Sample & Assay Technologies EGFR Pyro® Handbook
Contents
1. Following the protocol for use with paraffin embedded tissue The EZ1 DNA Tissue Kit is to be used in combination with the EZ1 Advanced cat no 9001410 or 9001411 and the EZ Advanced DNA Paraffin Section Card cat no 9018298 with the EZ1 Advanced XL cat no 9001492 and the EZ1 Advanced XL DNA Paraffin Section Card cat no 9018700 or with the BioRobot EZ1 cat no 9000705 no longer available and the EZ1 DNA Paraffin Section Card cat no 9015862 Controls Unmethylated control DNA is included in the kit as a positive control for PCR and sequencing reactions In addition a negative control without template DNA should always be included 12 EGFR Pyro Handbook 09 2010 Protocol 1 Run Setup for the PyroMark Q24 System Things to do before starting If the EGFR Plug in Report for analysis has not been installed create an Assay Setup as described in Appendix A This must only be done once before running the EGFR assays for the first time see Appendix A page 35 Procedure 1 Click U in the toolbar A new run file is created 2 Enter the run parameters see Run parameters page 14 3 Set up the plate by adding assays for the 5 different sequencing reactions to wells corresponding to the samples to analyze A negative sample without template DNA and the unmethylated control DNA provided are recommended as controls 4 When the run is set up an2. Inmn EGFR Pyro Handbook 09 2010 19 Protocol 4 Preparation of Samples Prior to Pyrosequencing Analysis on the PyroMark Q24 This protocol is for preparation of single stranded DNA and annealing of the sequencing primer to the template prior to Pyrosequencing analysis on the PyroMark Q24 Important points before starting Before opening the tubes with sequencing primers centrifuge briefly to collect contents at the bottom of the tubes M Add the 5 different sequencing primers the same pattern as predefined for the plate in the run setup see Protocol 1 Run Setup for the PyroMark 924 System page 13 depending on the region of analysis codon 719 exon 18 codons 768 and 790 exon 20 codons 858 861 exon 21 or exon 19 Things to do before starting M Place the PyroMark Q24 Plate Holder on a heating block at 80 C for use in step 17 M PyroMark Wash Buffer is supplied as a 10x concentrate Before using for the first time dilute to a 1x working solution by adding 225 ml high purity water to 25 ml 10x PyroMark Wash Buffer final volume of 250 ml Procedure 1 Dilute a sufficient amount of each sequencing primer Seq Primer EGFR 719 Seq Primer EGFR 768 Seq Primer EGFR 790 Seq Primer EGFR 858 861 and Seq Primer EGFR Exon 19 Del in PyroMark Annealing Buffer as shown in Table 6 Prepare a volume of diluted sequencing primer greater than that required for the total number of samples to be sequen
3. ES CTATCACTGTCAGCTITICGATCGTCATCGTCACGC 5 10 15 20 25 30 Figure 10 Pyrogram trace obtained after analysis of samples with a GGAATTAAGAGAAGC deletion in exon 19 32 EGFR Pyro Handbook 09 2010 Troubleshooting Guide This troubleshooting guide may be helpful in solving any problems that may arise For more information see also the Frequently Asked Questions page at our Technical Support Center www giagen com FAQ FAQbList aspx The scientists in QIAGEN Technical Services are always happy to answer any questions you may have about either the information and protocols in this handbook or sample and assay technologies for contact information see back cover or visit www qiagen com Refer to the PyroMark Q24 User Manual for general troubleshooting of the instrument Comments and suggestions Signals in the no template control negative control a Cross talk between Signal from one well is detected in a neighboring wells well If re running samples avoid placing samples with high signal intensities next to no template control wells b PCR contamination Use sterile pipet tips with filters Store and extract materials such as specimens controls and amplicons separately from PCR reagents Poor or unexpected sequence a Low quality genomic Low quality genomic DNA can cause the PCR to DNA fail Analyze PCR samples using an electrophoretic technique using for example the QlAxcel System or agarose gel electrophoresis
4. Component Volume reaction Reaction mix 20 ul Sample DNA 5 ul Total volume 25 pl 5 Program the thermal cycler according to the manvfacturer s instructions using the conditions outlined in Table 4 16 EGFR Pyro Handbook 09 2010 Table 4 Optimized cycling protocol Comments Initial activation 15 min 95 HotStarTaq DNA step Polymerase is activated by this heating step 3 step cycling Denaturation 20s 95 C Annealing 30s 53 Extension 20s TIE Number of cycles 42 Final extension 5 min 72 C 6 Place the PCR tubes in the thermal cycler and start the cycling program 7 After amplification proceed with Protocol 3 Immobilization of PCR Products to Streptavidin Sepharose High Performance Beads page 18 EGFR Pyro Handbook 09 2010 17 Protocol 3 Immobilization of PCR Products to Streptavidin Sepharose High Performance Beads This protocol is for immobilization of template DNA to Streptavidin Sepharose High Performance GE Healthcare prior to analysis on the PyroMark Q24 System Things to do before starting Allow all required reagents and solutions to reach room temperature 15 25 C before starting Procedure 1 Gently shake the bottle containing Streptavidin Sepharose High Performance until it is a homogeneous solution 2 Prepare a master mix for DNA immobilization according to Table 5 Prepare a volume 1096 greater than that required for the total number of reaction
5. A2 Type the following sequence in Sequence to Analyze CAKCGTG Manually add the following Dispensation Order TCGAGTCGAT 36 EGFR Pyro Handbook 09 2010 A T 0 L i t C G A G T G A T 5 10 Figure 13 Histogram for codon 768 nucleotide 2303 with the Sequence to Analyze CAKCGTG A4 Click amp in the toolbar and save the assay as EGFR codon 768 EGFR codon 790 Al Click in the toolbar and select New AQ Assay A2 Type the following sequence in Sequence to Analyze ATCAYGCAG Manually add the following Dispensation Order CATCGACTGCA 0 Nu S a C A T c G A C T G C A 5 10 Figure 14 Histogram for codon 790 nucleotide 2369 with the Sequence to Analyze ATCAYGCAG The red rectangle at the bottom of the bar at dispensation T8 illustrates the adjustment of heights of histogram bar A4 Click the Analysis Parameters tab and increase Peak Height Threshold Required peak height for Passed quality to 30 A5 In the histogram move the mouse cursor at the upper end of the bar at dispensation T8 and click twice while holding down the Ctrl button A small window will appear showing the default height of the histogram bar 1 00 Increase the level to 1 03 Click in the toolbar and save the assay as EGFR codon 790 EGFR codons 858 861 Al Click in the toolbar and select New AQ Assay A2 Type the followi
6. Technical 800 DNA PREP 800 362 7737 China Orders 86 21 3865 3865 Fax 86 21 3865 3965 Technical 800 988 0325 Denmark Orders 80 885945 Fax 80 885944 Technical 80 885942 Finland Orders 0800 914416 Fax 0800 914415 Technical 0800 914413 France Orders 01 60 920 926 Fax 01 60 920 925 Technical 01 60 920 930 Offers 01 60 920 928 Germany Orders 02103 29 12000 Fax 02103 29 22000 Technical 02103 29 12400 Hong Kong Orders 800 933 965 Fax 800 930 439 Technical 800 930 425 Ireland Orders 1800 555 049 Fax 1800 555 048 Technical 1800 555 061 Italy Orders 800 789 544 Fax 02 334304 826 Technical 800 787980 Japan Telephone 03 6890 7300 Fax 03 5547 0818 Technical 03 6890 7300 Korea South Orders 080 000 7146 Fax 02 2626 5703 Technical 080 000 7145 Luxembourg Orders 8002 2076 Fax 8002 2073 Technical 8002 2067 Mexico Orders 01 800 7742 639 Fax 01 800 1122 330 Technical 01 800 7742 436 The Netherlands Orders 0800 0229592 Fax 0800 0229593 Technical 0800 0229602 Norway Orders 800 18859 Fax 800 18817 Technical 800 18712 Singapore Orders 1800 742 4362 Fax 65 6854 8184 Technical 1800 742 4368 Spain Orders 91 630 7050 Fax 91 630 5145 Technical 91 630 7050 Sweden Orders 020 790282 Fax 020 790582 Technical 020 798328 Switzerland Orders 055 254 22 11 Fax 055 254 22 13 Technical 055 254 22 12 UK Orders 01293 422 911 Fax 01293 422 9
7. Pyro Handbook 09 2010 At the end of a working day liquid waste and remaining solutions should be discarded and the PyroMark Q24 Vacuum Workstation should be checked for dust and spillage see Appendix B page 39 17 Heat the PyroMark Q24 Plate with the samples at 80 C for 2 min using the prewarmed PyroMark Q24 Plate Holder 18 Remove the PyroMark Q24 Plate from the plate holder and let the samples cool to room temperature 15 25 for 5 10 min 19 Proceed with Protocol 5 Running of the PyroMark Q24 System page 24 EGFR Pyro Handbook 09 2010 23 Protocol 5 Running the PyroMark Q24 System This protocol describes the loading of PyroMark Gold Reagents into the PyroMark Q24 Cartridge and starting and finishing a run on the PyroMark 924 System For a detailed description about how to set up a run see the PyroMark Q24 User Manual Important point before starting The Pre Run information report found in the Tools menu at run setup see Protocol 1 Run Setup for the PyroMark Q24 System page 13 provides information about the volume of nucleotides enzyme and substrate buffer needed for a specific run Things to do before starting M Switch on the PyroMark Q24 The power switch is located at the rear of the instrument Procedure 1 Open the Buffers and Reagents box and remove the vials containing freeze dried enzyme and substrate mixtures and the vials containing nucleotides 2 Dissolve the freeze dried enz
8. Reagents incorrectly Prepare the PyroMark Q24 Gold Reagents stored or diluted according to the instructions supplied with the reagents 34 EGFR Pyro Handbook 09 2010 Appendix A Setting Up EGFR Pyro Assays If the EGFR Plug in Report has been installed use the assay setups supplied for codons 719 768 790 and 858 861 and exon 19 deletions The following steps do not need to be performed The EGFR Plug in Report can be obtained from pyro plugin Qgiagen com We strongly recommend the use of the EGFR Plug in Report over manual analysis Complex mutations can not be added manually to a Sequence to Analyze and have to be analyzed using the plug in After installation of the plug in or each time new software is installed or upgraded on the computer the correct function of the plug in should be verified as described in the EGFR Plug In Quick Guide If the EGFR Plug in Report has not been installed the assay file must be set up manually before running the EGFR Pyro assay for the first time as described below Procedure Set up the assay for EGFR codon 719 by using the PyroMark Q24 Software EGFR codon 719 Al Click in the toolbar and select New AQ Assay A2 Type the following sequence in Sequence to Analyze DGCTCCGGTGC The most frequent mutations in codon 719 will be detected in nucleotide 2155 using this Sequence to Analyze The Sequence to Analyze can be changed after the run to analyze for mutations at nucleotid
9. Spin 61104 Blood Mini Kit Columns Buffers Reagents Tubes VacConnectors PAXgene Tissue For collection fixation and stabilization 765112 Containers 10 of 10 samples 10 Prefilled Reagent Containers containing PAXgene Tissue Fix and PAXgene Tissue Stabilizer PAXgene Tissue DNA For 50 DNA preps PAXgene DNA Mini 767134 Kit 50 Spin Columns Processing Tubes Microcentrifuge Tubes Carrier RNA and Buffers to be used in conjunction with PAXgene Tissue Containers For up to date licensing information and product specific disclaimers see the respective QIAGEN kit handbook or user manual QIAGEN kit handbooks and user manuals are available at www giagen com or can be requested from QIAGEN Technical Services or your local distributor EN 42 EGFR Pyro Handbook 09 2010 Trademarks QIAGEN QlAamp QlAxcel BioRobot CoralLoad EpiTect EZ1 HotStarTaq MinElute Pyro Pyrogram PyroMark Pyrosequencing QIAGEN Group Milli Q Millipore Corporation PAXgene PreAnalytiX GmbH Sepharose GE Healthcare Windows Microsoft Corporation Limited License Agreement Use of this product signifies the agreement of any purchaser or user of the EGFR Pyro Kit to the following terms 1 vios The Pyro Kit may be used solely in accordance with the EGFR Pyro Handbook and for use with components contained in the kit only QIAGEN grants no license under any of its intellectual proper
10. at 15 to 25 C upon arrival The Pyro Buffers and Reagents box 2 2 containing buffers enzyme mixture substrate mixture dATPaS dCTP dGTP and dTTP the reagents for Pyrosequencing analysis is shipped on cool packs These components should be stored at 2 8 C upon arrival To minimize loss of activity it is advisable to keep both the enzyme mixture and the substrate mixture in the vials supplied Reconstituted enzyme and substrate mixtures are stable for at least 5 days at 2 8 C Reconstituted enzyme and substrate mixtures can be frozen and stored in their vials at 215 to 25 Frozen reagents should not be subjected to more than 3 freeze thaw cycles Important Nucleotides should not be frozen The EGFR Pyro Kit is stable until the kit expiration date when stored under these conditions EGFR Pyro Handbook 09 2010 5 Product Use Limitations The EGFR Pyro Kit is intended for molecular biology applications This product is not intended for the diagnosis prevention or treatment of a disease All due care and attention should be exercised in the handling of the products We recommend all users of QIAGEN products to adhere to the NIH guidelines that have been developed for recombinant DNA experiments or to other applicable guidelines Product Warranty and Satisfaction Guarantee QIAGEN guarantees the performance of all products in the manner described in our product literature The purchaser must determine the suitabil
11. our products This information is helpful to other scientists as well as to the researchers at QIAGEN We therefore encourage you to contact us if you have any suggestions about product performance or new applications and techniques For technical assistance and more information please see our Technical Support Center at www giagen com Support or call one of the QIAGEN Technical Service Departments or local distributors see back cover or visit www qiagen com 6 EGFR Pyro Handbook 09 2010 Quality Control In accordance with QIAGEN s ISO certified Quality Management System each lot of the EGFR Pyro Kit is tested against predetermined specifications to ensure consistent product quality Safety Information When working with chemicals always wear a suitable lab coat disposable gloves and protective goggles For more information please consult the appropriate material safety data sheets MSDSs These are available online in convenient and compact PDF format at www giagen com support MSDS aspx where you can find view and print the MSDS for each QIAGEN kit and kit component 24 hour emergency information Emergency medical information in English French and German can be obtained 24 hours a day from Poison Information Center Mainz Germany Tel 49 6131 19240 N EGFR Pyro Handbook 09 2010 7 Introduction The EGFR Pyro Kit enables quantitative measurement of mutations in codons 719 768 790 858 and 861 as well as d
12. overview of the results click one of the Analyze buttons Qu Analyze all wells Qus Analyze the selected well s The analysis results allele frequencies and quality assessment are displayed above the variable position in the Pyrogram trace For more details on how to analyze a run see the PyroMark Q24 User Manual 7 To generate a report select AQ Analysis Results or AQ Full Report in the menu The standard Sequence to Analyze as defined in the Analysis Setup addresses the most frequent mutations in codons 719 768 790 858 and 861 and the most frequent deletion in exon 19 see Appendix A page 35 If a sample contains a less frequent mutation the Sequence to Analyze can be changed to analyze also the mutation status at this position as described in Appendix A Updated frequencies of mutations in the human EGFR gene are provided online by the Sanger Institute at www sanger ac uk genetics CGP cosmic We recommend single peak heights above 20 RLU for the codon 768 assay and 30 RLU for the remaining 4 assays Set 20 or 30 RLU respectively as the required peak height for passed quality in assay setup see Appendix A and the PyroMark Q24 User Manual EGFR Pyro Handbook 09 2010 27 To allow proper quantification of codon 719 and codon 790 adjust the heights of the histogram bars in the assay setup see Appendix A page 35 The AQ Analysis Results report should be used for documentation of allele qu
13. supplied with the cartridge 23 Analyze the run according to Protocol 6 Analysis of a PyroMark Q24 Run page 26 EGFR Pyro Handbook 09 2010 25 Protocol 6 Analysis of a PyroMark Q24 Run This protocol describes the mutation analysis of a finished EGFR run using PyroMark Q24 Software Procedure 1 2 26 Insert the USB stick containing the processed run file into the computer s USB port Move the run file from the USB stick to the desired location on the computer using Windows Explorer Open the run file in the AQ mode of PyroMark Q24 Software either by selecting Open in the File menu or by double clicking the file 9 in the shortcut browser There are 2 methods for analyzing the run If using the EGFR Plug in Report go to step 5 If using the AQ analysis integral to the PyroMark Q24 System go to step 6 Note We strongly recommend using the EGFR Plug in Report This report ensures that the correct LODs are used and different sequences to analyze are automatically used to detect all mutations and deletions Using the EGFR Plug in Report To generate a report select AQ Add On Reports EGFR and Exon 18 Codon 719 or Exon 19 Deletions or Exon 20 Codon 768 or Exon 20 Codon 790 or Exon 21 Codons 858 to 961 from Reports in the menu 024 2 0 6 AQ Run Analysis C EGFR EGFR Example run 3 File Tools Reports Window Help 3 uU m A
14. 22 Technical 01293 422 999 2060606 USA Orders 800 426 8157 Fax 800 718 2056 Technical 800 DNA PREP 800 362 7737 QIAGEN Sample amp Assay Technologies
15. Q Analysis Statistics E L3 Shortcuts AQ Analysis Results Example AQ Pyrogram Report E Py 9 AQ Full Report 7 E A SNP Analysis Results Exon 20 Codon 768 CTG SNP Pyrogram Report Exon 20 Codon 790 Exar SNP Full Report Exon 21 Codons 858 to 861 n El SNP Overview Report 19 de l EGFR Exon 1 Exon 19 Deletions d Mutation I Mutaion2 Mutation 3 Mutaiond EGFR Exon 19 de EGFR Exon 18 de EGFR Exon 19 de EGFR Exon 19 de Mutation 1 Mutation 2 Mutation 3 Mutation 4 The wells will automatically be analyzed for all mutations for which LOD is given in Table 7 page 29 The results will be presented in an overview Pyro Handbook 09 2010 table see example below followed by the detailed results containing for example Pyrograms and analysis quality Summary Bl Mutationl Mutation 22354115 5 5 Mutation 2236del15 B3 Mutation3 Mutation 2240del18 5 3 delL747 P753insS B4 Mutation4 Mutation 2240del15 10 4 Bs Mutations Mutation 2239 2248 gt 11 3 delL747 A750insP 9 e B6 Mutaton Mutation 2237 2255 gt delE746 S752insV cs Mutations Mutation 2239 2248 gt c 15 6 delL747 A750inP __ ____ 22372231 ____ 136 delE746 S752insv eS opes ee 6 Using AQ analysis To analyze the EGFR run and get an
16. September 2010 EGFR Pyro Handbook For quantitative measurement of mutations in codons 719 768 790 858 and 861 as well as deletions and complex mutations in exon 19 of the human EGFR gene QIAGEN Sample amp Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies enabling the isolation and detection of contents of any biological sample Our advanced high quality products and services ensure success from sample to result QIAGEN sets standards in Purification of DNA RNA and proteins Nucleic acid and protein assays microRNA research and RNAi Automation of sample and assay technologies Our mission is to enable you to achieve outstanding success and breakthroughs For more information visit www giagen com Contents Kit Contents 4 Shipping and Storage 5 Product Use Limitations 6 Product Warranty and Satisfaction Guarantee 6 Technical Assistance 6 Quality Control 7 Safety Information 7 Introduction 8 Principle and procedure 9 Equipment and Reagents to Be Supplied by User 10 Important Notes 11 General precautions 11 Sample material 11 DNA isolation 11 Controls 12 Protocols E 1 Run Setup for the PyroMark Q24 System 13 B 2 PCR Using the PCR Reagents Supplied with the EGFR Pyro Kit 15 3 Immobilization of PCR Products to Streptavidin Sepharose High Performance Beads 18 B 4 Preparation of Samples Prior to Pyros
17. antification The numbers shown in the Pyrogram are rounded and do not show the exact quantification Reanalysis of samples with no mutation detected with standard Sequence to analyze or with Check or Failed quality assessment We strongly recommend reanalyzing all samples with no mutation detected with the standard Sequence to Analyze as well as samples that received Check or Failed quality assessment Check and Failed quality assessments may indicate a mutation in another position resulting in unexpected reference peaks To reanalyze and target less frequent mutations go to Analysis Setup and change Sequence to Analyze to variants described in Appendix A Click Apply and then click To All when the Apply Analysis Setup window appears Note Ensure the threshold for single peak height and the height of histogram bars are adjusted accordingly see Appendix A page 35 Rerunning samples for detection of low level mutations It is strongly recommended that a normal sample is included in every run for comparison Any sample showing a mutation frequency higher than the corresponding position in the normal sample should be examined in relation to the table showing the limit of detection see Table 7 page 29 If using the EGFR Plug in Report this is performed automatically As a guide samples that have a suspected mutation in the range from LOD Table 7 to LOD 3 units should be reanalyzed in duplicate together wi
18. ater Milli Q 18 2 MO x cm www millipore com or equivalent Procedure B1 Ensure that no vacuum is applied to the vacuum tool Make sure that the vacuum is closed Off and the vacuum pump is switched off B2 Discard any solutions left in the troughs B3 Rinse the troughs with high purity water or replace them if necessary Empty the waste container The cap can be removed without disconnecting the tubing B5 If the vacuum workstation must be cleaned for example due to dust or spillage follow the instructions in the PyroMark Q24 User Manual EGFR Pyro Handbook 09 2010 39 References QIAGEN maintains a large up to date online database of scientific publications utilizing QIAGEN products Comprehensive search options allow you to find the articles you need either by a simple keyword search or by specifying the application research area title etc For a complete list of references visit the QIAGEN Reference Database online at www qiagen com RefDB search asp or contact QIAGEN Technical Services or your local distributor ss n M IM H C 40 EGFR Pyro Handbook 09 2010 Ordering Information Product EGFR Pyro Kit 24 PyroMark Q24 PyroMark Q24 Vacuum Workstation PyroMark Q24 Software Accessories PyroMark Q24 Plate 100 PyroMark Q24 Cartridge 3 PyroMark Vacuum Prep Filt
19. b Unexpected rare A Check or Failed quality assessment can be mutation caused by an unexpected pattern of peaks This might indicate an unexpected mutation which is not analyzed by the standard Sequence to Analyze These samples should be analyzed using the alternative Sequences to Analyze considering unexpected mutations Check or failed result a Rare mutation not Adjust the sequence to analyze in the assay setup defined in the assay see Appendix A page 35 and reanalyze the setup run EGFR Pyro Handbook 09 2010 33 Comments and suggestions b Low peak height Handling errors in PCR setup or sample preparation prior to Pyrosequencing can result in low peaks It is recommended to reanalyze the sample c Warning message Background noise at dispensation T8 is below Uncertain Failed due expected level Adjust the height of the histogram to high peak height bar to the default value 1 00 only possible deviation at when using the analysis tool integral to the dispensation 8 is PyroMark Q24 System appearing in the codon 790 assay High background Incorrect storage of Store nucleotides at 2 8 C Storage at nucleotides 15 to 25 C can cause an increase in the background No signals in positive control unmethylated control DNA a Insufficient enzyme or sure to fill the PyroMark Q24 Cartridge substrate mix for all according to the Pre Run Information in the wells Tools menu b
20. ced for the number of samples one extra 20 EGFR Pyro Handbook 09 2010 Table 6 Example dilution of the sequencing primers Volume for Component Volume sample 9 1 reactions Seq Primer EGFR 719 or Seq Primer EGFR Ex 19 Del or Seq Primer EGFR 768 or 0 8 ul 8 ul Seq Primer EGFR 790 or Seq Primer EGFR 858 861 PyroMark Annealing Buffer 24 2 ul 242 ul Total volume 25 pl 250 pl 2 Add 25 ul of diluted sequencing primer to each well of the PyroMark 924 Plate according to the run setup see Protocol 1 Run Setup for the PyroMark Q24 System page 13 Keep one of the PyroMark Q24 Plate Holders supplied with the PyroMark Q24 Vacuum Workstation at room temperature 15 25 and use it as support when preparing and moving the plate 3 Place the PCR plate or strips from Protocol 3 and the PyroMark Q24 Plate on the worktable Figure 2 Ensure that the plate is in the same orientation as when samples were loaded Figure 2 Placement of PCR plate or strips and PyroMark Q24 plate on the vacuum workstation 4 Apply vacuum to the tool by switching on the vacuum EGFR Pyro Handbook 09 2010 21 10 11 12 13 14 15 16 22 Carefully lower the filter probes of the vacuum tool into the PCR plate or strips to capture the beads containing immobilized template Hold the probes in place for 15 s Take care when picking up the vacuum tool Sephar
21. d ready to run on the PyroMark Q24 System print a list of required volumes of enzyme mix substrate mix and nucleotides and the plate setup Select Pre Run Information from the Tools menu and when the report appears click 3 5 Close the run file and copy it to a USB stick supplied with the system using Windows Explorer The printed Pre Run Information can be used as a template for the sample set up see Protocol 3 Immobilization of PCR Products to Streptavidin Sepharose High Performance Beads page 18 To run the plate on PyroMark Q24 see Protocol 5 Running of the PyroMark Q24 System page 24 SSS Xr EGFR Pyro Handbook 09 2010 13 Run parameters Run name The name of the run is given when the file is saved Renaming the file also changes the name of the run Instrument method Select the instrument method according to the reagents and cartridge that will be used for the run see the instructions supplied with the products Plate ID Optional Enter ID of the PyroMark Q24 Plate Bar code Optional Enter a bar code number for the plate or if you have a bar code reader connected to your computer place the mouse cursor in the Barcode text box by clicking the box and scan the bar code Kit and Reagent ID Optional Enter the lot number for the EGFR Pyro Kit to be used The lot number can be found on the product label We recom
22. e 2156 To check if mutations are present at nucleotide 2156 change the Sequence to Analyze to the following sequence GSCTCCGGTGC Note Ensure the threshold for single peak height is set to 30 RLU In addition ensure that the heights of histogram bars are adjusted correctly see instructions below A3 Manually enter the following Dispensation Order ATGTCACTCGTG EGFR Pyro Handbook 09 2010 35 Figure 11 Histogram for codon 719 nucleotide 2155 with the Sequence to Analyze DGCTCCGGTGC The red rectangle at the bottom of the bar at dispensation C5 illustrates the adjustment of heights of histogram bar Figure 12 Histogram for codon 719 nucleotide 2156 with the Sequence to Analyze GSCTCCGGTGC The red rectangle at the bottom of the bar at dispensation C5 illustrates the adjustment of heights of histogram bar A4 Click the Analysis Parameters tab and increase Peak Height Threshold Required peak height for Passed quality to 30 A5 In the histogram move the mouse cursor at the upper end of the bar at dispensation C5 and click while holding down the Ctrl button A small window will appear showing the default height of the histogram bar 1 00 Increase the level to 1 04 for Sequence to Analyze DGCTCCGGTGC and to 2 04 for Sequence to Analyze GSCTCCGGTGC A6 Click amp in the toolbar and save the assay as EGFR codon 719 EGFR codon 768 Al Click in the toolbar and select New AQ Assay
23. e Run information report found in the Tools menu at run setup 7 Open the cartridge gate and insert the filled reagent cartridge with the label facing out Push the cartridge in fully and then push it down 8 Ensure the line is visible in front of the cartridge and close the gate 9 Open the plate holding frame and place the plate on the heating block 10 Close the plate holding frame and the instrument lid 11 Insert the USB stick containing the run file into the USB port at the front of the instrument Note Do not remove the USB port before the run is finished 12 Select Run in the main menu using the gt and screen buttons and press OK 13 Select the run file using the and screen buttons Note To view the contents of a folder select the folder and press Select To go back to the previous view press Back 14 When the run file is selected press Select to start the run 15 When the run is finished and the instrument confirms that the run file has been saved to the USB stick press Close 16 Remove the USB stick 17 Open the instrument lid 18 Open the cartridge gate and remove the reagent cartridge by lifting it up and pulling it out 19 Close the gate 20 Open the plate holding frame and remove the plate from the heating block 21 Close the plate holding frame and the instrument lid 22 Discard the plate and clean the cartridge as per the instructions in the product sheet
24. eletions and complex mutations in exon 19 of the human EGFR gene The kit consists of 4 PCR assays one for detecting mutations in codon 719 exon 18 one for detecting mutations in codons 768 and 790 exon 20 one for detecting mutations in codons 858 to 861 exon 21 as well as one for detecting deletions and complex mutations in exon 19 The 4 regions are amplified separately by PCR and sequenced through the defined region The amplicon covering codons 768 and 790 is divided into 2 sequencing reactions Sequences surrounding the defined positions serve as normalization and reference peaks for quantification and quality assessment of the analysis Exon 18 FETIS Seq 719 codon 719 gt gt GGCTCCGGTG FP Seq RPB 719 Ex19del 19 del gt gt Exon 19 RPB Ex 19 del Exon 20 FP 768 790 Seq 768 codons 768 ep gt C AGC GT and 790 768 790 FP 768 790 Seq 790 gt gt ATCIACGICA RPB 768 790 Exon 21 858 861 Seq 858 861 858 861 m gt GCCAAAKTGICTGGG RPB 858 861 Figure 1 Illustration of the EGFR assay The sequence indicated is the analyzed sequence for a normal sample FP Forward PCR primers RPB Reverse PCR primers B indicates biotinylation Seq Sequencing primers All mutations are sequenced in the forward direction 8 EGFR Pyro Handbook 09 2010 The kit consists of a PCR prim
25. equencing Analysis on the PyroMark Q24 20 B 5 Running the PyroMark Q24 System 24 B 6 Analysis of a PyroMark Q24 Run 26 Troubleshooting Guide 33 Appendix A Setting Up EGFR Pyro Assays 35 Appendix B Emptying the Waste Container and Troughs 39 References 40 Ordering Information 41 EGFR Pyro Handbook 09 2010 3 Kit Contents EGFR Pyro Kit box 1 2 EGFR Pyro Kit 24 Catalog no 970480 Number of reactions 24 Seq Primer EGFR 719 24 ul Seq Primer EGFR Ex 19 Del 24 ul Seq Primer EGFR 768 24 ul Seq Primer EGFR 790 24 ul Seq Primer EGFR 858 861 24 ul PCR Primer EGFR 719 24 ul PCR Primer EGFR Ex19 Del 24 ul PCR Primer EGFR 768 790 24 ul PCR Primer EGFR 858 861 24 ul PyroMark PCR Master Mix 2x 2 x 850 ul CoralLoad Concentrate 10x 1 2 ml H2O 5x 1 9 ml Unmethylated Control DNA 10 ng ul 100 ul 4 EGFR Pyro Handbook 09 2010 Pyro Buffers and Reagents box 2 2 Pyro Buffers and Reagents PyroMark Binding Buffer 2x10 ml PyroMark Annealing Buffer 2x10 ml PyroMark Denaturation Solution 2x250ml PyroMark Wash Buffer 10x 2x25ml Enzyme Mixture 2 vials Substrate Mixture 2 vials dATPaS 2 1180 ul dCTP 2 1180 ul dGTP 2 1180 ul dTTP 2x 1180 ul Handbook 1 Contains sodium hydroxide Shipping and Storage The EGFR Pyro Kit is shipped in two boxes The EGFR Pyro Kit box 1 2 is shipped on dry ice PyroMark PCR Master Mix CoralLoad Concentrate unmethylated control DNA and all primers should be stored
26. er Probe 100 PyroMark Control Oligo PyroMark Q24 Validation Oligo Contents For 24 reactions on PyroMark Q24 Systems Seq Primers PCR Primers Unmethylated Control DNA PyroMark PCR Master Mix CoralLoad Concentrate PyroMark Binding Buffer PyroMark Annealing Buffer PyroMark Denaturation Solution PyroMark Wash Buffer Enzyme Mixture Substrate Mixture dATPaS dCTP dGTP dTTP and H O Sequence based detection platform for Pyrosequencing of 24 samples in parallel Vacuum Workstation for preparing 24 samples in parallel from PCR product to single stranded template Analysis software 24 well sequencing reaction plate Cartridges for dispensing nucleotides and reagents Reusable filter probes for PyroMark Vacuum Workstation Q96 and Q24 For installation check of system For performance confirmation of system Pyro Handbook 09 2010 Cat no 970480 9001514 9001518 220 V 9001516 110 V 9001519 100 V 9019062 979201 979202 979010 979203 979204 41 Product Contents Cat no Related products DNA FFPE For 50 DNA preps 50 QlAamp 56404 Tissue Kit 50 MinElute Columns Proteinase K Buffers Collection Tubes 2 ml EZ1 DNA Tissue Kit For 48 preps Reagent Cartridges 953034 48 Tissue Disposable Filter Tips Disposable Tip Holders Sample Tubes 2 ml Elution Tubes 1 5 ml Buffer G2 Proteinase K QlAamp DSP DNA For 50 preps QlAamp Mini
27. er mix and sequencing primer s for each assay The primers are delivered in solution Each vial contains 24 ul of each primer or primer mix Principle and procedure The workflow below illustrates the assay procedure After PCR using primers targeting exons 18 19 20 and 21 the amplicons are immobilized on Streptavidin Sepharose High Performance beads Single stranded DNA is prepared and the corresponding sequencing primers anneal to the DNA The samples are then analyzed on the PyroMark Q24 System using a run setup file and a run file It is recommended to use the EGFR Plug in Report to analyze the run However the run can also be analyzed using the analysis tool integral to the PyroMark Q24 System The Sequence to Analyze can be then adjusted for detection of different deletions in exon 19 and of rare mutations in the other exons after the run see Protocol 6 Analysis of a PyroMark Q24 Run page 26 and Appendix A page 35 Workflow of EGFR Pyro procedure Assay and run setup Sample preparation PCR Protocol 2 Assay file setup Appendix A Immobilization Protocol 3 Y Run file setup Protocol 1 Preparation of samples Protocol 4 Bu c PyroMark Q24 run Protocol 5 Y Analysis of PyroMark Q24 run Protocol 6 Y Report EGFR Pyro Handbook 09 2010 9 Equipment and Reagents to Be Supplied by User When working with chemicals always wear a suitable lab coat disposable gloves and protective goggles For more in
28. formation consult the appropriate material safety data sheets MSDSs available from the product supplier M DNA isolation kit see DNA isolation page 11 Pipets adjustable Sterile pipet tips with filters for PCR setup Benchtop microcentrifuge Thermal cycler and appropriate PCR tubes Streptavidin Sepharose High Performance GE Healthcare cat no 17 5113 01 www gelifesciences com PyroMark Q24 cat no 9001514 PyroMark Q24 Software cat no 9019062 PyroMark Q24 Plate cat no 979201 PyroMark Q24 Cartridge cat no 979202 PyroMark Q24 Vacuum Workstation cat no 9001518 220V or 9001516 110V or 9001519 100V Plate mixer for immobilization to beads Heating block capable of attaining 80 24 well PCR plate or strips Strip caps High purity water Milli Q 18 2 MQ x cm or equivalent Note Sufficient water is provided in the kit for PCR to dissolve the enzyme mixture and the substrate mixture and for preparation of the master mix for DNA immobilization additional high purity water is required to dilute PyroMark Wash Buffer 10x Ethanol 70 10 EGFR Pyro Handbook 09 2010 Important Notes General precautions The user should always pay attention to the following M Strict compliance with the user manual is required for optimal results Dilution of the reagents other than as described in this handbook is not recommended and will result in a loss of performance E Use sterile pipet ti
29. gs to do before starting Before opening the tubes with PCR primers centrifuge briefly to collect contents at the bottom of the tubes Adjust the concentration of the control and sample DNA if necessary to 0 4 2 ng ul Procedure 1 Thaw all necessary components see Table 2 Mix well before use 2 Prepare a reaction mix for each PCR primer set according to Table 2 The reaction mix typically contains all of the components needed for PCR except the sample Prepare a volume of reaction mix greater than that required for the total number of PCR assays to be performed EGFR Pyro Handbook 09 2010 15 Table 2 Preparation of reaction mix for each PCR primer mix Component Volume reaction PyroMark PCR Master Mix 2x 12 5 ul CoralLoad Concentrate 10x 2 5 ul PCR Primer EGFR 719 or 1 ul PCR Primer EGFR Ex 19 Del or PCR Primer EGFR 768 and 790 or PCR Primer EGFR 858 861 Water supplied 4 ul Total volume 20 pl 3 Mix the reaction mix thoroughly and dispense 20 ul into each PCR tube It is not necessary to keep PCR tubes on ice since HotStarTaq DNA Polymerase is inactive at room temperature 4 Add 5 ul template DNA 2 10 ng of genomic DNA to the individual PCR tubes Table 3 and mix thoroughly A negative control without template DNA should always be included Include a reaction with unmethylated control DNA as positive control see Controls page 12 Table 3 Preparation of PCR
30. gure 16 Histogram for exon 19 del Click the Analysis Parameters tab and increase Peak Height Threshold Required peak height for Passed quality to 30 Click H in the toolbar and save the assay as EGFR Exon 19 del Pyro Handbook 09 2010 Appendix B Emptying the Waste Container and Troughs WARNING A Hazardous chemicals The Denaturation Solution used with the vacuum workstation contains sodium hydroxide which is irritating to eyes and skin Always wear safety glasses gloves and a lab coat The responsible body e g laboratory manager must take the necessary precautions to ensure that the surrounding workplace is safe and that the instrument operators are not exposed to hazardous levels of toxic substances chemical or biological as defined in the applicable Material Safety Data Sheets MSDSs or OSHA ACGIH or COSHH documents Venting for fumes and disposal of wastes must be in accordance with all national state and local health and safety regulations and laws OSHA Occupational Safety and Health Administration United States of America t ACGIH American Conference of Government Industrial Hygienists United States of America COSHH control of Substances Hazardous to Health United Kingdom Be sure to observe federal state and local environmental regulations for the disposal of laboratory waste Important point before starting M This protocol requires high purity w
31. ity of the product for its particular use Should any product fail to perform satisfactorily due to any reason other than misuse QIAGEN will replace it free of charge or refund the purchase price We reserve the right to change alter or modify any product to enhance its performance and design If a QIAGEN product does not meet your expectations simply call your local Technical Service Department or distributor We will credit your account or exchange the product as you wish Separate conditions apply to QIAGEN scientific instruments service products and to products shipped on dry ice Please inquire for more information A copy of QIAGEN terms and conditions can be obtained on request and is also provided on the back of our invoices If you have questions about product specifications or performance please call QIAGEN Technical Services or your local distributor see back cover or visit www giagen com Technical Assistance At QIAGEN we pride ourselves on the quality and availability of our technical support Our Technical Service Departments are staffed by experienced scientists with extensive practical and theoretical expertise in sample and assay technologies and the use of QIAGEN products If you have any questions or experience any difficulties regarding the EGFR Pyro Kit or QIAGEN products in general please do not hesitate to contact us QIAGEN customers are a major source of information regarding advanced or specialized uses of
32. mend entering both the reagent ID and the kit ID so that any unexpected problems with the reagents can be traced Run note Optional Enter a note about the contents or purpose of the run Add assay files To add an assay to a well you can either Right click the well and select Load Assay from the context menu E Select the assay in the shortcut browser and click and drag the assay to the well A well is color coded according to the assay loaded to the well Enter sample IDs and notes To enter a sample ID or note select the cell and enter the text To edit a sample ID or note either select the cell the current contents will be selected or double click the cell 14 EGFR Pyro Handbook 09 2010 Protocol 2 PCR Using the PCR Reagents Supplied with the EGFR Pyro Kit This protocol is for 4 separate PCR amplifications of regions containing codon 719 exon 18 codons 768 and 790 exon 20 codons 858 861 exon 21 or deletions and complex mutations in exon 19 using the EGFR Pyro Primers Important points before starting The HotStarTag DNA Polymerase in the PyroMark Master Mix requires an activation step of 15 min at 95 Setup all reaction mixtures in an area separate from that used for DNA purification adding template DNA to the PCR PCR product analysis or preparation of samples prior to Pyrosequencing analysis M Use disposable tips containing hydrophobic filters to minimize cross contamination Thin
33. ng sequence in Sequence to Analyze CKGGCCAAACDGCTGGGT Manually add the following Dispensation Order ATCGTGCAAGCATGCTG EGFR Pyro Handbook 09 2010 37 3 5 m ee A T G T G G C A T G T 5 Figure 15 Histogram for codons 858 861 with the Sequence to Analyze CKGGCCAAACDGCTGGGT A4 Click the Analysis Parameters tab and increase Peak Height Threshold Required peak height for Passed quality to 30 A5 Click amp in the toolbar and save the assay as EGFR codons 858 861 EGFR Exon 19 del A1 Click in the toolbar and select New AQ Assay A2 Type the following sequence in Sequence to Analyze A3 A4 A5 38 TATCAA GGAATTAAGAGAAGC AACATCTCCGAAAGCCAACAAGGA The most frequent deletion in exon 19 is 2235del15 To analyze for other deletions the Sequence to Analyze has to be changed according to each defined deletion Use the wt sequence TATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAA ATCCTCGAT and add squared brackets where the deletion starts and ends For the second most frequent deletion in exon 19 2236del15 change Sequence to Analyze to the following Manually add the following Dispensation Order CTATCACTGTCAGCTCGATCGTCATCGTCACGC 4 3 2 nil ll E J A GUT GUT l 5 10 15 20 25 30 Fi
34. ose beads sediment quickly If more than 1 min has elapsed since the plate or strips was agitated agitate again for 1 min before capturing the beads Transfer the vacuum tool to the trough containing 40 ml 7096 ethanol trough 1 Figure 2 Flush the filter probes for 5 s Transfer the vacuum tool to the trough containing 40 ml Denaturation Solution trough 2 Figure 2 Flush the filter probes for 5 s Transfer the vacuum tool to the trough containing 50 ml Wash Buffer trough 3 Figure 2 Flush the filter probes for 10 s Raise the vacuum tool up and back beyond 90 vertical for 5 s to drain liquid from the filter probes Figure 3 Figure 3 Illustration of the vacuum tool raised to beyond 90 vertical While the vacuum tool is held over the PyroMark Q24 Plate close the vacuum switch on the tool Off Release the beads in the plate containing the Seq Primers by shaking the tool gently from side to side Transfer the vacuum tool to the trough containing high purity water trough 4 Figure 2 and agitate it for 10 s Wash the filter probes by lowering the probes into high purity water trough 5 Figure 2 and applying vacuum Flush the probes with 70 ml high purity water Raise the vacuum tool up and back beyond 90 vertical for 5 s to drain liquid from the filter probes Figure 3 Close the vacuum switch on the tool Off and place the vacuum tool in the Parking P position Turn off the vacuum pump
35. ps with filters for PCR setup M Store and extract positive materials specimens positive controls and amplicons separately from all other reagents and add them to the reaction mix in a spatially separated facility Thaw all components thoroughly at room temperature 15 25 before starting an assay When thawed mix the components by pipetting repeatedly up and down or by pulse vortexing and centrifuge briefly Sample material All samples must be treated as potentially infectious material Specimen material is human DNA extracted from blood or formalin fixed paraffin embedded samples Samples from humans undergoing heparin treatment must not be used Blood samples that have been collected in tubes containing heparin as an anticoagulant should not be used Heparin affects the PCR DNA isolation The QIAGEN kits shown in Table 1 page 12 are recommended for DNA purification from the indicated human sample types for use with the EGFR Pyro Kit Carry out the DNA purification according to the instructions in the kit handbooks EGFR Pyro Handbook 09 2010 11 Table 1 DNA purification kits recommended for use with the EGFR Pyro Kit Catalog number Sample material Nucleic acid isolation kit QIAGEN GlAamp DNA FFPE Tissue Kit 50 56404 Paraffin embedded EZ1 DNA Tissue Kit 48 953034 fsste PAXgene Tissue Containers 10 765112 PAXgene Tissue DNA Kit 50 767134 Blood GlAamp DSP DNA Blood Mini Kit 61104
36. s to be performed Table 5 Master mix for DNA immobilization Component Volume sample Streptavidin Sepharose High Performance 2 ul PyroMark Binding Buffer 40 ul Water supplied 28 ul Total volume 70 pl 3 Add 70 ul of the master mix to wells of a 24 well PCR plate or strips as predefined in the run setup see Protocol 1 Run Setup for the PyroMark Q24 System page 13 4 Add 10 pl of biotinylated PCR product from Protocol 2 to each well containing master mix as predefined in the run setup see Protocol 1 Run Setup for the PyroMark Q24 System page 13 The total volume per well should be 80 ul after addition of the master mix and PCR product 5 Seal the PCR plate or strips using strip caps Ensure that no leakage is possible between the wells 18 EGFR Pyro Handbook 09 2010 6 Agitate the PCR plate at room temperature 15 25 for 5 10 min at 1400 rpm During this step prepare the PyroMark Q24 Vacuum Workstation for sample preparation as described in the PyroMark Q24 User Manual 7 Proceed immediately with Protocol 4 Preparation of Samples Prior to Pyrosequencing Analysis on the PyroMark Q24 page 20 Sepharose beads sediment quickly If more than 1 min has elapsed since the plate or strips was agitated agitate again for 1 min before capturing the beads A
37. th a normal sample in duplicate If using the Plug in Report step 5 a warning will be issued if this occurs If both duplicates give the same result as the original analysis and are visibly different from the normal control then the sample can be considered to be positive for the mutation 28 EGFR Pyro Handbook 09 2010 Table 7 LOD determined for specific mutations LOD COSMIC ID Mutation units V47 Exon 19 deletions 2233del15 1 6 26038 2235 2248 gt 1 6 13550 2235 2252 gt 2 8 13551 2235del15 1 8 6223 2236del15 1 2 6225 2237_2252 gt 2 4 12386 2237_2255 gt 1 6 12384 2237del15 19 12678 2237del18 1 7 12367 2238 2248 2 GC 2 5 12422 2238 2252 GCA 0 6 12419 2238del18 1 1 6220 2239 2248 gt 2 4 12382 2239 2251 gt C 1 7 12383 2239 2258 2 CA 3 9 12387 2239del18 1 5 6255 2239del9 3 7 6218 2240del12 1 5 6210 2240del15 1 9 12369 2240del18 1 9 12370 From the Catalogue of Somatic Mutations in Cancer available online at the Sanger Institute at www sanger ac uk genetics CGP cosmic Table continued on next page EGFR Pyro Handbook 09 2010 29 Table 7 Continued LOD COSMIC ID Mutation 96 units V47 Exon 18 codon 719 GGC AGC 1 5 6252 TGC 1 6 6253 GCC 9 1 6239 Exon 20 codon 768 AGC ATC 3 0 6241 Exon 20 codon 790 ACG ATG 10 7 6240 Exon 21 codon 858 CTG CGG 2 6 5 5 6224 Exon 21 codon 861 CAG 4 3 6213 CGG 4 2 12374 From the Catalog
38. ty to use or incorporate the enclosed components of this kit with any components not included within this kit except as described in the EGFR Pyro Handbook and additional protocols available at www giagen com Other than expressly stated licenses QIAGEN makes no warranty that this kit and or its use s do not infringe the rights of third parties This kit and its components are licensed for one time use and may not be reused refurbished or resold QIAGEN specifically disclaims any other licenses expressed or implied other than those expressly stated The purchaser and user of the kit agree not to take or permit anyone else to take any steps that could lead to or facilitate any acts prohibited above QIAGEN may enforce the prohibitions of this Limited License Agreement in any Court and shall recover all its investigative and Court costs including attorney fees in any action to enforce this Limited License Agreement or any of its intellectual property rights relating to the kit and or its components For updated license terms see www giagen com 2010 QIAGEN all rights reserved www qiagen com Australia Orders 1 800 243 800 Fax 03 9840 9888 Technical 1 800 243 066 Austria Orders 0800 28 10 10 Fax 0800 28 10 19 Technical 0800 28 10 11 Belgium Orders 0800 79612 Fax 0800 79611 Technical 0800 79556 Brazil Orders 0800 557779 Fax 55 11 5079 4001 Technical 0800 557779 Canada Orders 800 572 9613 Fax 800 713 5951
39. ue of Somatic Mutations in Cancer available online at the Sanger Institute at www sanger ac uk genetics CGP cosmic t Lowest mutation level in a sample resulting in a measured frequency 2LOD SS Eee 30 EGFR Pyro Handbook 09 2010 Representative results Representative Pyrogram results are shown in Figures 5 10 A 18 G 98 Te l3 250r 200 150r 100r 50r 0 L 1 S A T G T C A T G T G 5 10 Figure 5 Pyrogram trace obtained after analysis of a sample with a normal genotype in codon 719 with the Sequence to Analyze DGCTCCGGTGC G 98 T2 75r 50r 25 E S T G A G T G A T 5 Figure 6 Pyrogram trace obtained after analysis of a sample with a normal genotype in codon 768 with the Sequence to Analyze CAKCGTG les 100 aps 0 100 75r 50r 25r OF E lt c a G aA oc A 5 10 Figure 7 Pyrogram trace obtained after analysis of a sample with a normal genotype in codon 790 with the Sequence to Analyze ATCAYGCAG SSS SS ns EGFR Pyro Handbook 09 2010 31 COE 400 300 200 100 o Figure 8 Pyrogram trace obtained after analysis of a sample with a normal genotype in codons 858 861 with the Sequence to Analyze CKGGCCAAACDGCTGGGT ESCTATCACTGTCAGCTITCGATCGTCATCGTCACGC 5 10 15 2 25 3 Figure 9 Pyrogram trace obtained after analysis of a sample with a normal genotype in exon 19 GGAATTAAGAGAAGC 67
40. yme and substrate mixtures in 620 each of water supplied 3 Mix by swirling the vial gently Note Do not vortex In order to ensure that the mixture is fully dissolved leave it at room temperature 15 25 for 5 10 min Make sure that the solution is not turbid before filling the PyroMark Q24 Cartridge If the reagents are not to be used immediately place the reagent vials on ice or in a refrigerator 4 Allow the reagents and the PyroMark Q24 Cartridge to reach ambient temperature 20 25 5 Place the PyroMark Q24 Cartridge with the label facing you 6 Load the PyroMark Q24 Cartridge with the appropriate volumes of nucleotides enzyme and substrate mixes according to Figure 4 Make sure that no air bubbles are transferred from the pipet to the cartridge When working with chemicals always wear a suitable lab coat disposable gloves and protective goggles For more information consult the appropriate material safety data sheets MSDSs available from the product supplier ncc LL ALLLLLLLLLLLLLILOLHGIHTHILGIGOIHHHLLHLHLILGBH11 L1 LL E L LA ZZZLZZN 24 EGFR Pyro Handbook 09 2010 E 4 s Mow O BU Label Figure 4 Illustration of the PyroMark Q24 Cartridge seen from above The annotations correspond to the label on the reagent vials Add enzyme mixture E substrate mixture S and nucleotides A T C G according to the volume information given in the Pr
Download Pdf Manuals
Related Search