 and pol genes in mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 Human f globin intron Enhances expression of the gag and pol genes in mammalian cells HIV 1 2ag coding sequence Encodes the viral core proteins required for forming the structure of the lentivirus Luciw 1996 HIV 1 pol coding sequence Encodes the viral replication enzymes required for replication and integration of the lentivirus Luciw 1996 HIV 1 Rev resp
37. e or PVDF membranes see page 63 After blocking probe the blot with a suitable dilution of streptavidin AP or HRP conjugate and develop the blot using the WesternBreeze Chromogenic or Chemiluminescent Kits After SDS PAGE and western blotting with a streptavidin conjugate the protein of interest should exhibit biotinylation of the protein Expect to see background bands due to endogenous biotinylated proteins The expression level of the N and C terminally tagged proteins may vary or may be similar In rare cases conformation or subcellular compartmentalization variations may result in under biotinylation of the single biotinylation site within the capTEV tag If you do not observe any biotinylation on your protein of interest see Troubleshooting page 46 Under native electrophoresis conditions the protein of interest should migrate as a complex indicating the ability to interact with endogenous binding partners The ability for complex formation may vary between the N and C terminally tagged proteins or may be similar The next section shows results of a SDS PAGE and native electrophoresis experiment and provides guidelines for interpreting your results Based on the observed biotinylation and complex formation of your protein choose the appropriate N or C terminal construct for stable transduction into your cell line page 45 and further purification and analysis of your protein of interest Select the construct that pro
38. ecombination Region of pLenti6 capTEV CT DEST The recombination region of the expression clone resulting from pLenti6 capTEV CT DEST x entry clone is shown below Features of the Recombination Region e Dark shaded regions correspond to those DNA sequences transferred from the entry clone into the pLenti6 capTEV CT DEST vector by recombination e Light shaded regions correspond to the capTEV Tag e Non shaded and light shaded regions are derived from the pLenti6 capTEV CT DEST vector e Bases 2 448 and 4 130 of the pLenti6 capTEV CT DEST sequence are marked CMV Forward Priming Site CAAT TATA I 2251 TCGTAACAAC TCCGCCCCAT TGACGCAAAT GGGCGGTAGG CGTGTACGGT GGGAGGTCTA TATAAGCAGA Transcriptional Start I 2326 GCTCGTTTAG TGAACCGTCA GATCGCCTGG AGACGCCATC CACGCTGTTT TGACCTCCAT AGAAGACACC 2448 attB1 2391 GACTCTAGAG GATCCACTAG TCCAGTGTGG TGGAATTCTG CAGATATCAA CAAGTTT GTCTATAGTT GITCAAACAT GTT 4130 attB2 e Leu Tyr Lys Val val Asp Ile Gln His Ser Gly Gly zI TTG TAC AAA GTG GTT GAT ATC CAG CAC AGT GGC GGC TTT CAC CAA CTA TAG GTC GTG TCA CCG CCG 6X His Tag I Arg Ser Ser Leu Glu Gly Pro Arg Phe Glu Phe His His His His His His Gly Glu Asn 4167 CGC TCG AGT CTA GAG GGC CCG CGG TTC GAA TTC CAT CAT CAT CAT CAT CAT GGT GAG AAT GCG AGC TCA GAT CTC CCG GGC GCC AAG CTT AAG GTA GTA GTA GTA GTA GTA CCA CTC TTA TEV Recognition Site TEV Recognition Site BioEase Tag 1 r lr Leu Tyr Phe G
39. ecombine your gene of interest into both pLenti6 capTEV DEST vectors to create both N and C terminally tagged expression clones You will need to create two entry vectors containing your gene of interest with either a stop codon N terminal tagged recombine with pLenti6 capTEV NT DESTI1 or a Kozak translation initiation sequence and no stop codon C terminal tagged recombine with pLenti6 capTEV CT DEST These required elements are summarized below To make an entry clone to Then your gene of interest must recombine with contain pLenti6 capTEV NT DESTI e Stop codon pLenti6 capTEV CT DEST e Kozak consensus sequence see below e No stop codon Make sure that your gene of interest is in frame with the N or C terminal capTEV tag and other vector elements after performing the LR recombination reaction with the pLenti6 capTEV DEST vectors Refer to pages 14 15 to see the recombination regions of the vectors To recombine your entry clone with a destination vector for mammalian expression your insert should contain a Kozak consensus sequence with an ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1990 Kozak 1991 An example of a Kozak consensus sequence is provided below Other sequences are possible but the G or A at position 3 and the G at position 4 shown in bold illustrates the most commonly occurring sequence with strong consensus Replacing one of the two base
40. ed by expression of either one of two Blasticidin S deaminase genes BSD from Aspergillus terreus Kimura et al 1994 or bsr from Bacillus cereus Izumi et al 1991 These deaminases convert Blasticidin S to a non toxic deaminohydroxy derivative Izumi et al 1991 Merck Index 12 1 350 NH2 MW 458 9 Formula C17H26NsOs HCl Sn L N HOOC O CH3 HCI ANN NH NH2 O Always wear gloves mask goggles and a laboratory coat when handling Blasticidin Weigh out Blasticidin and prepare solutions in a hood e Blasticidin is soluble in water and acetic acid e Prepare a stock solution of 5 to 10 mg mL Blasticidin in sterile water and filter sterilize the solution e Aliquot in small volumes suitable for one time use and freeze at 20 C for long term storage or store at 4 C for short term storage e Aqueous stock solutions are stable for 1 week at 4 C and 6 8 weeks at 20 C e pH of the aqueous solution should not exceed 7 0 to prevent inactivation of Blasticidin e Do not subject stock solutions to freeze thaw cycles do not store in a frost free freezer e Upon thawing use what you need and discard the unused portion e Medium containing Blasticidin may be stored at 4 C for up to 2 weeks Map and Features of pLenti6 capTEV NT DEST1 Map of The figure below shows the features of the pLenti6 capTEV NT DESTI vector pLenti6 capTEV DNA from the entry clone replaces the region between bases 2
41. ed with the NativePure Lentiviral Expression Kit and the NativePure Lentiviral Expression and Affinity Purification System e One Shot Stb13 Chemically Competent E coli one vial per transformation thaw on ice immediately before use may also be purchased separately see page 62 e S 0 C Medium warm to room temperature e pUC19 positive control if desired to verify the transformation efficiency One Shot StbI3 Use this procedure to transform the LR recombination reaction into One Shot Transformation Stb 3 Chemically Competent E coli Procedure 1 Thaw one vial of One Shot Stb13 Chemically Competent E coli on ice for each transformation 2 Add 2 3 uL of the LR recombination reaction from Step 6 previous page into a vial of One Shot StbI3 cells and mix gently Do not mix by pipetting up and down For the pUC19 control add 10 pg 1 uL of DNA into a separate vial of One Shot cells and mix gently Incubate the vial s on ice for 30 minutes Heat shock the cells for 45 seconds at 42 C without shaking Remove the vial s from the 42 C water bath and place on ice for 2 minutes Add 250 uL of pre warmed S O C Medium to each vial Cap the vial s tightly and shake horizontally at 37 C for 1 hour at 225 rpm ina shaking incubator NO gr ges en 8 Spread 25 100 uL of the transformation mix on a pre warmed selective plate and incubate overnight at 37 C Plate two different volumes to ensure that at least
42. een functionally tested and the vector has been fully sequenced NT DEST1 Feature Benefit Rous Sarcoma Virus RSV Allows Tat independent production of viral mRNA enhancer promoter Dull et al 1998 HIV 1 truncated 5 LTR Permits viral packaging and reverse transcription of the viral mRNA Luciw 1996 5 splice donor and 3 acceptors Enhances the biosafety of the vector by facilitating removal of the Y packaging sequence and RRE such that expression of the gene of interest in the transduced host cell is no longer Rev dependent Dull et al 1998 HIV 1 psi y packaging signal Allows viral packaging Luciw 1996 HIV 1 Rev response element RRE Permits Rev dependent nuclear export of unspliced viral mRNA Kjems et al 1991 Malim et al 1989 CMV promoter Permits high level constitutive expression of the gene of interest Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 capTEV tag Allows in vivo biotinylation and affinity purification of recombinant proteins and associated complexes attR1 and attR2 sites Bacteriophage A derived DNA recombination sequences that permit recombinational cloning of the gene of interest from a Gateway entry clone Landy 1989 Chloramphenicol resistance gene Cm Allows counterscreening of plasmid ccdB gene Permits negative selection of the plasmid V5 epitope Allows detection of recombinant fusion protein by Anti
43. el analysis should show the correct digestion pattern indicating proper LR recombination with the lentiviral vector Additional or unexpected bands indicate aberrant recombination of the lentiviral vector TM This protocol provides general steps to retransform Stbl3 E coli and perform isolation of plasmid DNA for lentivirus production pLenti plasmid DNA midipreps often have lower yields therefore a 100 mL volume of culture must be used for one DNA midiprep 1 Dilute 1 uL of miniprep plasmid DNA from the positive clones 1 500 in TE 2 Use 1 pL of this diluted DNA to retransform into One Shot Stbl3 Chemically Competent Cells as described on page 18 3 Plate approximately one tenth of the transformation on LB plates containing 100 pg mL ampicillin and incubate at 37 C overnight 4 Pick 1 colony and culture in 2 mL LB medium containing 100 ug mL ampicillin for 6 8 hours at 37 C to obtain a starter culture 5 Inoculate 1 1 000 of the starter culture into LB medium containing 100 pg mL ampicillin e g inoculate 100 uL of starter culture in 100 mL LB ampicillin and culture at 37 C overnight Note Use at least 100 mL volume for large scale or midiprep isolation of DNA 6 Isolate plasmid DNA using PureLink HiPure Plasmid DNA Purification MidiPrep Kit or equivalent see Important page 21 7 Perform restriction analysis to confirm the presence of the insert Use the purified plasmid DNA from the positive clone for pr
44. ely see page 62 or go to www invitrogen com Continued on next page 13 Creating N and C Terminal Tagged Expression Clones Continued Recombination The recombination region of the expression clone resulting from Region of pLenti6 capTEV NT DESTI x entry clone is shown below pLenti6 capTEV Features of the Recombination Region NT DEST1 14 e Dark shaded regions correspond to those DNA sequences transferred from the entry clone into the pLenti6 capTEV NT DESTI vector by recombination TM e Light shaded regions correspond to the capTEV Tag TM e Non shaded and light shaded regions are derived from pLenti6 capTEV NT DEST1 e Bases 2 847 and 4 530 of the pLenti6 capTEV NT DEST1 sequence are marked CMV Forward Priming Site CAAT TATA ld o d 2383 TCGTAACAAC TCCGCCCCAT TGACGCAAAT GGGCGGTAGG CGTGTACGGT GGGAGGTCTA TATAAGCAGA BioEase Tag Met Gly Ala Gly 2453 GCTCTCTGGC TAACTAGAGA ACCCACTGCT TACTGGCTTA TCGAAATTAG CTTCACC ATG GGC GCC GGC TAG CCG COO CCE Woe Bro Well Wile Ala Pre tew ule Gly Mne Iie maa tys Wel bet Ala ser Glu dy ellie 2522 ACC CCG GTG ACC GCC CCG CTG GCG GGC ACT ATC TGG AAG GTG CTG GCC AGC GAA GGC CAG Kei G c c CANC were Ce G GIC GuxCc C GKC C OIe LGYA rue AC CHCA CMe NC Ce CHG COC CCEE aoma Well Jle Wile erly ele VaL keti tew Mie iev EI Ala Mawe bwe Wiehe Clw mme erii TT 2582 ACG GTG GCC GCA GGC GAG GTG CTG CTG ATT CTG GAA GCC AT
45. entiation stages or cell types Continued on next page System Summary Continued NativePure Lentiviral Expression System Continued NativePure Affinity Purification System The NativePure Lentiviral Expression System is derived from the ViraPower Lentiviral Expression System which facilitates highly efficient in vitro or in vivo delivery of a target gene to dividing and non dividing mammalian cells using a replication incompetent lentivirus The System includes the following major components e pLenti6 capTEV DEST vectors adapted for use with the Gateway Technology for the creation of expression plasmids containing the gene of interest fused to an N or C terminal capTEV tag The vectors also contain modified lentiviral elements that allow packaging of the construct into virions e g 5 and 3 LTRs Y packaging signal e The ViraPower Packaging Mix that contains an optimized mixture of the three packaging plasmids pLP1 pLP2 and pLP VSVG These plasmids supply the helper functions as well as structural and replication proteins in trans required to produce the lentivirus For more information about the packaging plasmids see the Appendix pages 56 61 e An optimized 293FT producer cell line that stably expresses the SV40 large T antigen under the control of the human CMV promoter and facilitates optimal production of virus For more information about the 293FT Cell Line refer to the 293FT Cell Line man
46. est The biotin tagged protein of interest forms complexes in your cell line of choice which is purified using streptavidin agarose affinity purification The TEV sites allow removal of the bound biotinylated proteins complexes of interest while endogenous biotinylated proteins remain bound to the streptavidin agarose column After TEV cleavage a 6XHis tag is present for identification of bait protein These features are described in detail in the following sections TM The BioEase Tag is a 72 amino acid peptide derived from the C terminus amino acids 524 595 of Klebsiella pneumoniae oxalacetate decarboxylase a subunit that contains a single covalent biotinylation site at lysine 561 of the protein Schwarz et al 1988 When fused to a heterologous protein the 72 amino acid BioEase domain is both necessary and sufficient to facilitate recognition and in vivo biotinylation of the recombinant protein of interest by cellular biotinylation enzymes The high affinity and selectivity of the streptavidin biotin interaction is utilized to efficiently purify the biotinylated protein and associated complexes by streptavidin agarose affinity chromatography using the NativePure Affinity Purification Kit supplied with Cat nos BN3005 and BN3007 also available separately see page 64 for ordering information For more information about cellular biotinylation processes refer to published reviews Chapman Smith amp J E Cronan 1999 Since
47. g interaction between biotin and streptavidin to easily detect your recombinant biotinylated protein with one of the following streptavidin conjugates Conjugate Catalog Number Streptavidin HRP SA100 01 Streptavidin AP 43 4322 Use WesternBreeze Chromogenic and Chemiluminescent Kits to facilitate detection of streptavidin conjugates see page 64 for ordering information The NativePAGE Novex Bis Tris Gel system is a near neutral pH pre cast polyacrylamide mini gel system used to perform native non denaturing electrophoresis The near neutral pH 7 5 environment during electrophoresis results in maximum stability of both proteins and gel matrix providing better band resolution than other gel systems including the traditional Tris glycine native electrophoresis Laemmli system The NativePAGE Novex Bis Tris Gel system provides a sensitive and high resolution method for analysis of native membrane protein complexes native soluble proteins molecular mass estimations and purity assessments of native proteins A variety of NativePAGE gels and pre made buffers for native electrophoresis are available see page 64 Use NuPAGE Novex Bis Tris Gels Novex Tris Glycine Gels or any other SDS PAGE gel of choice for performing SDS PAGE Select an appropriate acrylamide percentage that will best resolve your proteins of interest The N terminal fusion tag adds approximately 12 3 kDa to the size of your prote
48. get cell Yee et al 1987 Yu et al 1986 Zufferey et al 1998 Once integrated into the transduced target cell the lentiviral genome is no longer capable of producing packageable viral genome e The number of genes from HIV 1 that are used in the system has been reduced to three i e gag pol and rev e The VSV G gene from Vesicular Stomatitis Virus is used in place of the HIV 1 envelope Burns et al 1993 Emi et al 1991 Yee et al 1994 e Genes encoding structural and other components required for packaging of the viral genome are separated onto four plasmids All four plasmids have been engineered not to contain any regions of homology with each other to prevent undesirable recombination events that could lead to the generation of a replication competent virus Dull et al 1998 e Although the packaging plasmids allow expression in trans of proteins required to produce viral progeny e 2 gal pol rev env in the 293FT producer cell line none of them contain LTRs or the packaging sequence This means that none of the HIV 1 structural genes are actually present in the packaged viral genome and thus are never expressed in the transduced target cell No new replication competent virus can be produced e The lentiviral particles produced in this system are replication incompetent and only carry the gene of interest No other viral species are produced e Expression of the gag and pol genes from pLP1 has been rendered Re
49. h dilution gently by inversion and add to one well of cells total volume 1 mL If using Polybrene see page 31 add to each well for a final concentration of 6 pg mL Swirl the plate gently to mix Incubate cells at 37 C in a CO incubator overnight The following day Day 3 remove the media containing virus and replace with 2 mL of complete culture medium Incubate cells at 37 C in a CO incubator overnight The following day Day 4 remove the medium and replace with complete culture medium containing the appropriate amount of Blasticidin to select for stably transduced cells see page 31 Incubate cells at 37 C in a CO incubator Replace medium with fresh medium containing Blasticidin every 3 4 days After 10 12 days of selection day 14 16 you should see no live cells in the mock well and discrete antibiotic resistant colonies in one or more of the dilution wells Remove the medium and wash the cells twice with PBS Add crystal violet solution 1 mL for 6 well dish 5 mL for 10 cm plate and incubate for 10 minutes at room temperature 10 Remove the crystal violet stain and wash the cells with PBS Repeat wash 11 Count the blue stained colonies and determine the titer of each lentiviral stock When titering lentiviral stocks using HT1080 cells we generally obtain titers ranging from 1 5 x 10 for unconcentrated virus to 2 x 10 for concentrated virus transducing units TU mL Continued on next p
50. he transfection of nucleic acids into eukaryotic cells Using Lipofectamine 2000 to transfect 293FT cells offers the following advantages e Provides the highest transfection efficiency in 293FT cells e DNA Lipofectamine 2000 complexes can be added directly to cells in culture medium in the presence of serum e Removal of complexes or medium change or addition following transfection are not required although complexes can be removed after 4 6 hours without loss of activity Lipofectamine 2000 is supplied with Cat nos BN3004 and BN3007 and is available separately or as part of the ViraPower Bsd Lentiviral Support Kits see page 62 for ordering information To facilitate optimal formation of DNA Lipofectamine 2000 complexes we recommend using Opti MEM I Reduced Serum Medium see page 62 If you are a first time or inexperienced user with producing lentivirus using the ViraPower System and 293FT cells perform the recommended procedure Forward Transfection on page 27 This procedure requires plating the cells the day before transfection to obtain cells that are 90 95 confluent TM Note In previous ViraPower Lentivirus manuals this protocol was called the Alternate Transfection Method If you are an experienced lentivirus user and are familiar with the growth characteristics of 293FT cells you may choose to perform the rapid procedure Reverse Transfection on page 28 In this procedure the 293FT cells are a
51. iate medium e Lipofectamine 2000 transfection reagent store at 4 C mix gently before use Recommended We produce lentiviral stocks in 293FT cells using the following optimized Transfection transfection conditions The amount of lentivirus produced using these Conditions recommended conditions at a titer of 1 x 10 to 1 x 10 transducing units TU mL is generally sufficient to transduce 1 x 10 to 1 x 10 cells at a multiplicity of infection MOD 1 Condition Amount Tissue culture plate size 10 cm one per lentiviral construct Number of 293FT cells to transfect 5 6 x 10 cells depending on method see Recommendation on page 24 to prepare cells for transfection Amount of ViraPower Packaging 9 ug 9 uL of 1 ug pL stock Mix Amount of pLenti expression plasmid 3ug Amount of Lipofectamine 2000 36 uL 26 Note You may produce lentiviral stocks using other tissue culture formats but keep in mind that optimization will be necessary to obtain the expected titers Continued on next page Producing Lentivirus in 293FT Cells Continued Forward Transfection Procedure If you are a first time or inexperienced user follow the procedure below to cotransfect 293FT cells Include a negative control no DNA no Lipofectamine 2000 in your experiment to help you evaluate results 1 The day before transfection Day 1 plate 293FT cells in a 10 cm tissue culture plate so that they will be 90
52. icrograms of post nuclear supernatant was loaded per well on a 3 12 NativePAGE Novex Bis Tris gel and electrophoresed Proteins were transferred to Invitrolon PVDF membrane and subjected to western detection using streptavidin alkaline phosphatase conjugate 1 4 000 and the WesternBreeze Chromogenic Kit Apparent molecular weights kDa are listed on TM the left which correspond to NativeMark Unstained Protein Standard 1 2 3 4 5 Lane 1 5 uL of 1 20 diluted e zem NativeMark Unstained Protein Standard 4226 B Lane 2 Untransfected cell lysate 1048 negative control Lane3 APRC2 CT pore Lane 4 PSMB CT tagged lt q 720 m LIES Lane 5 PSMB NT tagged 480 242 l o5 s EM od 146 gt 66 These results show that in the case of the human proteasome subunit beta 2 protein PSMB the C terminally tagged protein forms a complex 20S proteosome complex shown by the arrow in lane 4 while the N terminally tagged protein lane 5 does not These data also show the size of the protein complex formed Background bands detected in all lanes may be protein present in the cell lysate with endogenous phosphatase activity endogenous biotinylation or nonspecific binding Stable Transduction of Cells with Lentivirus Introduction Materials Needed Stable Transduction Procedure Note TM Guidelines for transducing pLenti6 capTEV lentiviral constructs into your mammalian cell line and selecting fo
53. in The C terminal fusion tag adds approximately 15 1 kDa to the size of your protein Continued on next page 39 Detecting Protein Biotinylation and Complex Formation Continued Materials Needed 1X Lysis Buffer 40 e Transiently transduced cells i e 48 hours after transduction e 1X phosphate buffered saline PBS see page 62 e Complete protease inhibitor Roche Cat no 04693116001 or equivalent e Pepstatin Roche Cat no 10253286001 or equivalent e Deionized water e Protein quantification kit such as Quant iT Protein Assay Kit page 62 e Protein standards e Optional Benzonase nuclease e NativePAGE gels page 64 for native electrophoresis e NuPAGE Novex Bis Tris Gels or Tris Glycine gels page 63 for SDS PAGE e Appropriate units for electrophoresis and blotting e Streptavidin conjugate page 64 e WesternBreeze Detection Kits page 64 or equivalent TM Components supplied with the NativePure Lentiviral Affinity Purification Kit and the NativePure Lentiviral Expression and Affinity Purification System TM e NativePure 5X Lysis Binding Buffer see below for buffer composition For each experiment you will have 4 transiently transduced cell samples N and C terminal positive and negative controls Make 2 4 mL of 1X Lysis Buffer per sample depending on the volume of your samples i e 30 mL flask 10 cm dish T 175 flask see next section Prepare 1X Lysis Buffer 1
54. in conjugate to verify biotinylation of the protein of interest Also analyze the lysates using native gel electrophoresis to verify complex formation with the protein of interest After optimizing the expression and biotinylation of the bait protein of interest purify the biotinylated protein and associated protein complexes under native conditions using the NativePure Affinity Purification Kit supplied with Cat nos BN3005 and BN007 also available separately see page 64 Analyze the associated complexes by western detection or mass spectrometry TM Use of the NativePure Lentiviral Expression System to facilitate lentiviral based expression of your protein of interest provides the following advantages e Gateway adapted vectors enable rapid and highly efficient transfer of DNA sequences for protein expression and functional analysis while maintaining orientation and reading frame e Generates an HIV 1 based lentivirus that effectively transduces both dividing and non dividing mammalian cells thus broadening the potential applications beyond those of traditional Moloney Leukemia Virus MoMLV based retroviral systems Naldini 1998 e The number of lentivirus particles can be determined prior to delivery into mammalian cells by titering which allows you to control expression of the in vivo biotinylated bait protein of interest thus allowing complex formation under physiological conditions e Produces a pseudotyped virus with
55. ine 9 ug of the ViraPower Packaging Mix and 3 ug of pLenti expression plasmid DNA 12 ug total in 1 5 mL of Opti MEM I Medium without serum Mix gently b Inaseparate sterile 5 mL tube mix Lipofectamine 2000 gently before use then dilute 36 uL in 1 5 mL of Opti MEM I Medium without serum Mix gently and incubate for 5 minutes at room temperature c After the 5 minute incubation combine the diluted DNA with the diluted Lipofectamine 2000 Mix gently d Incubate for 20 minutes at room temperature to allow the DNA Lipofectamine 2000 complexes to form The solution may appear cloudy but this will not impede the transfection 2 While DNA lipid complexes are forming trypsinize and count the 293FT cells Resuspend the cells at a density of 1 2 x 10 cells mL in growth medium or Opti MEM I Medium containing serum Do not include antibiotics in the medium 3 Add the DNA Lipofectamine 2000 complexes to a 10 cm tissue culture plate containing 5 mL of growth medium or Opti MEM I Medium containing serum Do not include antibiotics in the medium 4 Add 5 mL of the 293FT cell suspension 6 x 106 total cells to the plate containing media and DNA Lipofectamine 2000 complexes Mix gently by rocking the plate back and forth Incubate cells overnight at 37 C in a CO incubator 5 The next day Day 2 remove the medium containing the DNA Lipofectamine 2000 complexes and replace with complete culture medium Incubate cells over
56. ing and proceeding to transduction For details and guidelines refer to published reference sources Yee 1999 Store viral stocks in cryovials at 80 C for long term storage Repeated freezing and thawing is not recommended as it may result in loss of viral titer When stored properly viral stocks of an appropriate titer should be suitable for use for up to one year After long term storage retiter viral stocks before transducing your mammalian cell line of interest It is possible to scale up the cotransfection experiment to produce a larger volume of lentivirus if desired For example we have scaled up the cotransfection experiment from a 10 cm plate to a T 175 cm flask and harvested up to 30 mL of viral supernatant If you wish to scale up your cotransfection remember that you will need to increase the number of cells plated and the amounts of DNA Lipofectamine 2000 and medium used in proportion to the difference in surface area of the culture vessel 29 Titering Lentiviral Stocks Introduction Experimental Outline Factors Affecting Viral Titer Selecting a Cell Line for Titering 30 Before proceeding to transduction and expression experiments we highly recommend that you determine the titer of your pLenti6 capTEV lentiviral stocks Determining the viral titer is necessary if e You wish to control the number of integrated copies of the lentivirus e You wish to generate reproducible expression result
57. ll 10 gels BN1003BOX NativePAGE Novex 4 16 Bis Tris Gels 10 well 10 gels BN1002BOX NativePAGE Novex 4 16 Bis Tris Gels 15 well 10 gels BN1004BOX NativePAGE Running Buffer 20X 1L BN2001 NativePAGE Cathode Buffer Additive 20X 250 mL BN2002 NativePAGE Sample Buffer 4X 10 mL BN2003 NativePAGE 5 G 250 Sample Buffer Additive 0 5 mL BN2004 NativePAGE Running Buffer Kit 1 kit BN2007 NativePAGE Sample Prep Kit 1 kit BN2008 10 DDM n dodecyl B D maltoside 1 mL BN2005 5 Digitonin 1mL BN2006 Streptavidin Agarose sedimented bead suspension 5mL S 951 AcTEV Protease 1000 units 12575 015 10 000 units 12575 023 Reagents for detecting protein are available separately For more information refer to www invitrogen com or contact Technical Support see page 65 Product Amount Cat no Streptavidin Agarose 5mL SA100 04 Streptavidin HRP Conjugate 2 5 mg 43 4323 Anti HisG AP Antibody 125 pL R942 25 WesternBreeze Chromogenic Kit Anti Rabbit 20 reactions WB7105 WesternBreeze Chemiluminescent Kit Anti Mouse 20 reactions WB7104 Continued on next page Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes SDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitroge
58. ln Gly Gln Leu Glu Asn Leu Tyr Phe Gln Gly Gly Ala Gly Thr Pro Val 4227 CTT TAT TTT CAG GGT CAA TTG GAG AAT CTT TAT TTT CAG GGT GGC GCC GGC ACC CCG GTG GAA ATA AAA GTC CCA GTT AAC CTC TTA GAA ATA AAA GTC CCA CCG CGG CCG TGG GGC CAC TEV Cleavage Site A TEV Cleavage Site TALJ FS Leo Ala Cy Ihr ILe Te Lya Well Leo Ala Ser Co Giy Gim Wore Weil Ala 4287 ACC GCC CCG CTG GCG GGC ACT ATC TGG AAG GTG CTG GCC AGC GAA GGC CAG ACG GTG GCC TGG CGG GGC GAC CGC CCG TGA TAG ACC TTC CAC GAC CGG TCG CTT CCG GTC TGC CAC CGG Ala Gly Glu Val Leu Leu Ile Leu Glu Ala Met Lys Met Glu Thr Glu Ile Arg Ala Ala 4347 GCA GGC GAG GTG CTG CTG ATT CTG GAA GCC ATG AAG ATG GAA ACC GAA ATC CGC GCC GCG CGT CCG CTC CAC GAC GAC TAA GAC CTT CGG TAC TTC TAC CTT TGG CTT TAG GCG CGG CGC In vivo biotinylation site Gln Ala Gly Thr Val Arg Gly Ile Ala Val Lys Ala Gly Asp Ala Val Ala Val Gly Asp 4407 CAG GCC GGG ACC GTG CGC GGT ATC GCG GIG AAA GCC GGC GAC GCG GIG GCG GTC GGC GAC GTC CGG CCC TGG CAC GCG CCA TAG CGC CAC TTT CGG CCG CTG CGC CAC CGC CAG CCG CTG V5 Reverse Priming Site V5 Epitope Thr Leu Met Thr Leu Ala Gly Ser Gly Ser Glu ely Lys Pro Ile Pro Asn Pro Leu Leu 4467 ACC CTG ATG ACC CTG GCG GGC TCT GGA TCC GAA GGT AAG CCT ATC CCT AAC CCT CTC CTC TGG GAC TAC TGG GAC CGC CCG AGA CCT AGG CTT CCA TTC GGA TAG GGA TTG GGA GAG GAG Gly Leu Asp Ser Thr Arg Thr Gly 4527 GGT CTC GAT TCT ACG CGT ACC GGT TAG TAA TGA GTTT CCA GAG
59. lth of the 293FT cells at the time of transfection has a critical effect on the success of lentivirus production Use of unhealthy cells will negatively affect the transfection efficiency resulting in production of a low titer lentiviral stock For optimal lentivirus production i e producing lentiviral stocks with the expected titers follow the guidelines below to culture 293FT cells before use in transfection e Make sure that cells are healthy and greater than 90 viable e Subculture and maintain cells in complete medium supplemented with 0 1 mM MEM Non Essential Amino Acids 2 mM Glutamine 1 mM sodium pyruvate 500 ug mL Geneticin and 10 fetal bovine serum that is not heat inactivated see page 62 e Donot allow cells to overgrow before passaging e Use cells that have been subcultured for less than 20 passages Include a positive control vector in the cotransfection experiment to generate a control lentiviral stock that may be used to optimize expression conditions in your mammalian cell line of interest A positive control vector pLenti6 capTEV CT GW ARPC2 is included for use as an expression control See page 55 for a plasmid map of the control vector Continued on next page Producing Lentivirus in 293FT Cells Continued Lipofectamine 2000 Opti MEM Recommended Procedure Lipofectamine 2000 reagent Ciccarone et al 1999 is a proprietary cationic lipid based formulation suitable for t
60. m 58 913 949 Lewis P F and Emerman M 1994 Passage Through Mitosis is Required for Oncoretroviruses but not for the Human Immunodeficiency Virus J Virol 68 510 516 Luciw P A 1996 in Fields Virology Fields B N Knipe D M Howley P M Chanock R M Melnick J L Monath T P Roizman B and Straus S E eds 3rd Ed pp 1881 1975 Lippincott Raven Publishers Philadelphia PA Malim M H Hauber J Le S Y Maizel J V and Cullen B R 1989 The HIV 1 Rev Trans activator Acts Through a Structured Target Sequence to Activate Nuclear Export of Unspliced Viral mRNA Nature 338 254 257 Naldini L 1998 Lentiviruses as Gene Transfer Agents for Delivery to Non dividing Cells Curr Opin Biotechnol 9 457 463 Naldini L 1999 in The Development of Human Gene Therapy Friedmann T ed pp 47 60 Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Naldini L Blomer U Gage F H Trono D and Verma I M 1996 Efficient Transfer Integration and Sustained Long Term Expression of the Transgene in Adult Rat Brains Injected with a Lentiviral Vector Proc Natl Acad Sci USA 93 11382 11388 Nayak S Li L and Lee J 2003 Enhanced TEV Protease Extends Enzyme Stability for Long Term Activity Focus 25 3 12 14 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomeg
61. medium containing virus and replace with fresh complete culture medium Incubate at 37 C in a CO incubator overnight 6 Thefollowing day Day 3 remove the medium and replace with fresh complete medium containing the appropriate amount of Blasticidin page 35 to select for stably transduced cells Incubate at 37 C in a CO incubator 7 Replace medium with fresh medium containing Blasticidin every 3 4 days until Blasticidin resistant colonies can be identified generally 10 12 days after selection 8 Pick atleast 5 Blasticidin resistant colonies see Note below and expand each clone to assay for expression of the recombinant biotinylated protein Integration of the lentivirus into the genome is random Depending upon the influence of the surrounding genomic sequences at the integration site you may see varying levels of recombinant protein expression from different antibiotic resistant clones Test at least 5 antibiotic resistant clones and select the clone that provides the optimal expression of your recombinant biotinylated protein and which exhibits proper complex formation for further studies 45 Troubleshooting Creating an Expression Clone The table below lists some potential problems and possible solutions that may help you troubleshoot creating an expression clone Problem Reason Solution Few or no colonies obtained from sample reaction and the transformation control gave colonies Inco
62. minimum concentration of Blasticidin required to kill your untransduced mammalian cell line i e perform a kill curve experiment For guidelines to perform a kill curve experiment see page 31 If you titered your lentiviral construct in the same mammalian cell line that you are using to perform the stable expression experiment then you may use the same concentration of Blasticidin for selection that you used for titering To obtain optimal expression of your gene of interest transduce the lentiviral construct into a mammalian cell line of choice using a suitable MOI MOI is defined as the number of virus particles per cell and generally correlates with the number of integration events and as a result expression Typically expression levels increase linearly as the MOI increases A number of factors influence the optimal MOI including the nature of your mammalian cell line e g non dividing vs dividing cell type see Note next page its transduction efficiency your application of interest and the nature of your gene of interest If you are transducing your lentiviral construct into the mammalian cell line of choice for the first time use a range of MOIS e g 0 0 05 0 1 0 5 1 2 5 to determine the MOI required to obtain optimal expression of your recombinant protein for your particular application Continued on next page 35 Transducing Cells with Lentivirus Continued Note Positive Control Important Mate
63. n it is possible to incubate cells for as little as 6 hours prior to changing medium The following day Day 2 remove the medium containing virus and replace with fresh complete culture medium Incubate at 37 C in a CO incubator overnight The following day Day 3 harvest the cells and assay for recombinant protein biotinylation and ability to form complexes by western analysis and native gel electrophoresis next section 37 Detecting Protein Biotinylation and Complex Formation Introduction Experimental Outline Important 38 TM After transducing your cells with the pLenti6 capTEV N and C terminal lentivirus stocks you must confirm biotinylation of your protein of interest and the ability of the tagged protein to form complexes prior to proceeding with purification or analysis experiments This section includes instructions to verify biotinylation using SDS PAGE and to verify complex formation using native electrophoresis followed by western detection with a streptavidin conjugate Note You may also analyze cells that have been transiently transfected with your pLenti6 capTEV expression clones page 23 using these protocols prior to producing lentivirus stocks To detect protein biotinylation and complex formation 1 Prepare cell lysate using freeze thaw cycles no SDS buffers 2 Analyze lysate by e SDS PAGE e Native gel electrophoresis 3 Perform two western blots e SDS PAGE gel to de
64. n Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 65 Purchaser Notification Limited U
65. n Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com SDS Certificate of Analysis Limited Warranty Safety Data Sheets SDSs are available on our website at www invitrogen com sds The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the box Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about a
66. n Policy eia i va eB e n a i BU tnit det bud 68 References sese ed T EE E c ERG REA EM II ARR UR ERR LAE TE REESE ER RERO REIR RH SEEMS 69 iii Kit Contents and Storage Types of Kits This manual is supplied with the following products Product Cat no NativePure Lentiviral Gateway Vector Kit BN3001 NativePure Lentiviral Expression Kit BN3004 NativePure Lentiviral Affinity Purification Kit BN3005 NativePure Lentiviral Expression and Affinity Purification System BN3007 Intended Use For research use only Not intended for human or animal diagnostic or therapeutic uses Kit Components The following table shows the components associated with the NativePure Lentiviral Expression System catalog numbers listed above Cat no Components BN3001 BN3004 BN3005 BN3007 Lentiviral Gateway Z L NativePure Vector Kit ViraPower Bsd Lentiviral Support Kit 293FT Cell Line One Shot Stb13 Chemically Competent E coli Gateway LR Clonase II NativePure Affinity Purification Kit Y Ns Ss S NS S S S Continued on next page Kit Contents and Storage Continued Shipping and NativePure Lentiviral Kits are shipped as described below Upon receipt store Storage each component as detailed below All reagents are guaranteed for a minimum of six months if stored properly Box Component Shipping Storage 1 Na
67. n next page 47 Troubleshooting Continued Transducing Mammalian Cells The table below lists some potential problems and possible solutions that may help you troubleshoot transduction and expression experiments Problem Reason Solution No expression of the gene of interest Promoter silencing Lentiviral constructs may integrate into a chromosomal region that silences the CMV promoter controlling expression of the gene of interest Screen multiple antibiotic resistant clones and select the clone that gives optimal biotinylated protein expression Viral stocks stored incorrectly Aliquot and store stocks at 80 C Do not freeze thaw more than 3 times Poor expression of the gene of interest Low transduction efficiency e Polybrene not included during transduction e Non dividing cell type used e Transduce the lentiviral construct into cells in the presence of Polybrene e Transduce your lentiviral construct into cells using a higher MOI MOI too low Transduce your lentiviral construct into cells using a higher MOI Too much antibiotic used for selection Determine the antibiotic sensitivity of your cell line by performing a kill curve Use the minimum antibiotic concentration required to kill your untransduced cell line Cells harvested too soon after transduction Do not harvest cells until at least 48 72 hours after transduction to allow expressed protein to acc
68. next page Optional Sequence the plasmids to determine that your gene of interest is in frame with the N and C terminal tags Optional Transiently transfect a mammalian cell line of your choice with your pLenti6 capTEV clones to check for protein expression and biotinylation Continued on next page Analyzing Transformants Continued Important Restriction Digest Materials Needed Screening Colonies by Miniprep Stbl3 E coli is wild type for endonuclease 1 end A14 When performing plasmid DNA isolation with commercially available kits ensure that Solution I of the Lysis Buffer often called Resuspension Buffer contains 10 mM EDTA to inactivate the endonuclease to avoid DNA nicking and vector degradation Alternatively follow the instructions included in the plasmid purification kits for endA1 F coli strains We recommend using the PureLink HO Mini Plasmid Purification Kit and preparing lentiviral plasmid DNA using PureLink HiPure Plasmid DNA Purification MidiPrep Kits page 62 To confirm that no rearrangement in the LTR regions of the plasmids has taken place perform restriction digests using Afl II and Xho I Afl II sites are present in both LTRs The Xho I site is present after the 3 end of the attR recombination sites Assuming there are no Afl II or Xho I sites in the insert 3 DNA fragments are generated from the Afl II Xho I digest Any unexpected DNA fragments are a
69. night at 37 C in a CO incubator Note Expression of the VSV G glycoprotein causes 293FT cells to fuse resulting in the appearance of large multinucleated cells known as syncytia This morphological change is normal and does not affect production of the lentivirus 6 Harvest virus containing supernatants 48 72 hours posttransfection Day 3 4 by removing medium into a 15 mL sterile capped conical tube Minimal differences in viral yield are observed whether supernatants are collected 48 or 72 hours posttransfection Caution Remember that you are working with infectious virus at this stage Follow the recommended guidelines for working with BL 2 organisms see pages 8 and 32 for more information Centrifuge supernatants at 2 000 x 2 for 15 minutes at 4 C to pellet debris Filter the viral supernatants through a Millex HV 0 45 um or equivalent PVDF filter 9 Pipet viral supernatants into cryovials in 1 mL aliquots Store viral stocks at 80 C Proceed to Titering Lentiviral Stocks page 30 Continued on next page 28 Producing Lentivirus in 293FT Cells Continued Concentrating Virus Long Term Storage Scaling Up Virus Production It is possible to concentrate VSV G pseudotyped lentiviruses using a variety of methods without significantly affecting their ability to transduce cells If your cell transduction experiment requires that you use a relatively high MOI you may wish to concentrate your virus before titer
70. nsduced cells using Blasticidin during the titer procedure you must first determine the minimum concentration of Blasticidin required to kill your untransduced mammalian cell line i e perform a kill curve experiment Typically concentrations ranging from 2 10 pg mL Blasticidin are sufficient to kill most untransduced mammalian cell lines Test a range of concentrations see protocol below to ensure that you determine the minimum Blasticidin concentration necessary for your cell line 1 Plate cells at approximately 25 confluence Prepare a set of 6 7 plates Allow cells to adhere overnight 2 The next day substitute culture medium with medium containing varying concentrations of Blasticidin 3 Replenish selective media every 3 4 days and observe percentage of surviving cells 4 Determine the appropriate concentration of Blasticidin that kills the cells within 10 14 days after addition of antibiotic Transduction of lentivirus into mammalian cells may be enhanced if cells are transduced in the presence of hexadimethrine bromide Polybrene For optimal results perform transduction in the presence of Polybrene Note however that some cells e g primary neurons are sensitive to Polybrene Before performing any transduction experiments you may want to test your cell line for sensitivity to Polybrene at a range of concentrations If your cells are sensitive to Polybrene e g exhibit toxicity or phenotypic changes do not add
71. ntaining pDONR vector to create your entry clone Refer to page 62 for pDONR 201 pDONR 221 and pDONR Zeo ordering information For more information go to www invitrogen com or contact Technical Support page 65 Refer to the manual for the specific vector you are using for detailed instructions to construct entry clones TM Ultimate ORF open reading frame clones are fully sequenced human and mouse clones supplied in a Gateway compatible entry vector If you are using an Ultimate ORF clone as the source of your gene of interest you may do the following For N terminal tagged protein TM Use Ultimate ORF clones directly as an entry clone for LR recombination with pLenti6 capTEV NT DESTI to generate your entry clone For C terminal tagged protein TM e Do NOT use Ultimate ORF clones directly as an entry clone for LR recombination with pLenti6 capTEV CT DEST to generate your entry clone due to the presence of a TAG stop codon TM e UseUltimate ORF clone as a template to amplify the gene of interest using primers that modify the stop codon and clone the template without the stop codon into the entry vector of choice For more information about the Ultimate ORF collection go to www invitrogen com or contact Technical Support page 65 Continued on next page 11 Generating Entry Clones Continued N and C Terminal Expression Clones Kozak Consensus Sequence 12 TM R
72. oducing the lentivirus see below and page 24 Once you have generated and validated the pLenti6 capTEV expression clones isolate plasmid DNA for transfection Plasmid DNA for transfection into eukaryotic cells must be very clean and free from contamination with phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating lentiviral plasmid DNA using the PureLink HiPure Plasmid DNA Purification MidiPrep Kit see page 62 for ordering information Important Do not use mini prep plasmid DNA for lentivirus production Once you have generated your expression clone maintain and propagate the plasmid in LB medium containing 100 ug mL ampicillin Continued on next page Analyzing Transformants Continued Sequencing Confirm that your gene of interest is in frame with the N or C terminal tag by sequencing your expression constructs We recommend using the following primers Refer to the diagrams on pages 14 15 for the location of the primer TM binding sites in each pLenti6 capTEV vector Vector Primer Sequence pLenti6 capTEV NT DEST1 CMV forward 5 CGCAAATGGGCGGTAGGCGTG 3 pLenti capTEV CT DEST V5reverse 5 ACCGAGGAGAGGGTTAGGGAT 3 Note For custom primer synthesis information go to www invitrogen com or contact Technical Support see page 65 Transient Prior to lentiviru
73. ogies Corporation or their respective owners 71 invitrogen by Lefe technologies Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
74. ommended Federal and institutional guidelines for working with BL 2 organisms e Perform all manipulations within a certified biosafety cabinet e Treat media containing virus with bleach e Treat used pipettes pipette tips and other tissue culture supplies with bleach and use biohazardous waste disposal e Wear gloves a laboratory coat and safety glasses or goggles when handling viral stocks and media containing virus Continued on next page Titering Lentiviral Stocks Continued Transducing and Titering Lentivirus Expected Results TM Follow the procedure below to determine the titer of your pLenti6 capTEV stocks You will use at least one 6 well plate of cells for every lentiviral stock to be titered one mock well plus five dilutions 1 The day before transduction Day 1 trypsinize and count the cells Plate them in a 6 well plate such that they will be 30 50 confluent at the time of transduction Incubate cells at 37 C in a CO incubator overnight Example When using HT1080 cells plate 2 x 10 cells per well in a 6 well plate On the day of transduction Day 2 thaw your lentiviral stocks and prepare 10 fold serial dilutions ranging from 10 to 10 For each dilution dilute the lentiviral stock into complete culture medium to a final volume of 1 mL DO NOT vortex Note You may prepare a wider range of serial dilutions 10 to 10 if desired Remove the culture medium from the cells Mix eac
75. one plate will have well spaced colonies For the pUC19 control dilute the transformation mix 1 10 into LB Medium e g add 100 uL of the transformation mix to 900 uL of LB Medium and plate 25 100 pL 9 Store the remaining transformation mix at 4 C Plate out additional cells the next day if desired 10 Proceed to Analyzing Transformants page 20 Continued on next page 18 Transforming One Shot StbI3 Competent E coli Continued Expected Results If you use E coli cells with a transformation efficiency of 1 x 10 cfu ug the LR reaction should result in greater than 5 000 colonies if the entire LR reaction is transformed and plated Confirming the The ccdB gene mutates at a very low frequency resulting in a very low number of Expression Clone false positives True expression clones will be chloramphenicol sensitive and ampicillin and Blasticidin resistant Transformants containing a plasmid with a mutated ccdB gene will be chloramphenicol ampicillin and Blasticidin resistant To check your putative expression clone test for growth on LB plates containing 30 ug mL chloramphenicol A true expression clone should not grow in the presence of chloramphenicol 19 Analyzing Transformants Introduction Experimental Outline 20 Analyze the transformants using restriction digestion as described below even if you have observed a successful LR recombination This allows you to confirm the presence of the
76. onse element RRE Permits Rev dependent expression of the gag and pol genes Human f globin polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin of replication ori Permits high copy replication and maintenance in E coli Ampicillin bla resistance gene Allows selection of the plasmid in E coli 57 Map and Features of pLP2 pLP2 Map The figure below shows the features of the pLP2 vector The sequence of pLP2 is 58 available at www invitrogen com or by contacting Technical Support see page 65 Comments for pLP2 4180 nucleotides RSV enhancer promoter bases 1 271 TATA box bases 200 207 Transcription initiation site base 229 RSV UTR bases 230 271 HIV 1 Rev ORF bases 391 741 HIV 1 LTR polyadenylation signal bases 850 971 bla promoter bases 1916 2014 Ampicillin bla resistance gene bases 2015 2875 pUC origin bases 3020 3693 Continued on next page Map and Features of pLP2 Continued Features of pLP2 4 180 bp contains the following elements All features have been pLP2 functionally tested Feature Benefit RSV enhancer promoter Permits high level expression of the rev gene Gorman et al 1982 HIV 1 Rev ORF Encodes the Rev protein that interacts with the RRE on pLP1 and on the pLenti6 capTEV DEST expression vector to induce Gag and Pol expression which promotes the nuclear export of
77. or samples with high DNA content pretreat the samples with benzonase Electrophoresis endonuclease to reduce protein streaking as follows 1 To the sample from Step 6 of the lysis treatment above add MgCl to a final concentration of 2 mM and 1 2 units of benzonase per uL of sample Mix well and incubate at room temperature for 30 60 minutes Centrifuge the lysate at 20 000 x g for 30 minutes at 4 C For NativePAGE electrophoresis add NativePAGE Sample Buffer 4X to obtain a final concentration of 1X in the sample Do not heat the samples Load the samples onto the NativePAGE Gel and load NativeMark Unstained Protein Standard page 64 Perform electrophoresis using the conditions listed in the NativePAGE manual SDS PAGE 1 To the sample from Step 6 of Preparing Cell Lysate Under Native Conditions above add NuPAGE LDS Sample Buffer 4X or Tris Glycine SDS Sample Buffer 2X to obtain a final concentration of 1X in the sample Add reducing agent DTT to a final concentration of 50 mM Heat the samples at 85 C for 2 5 minutes Load the samples onto the SDS gel and load an appropriate molecular weight standard Perform electrophoresis using the conditions listed in the manual supplied with the gel Continued on next page 41 Detecting Protein Biotinylation and Complex Formation Continued Western Analysis Expected Results The Next Steps 42 Perform western blotting with nitrocellulos
78. or use and handling of lentiviruses may vary at individual institutions consult the health and safety guidelines and or officers at TM your institution prior to use of the NativePure Lentiviral Expression System Experimental Outline Experimental Steps to create lentivirus stocks to express and analyze your recombinant Outline biotinylated proteins of interest in the mammalian cell lines of choice are outlined below Step Action 1 Clone the gene of interest with and without a stop codon into a Gateway entry vector to create two entry clones 2 Generate two expression clones N and C terminally tagged by performing LR recombination reactions between the appropriate entry clones and the pLenti6 capTEV NT DEST1 and pLenti6 capTEV CT DEST vectors Optional Transiently transfect your expression clones into a mammalian cell line of choice and analyze cell lysate to confirm in vivo biotinylation of recombinant protein by SDS PAGE and detection on a western blot using a streptavidin conjugate 3 Co transfect each expression clone with the optimized packaging plasmid mix separately into the 293FT Cell Line to produce two lentivirus stocks Titer the two lentiviral stocks Use the two lentiviral stocks to separately transduce a mammalian cell line of interest 6 Analyze cell lysate to confirm in vivo biotinylation of recombinant protein by SDS PAGE and detection on a western blot using a streptavi
79. organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by academic and government organizations without royalty payment to Invitrogen Organizations other than academia and government may also distribute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction This should allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technology including Gateway clones for purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 References Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450
80. orming LR recombination reactions between the appropriate entry clones and pLenti6 capTEV DEST vectors For more information on the Gateway Technology refer to the Gateway Technology with Clonase II manual see www invitrogen com or contact Technical Support page 65 A control plasmid containing the ARPC2 actin protein complex component p34 Robinson et al 2001 gene fused to the capTEV Tag at the C terminal end is included for use as a positive control for lentivirus production and as an expression control in the mammalian cell line of choice For a map see page 55 Producing Lentivirus How Lentivirus Works VSV Envelope Glycoprotein ViraPower Packaging Mix 293FT Cell Line Lentiviral Expression Techniques Once the lentivirus enters the target cell the viral RNA is reverse transcribed actively imported into the nucleus Lewis amp Emerman 1994 Naldini 1999 and stably integrated into the host genome Buchschacher amp Wong Staal 2000 Luciw 1996 After the lentiviral construct has integrated into the genome you may assay for transient expression of the recombinant protein or use antibiotic selection to generate a stable cell line for long term expression studies Most retroviral vectors are limited in their usefulness as gene delivery vehicles by their restricted tropism and generally low titers In the NativePure Lentiviral Expression System this limitation has been overcome by use
81. ot freeze thaw viral supernatant more than 3 times Poor choice of titering cell line Use HT1080 cells Gene of interest is large Viral titers generally decrease as the size of the insert increases inserts larger than 6 kb are not recommended Gene of interest is toxic to cells Do not generate constructs containing activated oncogenes or potentially harmful genes Polybrene not included during Transduce the lentiviral construct into cells in transduction the presence of Polybrene Lipofectamine 2000 handled e Store at 4 C Do not freeze incorrectly e Mix gently by inversion before use Do not vortex No colonies obtained Too much Blasticidin used for upon titering selection Determine the Blasticidin sensitivity of your cell line by performing a kill curve experiment Use the minimum antibiotic concentration required to kill your untransduced cell line Viral stocks stored incorrectly Aliquot and store stocks at 80 C Do not freeze thaw more than 3 times Polybrene not included during transduction Transduce the lentiviral construct into cells in the presence of Polybrene Titer indeterminable Too little antibiotic used for cells confluent selection Increase amount of antibiotic used for selection Viral supernatant not diluted sufficiently Titer lentivirus using a wider range of 10 fold serial dilutions e g 10 to 10 Continued o
82. ountries for internal research purposes only Use of these cell lines for Commercial Purposes requires a license from Life Technologies Continued on next page Purchaser Notification Continued Limited Use Label License No 317 LentiVector Technology Limited Use Label License No 358 Research Use Only This product is licensed under U S Pat Nos 5 817 491 5 591 624 5 716 832 6 312 682 6 669 936 6 235 522 6 924 123 and foreign equivalents from Oxford BioMedica UK Ltd Oxford UK and is provided for use in academic and commercial in vitro and in vivo research for elucidating gene function and for validating potential gene products and pathways for drug discovery and development but excludes any use of LentiVector technology for creating transgenic birds for the purpose of producing useful or valuable proteins in the eggs of such transgenic birds the delivery of gene therapies and for commercial production of therapeutic diagnostic or other commercial products not intended for research use where such products do not consist of or incorporate a lentiviral vector Information about licenses for commercial uses excluded under this license is available from Oxford BioMedica UK Ltd Medawar Centre Oxford Science Park Oxford OX4 4GA UK enquiries oxfordbiomedica co uk or BioMedica Inc 11622 EI Camino Real 100 San Diego CA 92130 2049 USA LentiVector is a registered US and European Community trade mark of Oxford Bio
83. placed with fresh complete media e Your titered lentiviral stocks store at 80 C until use e Mammalian cell line of choice e Complete culture medium for your cell line e 6mg mL Polybrene if desired see page 32 e Appropriately sized tissue culture plates for your application Components supplied with the NativePure Lentiviral Expression Kit and the NativePure Lentiviral Expression and Affinity Purification System e Blasticidin 10 mg mL stock if selecting for stably transduced cells Continued on next page Transducing Cells with Lentivirus Continued Transduction Procedure Plate the mammalian cell line of choice in complete media as appropriate for your application On the day of transduction Day 1 thaw your lentiviral stock and dilute if necessary the appropriate amount of virus at a suitable MOI into fresh complete medium Keep the total volume of medium containing virus as low as possible to maximize transduction efficiency DO NOT vortex Remove the culture medium from the cells Mix the medium containing virus gently by pipetting and add to the cells If using Polybrene see page 31 add the optimized amount to each well for a final concentration of up to 10 ug mL Swirl the plate gently to mix Incubate at 37 C in a CO incubator overnight Note If you are transducing cells with undiluted viral stock and are concerned about possible toxicity or growth effects caused by overnight incubatio
84. r lentiviral stock prior to use e Number of freeze thaw cycles Viral titers can decrease as much as 10 with each freeze thaw cycle e Improper storage of your lentiviral stock Lentiviral stocks should be stored at 80 C in cryovials We strongly recommend the human fibrosarcoma line HT1080 ATCC Cat no CCL 121 as the gold standard for reproducibly titering lentivirus However you may wish to use the same mammalian cell line to titer your lentiviral stocks as you will use to perform your expression studies e 2 if you are performing expression studies in a dividing cell line or a non primary cell line For more information on cells for titering see Factors Affecting Viral Titer above Continued on next page Titering Lentiviral Stocks Continued Antibiotic Selection Preparing Blasticidin Determining Antibiotic Sensitivity Using Polybrene During Transduction The pLenti6 capTEV expression constructs contain the Blasticidin resistance gene bsd Kimura et al 1994 to allow for Blasticidin selection Takeuchi et al 1958 Yamaguchi et al 1965 of mammalian cells that have stably transduced the lentiviral construct Blasticidin is available separately or as part of the ViraPower Bsd Lentiviral Support Kit see page 62 for ordering information For more information about how to prepare and handle Blasticidin refer to the Appendix page 50 Since you will be selecting for stably tra
85. r stable transformants using Blasticidin selection are provided below e Your titered lentiviral stocks store at 80 C until use e Mammalian cell line of choice e Complete culture medium for your cell line e 6mg mL Polybrene if desired see page 31 e Appropriately sized tissue culture plates for your application Components supplied with the NativePure Lentiviral Expression Kit and the NativePure Lentiviral Expression and Affinity Purification System e Blasticidin see page 35 Plate cells in complete media as appropriate for your application 2 Onthe day of transduction Day 1 thaw your lentiviral stock and dilute if necessary the appropriate amount of virus at a suitable MOI into fresh complete medium Keep the total volume of medium containing virus as low as possible to maximize transduction efficiency DO NOT vortex 3 Remove the culture medium from the cells Mix the medium containing virus gently by pipetting and add to the cells 4 If using Polybrene see page 31 add the optimized amount to each well for a final concentration of up to 10 ug mL Swirl the plate gently to mix Incubate at 37 C in a CO incubator overnight Note If you are transducing cells with undiluted viral stock and are concerned about possible toxicity or growth effects caused by overnight incubation it is possible to incubate cells for as little as 6 hours prior to changing medium 5 The following day Day 2 remove the
86. r to www invitrogen com or contact Technical Support see page 65 Product Amount Cat no NuPAGE Novex Bis Tris Gels varies multiple Novex Tris Glycine Gels varies multiple NuPAGE MOPS SDS Running Buffer 20X 500 mL NP0001 NuPAGE MES SDS Running Buffer 20X 500L NP0002 NuPAGE LDS Sample Buffer 4X 10 mL NP0007 NuPAGE Sample Reducing Agent 10X 250 uL NP0004 NuPAGE Transfer Buffer 20X 1L NP0006 1 HiMark Pre Stained Protein Standard 250 pL LC5699 Novex Tris Glycine SDS Running Buffer 10X 500 mL LC2675 Novex Tris Glycine SDS Sample Buffer 2X 20 mL LC2676 Nitrocellulose 0 45 um Membrane Filter Paper Sandwiches 20 sandwiches LC2001 Invitrolon PVDF 0 45 um Membrane Filter Paper Sandwiches 20sandwiches LC2005 Continued on next page 63 Additional Products continued Products for Native Protein Analysis Products for Protein Detection 64 A complete range of products for purification of native protein complexes and analysis using native gel electrophoresis is available For more information refer to www invitrogen com or contact Technical Support see page 65 Product Amount Cat no NativePure Affinity Purification Kit 1kit BN3003 NativeMark Unstained Protein Standard 5 x 50 uL LC0725 NativePAGE Novex 3 12 Bis Tris Gels 10 well 10 gels BN1001BOX NativePAGE Novex 3 12 Bis Tris Gels 15 we
87. rials Needed 36 In general we have found that 80 90 of the cells in an actively dividing cell line e g HT1080 express a target gene when transduced at an MOI of 1 Some non dividing cell types are transduced with lentiviral constructs less efficiently For example only about 5076 of the cells in a culture of primary human fibroblasts express a target gene when transduced at an MOI of 1 If you are transducing your lentiviral construct into a non dividing cell type you may need to increase the MOI to achieve optimal expression levels for your recombinant protein If you have generated a lentiviral stock of an expression control e g pLenti6 capTEV CT GW ARPC2 use the stock to help you determine the optimal MOI for your particular cell line and application A control lentiviral vector containing EmGFP pLenti6 2 GW EmGFP for optimizing MOI using fluorescence detection is available separately page 62 Remember that lentiviral stocks are generated by harvesting spent media containing virus from the 293FT producer cells Spent media lacks nutrients and may contain some toxic metabolic waste products If you are using a large volume of viral supernatant to transduce your mammalian cell line e g 1 mL of viral supernatant per well in a 6 well plate note that growth characteristics or morphology of the cells may be affected during transduction These effects are generally alleviated after transduction when the media is re
88. rmining Antibiotic Sensitivity for Your Cell Line Multiplicity of Infection MOI Determining the Optimal MOI Once you have generated lentiviral stocks with suitable titers transduce the lentiviral constructs into the mammalian cell line of choice and assay your recombinant proteins Guidelines are provided below Your lentiviral constructs contain a deletion in the 3 LTR that leads to self inactivation of the lentivirus after transduction into mammalian cells Once integrated into the cellular genome the lentivirus can no longer produce packageable virus After transducing lentiviral constructs into the mammalian cell line of choice you can e Pool a heterogeneous population of cells and confirm biotinylation of your protein of interest and the ability of the tagged protein to form complexes directly after transduction i e transient expression Note that you must wait for a minimum of 48 72 hours after transduction before harvesting your cells to allow expressed protein to accumulate in transduced cells e After selecting the optimal in vivo biotinylated protein and the ability of the tagged protein to form complexes in your cell line select for stably transduced cells using Blasticidin This requires a minimum of 10 12 days following transduction but allows generation of clonal cell lines that stably express the gene of interest see page 45 To select for stably transduced cells first determine the
89. rotein VSV G Encodes the envelope G glycoprotein from Vesicular Stomatitis Virus to allow production of a pseudotyped retrovirus with a broad host range Burns et al 1993 Emi et al 1991 Yee et al 1994 Human f globin polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin of replication ori Permits high copy replication and maintenance in E coli Ampicillin bla resistance gene Allows selection of the plasmid in E coli 61 Additional Products Accessory Some of the reagents supplied in the NativePure Lentiviral Expression System Products as well as other products suitable for use with the kits are available separately For more information refer to www invitrogen com or contact Technical Support see page 65 Product Amount Cat no pENTR D TOPO Cloning Kit 20 reactions K2400 20 pCR 8 GW TOPO TA Cloning Kit 20 reactions K2520 20 Gateway LR Clonase II Enzyme Mix 20 reactions 11791 020 One Shot Stb13 Chemically Competent E coli 20 x 50 pL C7373 03 One Shot ccdB Survival 2 T1 Chemically Competent Cells 10 transformations A10460 LB Media 500 mL 10855 021 Ampicillin 200 mg 11593 027 Carbenicillin 5g 10177 012 PureLink HQ Plasmid Miniprep Kit 100 reactions K2100 01 PureLink HiPure Plasmid DNA Purification MidiPrep Kit 25 reactions
90. rrect antibiotic used to select for transformants Check the antibiotic resistance marker and use the correct antibiotic to select for entry clones or expression clones Recombination reactions were not treated with Proteinase K Treat reactions with Proteinase K before transformation Too much entry clone was used in an LR reaction Use equal fmol of destination vector and entry clone High background in the absence of the entry clone LR reaction transformed into an E coli strain containing the F episome and the ccdA gene Use One Shot Stbl3 Chemically Competent E coli Few or no colonies obtained from the transformation control Competent cells stored incorrectly Store competent cells at 80 C Loss of transformation efficiency due to repeated freeze thawing Once you have thawed a tube of competent cells discard any unused cells Generating the Lentiviral Stock The table below lists some potential problems and possible solutions that may help you troubleshoot your cotransfection and titering experiments Problem Reason Solution Low viral titer Low transfection efficiency e Used poor quality expression construct plasmid DNA i e plasmid DNA from a mini prep e Unhealthy 293FT cells cells exhibit low viability e Cells transfected in media containing antibiotics i e Geneticin e Plasmid DNA transfection reagent ratio incorrect e
91. s Guidelines and protocols are provided in this section to titer your lentiviral stocks To determine the titer of lentiviral stocks you will 1 Prepare 10 fold serial dilutions of your lentiviral stocks 2 Transduce the different dilutions of lentivirus in the presence of the polycation Polybrene into a mammalian cell line HT1080 is recommended 3 Select for stably transduced cells using Blasticidin Stain and count the number of Blasticidin resistant colonies in each dilution A number of factors can influence viral titers including e The size of your gene of interest Titers will generally decrease as the size of the insert increases The size of the wild type HIV 1 genome is approximately 10 kb Since the size of the elements required for expression from pLenti6 capTEV vectors total approximately 4 kb the size of your gene of interest should theoretically not exceed 6 kb for efficient packaging e The characteristics of the cell line used for titering We strongly recommend the human fibrosarcoma line HT1080 as the gold standard for reproducibly titering lentivirus However other cell lines may be used In general these cells should be an adherent non migratory cell line and exhibit a doubling time in the range of 18 25 hours e The age of your lentiviral stock Viral titers may decrease with long term gt 1 year storage at 80 C If your lentiviral stock has been stored for longer than 6 months titer you
92. s and Storage Continued NativePure The following reagents are included in the NativePure AcTEV Protease Module ACTEV Protease supplied with Cat nos BN3005 and BN3007 only Store at 20 C Module Reagent Composition Amount AcTEV Protease 10 U pL AcTEV Protease in 400 pL 50 mM Tris HCI pH 7 5 1 mM EDTA 5 mM DTT 50 v v glycerol 0 1 w v Triton X 100 100 mM DTT 100 mM DTT in deionized water 500 pL viii Introduction System Summary Description of the System NativePure Lentiviral Expression System The NativePure Lentiviral Expression System includes NativePure Lentiviral Gateway Vectors and the NativePure Affinity Purification Kit The NativePure Lentiviral Vectors allow the creation of a replication incompetent HIV 1 based lentivirus with your gene of interest as an N or C terminal biotinylated fusion using Gateway Technology see page 6 for details on Gateway Technology After lentiviral transduction into a mammalian cell line of choice the NativePure Lentiviral Gateway Vectors allow in vivo biotinylation and expression of the biotin tagged protein of interest bait The biotin tagged recombinant protein bait can be used to identify novel proteins that specifically interact with the protein of interest or to test complex formation between proteins or protein domains for which there is a prior reason to expect an interaction TM
93. s at these positions provides moderate consensus while having neither results in weak consensus The ATG initiation codon is shown underlined G ANNATGG Creating N and C Terminal Tagged Expression Clones Introduction Experimental Outline Important After generating an entry clone you will perform LR recombination reactions to transfer the gene of interest into the pLenti6 capTEV DEST vectors to create your expression clones See the next pages for illustrations of the recombination regions of expression clones in pLenti6 capTEV CT DEST and pLenti6 capTEV NT DESTI vectors To ensure that you obtain the best possible results read this section and the sections entitled Performing the LR Recombination Reaction pages 16 17 and Transforming One Shot Stb13 Competent E coli pages 18 19 before beginning To generate expression clones 1 Perform LR recombination reactions using the attL containing entry clones TM and the attR containing pLenti6 capTEV DEST vectors Note Both entry clones and destination vectors should be supercoiled TM 2 Transform the reaction mixtures separately into One Shot Stbl3 Competent E coli Chemically 3 Select for expression clones TM Do not propagate the pLenti6 capTEV DEST vectors due to the possibility of unwanted recombination The amount of each plasmid supplied is sufficient for 40 reactions For ordering information to purchase these plasmids separat
94. s production you may transfect your expression constructs Transfection separately into a mammalian cell line of choice to determine protein expression biotinylation and complex formation Perform transient transfection using any method of choice and analyze cells as described in Detecting Protein Biotinylation and Complex Formation page 38 23 Producing Lentivirus in 293FT Cells Introduction 293FT Cell Line Positive Control 24 To produce lentiviral stocks containing the packaged pLenti expression constructs cotransfect the optimized packaging plasmid mix and your pLenti expression constructs into the 293FT Cell Line The following section provides protocols and instructions to generate lentiviral stocks TM The human 293FT Cell Line is supplied with NativePure Lentiviral Expression Kits Cat nos BN3004 and BN3007 also available separately to facilitate optimal lentivirus production Naldini et al 1996 The 293FT Cell Line a derivative of the 293F Cell Line stably and constitutively expresses the SV40 large T antigen from pCMVSPORT6TAg neo and must be maintained in medium containing Geneticin For more information about pCMVSPORT6TAg neo and how to culture and maintain 293FT cells refer to the 293FT Cell Line manual This manual is supplied with the NativePure Lentiviral Expression kits and is also available from www invitrogen com or by contacting Technical Support see page 65 The hea
95. se Label License No 22 Vectors and Clones Encoding Histidine Hexamer Limited Use Label License No 51 Blasticidin and the Blasticidin Selection Marker Limited Use Label License No 54 ULB ccdB Selection Technology Limited Use Label License No 108 Lentiviral Technology Limited Use Label License No 109 Retroviral Helper Lines 66 This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany Blasticidin and the blasticidin resistance gene bsd are the subject of U S Patent No 5 527 701 sold under patent license for research purposes only For inform ation on purchasing a license to this product for purposes other than research contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 This product is the subject of one or more of U S Patent Numbers 5 910 438 6 180 407 and 7 176 029 and corresponding foreign patents and is sold under license from the Universit Libre de Bruxelles for research purposes only ccdB selection technology is described in Bernard et al Positive Selection Vectors Using the F Plasmid ccdB Killer Gene Gene 1
96. tect protein biotinylation e Native gel electrophoresis to detect protein complex formation 4 Develop the blots with streptavidin conjugate using the WesternBreeze Kits see page 64 for ordering information The cell lysate is prepared using mild conditions for lysis to enable analysis of protein complexes The cell lysis protocol included in this section allows you to use the same lysate for analysis using native non denaturing electrophoresis and denaturing SDS PAGE e Use freeze thaw cycles for cell lysis to obtain intact protein complexes Trypsin treatment or scraping the cells is not recommended as these methods cause cell damage and dissociation of protein complexes e If you have already performed trypsin treatment inactivate trypsin using medium with 10 FBS Wash cells three times with 1X PBS before lysing the cells e Perform cell lysis in the absence of NP40 as some protein complexes may be unstable in the presence of NP40 e During lysate preparation avoid vortexing the lysate as it can dissociate protein complexes e If your sample is in a SDS PAGE sample buffer prepare a fresh lysate without SDS using the protocol on page 41 for native electrophoresis Do not use SDS PAGE samples for native gel electrophoresis Continued on next page Detecting Protein Biotinylation and Complex Formation Continued Streptavidin Conjugates NativePAGE Gel Electrophoresis SDS PAGE Note Use the stron
97. th the capTEV Tag as shown on pages 14 15 Recombinant protein recovered but not as a complex N or C terminal tag interfering with complex formation Test both N and C terminal tagged constructs to determine the construct that results in optimal complex formation page 11 Complexes dissociated during lysate preparation To avoid dissociation of protein complexes e Perform cell lysis using freeze thaw cycles Avoid trypsinizing the cells or scraping the cells e Perform cell lysis in the absence of NP40 as some protein complexes may be unstable in the presence of NP40 e Avoid vortexing the lysate during lysate preparation e Perform all purification steps at 4 C and use chilled buffers Complexes unable to form in mammalian cell line of choice Optimize using another mammalian cell line Protein complexes not observed Protein degraded e Perform all purification steps at 4 C e Check to make sure that the CapTEV tag is not cleaved during processing or purification e Include protease inhibitors during cell lysis 49 Blasticidin Description Molecular Weight Formula and Structure Handling Blasticidin Preparing and Storing Stock Solutions 50 Appendix Blasticidin S HCl is a nucleoside antibiotic isolated from Streptomyces griseo chromogenes which inhibits protein synthesis in both prokaryotic and eukaryotic cells Resistance is conferr
98. the unspliced viral RNA for packaging into viral particles HIV 1 LTR polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA Ampicillin bla resistance gene Allows selection of the plasmid in E coli pUC origin of replication ori Permits high copy replication and maintenance in E coli 59 Map and Features of pLP VSVG pLP VSVG Map The figure below shows the features of the pLP VSVG vector The sequence of pLP VSVG is available at www invitrogen com or by contacting Technical Support see page 65 Comments for pLP VSVG 5821 nucleotides CMV promoter bases 1 747 TATA box bases 648 651 Human f globin intron bases 880 1320 VSV G glycoprotein VSV G bases 1346 2881 Human B globin polyadenylation signal bases 3004 3769 pUC origin bases 3927 4600 C Ampicillin bla resistance gene bases 4745 5605 C bla promoter bases 5606 5704 C C complementary strand Continued on next page 60 Map and Features of pLP VSVG Continued Features of pLP VSVG pLP VSVG 5 821 bp contains the following elements All features have been functionally tested Feature Benefit Human CMV promoter Permits high level expression of the VSV G gene in mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 Human f globin intron Enhances expression of the VSV G gene in mammalian cells VSV G glycop
99. tivePure Lentiviral Gateway Vector Kit Room temperature 20 C 2 ViraPower Bsd Lentiviral Support Kit e ViraPower Packaging Mix Blue ice 20 C e Lipofectamine 2000 Blue ice 4 C do not freeze e Blasticidin Room temperature 209C 3 One Shot Stb13 Chemically Competent E coli Dry ice 80 C 4 293FT Cell Line Dry ice Liquid nitrogen 5 Gateway LR Clonase II Enzyme Mix Dry ice 209C 6 NativePure Binding and Purification Module e Streptavidin Agarose Blue ice 4 C e 10 NP40 Blue ice 4 C e NativePure 5X Lysis Binding Buffer Blue ice 4 C e NativePure 10X TEV Buffer Blue ice 4 C e NativePure Columns Blue ice 4 C e NativePure Concentrators Blue ice 4 C 7 NativePure AcTEV Protease Module e AcTEV Protease Dry ice 209C e 100mM DTT Dry ice 20 C NativePure TM Each NativePure Lentiviral Kit contains the following vectors Store the vectors Lentiviral at 20 C Gateway Vectors Vector Composition Amount pLenti6 capTEV NT DESTI1 40 uL of vector at 150 ng pL in 10 mM Tris HCl 6 ug 1 mM EDTA pH 8 0 pLenti6 capTEV CT DEST 40 uL of vector at 150 ng uL in 10 mM Tris HCl 6 ug 1 mM EDTA pH 8 0 pLenti6 capTEV CT GW ARPC2 20 uL of vector at 500 ng pL in 10 mM Tris HCl 10 pg 1 mM EDTA pH 8 0 Continued on next page Kit Contents and Storage Continued ViraPower Bsd Lentiviral Support Kit Contents The ViraPower Bsd Len
100. tiviral Support Kit includes the following vectors and reagents Cat nos BN3004 and BN3007 only Important Do not freeze Lipofectamine 2000 store at 4 C Reagent Composition Amount ViraPower Packaging Mix Contains a mixture of the pLP1 pLP2 and pLP VSVG 195 ug plasmids 1 pg L in TE pH 8 0 Lipofectamine 2000 Proprietary 0 75 mL Blasticidin Powder 50 mg One Shot StbI3 Chemically Competent E coli Genotype of Stbl3 Cells 293FT Cell Line vi TE buffer pH 8 0 10 mM Tris HCl 1 mM EDTA pH 8 0 The following reagents are included with the One Shot Stb13 Chemically Competent E coli kit Cat nos BN3004 and BN3007 only Transformation efficiency is 2 1 x 10 cfu ug plasmid DNA Store at 80 C Reagent Composition Amount S O C Medium 2 Tryptone 6 mL 0 5 Yeast Extract 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose Stbl3 Cells 21 x 50 uL pUC19 Control DNA 10 pg uL in 5 mM Tris HCI 0 5 mM EDTA pH 8 0 50 uL F mcrB mrr hsdS20 rg mp recA13 supE44 ara 14 galK2 lacY1 proA2 rpsL20 Str xyl 5 X leu mtl 1 Note This strain is endA1 The 293FT Cell Line is supplied as one vial containing 3 x 10 frozen cells in 1 mL of Freezing Medium Cat nos BN3004 and BN3007 only Upon receipt store in liquid nitrogen For 293FT thawing culturing and maintenance instructions see the 293FT Cell Line manual
101. ual see page 62 for ordering information TM The NativePure Affinity Purification Kit contains the following components to allow purification of biotinylated proteins and associated protein complexes expressed from vectors containing the capTEV Tag e Streptavidin Agarose e NativePure Columns e Pre made ready to dilute lysis binding and cleavage buffers e AcTEV Protease TM e NativePure Concentrators Continued on next page System Summary Continued How the System Works Advantages of the NativePure Lentiviral Expression System To express your biotinylated protein of interest in mammalian cells construct both N and C terminally tagged expression clones by performing LR recombination reactions between Gateway entry vectors containing the gene of interest and the appropriate pLenti6 capTEV DEST vectors Since individual protein expression and biotinylation may vary with an N or C terminal fusion tag in your cell line it is necessary to construct both versions and determine which is best for your application The resulting expression plasmids are each co transfected with the ViraPower Packaging Mix in 293FT cells to produce two lentiviral stocks which are titered to determine the number of infectious particles Transduce your mammalian cells with the lentivirus to allow expression of biotinylated proteins and to allow complex formation Lyse the cells and use western analysis with a streptavid
102. umulate in transduced cells Gene of interest is toxic to cells Generating constructs containing activated oncogenes or potentially harmful genes is not recommended Cytotoxic effects observed after transduction Large volume of viral supernatant used for transduction e Remove the spent media containing virus and replace with fresh complete media e Concentrate the virus Yee 1999 Polybrene used during transduction Verify the sensitivity of your cells to Polybrene If cells are sensitive omit the Polybrene during transduction Too much antibiotic used for selection Determine the antibiotic sensitivity of your cell line by performing a kill curve Use the minimum concentration of antibiotic required to kill your untransduced cell line Gene of interest is toxic to cells Try a different cell line 48 Continued on next page Troubleshooting Continued Protein The table below lists some potential problems and solutions for troubleshooting Biotinylation and biotinylation and complex formation Complex Formation Problem Possible Cause Solution No biotinylation of Incorrect detection method Use streptavidin conjugated to alkaline recombinant protein observed phosphatase or horseradish peroxidase followed by western detection as described page 39 Gene of interest not in frame with capTEV Tag Make sure that the gene of interest is in frame wi
103. v dependent by virtue of the HIV 1 RRE in the gag pol mRNA transcript Addition of RRE prevents gag and pol expression in the absence of Rev Dull et al 1998 e A constitutive promoter RSV promoter has been placed upstream of the 5 LTR in the pLenti expression vector to offset the requirement for Tat in the efficient production of viral RNA Dull et al 1998 Continued on next page Biosafety Features Continued Biosafety Level 2 Important Despite the inclusion of the safety features discussed on the previous page the lentivirus produced with this system can still pose some biohazardous risk since it can transduce primary human cells For this reason we highly recommend that you treat lentiviral stocks generated using this System as Biosafety Level 2 BL 2 organisms and strictly follow all published BL 2 guidelines with proper waste decontamination Furthermore exercise extra caution when creating lentivirus carrying potential harmful or toxic genes e g activated oncogenes For more information about the BL 2 guidelines and lentivirus handling refer to the document Biosafety in Microbiological and Biomedical Laboratories 5 Edition published by the Centers for Disease Control CDC This document may be downloaded at the following address http www cdc gov od ohs biosfty bmbl5 bmbl5toc htm Handle all lentiviruses in compliance with established institutional guidelines Since safety requirements f
104. vides better biotinylation signal and demonstrates complex formation If you are performing purification of your protein of interest refer to the NativePure Affinity Purification manual available from www invitrogen com and supplied with Cat nos BN3005 and BN3007 Expected Results Introduction Protein Biotinylation Results Examples of results obtained by SDS PAGE and native gel electrophoresis followed by western blot detection to confirm biotinylation and native complex formation of a number of N and C terminally tagged proteins of interest are shown in this section N and C terminal NT and CT tagged expression clones for the following genes were constructed as described in this manual actin related protein complex component p34 ARPC2 Golgi associated protein Bet 3 B galactosidase LacZ and human proteosome subunit beta 2 PSMB2 Freestyle 293 cells were transiently transfected with the plasmid DNA using 293fectin At 24 hours post transfection cells were harvested and lysed using the protocol on page 41 Ten micrograms of post nuclear supernatant was electrophoresed per well on a 4 12 NuPAGE Novex Bis Tris gel Proteins were transferred to a nitrocellulose membrane 0 45 um and subjected to western detection using streptavidin alkaline phosphatase conjugate 1 4 000 and the WesternBreeze Chemiluminescent Kit 1 2 3 4 5 6 7 8 Lane 1 ARPC2 NT 47 4 kDa ee Lane 2 ARPC2 CT 49 4 kDa
105. ycoprotein causes 293FT cells to fuse resulting in the appearance of large multinucleated cells known as syncytia This morphological change is normal and does not affect production of the lentivirus Harvest virus containing supernatants 48 72 hours posttransfection Day 4 5 by removing medium into to a 15 mL sterile capped conical tube Minimal differences in viral yield are observed whether supernatants are collected 48 or 72 hours posttransfection Caution Remember that you are working with infectious virus at this stage Follow the recommended guidelines for working with BL 2 organisms see pages 8 and 32 for more information Centrifuge supernatants at 2 000 x g for 15 minutes at 4 C to pellet debris Filter the viral supernatants through a Millex HV 0 45 um or equivalent PVDF filter Pipet viral supernatants into cryovials in 1 mL aliquots Store viral stocks at 80 C Proceed to Titering Lentiviral Stocks page 30 Continued on next page 27 Producing Lentivirus in 293FT Cells Continued Reverse If you are an experienced user you may use the rapid procedure below to cotransfect Transfection 293FT cells We recommend including a negative control no DNA no Lipofectamine Procedure 2000 in your experiment to help evaluate results You will need 6 x 10 293FT cells for each sample 1 On Day 1 prepare DNA Lipofectamine 2000 complexes for each transfection sample as follows a Ina sterile 5 mL tube comb

NativePure™ Lentiviral Expression System

Contents

Download Pdf Manuals

Related Search

Related Contents

NativePure&trade; Lentiviral Expression System

Contents

Download Pdf Manuals

Related Search

Related Contents

NativePure™ Lentiviral Expression System