SimRNA (version 3.20) User Manual 1. SimRNA
Contents
1. Hi The user will be notified about redefinition of those variables in the SimRNA output 4 SimRNA Output The main output of a simulation using SimRNA is the trajectory file traf1 At the beginning of the simulation the program generates a PDB file in reduced representation of the initial structure pdb and the secondary structure that was detected ss_detected In the case where the user supplies only the sequence then a structure constructed in a single circular pattern is generated where the circle contains the full sequence or the set of sequences in consecutive order based on the input sequence file If the user supplies a PDB formatted file then the reduced representation of the structure is is output at the beginning of the simulation 4 1 Trajectory format trafl The SimRNA output is a trajectory file t raf1 If a single simulation is launched then one trafl file is generated If the replica exchange Monte Carlo REMC method is requested the number on each trafl file corresponds to one replica It is worth noting that in the case of the REMC method each trafl file corresponds to the replica not to the temperature shelf Hence each trafl file maintains the conformational continuity the current frame is always obtained from series of modifications of the previous one However the temperature is change according to the way that the current replica is assigned to a particular temperature shelf The tr2. gt trafl extract_lowestE_frame py trajectory trafl The output for name above will be trajectory_minE trafl This single frame trajectory can be converted into a PDB file using the SimRNA_trafl2pdbs tool The user is encouraged to examine this script file if additional tools for trajectory processing are needed or desired Comments Whereas obtaining the lowest energy is one way the simplest way of processing the trajectory files benchmarks demonstrated that better results were generally obtained by using clustering The current version of the tool assumes that the energy was calculated without restraints the fourth element in the header for each frame see Section 4 1 for the format of the trafl file This information is read at line 30 of the script file When the full energy with restraints is to be considered this line of the script should to be changed to the third item 6 3 Clustering Clustering is a tool for processing trajectory file by finding and grouping similar structures together into a single group etc Benchmarks demonstrated that clustering provides better results in terms of structure prediction The input for clustering is just the trajectory trafl file It can be the result of concatenation of several trajectory files Typically those trafl files originate from multi instance runs of replica exchange methods The output of clustering is a set of trafl files corresponding to subsequent clusters
3. Usage gt clustering trajectory trafl fraction_of_lowE_frames_to_cluster rmsd_thrs_1 rmsd_thrs_2 Example usage gt clustering mytest trafl 0 01 3 5 5 0 gt amp mytest_clust log where mytest trafl is an input trafl file 0 01 indicates that 1 of the lowest energy frames of an input trafl will be subjected for clustering where the remaining frames will be ignored 3 5 is the RMSD threshold in the set for first pass of clustering 5 0 is RMSD threshold in the set for a second pass of clustering NOTE those two clustering passes it can be more are just independent clustering instances but are using the same RMSD all_vs_all matrix The reason for that is because thecalculation of the RMSD for the all_vs_all matrix is the most computational demanding stage of the clustering procedure it may take a lot of time As a result assuming mytest trafl input the user will obtain mytest_thrs3 5A_clust01 trafl mytest_thrs3 5A_clust02 trafl mytest_ther3 5A_clust03 trafl mytest_thrs5 0A_clust01 trafl mytest_thrs5 0A_clust02 trafl mytest_thrs5 0A_clust03 trafl Each of the files listed above is a trajectory format file it is not a trajectory by definition containing elements of a given cluster The frames of each cluster in the trafl files are sorted where the first frame corresponds for the structure closest to the center of density Thus conversion to a PDB file can be applied to just the first frame For example
4. To run a simulation with a specific random seed the following syntax is required gt SimRNA s mytest seq c configSA dat R 17801 o mytestl gt amp mytestl log amp Where in this example the random seed was set to 17801 6 Additional Tools Additional tools are also included with the distribution 6 1 SimRNA_trafl2pdbs trajectory converter SimRNA_trafl2pdbs transforms an output from the SiMRNA trajectory file into a PDB formatted file It also makes all atom reconstruction optional The SimRNA_trafl2pdbs converter requires a reference PDB structure this can be the initial PDB structure generated at the beginning of the run and the trajectory data extension trafl and a specification of which structure s is desired To run this application simply type the reference PDB file the trafl file and the list of structures or ranges to be converted that is are desired gt SimRNA_trafl2pdbs structure pdb trajectory trafl list or gt SimRNA_trafl2pdbs structure pdb trajectory trafl list AA where list can consist of the following types of formats list Output Converts the first frame of an input trajectory file trafl to a PDB file input myfile trafl output myfile 000001 pdb 1 LO 35 Converts frame numbers 1 10 and 35 of an input trajectory file into the PDB files with the respective indices input myfile trafl output myfile 000001 pdb myfile 000010 pdb etc T LOTS oro Ar0d Converts
5. 0 This tool is typically used for generating data for RMSD vs Energy plots when the native structure is known It allows for showing the projection of conformational space rooted in the native conformation It is worth noting that this tool allows for calculation of the RMSD for the shortest two frame trajectory when each frame can be any structure The minimum requirement is that number of atoms in each frame must be the same The RMSD calculator assumes a 1 to 1 correspondence between the atoms Such calculations only make sense when done for the same sequence The input trajectory for the tool can be any conformation however typically the user will want to put reference frame at the beginning It can be done by concatenating trajectories gt cat reference_frame trafl trajectoryl trafl gt sum_trajectory_with_first_reference trafl where the reference _frame traf1 file is one frame one conformation trajectory it can be the native structure obtained by running SimRNA in zero interations mode see below Assuming file names as above gt calc_rmsd_to_lst_frame sum_trajectory_with_first_reference trafl output_name rmsd_e The output file becomes a two column file which can be plotted in separate plotting program like gnuplot see figure 3 in the main text 6 5 TraflView TraflView allows the user to browse the trajectory files from SiMRNA directly This program was first developed for protein structure manip
6. The shape of the function resembles a V witha bottom that can correspond to a single point or to a flat region Figure 1a In case of a WELL type restraint the function is flat and equals zero for any distance outside the desired range while the distances within the desired range correspond to the negative value of the weight Figure 1b Both the SLOPE and WELL restraint functions can be reversed when a negative weight is applied c f Figures 1c and d For example applying a SLOPE type function with a negative weight can be used as a repelling function Figure 1c This function can be useful in simulations in which the user desires to study molecule stretching between terminal residues for example On the other hand the WELL type function can be applied with a negative weight when the user wishes to define a distance range that the atoms should avoid When atoms are in the distance range specified by WELL an additional penalty is applied Figure 1d Any number of these two types of functions can be also combined in order to define complex restraints The resulting function can adopt various shapes Figures le and f Therefore the relative distance of two atoms under consideration can be described by a dedicated function or a linear combination of functions used as a part of the total scoring of the energy For both types of restraints the user must specify the rest
7. forth If the occupancy is equal 1 00 then the atom is not restricted while the other atoms can be The PDB formatted file can also contain more than one chain Subsequent chains are recognized only by the chain id one character The chains have to be in one piece they cannot be interlaced The PDB keyword TER is not mandatory Comments If in the case of multichain task initiated from a pdb file the atom numbers have to be unique within the whole file Because of the reduced representation SimRNA uses CONNECT in the output PDB file where CONNECT references the atom numbers If the atom numbers are not unique it is likely to result in considerable ambiguity for the display tools Nevertheless it doesn t affect simulation itself If a simulation is initiated just from a sequence the residues and atoms are numbered consecutively starting from 1 In case of multichain tasks subsequent chains are named A B C eZ a b cz 3 1 Command line options simulation_config_file The config file contains a variety of important settings and is the recommended way to start a simulation see section 3 5 for details output_files_basename If this is not specified then the program will use pdb or sequence file name as a base name for output secondary_strc_restraints_file This allows the user to specify the secondary structure restraints in bracket format Like the sequence file input it sh
8. gt SimRNA_trafl2pdbs mytest 000001 pdb mytest_thrs3 5A_clust0Ol trafl1lAA This command converts the first frame of the first cluster obtained with a 3 5A RMSD threshold to a pdb file with all atom reconstruction Of course other or all frames of the cluster can be converted into pdbs as well There is one further consideration The trafl file that is generated as a result of clustering has a different meaning in 5 fileld of the header For a clustering output this holds the RMSD value in relation to the center of the density instead of current temperature NOTE the current implementation of the clustering tool doesn t provide any cut off for a number of clusters Actually it identifies subsequent clusters until it exhausts the input data In such cases only the first few clusters are meaningful the remaining clusters are usually just the sparse remains The user should inspect the clustering output to identify the percentage of structures that are contained in the 1 2 3 and so on set of clusters 6 4 calc_rmsd_to_1st_frame This tool allows for calculation of the RMSD value in relation to the first frame for the entire trajectory The input is just the trajectory trafl file while the output is a two column file RMSD vs Energy The RMSD value is calculated while the energy value is just read from trajectory file The calculated RMSD value is in relation to the first frame so the RMSD in the first line will be always 0
9. most of the same properties TIGHT has been introduced and I The weight on the secondary structure specified using the command line option S secondary_structure can also be scaled SECOND_STRC_RESTRAINTS_WEIGHT 1 0 The frequencies of subsequent Monte Carlo moves can also be adjusted FRACTION_OF_NITROGEN_ATOM_MOVES 0 10 FRACTION_OF_ONE_ATOM_MOVES 0 4 FRACTION_OF_TWO_ATOMS_MOVES 0 4 FRACTION_OF_FRAGMENT_MOVES 0 0 Lon Oo Where the values listed above are default These parameters were decided based on testing the program The user is advised to use discretion in changing them For systems composed of several RNA chains additional constraint namely limiting sphere is activated Chains contained within the sphere are not permitted to drift away from each other The reason for including this range is because it reduces the search space volume of simulated system When any atom drifts outside the limiting sphere an additional positive value is added to the total energy where the value is_dist_of_violation weight By default radius of that sphere is calculated as float numberOfNucleotides and the default weight is set to 1 0 Those values can be specified by the user in config dat file i e LIMITING _SPHERE_RADIUS 41 5 LIMITING SPHERE _WEIGHT 0 25
10. stages of trajectory processing can be done on just trajectories while the other stages especially conversion to pdb require additional information that are not in trajectory itself When displaying the files using traflView the initial bonds file is needed see Section 6 4 When the user desires to convert some of the trajectory frames into PDB files Section 6 1 the missing information must be provided by the user as a PDB file which will only be used as a template where the actual coordinates will be provided from the given trajectory frame or frames of interest t is the user s responsibility is to provide the proper data It is recommended to use initial PDB file generated by SimRNA at the start of the simulation if the initial starting file was from a sequence or there is no other source of information The 5 field of the header the temperature field allows for binning the conformations into specific temperature ranges or assigning them to particular temperature shelves 5 Examples When starting SimRNA please make sure that there is a link to the data file in the working directory See Section 2 This can be accessed by linking the directory where the distribution is located to the current working directory gt In s path_to_SimRNA_directory data data It is strongly recommended that the configuration file be used with the simulation gt cat configSA dat NUMBER_OF_ITERATIONS 16000000 TRA_WRITE_I
11. AL_STEP float Likewise specifies the final temperature of simulation Comments The final temperature can be lower or higher that initial temperature In the second case the system is being gradually heated The final temperature can be also equal the initial temperature In such a case the program maintains same temperature during entire simulation The order of parameters is not important The config file lines must be in upper case only The format of the file up to this point should be as follows NUMBER_OF_ITERATIONS 1000 TRA_WRITE_IN_EVERY_N_ITERATIONS 20 INIT_TEMP 1 35 FINAL _ TEMP 0 90 There are some additional short range energy terms that can be set up the use in the configuration file These options include the following BONDS_WEIGHT 1 0 ANGLES WEIGHT il TORS_ANGLES_WEIGHT 0 0 ETA_THETA WEIGHT 0 4 CI The BONDS_WEIGHT defines the strength of the bonds holding the structure together A value zero would mean that there are no bonds and the atoms will all behave as though the RNA is a gas The ANGLES WEIGHT define the response of the flat angles to bending In the current version of SimRNA the TORS_ANGLES_WEIGHT is ignored this is intended to add additional helical orientation to the RNA strand In the place of TORS_ANGLES WEIGHT the option ETA_THETA W accomplishes
12. N_EVERY_N_ITERATIONS 16000 INIT_TEMP 1 35 FINAL_TEMP 0 90 BONDS_WEIGHT 1 0 ANGLES WEIGHT 1 0 TORS_ANGLES_ WEIGHT 0 0 ETA_THETA_ WEIGHT 0 40 Comment This config file is set to a fairly long simulated annealing run where the intermittent sampling iterations per frame involve 16000 steps The duration of the simulation is commensurate with the total number of iterations and the number of residues The user will receive 1001 frames 1000 1 the first is just the starting conformation When SimRNA is called with the option E number_of_replicas replica exchange then instead of a simulated annealing run the replica exchange protocol will be initiated Replica swaps will be attempted with the same timing as writing into trajectory files In this case the user will receive N trajectories where N is the number of replicas each file of them will contain 1001 frames The number of structures you will obtain from a single thread is always NUMBER_OF_ITERATIONS TRA_WRITE_IN_EVERY_N_ ITERATIONS 1 A sequence file is also required gt cat mytest seq aaaaaccccuuuuu To run SimRNA the following syntax is then recommended gt SimRNA s mytest seq c configSA dat o mytestl gt amp mytestl log amp and the output file
13. PE restraint a single line in the restraints file SLOPE atom_l_id atom_2_id min_dist max_dist weight or alternative for SLOPE DISTANCE atom_l_id atom_2_id min_dist max_dist weight Example line in a restraints file SLOPE A 23 C4 C 45 P 5 WELL A 23 C4 C 45 P 6 l an a oe O oO where A 23 C4 means atom C4 of nucleotide 23 in chain A C 45 P means atom P in nucleotide 45 in chain C wa 5 5 A minimal distance where the weight is zero for SLOPE 6 5 A minimal distance where the weight is 1 for WELL 7 5 A maximal distance where the weight is 1 for WELL 8 5 A maximal distance where the weight is zero for SLOPE 1 0 weight of this restraint weight for both SLOPE and WELL For WELL the value is 1 between 6 5 and 7 5 A for SLOPE the value increases for distances greater than 8 5 or less than 5 5 A This is an example of a multifunctional restraint that resembles Figure 1e Comments If the input file is a PDB file then the nucleotide numbers specified in the restraints file are according to numbering in input PDB file In SimRNA representation the atom name N represents the nitrogen that binds the base to the backbone Hence N corresponds to N1 for pirymidines and N9 for purines This label can also be used instead of N9 for purines and N1 for pirymidines SimRNA also permits the user to restrain the C2 atom or and also the C6 atom for purines or the C4 atom f
14. SimRNA version 3 20 User Manual 1 SimRNA Functionality SimRNA is a tool for simulations of RNA conformational dynamics folding unfolding multiple chain complex formation etc and its applications include RNA 3D structure prediction SimRNA can be initiated with input files that include either the RNA sequence or sequences in a single line similar to the Vienna format or in the form of a structure written in PDB format The PDB format should be simply the structure of the RNA with no heteroatoms or unusual names In the current version readable residues are A C G and U only i e no modified residues are supported as of yet The file outputs from SimRNA consist of the trajectory or set of trajectories of the RNA simulation trace with file extension trafl a file containing bonding information with file extension bonds a PDB file containing the initial structure at the beginning of the simulation this is a circular shaped structure when only a sequence is provided and a file indicating the initial secondary structure that was found in the starting structure with file extension ss_detected All these files can be used or reused in various tasks of post processing SimRNA also generates output during the simulation specifying the total energy at a particular step of the simulation Additional tools that accompany this distribution are explained in the Section 6 titled Additional Tools 2 SimRNA Additional
15. acking of the temperature field allows the user to trace back the movement of the replica through the different temperature shelves The SimRNA trafl format is a simple text file Each frame consists of two lines a 5 fields header int int float float float a line with the atomic coordinates a string of floats corresponding to the position of the atoms in each base The format of the header is consec_write_number replica_number energy_value_plus_restraints_score energy_value current_temperature where consec_write_number is just the order in which the file is written replica_number useful for tracing the replica when the files from the simulation are concatenated energy_value_plus_restraints_score indicates the energy including the restraints energy_value indicates the energy without the restraints or just the energy if no restraints are used see Section 3 4 current_temperature denotes current temperature in replica exchange mode it denotes particular temperature shelf The format of coordinates line is just xl yl z1 x2 y2 z2 xN yN zN The coordinates of the subsequent points corresponds to the following order of the atoms P C4 N N1 or N9 for pyrimidine or purine respectively B1 C2 B2 C4 or C6 for pyrimidine or purine respectively In general the coordinate line will contain 5 numberOfNucleotides points so 3 5 numberOfNucleotides coordinate items in 3D
16. aling It is recommended that the user use the config file instead of this command This option overrides NUMBER_OF_ITERATIONS option specified in config file see Section 3 5 3 2 Format of sequence and structure input files s input_file_sequence The input data is written in a single line in a basic text file with the sequence of RNA both upper and lower cases are acceptable For example AGACUGCUGAGAGACC There should be nothing but the desired sequence or sequences contained in the file because the program will read everything in the file as though it were part of a sequence There should be no additional spaces either To have more than one RNA chain as input an input the user must separate the different chains by white spaces For example aagcua aaagcugggcu or AGACUGCUGAGAGACC UGCUGAGAGACC p input_file_PDB The user requests starting the calculation with a structure provide by the user in PDB format Comment The format of the PDB file has some very strict requirements i e it should be a simple structure no heteroatoms no non standard base notations the readable residues are A C G and U only i e no modified residues are supported as of yet Every5 most residue must contain a P This can be added by some software tools In a pinch if the P of the 5 most residue is missing from any chain in the PDB file then the user can rename the O5 atom of the 5 most
17. contains the secondary structure of the initial file according to the SimRNA classifier It is worth noting that both the trafl file and the PDB file contain energy value according to the SimRNA energy function of the input structure The one frame trafl file which may contain the native conformation can be used as a reference in calculating the E vs RMSD plot procedure see above NOTE If the user has series of PDB files they can be converted into single frame trajectories Those trajectories can be concatenated and processed by clustering This procedure requires that the PDB files are in a same format and contains conformations corresponding to the same sequences 8 Using SimRNA repeating benchmark procedure In our bechmarking procedure we performed fairly long simulations using replica exchange mode with 10 replicas For each case of prediction we run 8 independent runs each of them in replica exchange mode 10 replicas Then we clustered the results In order to repeat this procedure de novo the user should prepare the following config file gt cat config dat NUMBER_OF_ITERATIONS 16000000 TRA_WRITE_IN_EVERY_N_ITERATIONS 16000 INIT_TEMP 1 35 FINAL_TEMP 0 90 BONDS_WEIGHT 1 0 ANGLES _WEIGHT 1 0 TORS_ANGLES_WEIGHT 0 0 ETA_THETA_WEIGHT 0 40 Let s assume we want to run simulations f
18. distance restraints WELL and SLOPE same as DISTANCE before keyword DISTANCE still works for SLOPE Both restraints describe the preferred distance as a range between a minimal and a maximal distance Figure 1a and b score score 0 0 distance jo 0 0 distance d min max dist dist score 2 G rs V 0 0 0 distance 0 distance e f 2 2 re 3 O O D D 0 0 0 distance 0 distance Figure 1 Examples of types of constraints a An elementary function of type SLOPE that depends on the following three parameters the minimum distance the maximum distance and the slope b An elementary function of type WELL that depends on three parameters the minimum and maximum distance and the depth of the well c A single SLOPE function with negative weight d A single WELL function with negative weight e A combination one SLOPE function and one WELL function f A combination of three SLOPE and two WELL functions both one WELL function and one SLOP GI function with negative weights In the case of a SLOPE type restraint the two atoms are tethered towards the region by applying a linear penalty that corresponds to the degree of violation of the distance from the desired region When the distance between the atoms becomes equal to the desired value the value of the function reaches zero
19. e of more than one sequence multiple lines each containing only one sequence are allowed For the p or P option in the current SimRNA distribution the input PDB file must contain only the RNA chains Moreover the residues must be complete namely they should contain at least the atoms that are used in SimRNA representation P C4 N N1 N9 C2 and C4 pyrimidines or C6 purines These options are explained subsequently s input_file_sequence This is a sequence file essentially in Vienna package format one single line containing an unbroken sequence e g aaaaaaccccuuuuu or if two or more independent strands are involved these unbroken sequences separated by a single space on the line e g aaaaauuuuu aaaaauuuuu p input_file_PDB Note the owercase p Here the input file is a structure given in PDB format P input_file_PDB Note the uppercase P Again the input file is a structure given in PDB format However the occupancy and B factor columns of the PDB file are used to specify atom position pinning or freezing constraints In such cases Ifthe occupancy is equal to 0 00 then the current atom is fixed its position is not changed during entire simulation If the occupancy is between 0 00 and 1 00 but neither 0 00 nor 1 00 then the B factor value is treated as a radius of unrestricted movement Hence a B factor of 2 00 is 2 0 A 4 30 would be 4 3 A and so
20. es it may take some time a black graphic window will be initiated The window can be enlarged by pulling with the mouse cursor In the current implementation it doesn t maintain the same horizontal vertical proportions that will have to be the job of the user The user interface is accomplished by several keys and mouse movements keys are case sensitive c on off colors the structures rainbow style when 5 end is blue and 3 is red e on off show energy plot green line in bottom part of the window Esc quitting the viewer Selecting different frames moving forward and backward is accomplished by digit keys 1 and 3 one step backward or forward respectively 7 and 9 ten steps backward or forward respectively Software Developed by Michal Boniecki during his PhD studies initially dedicated for viewing Refiner and CABS trajectories 4and 6 a hundred steps backward or forward respectively NOTE TraflView only reads the digit keys Therefore to have this function it is recommended that the user set the keypad such that the NumLock is switched on Rotating zooming in out and moving the current conformation is accomplished by using the mouse Left button mouse movement left right and up down rotation of a structure Middle button mouse movement only left right zooming in out of a structure Right button mouse movement only left right moving of a struc
21. frame numbers 1 10 35 and the range of frames 52 to 64 to PDB files with the respective indices Converts all frames of an input trajectory file However please see warnings in comments below And the option AA initiates an all atom reconstruction of the specified frames in list When AA is not used the output PDB files will be in the reduced representation format and a file with extension ss_detected that indicates the RNA secondary structure that was detected When AA is used the output will be both the all atom representation plus the reduced representation and ss_ detected files Comments The SimRNA_trafl2pdbs converter also requires presence of data directory or link to it this is because it has to read in all atom backbone conformers as well as all atom base representations Be forewarned that frivolous usage of the option will mean that a 10000 frame trajectory file will generate 10000 independent PDB files in the directory plus 10000 ss detected files and if the option AA is used too then 10000 files with the tag _AA pdb as well Hence a grand total of 30000 files could suddenly overwhelm the directory If this is expected by the user fine but be sure that is what is desired 6 2 trafl_extract_lowestE_frame py This is a simple python script that reads in the trajectory file finds the lowest energy frame and outputs it as a single frame trafl file Usage
22. in figure 2 see below folding of 1e95 NATIVE PREDICTION RMSD 3 582 1e95_OX_nOLimsd_e Figure 2 Folding of 1e95 The structures are shown in reduced representation where green is the native structure and red is the predicted structure The secondary structure is generated from the SimRNA program and the RSMD vs Energy plot is in the lower right corner
23. m a dsRNA stem with an interior loop containing poly C When the sequence is written as above in the restraint file the first line is ignored The actual sequence must be entered using the s or p command line option If more than two chains are involved this can also be accommodated by the above scheme For example constraints on four chains could be written as follows aaaaccccuuuu aaaaccccuuuu aaaaggggaaaa aaaaggggaaaa CCA aed CL VS Pagan Jol So eather emesis ately eld rete dc In general there are a variety of ways that this file can be written However clarity is probably the most important thing to remember Comment please note that SimRNA doesn t allow the user to exclude the possibility of base pairing using the secondary structure constraints file Thus even the dot does not prohibit the formation of base pairing 3 4 Format of long range restraint files r restraints_file The input restraint file contains information on the type and position of the restraints between atoms Restraint options A restraint can be thought of as a flexible tether that drives the selected atoms towards a certain distance by applying a penalty for distances that deviate from that range It can also provide a reward when a desired distance is achieved The penalty and reward are positive and negative contributions to the total energy of the simulated system respectively There are two types of
24. ocedure will generate files fold_2ap0_all_thrs2 80A_clust0l trafl fold_2ap0_all_thrs2 80A_clust02 trafl fold_2ap0_all_thrs2 80A_clust03 trafl Let s consider only first 3 clusters First frame center of density of each of them can be converted into pdb with all atom reconstruction gt SimRNA_trafl2pdbs fold_2ap0_01_01 000001 pdb fold_2ap0_all_thrs2 80A_clust0l trafl 1 AA gt SimRNA_trafl2pdbs fold_2Zap0_01_01 000001 pdb fold_2ap0_all_thrs2 80A_clust02 trafl 1 AA gt SimRNA_trafl2pdbs fold_2Zap0_01_01 000001 pdb fold_2ap0_all_thrs2 80A_clust02 trafl 1 AA In order to get E vs RMSD plot here native is known so it may work as an root 2ap0 native structure has to be converted into one frame traf gt SimRNA c config dat n 0 p 2ap0_native pdb o 2ap0_native gt amp 2apO_native log whereupon file 2ap0_native trafl will appear Then the file should be set as a first frame of concatenated trafl file gt cat 2ap0_native trafl fold_2ap0_all trafl gt fold_2ap0_all_wNative trafl The resulting file fold_2ap0_all_wNative trafl will contain the native conformation at the beginning first index Then two column rmsd_e file can be generated by using gt calc_rmsd_to_lst_frame fold_2ap0_all_wNative trafl fold_2ap0_all_wNative rmsd_e The resulting file fold_2ap0_all_wNative rmsd_e _can be plotted using standard tools like gnuplot It will generate a plot similar to the one shown
25. or pirymidines The user can also apply restraints for a middle atom of the base pseudo atom which is named MB This is useful for restraining the bases such that they are only in contact but not specifically tied to some prescribed orientation such as Watson Crick or Hoogsteen edge or whatever 3 5 Format of the config file c simulation_config file The argument is a file containing simulation configuration parameters With this option the user can configure the simulation in a more advanced way The configuration file is text file with one parameter specified on each line There can be blank lines each line must contain a command or must be empty Config file options These are some of the options that can be included in a typical config file NUMBER_OF_ITERATIONS N This specifies the number of unified iterations in a simulated annealing simulation This can be overridden by n option TRA_WRITES_IN_EVERY_N_ITERATIONS N This specifies how many iterations should occur before the conformation is appended to the trajectory file In general there probably should be at least 10000 iterations of SimRNA before a write is done to generate a meaningful structural change However if the user desires to have a chain of quite similar structures this value can be low INIT_TEMP float This specifies the starting temperature of the simulation FIN
26. or the sequence of 2ap0 Then we must prepare the following sequence file gt cat 2ap0 seq AGUGGCGCCGACCACUUAAAAACAACGG Then just run 8 independent runs SimRNA c config dat SimRNA c config dat 10 s 2ap0 seq o fold_2ap0_01 gt amp fold_2ap0_01 log 10 s 2ap0 seq o fold_2ap0_02 gt amp fold_2ap0_02 1log SimRNA c config dat E 10 s 2ap0 seq o fold_2ap0_08 gt amp fold_2ap0_08 log NOTE Those runs are computationally demanding SimRNA replica exchange mode is parallelized using OpenMP The calculations specified above will be optimally executed at 8x10 80 CPU cores In such a case execution time will be several hours It should be noted that one can obtain good predictions even after 10 of the time of the simulations above so the config dat file can be modified accordingly but we chose to perform much longer runs The simulations above will generate files fold_2ap0_01_01 trafl fold_2ap0_01_02 trafl fold_2ap0_08_09 trafl fold_2ap0_08_10 trafl In total there will be 80 trafl files generated where each of them will contain 1001 frames Then the structures have to be concatenated gt cat fold_2ap0_ _ trafl gt fold_2ap0_all trafl Then 1 of lowest energy structures will be subjected for clustering gt clustering fold_2ap0_all trafl 0 01 2 8 gt amp fold_2ap0_clustering log NOTE we used 2 8 A rmsd threshold which is 0 1 seq_length Clustering pr
27. ould consist of just a single line or in the case of pseudoknots it contains consecutive dot bracket lines specifying the positions of the pseudoknots restraints_file This is the file specifying restraints The details on the format of the file for restraints are discussed below The format is somewhat strict and should be followed or an error will be issued int_number_of_Replicas Request to use the replica exchange Monte Carlo method REMC where the program initiates a specified number of relica and perform a REMC simulation int_number This allows the user to choose generate or provide a specified random number seed for doing calculations This is mainly useful when trying to reproduce a simulation The user can always check the initial random seed in the SimRNA standard output regardless of whether the random seed was specified by the user or generated by default using the clock The program generates a list of PDB files each trajectory frame is written to a PDB file in addition to the trajectory file This is generally not necessary and does take up a lot of space when running a long simulation so it should not be asked for frivolously It is recommended that the user extract all desired PDB formatted files using SimRNA_trafl2pdb see Section 5 n number_of_iterarions This specifies the number of iterations to be done in the simulation The argument is the number of iterations in one temperature cycle of simulated anne
28. raints in subsequent lines of the restraint file in the following format ChX i atom_i Chy j atom_j min_dist max_dist weight where examples are provided in the next section Here ChX and ChY specify the chain index chain name can be the same or different i and j refer to the index of the particular residue on the respective chain and atom_i and atom_j refer to the atom on which the constraint is applied Restraints of type WELL are O except for the range between min_dist and max_dist For the region between min max min_dist lt gt max_dist the value becomes 1 weight Restraints of type SLOPE are 0 within the range min _dist lt gt max_dist Outside that range a linear increasing positive penatly is added the pair of atoms are attracted to each other because there is less penalty as they approach the region between min_dist and max_dist The value for the penalty is dist_violationtwei ght Restraints for a given pairs of atoms can be combined added It requires two or more lines to specify subsequent contributions Restraint command formats In SimRNA distance restraints can be defined for any pair of atoms used in SimRNA representation as well as to the central point of the nucleic acid base P C4 N N1 N9 C2 C4 for pyrimidines and C6 for purines and the midpoint MB The WELL restraint a single line in the restraints file WELL atom_l_id atom_2_id min_dist max_dist weight The SLO
29. requirements The distribution comes with a directory data that contains files with information about the energy function and important settings for the statistical potentials The user must have the directory or symbolic link to some other location named data inside of the working directory where SIMRNA is running The data directory or link contains the energy function files and is therefore essential to run SimRNA The data stored inside these files strongly affect results the user obtains Therefore the user should not make changes inside these files unless the user understands the purpose and function of the files or at least the user should make a backup copy of the data before changing it If this directory is missing in the working directory where SiMRNA is called or the program for some reason can t see it the user will usually encounter the following error Error in opening file data arccos and subsequent termination of the program 3 SimRNA Usage SimRNA is fairly flexible on command line formats requirement however the following syntax is required to successfully run SimMRNA gt SimRNA s input_file_sequence or gt SimRNA p input_file_PDB or gt SimRNA P input_file_PDB Comments Please pay attention to the format For the s option SimRNA does not accept comment scripts only one single line should appear in the input file or in the cas
30. residue to P in that particular chain and the SimRNA will treat that atom as a P 3 3 Format of secondary structure restraint files S secondary_strc_restraints_file If the user wants to provide secondary structure restraints the contents of the restraint file should be in the following one line format Or when pseudoknots are involved several lines can be provided depending on the characteristics of the pseudoknot For example if there is only one pseudoknot then the following is sufficient If more than one pseudoknot is involved each one should be written on a separate line For example the following structure would involve two pseudoknots Comments In general it is good policy to write the dominant secondary structure on the first line and place only single hairpin loops closing the pseudoknots on subsequent lines however this is not strictly required The program reads in the constraints line by line Therefore the following input It is important emphasize that the data for secondary structure and pseudoknots must be listed on subsequent lines regardless of how the data is specified Otherwise SimRNA will assume that there is a second chain and it is likely an error will occur Constraints can also be applied to multi chain problems For example in the case of two chains restraints can be written as follows aaaaccccuuuu aaaaccccuuuu 2662 0000 eee The above example will for
31. s will be the following mytestl bonds mytestl trafl mytest1 000001 pdb mytest1 000001 ss_detected Comments The o option is recommended if one attempts more than one calculation in the same directory because the default output tag if nothing is specified is mytest seq and in any subsequent calls to SimRNA SimRNA will overwrite the user s preciously obtained calculations of the same name Requesting the log file is recommended because it is possible to check the configurations and settings that were used to start the simulation Since the output it to stderr the gt amp notation should be used The amp atthe end of the line is recommended so that the terminal is free for other activities such as checking the status of the calculations The random seed variable for the Monte Carlo simulation is initiated from the clock This information can be found in the log file after the simulation in case it is desired to exactly reproduce the same calculation If a PDB file is available then the following syntax can be used gt SimRNA p mytest pdb c configSA dat o mytest2 gt amp mytest2 log amp with the name of the output files being the same as above for the s option To carry out replica exchange Monte Carlo simulations with 10 replica the following command line is sufficient m gt SimRNA s mytest seq c configSA dat E 10 o mytestE gt amp mytestE log amp
32. space 3 coordinates per atom 5 atoms per residue hence 15 coordinates per residue Users can write their own scripts fairly easy for trajectory processing Reading subsequent lines when the number of items in a line is 5 it means this is the header for next line Comments The trajectories can be concatenated An easy way is using the Unix command gt cat filel trafl file2 trafl gt newfile trafl When SimRNA is run in several instances which is recommended all files can be combined into a single trafl file and then can be subjected to further processing e g clustering It also is useful for outputs from simulations in replica exchange mode especially when several instances are initiated also recommended The user will receive many trajectory files The necessary requirements for trajectory files to be concatenated is that they should have the same number of atoms in coordinate lines so basically they should originate from simulations of the same sequence For some types of processing an additional requirement is that the trajectories should originate from simulations under the same conditions e g same energy function similar temperature similar restraints or other possibilities The trajectory may contain only one conformation In this case it will be just a two line file The trajectory file doesn t contain any information about the sequence chain names atom residue numberings etc Some
33. ture It is worth noting that TraflView also outputs data that is displayed in the terminal where the application is called In the output there is the RMSD value to the reference frame By default the reference frame is first frame in the trafl file however it can be any frame A new reference structure can be selected by pressing key r when the desired structure is currently displayed The current display can be also dumped into bmp file by pressing key S 7 Using SimRNA as a SS classifier getting single frame trafl zero interation run SimRNA can be used as a secondary structure classifier when input structure is a PDB file By default SimRNA generates a ss_detected file at the beginning of the simulation that contains secondary structure analysis of the initial structure Hence if the user wishes to obtain a trafl file the secondary structure or the energy of the structure in the PDB file i e if no simulation is desired the user can run SimRNA in zero iteration mode This can be accomplished by Setting NUMBER_OF_ITERATIONS to 0 in config file Using option n 0 which overrides config setting When SimRNA is run in zero iteration it dumps typical output The PDB file of the starting structure in reduced representation which can be viewed by typical pdb viewers such as rasmol pymol Aone frame trafl file a file containing just the input structure in trafl format A ss detected file which
34. ulation using REFINER in the Kolinski lab The file with extension bonds is required to view the traf1 files This tool is still under development nevertheless it is a very handy tool for viewing or even monitoring the progress of a SimRNA simulation so we decided to add it to SimRNA suite To browse the trajectories run this application simply type output SimRNA trafl file and bonds file traflView SimRNAoutput trafl SimRNAoutput bonds where SimRNAout put is output file generated by SIMRNA in the given run TraflView can also be used to visualize a set of trajectories given in pdb format The bonds information is require for files with reduced representation that have bond lengths much greater than 1 5 A Standard PDB files serving as trajectories can be read directly without the additional information from bonds Comment As a piece of browsing software TraflView has some very specific requirements on unix libraries If TraflView fails to run on the particular Linux system then it is necessary to install the graphics package mesa In general if the package mesa is available and installable then this can be installed using gt sudo aptitude install mesa on a Linux operating system It is also recommended that a relatively new version of Linux Ubuntu for Fedora Core operating system be installed to guarantee compatibility When the user launches TraflView for longer trajectori
Download Pdf Manuals
Related Search