Home

pLenti6/V5 Directional TOPO® Cloning Kit

1. TM when Stbl3 E coli are used for transformation You will perform TOPO Cloning in a reaction buffer containing salt i e using the stock salt solution provided in the kit Use the stock Salt Solution as supplied and set up the TOPO Cloning reaction as directed below Performing the TOPO Cloning Reaction continued Performing the TOPO Cloning Reaction Use the procedure below to perform the TOPO Cloning reaction Reminder For optimal results be sure to use a 0 5 1 to 2 1 molar ratio of PCR product TOPO vector in your TOPO Cloning reaction Note The blue color of the TOPO vector solution is normal and is used to visualize the solution Reagents Amount Fresh PCR product 0 5 to 4 pl Salt Solution 1 ul Dilute Salt Solution 1 4 Water TOPO vector add to a final volume of 5 ul Tul Total volume 6 ul Store all reagents at 20 C when finished Salt solution and water can be stored at room temperature or 4 C 1 Mix reaction gently and incubate for 5 minutes at room temperature 22 23 C Note For most applications 5 minutes will yield plenty of colonies for analysis Depending on your needs the length of the TOPO Cloning reaction can be varied from 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may be sufficient For large PCR products 1 3 kb or if you are TOPO Cloning a pool of PCR products increasing the reaction t
2. Make sure that the reverse PCR primer does not contain the sequence CACC at the 5 end Large number of incorrect inserts cloned PCR cloning artifacts Gel purify your PCR product to remove primer dimers and smaller PCR products Optimize your PCR Include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Incorrect PCR primer design Make sure that the forward and reverse PCR primers are designed correctly Different sized colonies i e large and small appear when using TOP10 E coli for transformation Some transformants contain plasmids in which unwanted recombination has occurred between 5 and 3 LTRs Do not use TOP10 E coli for transformation Use the One Shot Stb13 Chemically Competent E coli supplied with the kit for transformation Stb13 E coli are recommended for cloning unstable DNA including lentiviral DNA containing direct repeats and generally do not give rise to unwanted recombinants Few or no colonies obtained from sample reaction and the transformation control gave no colonies One Shot competent E coli stored incorrectly Store One Shot competent E coli at 80 C If you are using another E coli strain follow the manufacturer s instructions Did not perform the 1 hour grow out period before plating the transformation mixture After the heat shock step add S O C Medium and in
3. enhancer promoter for Tat independent production of viral mRNA in the producer cell line Dull et al 1998 e Modified HIV 1 5 and 3 Long Terminal Repeats LTR for viral packaging and reverse transcription of the viral mRNA Dull et al 1998 Luciw 1996 Note The U3 region of the 3 LTR is deleted AU3 and facilitates self inactivation of the 5 LTR to enhance the biosafety of the vector Dull et al 1998 e HIV 1 psi Y packaging sequence for viral packaging Luciw 1996 e HIV Rev response element RRE for Rev dependent nuclear export of unspliced viral mRNA Kjems et al 1991 Malim et al 1989 Human cytomegalovirus CMV immediate early promoter for high level constitutive expression of the gene of interest in a wide range of mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 e Directional TOPO Cloning site for rapid and efficient directional cloning of blunt end PCR products see page 3 for more information e C terminal V5 epitope for detection of the recombinant protein of interest Southern et al 1991 e Blasticidin bsd resistance gene for selection in E coli and mammalian cells Izumi et al 1991 Kimura et al 1994 Takeuchi et al 1958 Yamaguchi et al 1965 e Ampicillin resistance gene for selection in E coli e pUC origin for high copy replication and maintenance of the plasmid in E coli The control plasmid pLenti6 V5 GW lacZ is included for use as a po
4. 5 mM dCTP 12 5 mM dGTP 12 5 mM dTTP in water pH 8 Salt Solution 1 2 M NaCl 50 ul 0 06 M MgCl Water 1 ml CMV Forward Sequencing 0 1 us ul in TE Buffer pH 8 20 pl Primer V5 C term Reverse 0 1 ug ul in TE Buffer pH 8 20 ul Sequencing Primer Control PCR Primers 0 1 ug ul each in TE Buffer pH 8 10 ul Control PCR Template 0 1 ug ul in TE Buffer pH 8 10 ul pLenti6 V5 GW lacZ Lyophilized in TE Buffer pH 8 10 ug continued on next page Kit Contents and Storage continued Sequences of the Primers One Shot StbI3 Chemically Competent E coli Genotype of StbI3 Cells ViraPower Bsd Lentiviral Support Kit and 293FT Cell Line The table below provides the sequences of CMV Forward and V5 C term Reverse sequencing primers Two micrograms of each primer are supplied Primer Sequence CMV Forward 5 CGCAAATGGGCGGTAGGCGTG 3 V5 C term Reverse 5 ACCGAGGAGAGGGTTAGGGAT 3 The table below lists the items included in the One Shot Stbl3 Chemically Competent E coli kit Box 2 Transformation efficiency is gt 1 x 10 cfu ug plasmid DNA Store Box 2 at 80 C mM EDTA pH 8 Reagent Composition Amount S O C Medium 2 Tryptone 6 ml may be stored at 4 C or 0 5 Yeast Extract room temperature 10 mM NaCl 2 5 mM KCl 10 mM MsCh 10 mM MgSO 20 mM glucose Stb13 Cells 21 x 50 ul pUC19 Control DNA 10 pg ul in 5 mM Tris
5. For the pLenti6 V5 D TOPO vector using 1 5 ng of a 1 kb PCR product or 5 10 ng of a 2 kb PCR product in a TOPO Cloning reaction generally results in a suitable number of colonies 100 50 Relative Activity colonies reaction 0 0 1 1 10 PCR Product Vector Molar Ratio Performing the TOPO Cloning Reaction Introduction Recommended E coliHost Using Salt Solution in the TOPO Cloning Reaction 10 Once you have produced the desired blunt end PCR product you are ready to TOPO Clone it into the pLenti6 V5 D TOPO vector and transform the recombinant vector into competent E coli You should have everything you need set up and ready to use to ensure that you obtain the best possible results We suggest that you read this section and the section entitled Transforming One Shot Competent E coli page 12 before beginning If this is the first time you have TOPO Cloned perform the control reactions on pages 25 26 in parallel with your samples For optimal results we recommend using Stb13 E coli for transformation as this strain is particularly well suited for use in cloning unstable DNA such as lentiviral DNA containing direct repeats One Shot Stbl3 Chemically Competent E coli are included in the kit for transformation For instructions see One Shot Stb13 Chemical Transformation Procedure page 13 Note that transformants containing unwanted recombinants are generally not obtained
6. continued on next page Map and Features of pLenti6 V5 D TOPO continued Features of pLenti6 V5 D TOPO 6963 bp contains the following elements Features have pLenti6 V5 D been functionally tested TOPO Feature Benefit Rous Sarcoma Virus RSV Allows Tat independent production of viral mRNA Dull enhancer promoter et al 1998 HIV 1 truncated 5 LTR Permits viral packaging and reverse transcription of the viral mRNA Luciw 1996 5 splice donor and 3 acceptors Enhances the biosafety of the vector by facilitating removal of the Y packaging sequence and RRE such that expression of the gene of interest in the transduced host cell is no longer Rev dependent Dull et al 1998 HIV 1 psi y packaging signal Allows viral packaging Luciw 1996 HIV 1 Rev response element RRE Permits Rev dependent nuclear export of unspliced viral mRNA Kjems et al 1991 Malim et al 1989 Human CMV promoter Permits high level expression of the gene of interest Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 CMV forward priming site Permits sequencing of the insert TOPO Cloning site directional Permits rapid directional cloning of your PCR product V5 epitope Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Allows detection of your recombinant protein with the Anti V5 antibodies Southern et al 1991 V5 C term reverse prim
7. of the ORF Note that you will need to replace the stop codon with a codon for an innocuous amino acid such as glycine alanine or lysine continued on next page Designing PCR Primers continued Example 2 of Reverse Primer Design Important e TOPO Cloning is underlined GCG GTT AAG TCG GAG CAC TCG ACG ACT GCA TAG 3 e To fuse the ORF in frame with the C terminal tag in pLenti6 V5 D TOPO remove the stop codon by starting with nucleotides homologous to the last codon TGC and continue upstream The reverse primer will be 5 TGC AGT CGT CGA GTG CTC CGA CTT 3 Below is the sequence for the C terminus of a theoretical protein The stop codon This will amplify the C terminus without the stop codon and allow you to join the ORF in frame with the C terminal tag e Ifyou don t want to join the ORF in frame with a C terminal tag simply design the reverse primer to include the stop codon 5 CTA TGC AGT CGT CGA GTG CTC CGA CTT 3 e Remember that pLenti6 V5 D TOPO accepts blunt end PCR products into the pLenti6 V5 D TOPO vector e We recommend that you gel purify your oligonucleotides especially if they are long gt 30 nucleotides Do not add 5 phosphates to your primers for PCR This will prevent ligation Use the diagram below to help you design suitable PCR primers to clone your PCR product into pLenti6 V5 D TOPO Restriction sites are labeled to indicate the actual cleavage
8. site Note that pLenti6 V5 D TOPO is supplied linearized with both ends adapted with topoisomerase I see diagram on page 30 The sequence of pLenti6 V5 D TOPO is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 34 For more information about the features of pLenti6 V5 D TOPO see the Appendix pages 3 end of CMV promoter TATA r 1 aul TGACGCAAAT GGGCGGTAGG CGTGTACGGT GGGAGGTCTA TATAAGCAGA GCTCGTTTAG BamH Spe I I TGACCTCCAT AGAAGACACC GACTCTAGAG GATCCACTAG Site for pLenti6 V5 D TOPO 30 31 CAAT CMV forward priming site 2251 TCGTAACAAC TCCGCCCCAT Transcriptional start 2331 TGAACCGTCA GATCGCCTGG AGACGCCATC CACGCTGTTT BstX Xho 1 2411 TCCAGTGTGG TGGAATTGAT CCCTTIONCO Vic AAG GGC TCG AGT CTA GGGAAG TCS mee TTC CCG AGC TCA Lys Gly Ser Ser V5 epitope V5 C term reverse priming site 1 2476 AAG CCT ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT ACG CGT Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg 2541 TTAATTCTGT CTA GAG Leu Glu ACC GGT Thr Gly Apal Sacil GGC CCG CGG Gly Pro Arg TAG TAA TGA KKK KKK KKK Sfu I VE TTC GAA GGT Phe Glu Gly GTTTGGAA Producing Blunt End PCR Products Introduction Materials Supplied by the User Producing Blunt End PCR Products Checking the PCR Product Once you have decided on a PCR strategy and have synthesized the primers produce your b
9. that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing
10. 19 control dilute the transformation mix 1 10 into LB Medium e g add 100 ul of the transformation mix to 900 ul of LB Medium and plate 25 100 ul Store the remaining transformation mix at 4 C Plate out additional cells the next day if desired An efficient TOPO Cloning reaction may produce several hundred colonies Pick 10 20 colonies for analysis see Analyzing Transformants next page 13 Analyzing Transformants Introduction Experimental Outline 14 We recommend analyzing the transformants using both restriction digestion and sequencing or PCR analysis as described below This allows you to confirm the presence of the insert as well as ensure the absence of any aberrant lentiviral vector recombination between the LTRs Note PCR screening of clones should never be used in place of restriction analysis For example clones that contain both correct and aberrantly recombined DNA may look positive by PCR but may not be optimal for lentivirus production You will screen colonies by performing miniprep and restriction analysis to validate the clones You may also perform PCR analysis or sequencing of your clones with the primers provided to determine that your insert is in the correct orientation and is in frame with the V5 epitope tag After verifying the correct clones you will use the miniprep DNA to re transform Stb13 E coli You will then isolate plasmid DNA for transfection and lentivirus production Plasmid
11. 471 Izumi M Miyazawa H Kamakura T Yamaguchi I Endo T and Hanaoka F 1991 Blasticidin S Resistance Gene bsr A Novel Selectable Marker for Mammalian Cells Exp Cell Res 197 229 233 Kimura M Takatsuki A and Yamaguchi I 1994 Blasticidin S Deaminase Gene from Aspergillus terreus BSD A New Drug Resistance Gene for Transfection of Mammalian Cells Biochim Biophys ACTA 1219 653 659 Kjems J Brown M Chang D D and Sharp P A 1991 Structural Analysis of the Interaction Between the Human Immunodeficiency Virus Rev Protein and the Rev Response Element Proc Natl Acad Sci USA 88 683 687 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biology 115 887 903 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Luciw P A 1996 Human Immunodeficiency Viruses and Their Replication In Fields Virology B N Fields D M Knipe P M Howley R M Chanock J L Melnick T P Monath B Roizman and S E Straus eds Philadelphia PA Lippincott Raven Publishers pp 1881 1975 Malim M H Hauber J Le S Y Maizel J V and Cullen B R 1989 The HIV 1 Rev Trans activator Acts Through a St
12. 7 E mail tech_service invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com Material Data Safety Sheets MSDSs Limited Warranty 34 MSDSs Material Safety Data Sheets are available on our website at www invitrogen com msds Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents
13. DNA for transfection into 293FT cells must be very clean and free from contaminants and salts and should be isolated by midiprep or large scale DNA preparation Step Action 1 For each transformation pick 10 20 ampicillin resistant colonies from plating the transformation mix Culture cells overnight in LB medium containing 100 ug ml ampicillin 2 Isolate plasmid DNA for each colony using a miniprep kit see Important next page 3 Analyze the plasmids by restriction analysis to confirm the presence and orientation of your insert as well as the integrity of the vector Optional Sequence the plasmids to determine that your gene of interest is in frame with the C terminal V5 epitope tag 4 Re transform One Shot Stbl3 Chemically Competent E coli separately with the validated clones 5 Inoculate LB ampicillin with a fresh colony and grow for 6 8 hours to generate a starter culture 6 Inoculate the starter culture into at least 100 ml LB ampicillin and grow for 18 hours 7 Isolate plasmid DNA using a midiprep kit or large scale DNA preparation see Important next page for lentivirus production continued on next page Analyzing Transformants continued Important Restriction Digest Materials Needed Screening Colonies by Miniprep What You Should See TM Stb13 E coli is wild type for endonuclease 1 endA1 When performing plasmid DNA isolation with com
14. Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com Use of this product in conjunction with methods for the introduction of RNA molecules into cells may require licenses to one or more patents or patent applications Users of these products should determine if any licenses are required Blasticidin and the blasticidin resistance gene bsd are the subject of U S Patent No 5 527 701 sold under patent license for research purposes only For information on purchasing a license to this product for purposes other than research contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 email outlicensing invitrogen com continued on next page 35 Purchaser Notification continued Limited Use Label License No 108 Lentiviral Technology Limited Use Label License No 109 Retroviral Helper Lines 36 TM The Lentiviral Technology based upon the lentikat system is exclusively licensed from Cell Genesys Inc under U S Patent Nos 5 686 279 5 834 256 5 858 740 5 994 136 6 013 516 6 051 427 6 165 782 and 6 218 187 and corresponding patents and applications in other countries for internal research purposes only Use of this technology for gene therapy applications or bioprocessing other than for non human research
15. HCl 0 5 50 ul F merB mrr hsdS20 rg my recA13 supE44 ara 14 galK2 lacY1 proA2 rpsL20 Str xyl 5 A leu mtl 1 Note This strain is endA1 The ViraPower Lentiviral Directional TOPO Expression Kit includes the TM ViraPower Bsd Lentiviral Support Kit and the 293FT Cell Line to facilitate production of replication incompetent lentiviral stocks For a detailed description of the reagents provided in the ViraPower Bsd Lentiviral Support Kit and their TM use refer to the ViraPower Lentiviral Expression System manual For a detailed description of the 293FT Cell Line and instructions to culture and maintain the cells refer to the 293FT Cell Line manual ix Accessory Products Introduction Additional Products The products listed in this section may be used with the pLenti6 V5 Directional TOPO Cloning Kit For more information refer to our Web site www invitrogen com or call Technical Service see page 34 Some of the reagents supplied in the pLenti6 V5 Directional TOPO Cloning Kit as well as other reagents suitable for use with the kit are available separately from Invitrogen Ordering information for these reagents is provided below Item Quantity Catalog no One Shot Stbl3 Chemically Competent E coli 20 x 50 ul C7373 03 Ampicillin 200 mg 11593 019 Blasticidin 50 mg R210 01 S N A P Midiprep Kit 20 reactions K1910 01 P
16. Prep Kit page x or equivalent For each transformation pick 10 20 colonies from plates obtained after plating the transformation mix Culture them overnight in LB medium containing 100 ug ml ampicillin Isolate plasmid DNA using PureLink HQ Mini Plasmid Purification Kit or equivalent see Important above The typical yield of pLenti DNA with PureLink HO Mini Plasmid Purification Kit is 5 7 ug which is lower than the average DNA yield using this purification kit Perform restriction digests on plasmid DNA and analyze the digested DNA on 1 2 agarose gels to confirm the correct pLenti6 V5 D TOPO clones Depending on the restriction sites you are using you should be able to determine the number and size of bands you should obtain from your digestion Agarose gel analysis should show the correct digestion pattern indicating proper TOPO cloning into the lentiviral vector Additional or unexpected bands indicate aberrant recombination of the lentiviral vector Continued on next page 15 Analyzing Transformants continued Analyzing Transformants by PCR Sequencing Important 16 Use the protocol below or any other suitable protocol to analyze positive transformants using PCR For PCR primers use a combination of the CMV Forward primer or the V5 C term Reverse primer and a primer that hybridizes within your insert You will have to determine the amplification conditions If you are using this technique
17. Vectors TOPO Cloning Efficiency Primers One Shot StbI3 Chemically Competent E coli 38 This section describes the criteria used to qualify the components of the pLenti6 V5 Directional TOPO Cloning Kit The pLenti6 V5 DEST parental vector of pLenti6 V5 D TOPO and pLenti6 V5 GW lacZ plasmids are qualified by restriction enzyme digestion The pLenti6 V5 DEST vector is qualified by restriction digest prior to adaptation with topoisomerase I After adaptation with topoisomerase I the pLenti6 V5 D TOPO vector is lot qualified using the control reagents included in the kit Under conditions described on pages 25 26 a 750 bp control PCR product is amplified using a forward primer containing CACC at its 5 end and a reverse primer The PCR product is TOPO Cloned into the pLenti6 V5 D TOPO vector and transformed into the One Shot Stb13 chemically competent E coli included with the kit Each lot of vector should yield greater than 85 cloning efficiency Forty transformants are characterized using directional PCR Of the transformants characterized greater than 90 should contain an insert in the correct orientation Primers are lot qualified by DNA sequencing experiments using the dideoxy chain termination technique Each lot of One Shot Stbl3 chemically competent E coli is tested for transformation efficiency using the pUC19 control plasmid included in the kit and following the pr
18. ale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Retroviral helper cell lines are licensed from Wisconsin Alumni Research Foundation under U S Patents and corresponding patents and applications in other countries for in ternal research purposes only Use of these cell lines for Commercial Purposes requires a license from Life Technologies continued on next page Purchaser Notification continued Limited Use Label License No 304 Improved Trans fection Reagent Limited Use Label License No 317 LentiVector Technology Limited Use Label License No 345 Gateway Vec to
19. ation mix onto LB plates containing 100 ug ml ampicillin Be sure to plate two different volumes to ensure that at least one plate has well spaced colonies 5 Incubate overnight at 37 C Hundreds of colonies from the vector PCR insert reaction should be produced To analyze the transformants isolate plasmid DNA and digest with Xho I and EcoR I Xho I cuts once in the vector and EcoR I cuts once in the insert You should see the following digestion patterns e Correct orientation 651 7063 bp e Reverse orientation 109 7605 bp e Empty vector 6964 bp Greater than 90 of the colonies should contain the 750 bp insert in the correct orientation Relatively few colonies should be produced in the vector only reaction pUC19 plasmid is included to check the transformation efficiency of the One Shot Stb13 competent cells Transform one vial of One Shot Stb13 cells with 10 pg of pUC19 using the protocol on page 13 Plate 10 ul of the transformation mixture plus 20 ul of S O C Medium on LB plates containing 100 ug ml ampicillin Transformation efficiency should be gt 1 x 108 cfu ug DNA Gel Purifying PCR Products Introduction Note Using the S N A P Gel Purification Kit Quick S N A P Method Smearing multiple banding primer dimer artifacts or large PCR products gt 3 kb may necessitate gel purification If you wish to purify your PCR product be extremely careful to remove all sources of n
20. biotic isolated from Streptomyces griseochromogenes which inhibits protein synthesis in both prokaryotic and eukaryotic cells Takeuchi et al 1958 Yamaguchi et al 1965 Resistance is conferred by expression of either one of two blasticidin S deaminase genes bsd from Aspergillus terreus Kimura et al 1994 or bsr from Bacillus cereus Izumi et al 1991 These deaminases convert blasticidin S to a non toxic deaminohydroxy derivative Izumi et al 1991 The formula for blasticidin S is Ci7H2sNsOs HCL and the molecular weight is 458 9 The diagram below shows the structure of Blasticidin NH2 Bi pe HOOC o CH3 HCl ANN NH O NH Always wear gloves mask goggles and protective clothing e g a laboratory coat when handling Blasticidin Weigh out Blasticidin and prepare solutions in a hood Blasticidin may be obtained separately from Invitrogen Catalog no R210 01 in 50 mg aliquots Blasticidin is soluble in water Sterile water is generally used to prepare stock solutions of 5 to 10 mg ml Dissolve Blasticidin in sterile water and filter sterilize the solution Aliquot in small volumes suitable for one time use see next to last point below and freeze at 20 C for long term storage or store at 4 C for short term storage Aqueous stock solutions are stable for 1 2 weeks at 4 C and 6 8 weeks at 20 C pH of the aqueous solution should be 7 0 to prevent inactivation of Blasticidin Do not subjec
21. ced host cell line Generally concentrations ranging from 2 10 ug ml Blasticidin are sufficient to kill most untransduced mammalian cell lines We recommend testing a range of concentrations to ensure that you determine the minimum concentration necessary for your cell line For guidelines to generate a kill curve refer to the ViraPower Lentiviral Expression System manual For instructions to prepare and handle Blasticidin see the Appendix page 29 TM Refer to the ViraPower Lentiviral Expression System manual for instructions and guidelines to e Transduce your Lenti6 V5 construct into the mammalian cell line of interest at the appropriate multiplicity of infection MOI e Generate stable cell lines using Blasticidin selection To detect expression of your recombinant fusion protein you may perform e Western blot analysis using the Anti V5 Anti V5 HRP or Anti V5 AP antibodies available from Invitrogen or an antibody to your protein e Immunofluorescence using the Anti V5 FITC antibody available from Invitrogen e Functional analysis For more information about the Anti V5 antibodies refer to our Web site www invitrogen com or call Technical Service see page 34 Ordering information is provided on page xi The C terminal peptide containing the V5 epitope will add approximately 2 9 kDa to the size of your protein The galactosidase protein expressed from the Lenti6 V5 GW lacZ control lentiviral constru
22. cribes the antibodies available from Invitrogen Horseradish peroxidase HRP or alkaline phosphatase AP conjugated antibodies allow one step detection using chemi luminescent or colorimetric detection methods A fluorescein isothiocyanate FITC conjugated antibody allows one step detection in immunofluorescence experiments The amount of antibody supplied is sufficient for 25 western blots or 25 immuno staining reactions FITC conjugated antibody only Item Quantity Catalog no Anti V5 Antibody 50 ul R960 25 Anti V5 HRP Antibody 50 ul R961 25 Anti V5 AP Antibody 125 ul R962 25 Anti V5 FITC Antibody 50 ul R963 25 xi xii Overview Introduction Features of the pLenti6 V5 D TOPO Vector Introduction The pLenti6 V5 Directional TOPO Cloning Kit combines the ViraPower Lentiviral Expression System with TOPO Cloning technology to provide a highly efficient rapid cloning strategy for insertion of blunt end PCR products into a vector for expression in dividing and non dividing mammalian cells TOPO Cloning requires no ligase post PCR procedures or restriction enzymes pLenti6 V5 D TOPO is a 7 0 kb expression vector designed to facilitate rapid directional TOPO Cloning and high level expression of PCR products in mammalian cells using the ViraPower Lentiviral Expression System available from Invitrogen Features of the vector include e Rous Sarcoma Virus RSV
23. ct is approximately 121 kDa in size You may assay for B galac tosidase expression by western blot analysis activity assay using cell free lysates Miller 1972 or by staining the cells for activity Invitrogen offers an anti B galactosidase antibody A11132 B Gal Assay Kit Catalog no K1455 01 and the B Gal Staining Kit Catalog no K1465 01 for fast and easy detection of B galactosidase expression Troubleshooting TOPO Cloning Reaction and Transformation The table below lists some potential problems and possible solutions that may help you troubleshoot the TOPO Cloning and transformation reactions To help evaluate your results we recommend that you perform the control reactions see pages 25 26 in parallel with your samples Problem Reason Solution Few or no colonies obtained Suboptimal ratio of PCR Use a 0 5 1 to 2 1 molar ratio of PCR from sample reaction and product TOPO vector used in the product TOPO vector the transformation control TOPO Cloning reaction gave colonies Too much PCR product used in the TOPO Cloning reaction e Dilute the PCR product e Usea 0 5 1 to 2 1 molar ratio of PCR product TOPO vector PCR primers contain 5 phosphates Do not add 5 phosphates to your PCR primers Incorrect PCR primer design e Make sure that the forward PCR primer contains the sequence CACC at the 5 end e Make sure that the reverse PCR primer does not c
24. cubate the transforma tion mixture for 1 hour at 37 C before plating Insufficient amount of E coli plated Increase the amount of E coli plated Transformants plated on selective plates containing the wrong antibiotic Use the appropriate antibiotic for selection 24 Appendix Performing the Control Reactions Introduction We recommend performing the following control TOPO Cloning reactions the first time you use the kit to help you evaluate your results Performing the control reactions involves producing a control PCR product using the reagents included in the kit and using this product directly in a TOPO Cloning reaction Before Starting For each transformation prepare two LB plates containing 100 ug ml ampicillin Producing the Use your thermostable proofreading polymerase and the appropriate buffer to Control PCR amplify the control PCR product Follow the manufacturer s recommendations Product for the proofreading polymerase you are using 1 To produce the 750 bp control PCR product set up the following 50 ul PCR Component Amount Control DNA Template 100 ng 1 ul 10X PCR Buffer appropriate for enzyme 5 ul dNTP Mix 0 5 ul Control PCR Primers 0 1 ug l each 1 ul Sterile water 41 5 ul Proofreading polymerase 1 2 5 U l 1 ul Total volume 50 ul 2 Overlay with 70 ul 1 drop of mineral oil if required 3 Amplify using the following cycling parame
25. e Forward PCR Primer Example of Forward Primer Design Note The design of the PCR primers to amplify your gene of interest is critical for expression Consider the following when designing your PCR primers e Sequences required to facilitate directional cloning e Sequences required for proper translation initiation of your PCR product e Whether or not you wish your PCR product to be fused in frame with the C terminal V5 epitope tag When designing your forward PCR primer consider the points below Refer to page 7 for diagrams of the TOPO Cloning site for pLenti6 V5 D TOPO e To enable directional cloning the forward PCR primer must contain the sequence CACC at the 5 end of the primer The 4 nucleotides CACC base pair with the overhang sequence GTGG in the pLenti6 V5 D TOPO vector e Your sequence of interest should include a Kozak translation initiation sequence with an ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1991 Kozak 1990 An example of a Kozak consensus sequence is G AJNNATGG Other sequences are possible but the G or A at position 3 and the G at position 4 are the most critical for function shown in bold The ATG initiation codon is underlined Below is the DNA sequence of the N terminus of a theoretical protein and the proposed sequence for your forward PCR primer The ATG initiation codon is underlined DNA sequence 5 ATG GGA TCT GAT AAA Proposed For
26. ector in 10 ul sterile water to prepare a 1 ug l stock TM solution Use the stock solution to transform Stb13 E coli Use 10 ng of plasmid DNA for transformation 2 Select transformants on LB agar plates containing 100 ug ml ampicillin Optional perform AflII and XhoI double digest as described on page 15 to confirm plasmid 3 Prepare a glycerol stock of a transformant containing plasmid for long term storage see page 18 TM Refer to the ViraPower Lentiviral Expression System manual for detailed guidelines and protocols to e Cotransfect your pLenti6 V5 D TOPO construct and the ViraPower Packaging Mix into the 293FT cell line to generate a lentiviral stock e Determine the titer of your viral stock continued on next page 21 Expressing Your Recombinant Protein continued Determining Blasticidin Sensitivity Transducing Mammalian Cells Detecting Recombinant Fusion Proteins Note Assay for B galactosidase Activity 22 Once you have produced a lentiviral stock with a suitable titer you will use this stock to transduce your lentiviral construct into the mammalian cell line of choice You may assay for transient expression of your recombinant protein or use Blasticidin to select for stably transduced cells Before generating your stably transduced cell line we recommend that you generate a kill curve to determine the minimum concentration of Blasticidin required to kill your untransdu
27. er Lentiviral Expression System to produce a viral stock which may then be used to transduce your mammalian cell line of choice to express your recombinant protein see outline below 1 Cenerate the pLenti6 V5 pLenti6 V5 expression construct containing Expression your gene of interest Construct ViraPower Packaging Mix 2 Cotransfect the 293FT producer cell line with your pLenti6 V5 expression construct and the optimized packaging mix gt 293FT Producer Cell Line 3 Harvest viral supernatant and determine the titer 4 Add the viral supernatant to your mammalian cell line of interest Select for stably transduced cells using blasticidin if desired Your Mammalian Cell Line of Interest Pcmv gene of interest V5 5 Assay for recombinant protein of interest continued on next page 19 Expressing Your Recombinant Protein continued Materials to Have on Hand 20 To express your gene of interest from pLenti6 V5 D TOPO using the ViraPower Lentiviral Expression System you will need to have the following reagents e 293FT cell line for producing maximized levels of virus Naldini et al 1996 This cell line is derived from 293F cells and stably expresses the SV40 large T antigen for enhanced virus production TM e ViraPower Packaging Mix When cotransfected with the pLenti6 V5 D TOPO plasmid into the 293FT producer cell line this optimized mixture of plasmids suppl
28. ere separate samples Run both samples over the same DNA binding column B i e perform two spins and treat as a single DNA prep in subsequent steps 7 Perform restriction analysis see page 15 to confirm the presence of the insert 8 Use the purified plasmid DNA from the positive clone for producing the lentivirus and to check protein expression optional see next page Note Typical DNA yield should be 300 400 ug and the O D 260 280 ratio should be between 1 8 and 2 1 Once you have generated and validated your clone you will isolate plasmid DNA for transfection Plasmid DNA for transfection into eukaryotic cells must be very clean and free from contamination with phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating lentiviral plasmid DNA using the S N A P MidiPrep Kit Important Do not use mini prep plasmid DNA for lentivirus production Maintain and propagate the pLenti6 V5 D TOPO expression plasmid in LB medium containing 100 ug ml ampicillin Addition of other antibiotics is not required continued on next page 17 Analyzing Transformants continued Long Term Storage Verifying Expression of Recombinant Protein Optional 18 Once you have identified the correct clone be sure to purify the colony and make a glycerol stock for long term storage We recommend that you store a st
29. es of the System refer to the ViraPower Lentiviral Expression System manual For more information about the 293FT cell line refer to the 293FT Cell Line manual Both manuals are available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 34 How Directional TOPO Cloning Works How Topoisomerase Works Directional TOPO Cloning Topoisomerase I from vaccinia virus binds to duplex DNA at specific sites CCCTT and cleaves the phosphodiester backbone in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products Directional joining of double strand DNA using TOPO charged oligonucleotides occurs by adding a 3 single stranded end overhang to the incoming DNA Cheng and Shuman 2000 This single stranded overhang is identical to the 5 end of the TOPO charged DNA fragment At Invitrogen this idea has been modified by adding a 4 nucleotide overhang sequence to the TOPO charged DNA and adapting it to a whole vector format In this
30. for the first time we recommend performing restriction analysis in parallel Artifacts may be obtained because of mispriming or contaminating template Materials Needed AccuPrime Pfx SuperMix cat no 12344 040 Appropriate forward and reverse PCR primers 20 uM each Procedure 1 For each sample aliquot 48 ul of AccuPrime Pfx SuperMix into a 0 5 ml microcentrifuge tube Add 1 ul each of the forward and reverse PCR primer 2 Pick 5 10 colonies that have been analyzed by restriction digest see page 15 and resuspend them individually in 50 ul of SuperMix containing PCR primers remember to make a patch plate to preserve the colonies for further analysis Incubate reaction for 10 minutes at 94 C to lyse cells and inactivate nucleases Amplify for 20 to 30 cycles For the final extension incubate at 72 C for 10 minutes Store at 4 C ss PF w Visualize by agarose gel electrophoresis Once you have identified the correct clone s you may sequence your construct to confirm that your gene is cloned in the correct orientation and in frame with the V5 epitope The CMV Forward and V5 C term Reverse primers are included in the kit to help you sequence your insert see diagram on page 7 for the location of the priming sites in the pLenti6 V5 D TOPO vector The complete sequence of pLenti6 V5 D TOPO is available on our Web site www invitrogen com If you have problems obtaining transformants or the correct in
31. ies the viral proteins in trans that are required to create viral particles e Transfection reagent for efficient delivery of the ViraPower Packaging Mix and the pLenti6 V5 D TOPO expression construct to 293FT cells We recommend using Lipofectamine 2000 Reagent for optimal transfection efficiency e Blasticidin for selection of stably transduced cells see the Appendix page 29 for more information For more information about the 293FT cell line see the 293FT Cell Line manual For more information about the ViraPower Packaging Mix refer to the ViraPower Lentiviral Expression System manual Both manuals are available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 34 The 293FT cell line and the ViraPower Bsd Lentiviral Support Kit containing the ViraPower Packaging Mix Lipofectamine 2000 and Blasticidin are available separately from Invitrogen see below for ordering information Item Catalog No ViraPower Bsd Lentiviral Support Kit K4970 00 293FT Cell Line R700 07 continued on next page Expressing Your Recombinant Protein continued DNA Isolation Guidelines Important Positive Control Producing Lentiviral Stocks Plasmid DNA for transfection into eukaryotic cells must be very clean and free from contamination with phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid c
32. ime may yield more colonies 2 Place the reaction on ice and proceed to Transforming One Shot Stb13 Competent Cells next page Note You may store the TOPO Cloning reaction at 20 C overnight 11 Transforming One Shot Competent E coli Introduction Materials Needed Note 12 Once you have performed the TOPO Cloning reaction you will transform your pLenti6 V5 D TOPO construct into competent E coli One Shot Stbl3 Chemically Competent E coli Box 2 are included with the kit to facilitate transformation and are recommended see page 10 Note The transformation efficiency of One Shot Sb13 Chemically Competent E coli is 2 gt 1x 10 cfu ug plasmid DNA Have the following materials on hand before beginning e TOPO Cloning reaction from Step 2 previous page e One Shot Stb13 Chemically Competent E coli supplied with the kit Box 2 one vial per transformation thaw on ice immediately before use e pUC19 positive control if desired to verify the transformation efficiency supplied with the kit Box 2 e LB Medium pre warmed to 37 C Note You may use S O C Medium provided with the kit in place of LB Medium for cell recovery e 15 ml sterile capped tubes e 42 C water bath e LB plates containing 100 ug ml ampicillin two for each transformation warm at 37 C for 30 minutes before use e 37 C shaking and non shaking incubator There is no blue white screeni
33. ing site Allows sequencing of the insert SV40 early promoter and origin Allows efficient high level expression of the Blasticidin resistance gene and episomal replication in cells expressing the SV40 large T antigen EM7 promoter Synthetic prokaryotic promoter for expression of the Blasticidin resistance gene in E coli Blasticidin bsd resistance gene Permits selection of stably transduced mammalian cell lines Kimura et al 1994 AU3 HIV 1 truncated 3 LTR Modified 3 LTR that allows viral packaging but self inactivates the 5 LTR for biosafety purposes Dull et al 1998 The element also contains a polyadenylation signal for efficient transcription termination and polyadenylation of mRNA in transduced cells SV40 polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA bla promoter Permits expression of the ampicillin bla resistance gene Ampicillin bla resistance gene Allows selection of the plasmid in E coli pUC origin of replication ori Permits high copy replication and maintenance in E coli 31 Map of pLenti6 V5 GW lacZ Description pLenti6 V5 GW lacZ Map 32 pLenti6 V5 GW lacZ is a 10127 bp control vector expressing P galactosidase and was generated using the Gateway LR recombination reaction between an Entry Clone containing the lacZ gene and pLenti6 V5 DEST B galactosidase is expre
34. invitrogen pLenti6 V5 Directional TOPO Cloning Kit Five minute directional TOPO Cloning of blunt end PCR products into an expression vector for the ViraPower Lentiviral Expression System Catalog nos K4955 00 K4955 10 Version E 8 June 2010 25 0502 ii Table of Contents Tableiof EE iii TOPO Cloning Procedure for Experienced Users una v Kit Contents and Storage repetien eeaeee taae iE EE ene E ETRE EEEE AE pE eE E SE e E E ae EERE OAE beer vii ACCOSSO e LUTO ES PE E A ET lia it A T iria x Introduction E 1 OOVET VIEW eieiei li A AA EEES S E EEE EEEE A eet rette ne 1 How Directional TOPO Cloning Works en na Her 3 Experimental Outline entgeet ee EE 4 Methods nassen een 5 Designing EE E 5 Producing Blunt End PER Products vaina nee At O R 8 Performing the TOPO Cloning REO aaa AI wa Coe AER 10 Transforming One Shot Competent E E 12 Analyzing Transformants seis eege Eegeregie EE 14 Expressing Your Recombinant Protein EEN 19 Appendix E 25 Performing the Control Reactions EEN 25 Gel Purifying PCR Droducts een 27 Bl sticidin E 29 Map and Features of pLenti6 V5 D TOPO Ze uni E Eh 30 Maprof plenti6 VOsGW 1ACZ eebe EES 32 E EE 33 Technical Service mier enna Gate vata vain use Biss 34 Purchaser Notifications ege En ANA casks SSL dra 35 References Zorten Eeer ee ere 39 iii iv TOPO Cloning Procedure for Experienced Users Introduction This quick reference sheet is provided for experienced u
35. lunt end PCR product using any thermostable proofreading polymerase Follow the guidelines below to produce your blunt end PCR product You will need the following reagents and equipment for PCR Note dNTPs adjusted to pH 8 are provided in the kit e Thermocycler and thermostable proofreading polymerase e 10X PCR buffer appropriate for your polymerase e DNA template and primers to produce the PCR product Set up a 25 ul or 50 ul PCR reaction using the guidelines below 1 Follow the instructions and recommendations provided by the manufacturer of your thermostable proofreading polymerase to produce blunt end PCR products 2 Use the cycling parameters suitable for your primers and template Make sure to optimize PCR conditions to produce a single discrete PCR product 3 Use a 7 to 30 minute final extension to ensure that all PCR products are completely extended 4 After cycling place the tube on ice or store at 20 C for up to 2 weeks Proceed to Checking the PCR Product below After you have produced your blunt end PCR product use agarose gel electrophoresis to verify the quality and quantity of your PCR product Check for the following outcomes below e You have a single discrete band of the correct size If you do not have a single discrete band follow the manufacturer s recommendations to optimize your PCR with the polymerase of your choice e We strongly recommend that you gel purify the desired PCR pr
36. mercially available kits ensure that Solution I of the Lysis buffer often called Resuspension Buffer contains 10 mM EDTA to inactivate the endonuclease to avoid DNA nicking and vector degradation Alternatively follow the instructions included in the plasmid purification kits for endA1 E coli strains We recommend using the PureLink HQ Mini Plasmid Purification Kit and preparing lentiviral plasmid DNA using S N A P MidiPrep Kits page x To confirm that no rearrangement in the LTR regions of the plasmid has taken place perform restriction digests using a combination of Afl II and Xho I Afl II sites are present in both LTRs The Xho I site is present in the plasmid backbone at the 3 end of the insert Assuming there are no Afl II or Xho I sites in the insert 3 DNA fragments are generated from the Afl II Xho I digest Any unexpected DNA fragments are a result of LTR recombination If Afl II and or Xho I sites are present in the insert you can use a restriction enzyme or a combination of enzymes that cut once in the vector and once in the insert The complete restriction enzyme maps of the pLenti6 V5 D TOPO vector is available at www invitrogen com You will need the following materials e LB medium containing 100 pg ml ampicillin e PureLink HQ Mini Plasmid Purification Kit page x or equivalent e Appropriate restriction enzymes see above e E Gels 1 2 agarose gels page x or equivalent e S N A P Midi
37. mmediately transfer the tube to ice for 2 minutes 4 Add 250 ul of pre warmed LB or S O C Medium 5 Incubate at 37 C for 1 hour with shaking 6 Spread 25 100 ul of bacterial culture on a prewarmed LB agar plate containing 100 ug ml ampicillin and incubate overnight at 37 C Control Reaction We recommend using the Control PCR Template and the Control PCR Primers included with the kit to perform the control reaction See the protocol on pages 25 26 for instructions vi Kit Contents and Storage Types of Kits Kit Components Shipping Storage This manual is supplied with the following products Product Catalog no ViraPower Lentiviral Directional TOPO Expression Kit K4950 00 pLenti6 V5 Directional TOPO Cloning Kit K4955 10 Catalog nos K4950 00 and K4955 10 include the following components For a detailed description of the reagents supplied with the pLenti6 V5 D TOPO and the One Shot Stbl3 Chemically Competent E coli kits see pages viii ix For a detailed description of the reagents supplied with the ViraPower Bsd Lentiviral Support Kit or instructions to culture and maintain the 293FT Cell Line see the TM ViraPower Lentiviral Expression System or 293FT Cell Line manuals respectively Both manuals are supplied with the ViraPower Lentiviral Directional TOPO Expression Kit but are also available for downloading from our Web site www invitrogen com o
38. ng for the presence of inserts Most transformants will contain recombinant plasmid with the PCR product of interest cloned in the correct orientation Sequencing primers are included in the kit to sequence across an insert in the multiple cloning site to confirm orientation and reading frame continued on next page Transforming One Shot Competent Cells continued One Shot Stbi3 Chemical Transformation Procedure Use this procedure to transform the TOPO Cloning reaction into One Shot Stb13 Chemically Competent E coli 1 10 TM Thaw on ice one vial of One Shot Stbl3 chemically competent cells for each transformation Add 2 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 11 into a vial of One Shot Stb13 cells and mix gently Do not mix by pipetting up and down For the pUC19 control add 10 pg 1 ul of DNA into a separate vial of One Shot cells and mix gently Incubate the vial s on ice for 30 minutes Heat shock the cells for 30 seconds at 42 C without shaking Remove the vial s from the 42 C water bath and place them on ice for 2 minutes Transfer cells gently to a sterile 15 ml tube containing 1 ml of pre warmed LB Medium Cap the tube s tightly and shake horizontally at 37 C for 1 hour at 225 rpm in a shaking incubator Spread 100 ul of the transformation mix on a prewarmed selective plate and incubate overnight at 37 C For the pUC
39. ocedure on page 13 Test transformations are performed on 3 to 20 vials per lot depending on batch size Transformed cultures are plated on LB plates containing 100 ug ml ampicillin and incubated overnight Transformation efficiency should be greater than 1 x 10 cfu ug plasmid DNA In addition untransformed cells are tested for the appropriate antibiotic sensitivity and the absence of phage contamination References Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Cheng C and Shuman S 2000 Recombinogenic Flap Ligation Pathway for Intrinsic Repair of Topoisomerase IB Induced Double Strand Breaks Mol Cell Biol 20 8059 8068 Dull T Zufferey R Kelly M Mandel R J Nguyen M Trono D and Naldini L 1998 A Third Generation Lentivirus Vector with a Conditional Packaging System J Virol 72 8463 8
40. ock of plasmid DNA at 20 C 1 Streak the original colony out for single colonies on LB plates containing 100 ug ml ampicillin Isolate a single colony and inoculate into 1 2 ml of LB containing 100 ug ml ampicillin Grow until culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial Store at 80 C Before proceeding to generate a lentiviral stock of your pLenti6 V5 D TOPO expression construct you may verify that the construct expresses the gene of interest by transfecting the plasmid directly into mammalian cells and assaying for your recombinant protein if desired Follow the guidelines below Use an easy to transfect dividing mammalian cell line e g HEK 293 or COS 7 Use a transfection reagent that allows high efficiency transfection we recommend using Lipofectamine 2000 Reagent Note Lipofectamine 2000 is supplied with the ViraPower Lentiviral Directional TOPO Expression Kit but is also available separately from Invitrogen see page x for ordering information Follow the manufacturer s instructions for the transfection reagent you are using to perform plasmid transfection If you are using Lipofectamine 2000 follow the instructions included with the product Expressing Your Recombinant Protein Introduction Once you have TOPO Cloned your gene of interest into pLenti6 V5 D TOPO you are ready to use Invitrogen s ViraPow
41. oduct even if you obtain a discrete band This is especially important if your PCR template was an ampicillin resistant plasmid because amp resistant plasmids can be carried through the cloning reaction and can grow favorably over the lentiviral plasmid construct after transformation For a protocol to gel purify your PCR product see pages 27 28 e Estimate the concentration of your PCR product You will use this information when setting up your TOPO Cloning reaction see Amount of PCR Product to Use in the TOPO Cloning Reaction next page for details continued on next page Producing Blunt End PCR Products continued Amount of PCR Product to Use in the TOPO Cloning Reaction When performing directional TOPO Cloning we have found that the molar ratio of PCR product TOPO vector used in the reaction is critical to its success To obtain the highest TOPO Cloning efficiency use a 0 5 1 to 2 1 molar ratio of PCR product TOPO vector see figure below Note that the TOPO Cloning efficiency decreases significantly if the ratio of PCR product TOPO vector is lt 0 1 1 or gt 5 1 see figure below These results are generally obtained if too little PCR product is used i e PCR product is too dilute or if too much PCR product is used in the TOPO Cloning reaction If you have quantitated the yield of your PCR product you may need to adjust the concentration of your PCR product before proceeding to TOPO Cloning Tip
42. of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 27 RNA Transfection Limited Use Label License No 51 Blasticidin and the Blasticidin Selection Marker Use of the pLenti6 V5 Directional TOPO Cloning Kit is covered under the licenses detailed below The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided
43. omplexing decreasing transfection efficiency When performing plasmid DNA isolation with commercially available kits from E coli strains such as Stb13 that are wild type for endonuclease 1 endA1 ensure that Solution I of the Lysis or Resuspension Buffer contains 10 mM EDTA EDTA will inactivate the endonuclease and avoid DNA nicking and vector degradation Alternatively follow the instructions included the plasmid purification kits for endA1 E coli strains Note We also recommend performing restriction analysis to verify the integrity of your expression construct after plasmid preparation See page 15 for details Do not use mini prep plasmid DNA for lentivirus production We recommend preparing lentiviral plasmid DNA using the S N A P MidiPrep Kit which contains 10 mM EDTA in the Resuspension Buffer see page x for ordering information To optimize expression conditions in your mammalian cell line of interest we recommend including the pLenti6 V5 GW lacZ positive control plasmid supplied with the kit in your experiment In pLenti6 V5 GW lacZ the gene encoding B galactosidase is expressed in mammalian cells under the control of the CMV promoter Once you have produced a lentiviral stock and stably transduced the lentivirus into your mammalian cell line of interest you may easily assay for P galactosidase expression see the next page To propagate and maintain the pLenti6 V5 GW lacZ plasmid 1 Resuspend the v
44. on page 11 An even easier method is to simply cut out the gel slice containing your PCR product place it on top of the S N A P column bed and centrifuge at full speed for 10 seconds Use 1 2 ul of the flow through in the TOPO Cloning reaction page 11 Be sure to make the gel slice as small as possible for best results continued on next page 27 Gel Purifying PCR Products continued Low Melt Agarose Method 28 If you prefer to use low melt agarose use the procedure below Note that gel purification will result in a dilution of your PCR product and a potential loss of cloning efficiency 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 2 in TAE buffer Visualize the band of interest and excise the band Place the gel slice in a microcentrifuge tube and incubate the tube at 65 C until the gel slice melts Place the tube at 37 C to keep the agarose melted Add 4 ul of the melted agarose containing your PCR product to the TOPO Cloning reaction as described on page 11 Incubate the TOPO Cloning reaction at 37 C for 5 to 10 minutes This is to keep the agarose melted TM Transform 2 to 4 ul directly into One Shot Stb13 cells using the procedure on page 13 Blasticidin Blasticidin Molecular Weight Formula and Structure Handling Blasticidin Preparing and Storing Stock Solutions Blasticidin S HCl is a nucleoside anti
45. ontain the sequence CACC at the 5 end Used Taq polymerase or a Taq proofreading polymerase mixture for PCR Use a proofreading polymerase for PCR Large PCR product e Use a0 5 1 to 2 1 molar ratio of PCR product TOPOS vector e Increase the incubation time of the TOPO reaction from 5 60 minutes can also be increased to overnight e Gel purify the PCR product to remove primer dimers and other artifacts does not run as a single discrete band on an agarose gel PCR reaction contains artifacts i e e Optimize your PCR using the proofreading polymerase of your choice e Gel purify your PCR product Incomplete extension during PCR Include a final extension step of 7 to 30 minutes during PCR Longer PCR products need a longer extension time Cloning large pool of PCR products or a toxic gene e Increase the incubation time of the TOPO reaction from 5 60 minutes can also be increased to overnight e Usea0 5 1 to 2 1 molar ratio of PCR product TOPO vector continued on next page 23 Troubleshooting continued TOPO Cloning Reaction and Transformation continued Problem Reason Solution Large percentage of inserts cloned in the incorrect orientation Incorrect PCR primer design Make sure that the forward PCR primer contains the sequence CACC at the 5 end Reverse PCR primer is complementary to the GTGG overhang at the 5 end
46. ournal of Antibiotics Series A 11 1 5 Yamaguchi H Yamamoto C and Tanaka N 1965 Inhibition of Protein Synthesis by Blasticidin S I Studies with Cell free Systems from Bacterial and Mammalian Cells J Biochem Tokyo 57 667 677 2002 2006 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 40 Notes Notes invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
47. ple 2 on the next page e Ifyou do NOT wish to fuse your PCR product in frame with the C terminal tag then include the native sequence containing the stop codon in the reverse primer or make sure the stop codon is upstream from the reverse PCR primer binding site see Example 2 on the next page If you plan to amplify DNA from a cDNA clone make sure that your reverse PCR primer does not contain sequences encoding the polyA tail The presence of polyA sequences between the viral LTR s prevents production of functional lentivirus Below is the sequence of the C terminus of a theoretical protein You want to fuse the protein in frame with the C terminal tag in pLenti6 V5 D TOPO The stop codon is underlined DNA sequence AAG TCG GAG CAC TCG ACG ACG GTG TAG 3 One solution is to design the reverse PCR primer to start with the codon just up stream of the stop codon but the last two codons contain GTGG underlined below which is identical to the 4 bp overhang sequence As a result the reverse primer will be complementary to the 4 bp overhang sequence increasing the probability that the PCR product will clone in the opposite orientation You want to avoid this situation DNA sequence AAG TCG GAG CAC TCG ACG ACG GTG TAG 3 Proposed Reverse PCR primer sequence TG AGC TGC TGC CAC AAA 5 Another solution is to design the reverse primer so that it hybridizes just down stream of the stop codon but still includes the C terminus
48. r by contacting Technical Service see page 34 Component Catalog no K4950 00 K4955 10 pLenti6 V5 D TOPO Reagents 293FT Cell Line One Shot Stb13 Chemically Competent E coli ViraPower Bsd Lentiviral Support Kit y N y y y y The ViraPower Directional TOPO Kits are shipped as described below Upon receipt store each item as detailed below Note Catalog no K4955 10 includes Box 1 and Box 2 only Box Component Shipping Storage 1 pLenti6 V5 D TOPO Dry ice 20 C Reagents 2 One Shot Stb13 Chemically Dry ice 80 C Competent E coli 3 ViraPower Bsd Lentiviral Blue ice ViraPower Packaging Support Kit Mix 20 C Lipofectamine 2000 4 C Blasticidin 20 C 4 293FT Cell Line Dry ice Liquid nitrogen continued on next page vii Kit Contents and Storage continued pLenti6 V5 D TOPO Reagents viii pLenti6 V5 D TOPO reagents Box 1 are listed below Note that the user must supply a thermostable proofreading polymerase and the appropriate PCR buffer Store Box 1 at 20 C Expression Control Plasmid Reagent Concentration Amount pLenti6 V5 D TOPO 15 20 ng ul linearized plasmid DNA in 20 ul TOPO adapted 50 glycerol 50 mM Tris HCl pH 7 4 at 25 C 1mM EDTA 2 mM DTT 0 1 Triton X 100 100 ug ml BSA 30 uM bromophenol blue dNTP Mix 12 5 mM dATP 10 pl 12
49. rs This product is covered by U S Pat Nos 7 145 039 7 166 745 7 173 154 7 323 594 and 7 479 573 This product is licensed under U S Pat Nos 5 817 491 5 591 624 5 716 832 6 312 682 6 669 936 6 235 522 6 924 123 and foreign equivalents from Oxford BioMedica UK Ltd Oxford UK and is provided for use in academic and commercial in vitro and in vivo research for elucidating gene function and for validating potential gene products and pathways for drug discovery and development but excludes any use of LentiVector technology for creating transgenic birds for the purpose of producing useful or valuable proteins in the eggs of such transgenic birds the delivery of gene therapies and for commercial production of therapeutic diagnostic or other commercial products not intended for research use where such products do not consist of or incorporate a lentiviral vector Information about licenses for commercial uses excluded under this license is available from Oxford BioMedica UK Ltd Medawar Centre Oxford Science Park Oxford OX4 4GA UK enquiries oxfordbiomedica co uk or BioMedica Inc 11622 EI Camino Real 100 San Diego CA 92130 2049 USA LentiVector is a registered US and European Community trade mark of Oxford BioMedica ple This product or one or more vectors made using this product is the subject of U S Patent No 5 888 732 owned by Life Technologies Corporation 37 Product Qualification Introduction
50. ructured Target Sequence to Activate Nuclear Export of Unspliced Viral mRNA Nature 338 254 257 continued on next page 39 References continued Miller J H 1972 Experiments in Molecular Genetics Cold Spring Harbor New York Cold Spring Harbor Laboratory Naldini L Blomer U Gage F H Trono D and Verma I M 1996 Efficient Transfer Integration and Sustained Long Term Expression of the Transgene in Adult Rat Brains Injected with a Lentiviral Vector Proc Natl Acad Sci USA 93 11382 11388 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase I in Escherichia coli is Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Takeuchi S Hirayama K Ueda K Sakai H and Yonehara H 1958 Blasticidin S A New Antibiotic The J
51. sers of the TOPO Cloning procedure If you are performing the TOPO Cloning procedure for the first time we recommend that you follow the detailed protocols provided in the manual Step Action Design PCR Primers e Include the 4 base pair sequences CACC necessary for directional cloning on the 5 end of the forward primer e Design the primers such that your gene of interest will be optimally expressed and fused in frame with the V5 epitope tag if desired Amplify Your Gene of 1 Use a thermostable proofreading DNA polymerase and the PCR primers Interest above to produce your blunt end PCR product 2 Use agarose gel electrophoresis to check the integrity and determine the yield of your PCR product Perform the TOPO 1 Set up the following TOPO Cloning reaction For optimal results use a Cloning Reaction 0 5 1 to 2 1 molar ratio of PCR product TOPO vector Fresh PCR product 0 5 to 4 ul Salt Solution 1 ul Water add to a final volume of 5 ul TOPO vector 1 ul Total volume 6 ul 2 Mix gently and incubate for 5 minutes at room temperature 3 Place on ice and proceed to transform One Shot Stbl3 chemically competent E coli below Transform One Shot 1 Add 2 ul of the TOPO Cloning reaction into a vial of One Shot Stb13 Stb13 Chemically chemically competent E coli and mix gently Competent E coli 2 Incubate on ice for 30 minutes 3 Heat shock the cells for 45 seconds at 42 C without shaking I
52. sert perform the control reactions described on page 25 26 or refer to the Troubleshooting section page 23 for tips to help you troubleshoot your experiment Analyzing Transformants continued Isolating Lentiviral Plasmid DNA DNA Isolation Guidelines Maintaining the Expression Clone TM This protocol provides general steps to retransform Stb13 E coli and perform isolation of plasmid DNA for lentivirus production pLenti plasmid DNA midipreps often have lower yields therefore a 100 ml volume of culture must be used for one DNA midiprep 1 Dilute 1 pl of miniprep plasmid DNA from a positive clone 1 500 in TE 2 Use 1 pl of this diluted DNA to retransform into One Shot Stbl3 Chemically Competent Cells as described on page 12 3 Plate approximately one tenth of the transformation on LB plates containing 100 ug ml ampicillin and incubate at 37 C overnight 4 Pick 1 colony and culture in 2 3 ml LB medium containing 100 ug ml ampicillin for 6 8 hours at 37 C to obtain a starter culture 5 Inoculate the entire volume of the starter culture into LB medium containing 100 ug ml ampicillin and culture at 37 C overnight Note Use at least 100 ml volume for large scale or midiprep isolation of DNA 6 Isolate plasmid DNA using S N A P MidiPrep Kit or equivalent see Important page 15 Note For best results using the S N A P MidiPrep Kit split the 100 ml culture into two 50 ml tubes and process as if they w
53. sitive expression control in the mammalian cell line of choice For more information about the ViraPower Lentiviral Expression System see the next page continued on next page Overview continued The ViraPower Lentiviral Expression System The ViraPower Lentiviral Expression System facilitates highly efficient in vitro or in vivo delivery of a target gene to dividing and non dividing mammalian cells using a replication incompetent lentivirus Based on the lentikat system developed by Cell Genesys Dull et al 1998 the ViraPower Lentiviral Expression System possesses features which enhance its biosafety while allowing high level gene expression in a wider range of cell types than traditional retroviral systems To express your gene of interest in mammalian cells using the ViraPower Lentiviral Expression System you will 1 TOPO Clone a PCR fragment encoding your gene of interest into pLenti6 V5 D TOPO to create an expression construct 2 Cotransfect your pLenti6 V5 D TOPO expression plasmid and the ViraPower Packaging Mix into the 293FT Cell Line to produce lentivirus 3 Use your lentiviral stock to transduce the mammalian cell line of choice Assay for transient expression of the recombinant protein or generate a stable cell line using Blasticidin selection For more information about the ViraPower Lentiviral Expression System the ViraPower Packaging Mix and the biosafety featur
54. ssed as a C terminal V5 fusion protein with a molecular weight of approximately 121 kDa For more information about the Gateway Cloning Technology and pLenti6 V5 DEST refer to the pLenti6 V5 DEST manual which is available for downloading from our Web site or by contacting Technical Service The figure below shows the features of the pLenti6 V5 GW lacZ vector The complete sequence of pLenti6 V5 GW lacZ is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 34 atiB1 lacZ attB2 V5 epitope amp pLenti6 V5 GW lacZ Comments for pLenti6 V5 GW lacZ 10127 nucleotides 10127 bp RSV enhancer promoter bases 1 229 HIV 1 5 LTR bases 230 410 5 splice donor base 520 HIV 1 psi yw packaging signal bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 3 splice acceptor base 1656 3 splice acceptor base 1684 CMV promoter bases 1809 2392 attB1 site bases 2440 2464 lacZ ORF bases 2484 5540 attB2 site bases 5560 5584 V5 epitope bases 5637 5678 SV40 early promoter and origin bases 5733 6041 EM7 promoter bases 6096 6162 Blasticidin resistance gene bases 6163 6561 AU3 HIV 1 3 LTR bases 6647 6881 AU3 bases 6647 6700 Truncated HIV 1 3 LTR bases 6701 6881 SV40 polyadenylation signal bases 6953 7084 bla promoter bases 7943 8041 Ampicillin b a resistance gene bases 8042 8902 pUC origin bases 9047 9720 Recipes LB Luria Ber
55. system PCR products are directionally cloned by adding four bases to the forward primer CACC The overhang in the cloning vector GTGG invades the 5 end of the PCR product anneals to the added bases and stabilizes the PCR product in the correct orientation Inserts can be cloned in the correct orientation with efficiencies equal to or greater than 90 Topoisomerase o CCCTT CACC ATG NNN NNN AAG GG GGGAAGTGG 6TGG TAC NNN NNN TTE CE PCR product Overhang 0 Overhang invades double stranded O DNA displacing the bottom strand Topoisomerase CCCTTCACC ATG NNN NNN AAG GG RE TAS NNN NNN TTC CC ge G Experimental Outline Flow Chart The flow chart below describes the general steps required to produce and clone your blunt end PCR product Determine strategy for PCR Produce blunt end PCR product using properly designed PCR primers pe gt TOPO Cloning Reaction Mix together PCR product and pLenti6 V5 D TOPO Incubate 5 minutes at room temperature lt lt Transform into Stbl3 E coli cells gt Transform into Stbl3 E coli cells Select and analyze colonies Prepare purified plasmid for transfection Proceed to virus production using the ViraPower Lentiviral Expression System Methods Designing PCR Primers Designing Your PCR Primers Guidelines to Design th
56. t stock solutions to freeze thaw cycles do not store in a frost free freezer Upon thawing use what you need and store the thawed stock solution at 4 C for up to 2 weeks Medium containing Blasticidin may be stored at 4 C for up to 2 weeks 29 Map and Features of pLenti6 V5 D TOPO pLenti6 V5 D TOPO Map 30 The figure below shows the features of pLenti6 V5 D TOPO vector The complete sequence of pLenti6 V5 D TOPO is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 34 Comments for pLenti6 V5 D TOPO 6963 nucleotides RSV enhancer promoter bases 1 229 HIV 1 5 LTR bases 230 410 5 splice donor base 520 HIV 1 psi w packaging sequence bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 3 splice acceptor base 1656 3 splice acceptor base 1684 CMV promoter bases 1809 2392 CMV forward priming site bases 2274 2294 Directional TOPO site bases 2431 2444 V5 epitope bases 2473 2514 V5 C term reverse priming site bases 2482 2502 SV40 early promoter and origin bases 2569 2877 EM7 promoter bases 2932 2998 Blasticidin resistance gene bases 2999 3397 AU3 HIV 1 3 LTR bases 3484 3717 AU3 bases 3484 3536 Truncated HIV 1 3 LTR bases 3537 3717 SV40 polyadenylation signal bases 3789 3920 bla promoter bases 4779 4877 Ampicillin b a resistance gene bases 4878 5738 pUC origin bases 5883 6556
57. tani Medium Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic 100 ug ml ampicillin if desired 4 Store at 4 C 33 Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 611
58. ters Step Time Temperature Cycles Initial Denaturation 2 minutes 94 C 1X Denaturation 1 minute 94 C Annealing 1 minute 55 C 25X Extension 1 minute 72 C Final Extension 7 minutes 72 C 1X 4 Remove 10 ul from the reaction and analyze by agarose gel electrophoresis Make sure that you see a single discrete 750 bp band 5 Estimate the concentration of the PCR product and adjust as necessary such that the amount of PCR product used in the control TOPO Cloning reaction results in an optimal molar ratio of PCR product TOPO vector i e 0 5 1 to 2 1 Proceed to the Control TOPO Cloning Reactions next page continued on next page 25 Performing the Control Reactions continued Control TOPO Using the control PCR product produced on the previous page and the Cloning Reactions pLenti6 V5 D TOPO vector set up two 6 ul TOPO Cloning reactions as Analysis of Results Transformation Control 26 described below 1 Set up control TOPO Cloning reactions Reagent Vector Only Vector PCR Insert Water 4 ul 3 pl Salt Solution 1 ul 1ul Control PCR Product 1 ul pLenti6 V5 D TOPO vector 1 ul 1 ul Total volume 6 ul 6 ul 2 Incubate at room temperature for 5 minutes and place on ice 3 Transform 2 ul of each reaction into separate vials of One Shot Stb13 cells using the protocol on page 13 4 Spread 25 100 ul of each transform
59. uclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols Three simple protocols are provided below The cloning efficiency may decrease with purification of the PCR product e g PCR product too dilute You may wish to optimize your PCR to produce a single band see Producing Blunt End PCR Products page 8 The S N A P Gel Purification Kit available from Invitrogen Catalog no K1999 25 allows you to rapidly purify PCR products from regular agarose gels 1 Electrophorese amplification reaction on a 1 to 5 regular TAE agarose gel Note Do not use TBE to prepare agarose gels Borate interferes with the sodium iodide step below 2 Cut out the gel slice containing the PCR product and melt it at 65 C in 2 volumes of the 6 M sodium iodide solution Add 1 5 volumes Binding Buffer Load solution no more than 1 ml at a time from Step 3 onto a S N A P column Centrifuge 1 minute at 3000 x g in a microcentrifuge and discard the supernatant TM If you have solution remaining from Step 3 repeat Step 4 Add 900 ul of the Final Wash Buffer Centrifuge 1 minute at full speed in a microcentrifuge and discard the flow through Repeat Step 7 Elute the purified PCR product in 40 ul of TE or sterile water Use 4 ul for the TOPO Cloning reaction and proceed as described
60. ureLink HQ Plasmid Miniprep Kit 100 reactions K2100 01 AccuPrime Pfx SuperMix 200 reactions 12344 040 E Gel 1 2 Starter Pak 6 gels Powerbase 1 kit G6000 01 E Gel 1 2 18 Pak 18 gels G5018 01 Lipofectamine 2000 0 75 ml 11668 027 1 5 ml 11668 019 B gal Antiserum rabbit IgG fraction 500 ul A11132 B Gal Assay Kit 1 kit K1455 01 B Gal Staining Kit 1 kit K1465 01 S N A P Gel Purification Kit 1 kit K1999 25 Accessory Products continued ViraPower Lentiviral Expression Products Detection of Recombinant Protein The pLenti6 V5 D TOPO vector is designed for use with the ViraPower Lentiviral Expression System available from Invitrogen Ordering information for TM other ViraPower lentiviral support products and expression vectors is provided below Item Quantity Catalog no ViraPower Lentiviral Gateway Expression Kit 1 kit K4960 00 ViraPower Zeo Lentiviral Gateway Expression Kit 1 kit K4980 00 ViraPower UbC Lentiviral Gateway Expression Kit 1 kit K4990 00 ViraPower Bsd Lentiviral Support Kit 20 reactions K4970 00 ViraPower Zeo Lentiviral Support Kit 20 reactions K4985 00 ViraPower Lentiviral Packaging Mix 60 reactions K4975 00 293FT Cell Line 3 x 10 cells R700 07 Expression of your recombinant fusion protein from pLenti6 V5 D TOPO can be detected using an antibody to the V5 epitope The table below des
61. use requires a license from Cell Genesys Cell Genesys Inc 342 Lakeside Drive Foster City California 94404 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer including non gene therapy research and target validation applications in laboratory animals whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 res
62. ward PCR primer 5 C ACC ATG GGA TCT GAT AAA If you design the forward PCR primer as noted above then e The primer includes the 4 nucleotides CACC required for directional cloning e The ATG initiation codon falls within the context of a Kozak sequence see boxed sequence allowing proper translation initiation of the PCR product in mammalian cells The first three base pairs of the PCR product following the 5 CACC overhang will constitute a functional codon continued on next page Designing PCR Primers continued Guidelines to Design the Reverse Primer Important Example 1 of Reverse Primer Design When designing your reverse PCR primer consider the points below Refer to page 7 for diagrams of the TOPO Cloning site for pLenti6 V5 D TOPO e To ensure that your PCR product clones directionally with high efficiency the reverse PCR primer MUST NOT be complementary to the overhang sequence GTGG at the 5 end A one base pair mismatch can reduce the directional cloning efficiency from 90 to 50 increasing the likelihood of your ORF cloning in the opposite orientation see Example 1 below We have not observed evidence of PCR products cloning in the opposite orientation from a two base pair mismatch e If you wish to fuse your PCR product in frame with the C terminal tag containing the V5 epitope then design the reverse PCR primer to remove the native stop codon in the gene of interest see Exam

pLenti6/V5 Directional TOPO® Cloning Kit

Contents

Download Pdf Manuals

Related Search

Related Contents

pLenti6/V5 Directional TOPO&reg; Cloning Kit

Contents

Download Pdf Manuals

Related Search

Related Contents

pLenti6/V5 Directional TOPO® Cloning Kit