Darn v1.0 User manual
Contents
1. Darn v1 0 A weighted constraint solver for RNA motif localization User manual INRA Toulouse France February 10 2010 Contents 1 Presentation 2 2 Install 2 3 Run example 3 4 Arguments description 3 5 Motif description syntax 4 daly General shape itn 2 Be ee Ee a A E ERS es 4 5 2 List of available cost functions 2 200004 4 5 3 Changing the Costs r zaree ioios Ba Bie a ae ca eee A 7 5 4 The model parameter 2 5 2 c0 3 pes ke cee ee ae oo 7 do Example ooed somaa Oech e Sib ah wg ae es 8 6 FAQ 8 1 Presentation Darn is a RNA motif search tool It finds all the subsequences that match a specified motif on some input genomic sequence s Darn uses a weighted constraint solver to localize the portions of a genomic sequence that match a motif The motif is expressed in a specific language see section 5 Some motif descriptors are provided with the software for FMN Lysine RNaseP SAM snoRNA C D box and tRNA search The predictions could be available in GFF FASTA and other formats see section 4 Darn can be use on line at this address http carlit toulouse inra fr Darn Darn was developped by Matthias Zytnicki during his PhD in the BIA lab at INRA Toulouse France Darn is written in C for Linux systems and is distributed under the GNU GPL li cence The current version is 1 0 February 10 2010 If you are satisfied to use it please cite Darn A Weighted Constraint Solver for RNA Motif Lo2. This is a trans interaction in the geometric family 2 as defined by Leontis et al If you wish to accept all geometric families given two sides and an orientation write family all DUPLEX cost function DUPLEX errors 1 model soft X1 X2 Y1 Y2 Set the presence of a duplex formed by a stem between positions X1 and X2 on the main sequence and a stem between positions Y1 and Y2 on the target sequence The duplex may contain a substitution an insertion or a deletion Notice that it is a time consuming constraint so set the distance between X1 and X2 and between Y1 and Y2 and do not use high numbers of errors If you want to allow wobble interactions add wobble yes to the list of parameters 5 3 Changing the costs For the PATTERN HELIX DUPLEX and REPETITION cost functions you can also change the costs given by the functions For example if you write PATTERN word ACGU errors 1 model soft X1 X2 0 2 then the cost given for no error is 0 as usual If one error is found a cost of 2 is given 5 4 The model parameter The PATTERN HELIX DUPLEX and REPETITION functions all have an errors parameter If the number of errors found is greater than the value of errors then the element of structure is not accepted However if you use model optional then every cost greater than errors will be set to errors If you use model hard then every cost greater than e
3. 4 Set the presence of an helix formed by a stem between positions X1 and X2 on the one hand and a stem between positions X3 and X4 on the other hand The stem should contain not less than 5 base pairings and not more than 7 base pairings The loop should contain not less than 4 nucleotides and not more than 10 nucleotides One sub stitution is allowed in the stem If you also want to allow insertions and deletions add indels yes to the list of parameters Only canonic interactions i e A U and G C are allowed If you want to allow wobble interactions i e G U add wobble yes to the list of parameters REPETITION cost function REPETITION size 5 7 distance 4 10 errors 1 model soft X1 X2 X3 X4 Set that the subsequence between positions X1 and X2 is repeated between positions X3 and X4 The size parameter give the size of the repeated subsequence and the distance parameter gives the distance between the two subsequences The number of allowed differences between the subsequences is given by the parameter error and the optional parameter indels states whether indels are allowed PAIR cost function PAIR interaction WATSON_CRICK interaction SUGAR orientation TRANS family 2 model soft X1 X2 Set a non canonic pairing between the nucleotides at positions X1 and X2 The nu cleotide at position X1 interacts with its Watson Crick side the nucleotide at position X2 interacts with its Sugar side
4. CCCCCACC CEECCOEC E Ceres wr puha EN EEE E E EREE E D oe peeve ews CEOE gts n oe Darn_Pred_3 DARN 17280 17350 0 GCGGGCATCGTATAATGGCTATTACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCCCGCTGCCCGC ECEE ARE esae FEE E emi PISI Terss CECCU eiia Darn_Pred_4 DARN 51381 51452 0 GTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGAC COBOL eo hg se the ye he ee 0 eee Ve Va acne se SIEGE Ce hears 5 4 Arguments description The syntax to call Darn is the following darn d filel s file2 o outputfile n F RIB x file3 v FESI GIPLIEN let i76 ul Ts w y drawdirectory z webdrawdirectory V V V a time Main options d filel the file that contains the descriptor s file2 the file that contains the main stem o output file a file to write the solutions default standard output n F default R B search on the forward F reverse R both B strand s on the main sequence x files the file that contains the duplex stem sequence v search from 3 to 5 on the duplex sequence Output options f S default G P F print solutions with specific S GFF G easy parsable P FASTA F format t print the secondary structure only in specific output format c print solutions with lower cost first solution score not given in FASTA output format u print all dominated solutions e print the costs given by the constraints only i
5. PACER length 4 8 model hard X10 X12 SPACER length 1 1 model hard X12 X13 SPACER length 3 6 model hard X13 X14 SPACER length 0 8 model hard X14 X15 SPACER length 0 1 model hard X16 X17 SPACER length 3 6 model hard Y1 Y2 SPACER length 3 6 model hard Y3 Y4 SPACER length 10 12 model hard Y1 Y4 6 FAQ How to report a bug or a feature required Use the Bug and Feature Tracker of the project So go to the following page https mulcyber toulouse inra fr tracker atid 528 amp group_id 15 amp func browse Click on the New link fill the description frame and submit the request I can t access directly pages related to Darn Darn is hosted by a software Forge mulcyber toulouse inra fr with secure access It is necessary to accept the certificate to access this Forge pages for example the Download page Error message Error Cannot open file for cost values By default Darn is looking for a file costs dat in the current directory To be able to call Darn from everywhere define an environment variable DARN_PATH Using tcsh shell type setenv DARN_PATH src_directory Using bash shell type export DARN_PATH src_directory To avoid to type this command in each session add it to the apropriate script Using tcsh shell add the line in the tcshrc file Using bash shell add the line in the bashrc file
6. calization M Zytnicki C Gaspin T Schiex Constraints Volume 13 2008 2 Install From archive package darn 1 0 tar gz only gec g and makedepend are re quired on the computer First download the software Go to this Internet page https mulcyber toulouse inra fr frs group_id 15 Download the current file darn 1 0 tar gz Then go to the directory containing the file Execute the following commands tar xzvf darn 1 0 tar gz cd darn make To be able to call the software from everywhere define an environment variable called DARN_PATH If lt path gt is the absolute path of darn directory execute the command setenv DARN_PATH lt path gt src if you use tcsh shell export DARN_PATH lt path gt src if you use bash shell To avoid to type this command in each user session add it to the login shell script in your home directory Using tcsh script the file is called t cshrc Using bash script the file is called bashrc 3 Run example After the installation go to the src directory and type the following command darn s example sample fa d descriptor tRNA_Bacteria des n B f P You should have the following output Darn_Pred_l DARN 9979 10050 0 GTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTTCACGGCGGTAACAGGGGT TCGAATCCCCTAGGGGAC EEEE IOC Ciara a Sunes Sees Ale COCEC detec Ve ee Cl CC eee sete Darn_Pred_2 DARN 17079 17159 0 GGTGGGGTTCCCGAGCGGCCAAAGGGAGCAGACTGTAAATCTGCCGTCACAGACTTCGAAGGTTCGAATCCTT
7. hese functions use a parameter model which is set to soft by default We will detail its meaning in subsection 5 4 PATTERN cost function PATTERN word ACGU errors 1 model soft X1 X2 Look for the word ACGU starting at position X1 and ending at position X2 with one possible error You may use the letters A C G U or T N or any ambiguous nucleotide namely B D etc to describe the word Possible errors are insertions deletions and substitutions SPACER cost function SPACER length 15 20 30 35 costs 1 5 model soft X1 X2 If the distance between positions X1 and X2 is not less than 20 and not greater than 30 then give a cost of 1 If the distance between positions X1 and X2 is less than 15 or greater than 35 then give a cost of 5 Otherwise it gives a cost between and 5 The spacer cost profile looks like this cost max cost min cost len 1 len 2 len 3 len 4 x x COMPOSITION cost function COMPOSITION nucleotides CG threshold gt 60 80 costs 1 5 model soft X1 X2 If the G C between positions X1 and X2 is not less than 80 then the given cost is 1 If it is not greater than 60 then the given cost is 5 Otherwise the cost is between 1 and 5 The composition cost profile looks like this cost max cost min cost min max G C thresh thresh HELIX cost function HELIX stem 5 7 loop 4 10 errors 1 model soft X1 X2 X3 X
8. n specific output format Web output options w output solutions using HTML markups y drawdirectory draw the solution in the given directory z webdrawdirectory WWW address to the directory containing the drawings Verbosity V verbose search VV very verbose search VVV very very verbose search VVVV verbose search for software development Miscellanous a_ ni alarm stop after n seconds 5 Motif description syntax Darn searches in the input sequence s all the subsequences that match a motif This motif has to be described in the following specific language allowing to describe the general shape of a non protein coding RNA through constraints 5 1 General shape Here is the skeleton of a descriptor TOP_VALUE n POSITIONS X_VAR Xmin Xmas Y_VAR Ymin Ymac cost functions here The first line gives the overall number of errors the candidate may have with respect to the signature This number is n On the second line the X positions refer to positions in the main sequence whereas the Y positions refer to positions in the target sequence if any Thus if you do not need any target sequence drop the Y_VAR Yimin Ymax part This line creates Xmas Xmin 1 ranging from Xx to Xx positions on the main sequence and Ymar Ymin 1 on the target sequence aa 5 2 List of available cost functions Here are some examples involving every supported cost function All t
9. rrors will not be accepted like the soft option but any cost not greater than errors will be set to zero The syntax of the functions SPACER and COMPOSITION with model hard changes a bit The SPACER only uses two lengths the minimum and the maximum lengths and the COMPOSITION only uses one threshold Both of them do not use the costs parameter 5 5 Example Here is a little example describing an H ACA box sRNA an H ACA box sRNA TOP_VALUE 3 VARIABLES X_VAR 1 18 Y_VAR 1 4 PATTERN word RA err 0 model hard X7 X8 PATTERN word GA err 1 model optional X7 X8 PATTERN word RUGA err 0 model hard X9 X10 PATTERN word ANA err 0 model hard X17 X18 PATTERN word NUNN err 0 model hard Y2 Y3 HELIX stem 7 10 loop 30 65 err 1 model soft X1 X2 X15 X16 DUPLEX err 1 model soft X3 X4 Y1 Y2 DUPLEX err 1 model soft X13 X14 Y3 Y4 COMPOSITION nucleotides GC threshold gt 75 100 costs 0 2 model soft X5 X6 COMPOSITION nucleotides GC threshold gt 70 100 costs 0 2 model soft X5 X6 COMPOSITION nucleotides GC threshold gt 65 100 costs 0 2 model soft X11 X12 SPACER length 0 8 model hard X2 X3 SPACER length 3 6 model hard X3 X4 SPACER length 1 1 model hard X4 X5 SPACER length 6 8 model hard X5 X6 SPACER length 1 1 model hard X6 X7 SPACER length 3 30 model hard X8 X9 SPACER length 1 1 model hard X10 X11 S
Download Pdf Manuals
Related Search