file - BioMed Central
Contents
1. Sequences are defaulted to show sense strand If needed please click O to show antisense strand SNP ID rs68134313 GTGOGGGGTGGTOGGCCTGCCCTT AC ASTETE 31 3 SGTCGGGCCTSCCCTTCCAATGGATCCACTCACAGTTTICCATAGG 3 C show all Non Commercial Commercial Fig 3 14 The available restriction enzyme information for the sense strand with SNP in the in del format SNP ID Sequence RFLP w CTGAGTAGCTGGGATTAGAGGTGCCC TCACCACGCCTGGCTGATTTTTTGT 3 CTGAGTAGCTGGGATTAGAGGTGCCCATCACCACGCCTGGCTGATTTTTTGT 3 CTGAGTAGCTGGGATTAGAGGTGCCCGTCACCACGCCTGGCTGATTTTTTGT 3 C show all Non Commercial Non Commercial Supplies NEB Price Non IUPAC Bod Daia IUPAC uea SETAE paeinmuciTen Holostei Fig 3 15 The available restriction enzyme information for the sense strand with SNP in the Sequence ID Sequence t 1 tri allelic format 27 Updated 2009 11 03 SNP RFLPing 2 User Manual Sequences are defaulted to show sense strand If needed please click show antisense strand SNP ID rs13631133 RFLP Y 5 GTGCCATCTTTTCCTTGGTGGGTGTC ACTTAAAGACCAACTTCTTGGCTIT 3 5 GTGCCATCTTTTCCTTGGTGGGTGTCAACTTAAAGACCAACTTCTTIGGCTIT 3 5 GTGCCATCTTTTICCTTIGGTGSOGTGTCGACTTAAAGACCAACTICTTGGCTITT 3 5 GTGCCATCTTTTOCTTGGTGGGOTGOTCTACTTAAAGACCAACTTCTTGOCTTT 3 RFLP w 3 CACGGTAGAAAAGGAACCACCCACAG TGAATTICTGGTTGAAGAACCGAAA 5 3 CACGGTAGAAAAGGAACCACCCACAGCTTGAATTTCTGGTT2. 1 Fig 2 18 The available sense and anti sense strand restriction enzyme information for rs11540652 when the checkbox for anti sense strand indicated by a red arrow line is checked is the sense strand and is the antisense strand 0 and 1 indicate the alternative nucleotide for the same SNP 13 Updated 2009 11 03 SNP RFLPing 2 User Manual 2 2 6 Example 6 Further restriction enzyme information description The enzymes information contains 1 Sequence ID for sense and anti sense strands 2 Recognition Sequence and 3 Commercial and Non Commercial enzymes For Recognition Sequence this system provides the hyperlink for the same recognition sequence Fig 2 19 When the hyperlink for Enzyme Name is clicked the search results for this enzyme name in NEW ENGLANE BioLabs NEB will be output Fig 2 20 For Commercial enzymes two options are available one is Suppliers and the other is NEB Price When users select the Suppliers the following enzyme hyperlinks will link to REBASE Suppliers Fig 2 21 When users select the NEB Price the following enzymes hyperlink will link to price manager for Restriction Endonucleases which is our locally built in database all enzyme prices come from the price for NEB Fig 2 22 and Fig 2 23 For Non Commercial enzymes enzymes hyperlink will be link to NCBI PubMed to search related documents Fig 2 24 Prototy
3. 2 samole2 3 samole3 3 Multiple ss ample 2 22 3 sample3 4 Mixed rs and ss 1 sample 2 sample 3 sample3 example Fig 2 9 Multiple rs and ss input with the comma symbols to separate 8 Updated 2009 11 03 SNP RFLPing 2 User Manual SNP IDs Ai P 2a TTE Se a eee ey en ee Please input Reference SNP IDs rs or Submitter SNP IDs ss for SNP RFLP analysis the maximum load is 50 irs 11540652 rs28934875 ss90566964 rs45541837 ss74801690 SNP IDs auen c 1 Single ID 1 rs11540652 2 rs1318703 3 5538341834 4 ss1717832 2 Multiple rs 1 sample 2 sample 3 sampled 3 Multiple ss 1 sample 2 ample 3 4 Mixed rs and ss aati 2 sample 3 sample3 example Fig 2 10 Multiple rs and ss input with space to separate 5390566964 rs45541837 5574801690 i Query Ciear 1 Single ID 1 811540652 2 1 1318703 3 ss nk 1834 4 551717832 exarnple 2 Multiple rs 1 sample 2 sample2 3 sampl e 3 Multiple ss 1 sample 2 sample2 3 Sample 4 Mixed rs and ss 1 sample 2 sample Fig 2 11 Multiple rs and ss mixed input with lines press the enter key of keyboard to separate 9 Updated 2009 11 03 SN P RELPing 2 User Manual 2 2 2 Example 2 Query SNPs information After inputting SNP ID users can click the Query button to query SNPs information Users will see the waiting page
4. NCBI http www ncbi nlm nih gov REBASE http rebase neb com rebase rebase html dbSNP http www ncbi nlm nih gov SNP GenBank http www ncbi nlm nih gov Genbank HapMap http www hapmap org SNP500Cancer http snpSO0O0cancer nci nih gov home_1 cfm CFID 2676524 amp CFTOKEN 98627459 PolymiRTS http compbio utmem edu miRSNP CGAP GO browser http cgap nci nih gov Genes GOBrowser ENCODE http genome ucsc edu ENCODE Prim SNPing http bio kuas edu tw prim snping Seq SNPing http bio kuas edu tw Seq SNPing SNP Flankplus http bio kuas edu tw snp flankplus snpin jsp LD2SNPing http bio kuas edu tw LD2SNPing SNP ID info http bio kuas edu tw snpid info 44 Updated 2009 11 03
5. 2 ASPA 3 ARHGEF 15 4 H19 5 TRIM16 5 LocusLink ID 1 7157 2 443 3 22899 4 283120 5 10626 6 Local SNP ID 1 TSC0227 737 2 OMIM 191770 0010 3 SLC644 014756 4 JWB 1007419 5 BGI rs9909154 Fig 5 1 This input options of GenBank Accession Limits Organism Function class SNP class Heterozygosity Accession All v All Anopheles gambiae heterozygous Apis mellifera jin del Submitter SNP ID Bison bison intron mixed Accession version Bos indicus x bos taurus lcoding synonymous multinucleotide polymorphism 30 40 Gene Name Bos taurus locus region named locus 40 50 LocusLink ID Caenorhabditis elegans Ina ute no variation Local SNP ID Canis famaharis splice site snp iia iti ini Danio rerio Gallus gallus Homo sapiens Macaca mulatta Monodelphis domestica Mus musculus Oryza sativa Pan troglodytes Rattus norvegicus Reference SNF ID Fig 5 2 The options for organism limits and accession in this function of GenBank Accession 33 Updated 2009 11 03 SNP RFLPing 2 User Manual After inputting accession no for example TP53 users can click the button Query and it will be redirect to a waiting page Fig 2 12 Waiting for a moment the results will be shown as Fig 5 3 including the key for input here is Gene Name TP53 the pages options items for SNPs function class SNP class Heterozygosity TaqMan and SNPs information which the same as 2 SNP
6. TTGCTGTCGCGGGATTTCGGTCCACTGAGAGGTGGATGGGTAGTAGTATGGIAC AGAAATCGGTAAGAGGTGGGCCCAG Sequence o ouen Reset uence 2 IUPAC sequence2 examples aquence1 AC Fig 4 3 Three SNPs within one sequence in the dNTP1 dNTP2 format If the SNP is marked in IUPAC code the sequence is continued as shown in Fig 4 4 30 Updated 2009 11 03 SNP RFLPing 2 User Manual Multiple SNPs se ing a for SNF P RFLP analysis th e maxim toad is 50 Bei Description TGAGAGGTGGATGGGT TATGRMAGAAATCGGTAAGAGGTGGGCCCAGTTAGCACCG f GGGC GCTGT CGCGGGATTTCGGTCCACTGAGAGGCTG GATGGGTA TCGGTAAGAGGTGGGCCCAG Sequence examples 2 Three SNPs 1 NTPS 3 Four SNPs 1 dNTPs nT 7 H Fig 4 4 Three SNPs within one sequence in the IUPAC format Multiple SNPs NvPlease input a sequnece for SNP RFLP analysis w Description four SNPs GTATGGAAGAAATCGGTAAGAGGTGGIAIG CCCAGGGGTCAGAGGCAAGCAGAGGTGAGAGGTGGATGGGTAGTAGTATGG AIC AGAAATCGGTAAGAGGTGGGCCCAGTTAGCACCGCGGGTCGCTACGGGCCTICIT TTGCTGTCGCGGGATTTCGGTCCACTGAGAGGTGGATGGGTAGTAGTATGGIAIC AGAAATCGGTAAGAGGTGGGCCCAG S maximum load J EAL 1 ie makin de HUET HF clad ee Sequence Eae Ps seauencet 2 IUPAC sequence2 Are ie Bal i 2 IUPAC sequence 3 Four SNPs 1 dNTPs AED 2 IUPAC sequencez 1 Two SNES 1 d examples Fig 4 5 Four SNPs within one sequence in the ANTP1 dN
7. 10 aTACTGTAcaatg D 9 atacTGTACAAtg D Fig 7 4 The results for query miRNA number miR 198 of human This figure show 8 records of 10 records 38 Updated 2009 11 03 SNP RFLPing 2 User Manual In order to query the SNP sequence information to SNP RFLP analysis users can check the box in the front of transcript ID and click the button Search SNP Sequence A waiting page for SNPs information will be displayed Then users can reselect SNP once again for SNP RFLP analysis Fig 7 5 The following operation is similar as described above not shown here EW N Varvu ho PubMed NOt On mRNA Mo 30 No OMIM HGVS Names NM_022114 2 c 1853G gt C NM_199454 1 c 1853G gt C NT_004321 17 9 668008G C Fig 7 5 The SNP information results for query two transcript IDs NM_198576 and NM_199454 of miRNA number miR 198 of human 39 Updated 2009 11 03 SNP RFLPing 2 User Manual 8 Function Gene Ontology based annotation for SNPs 8 1 Overview The Gene Ontology Browser GO Browser http cgap nci nih gov Genes GOBrowser providing the annotation for human and mouse genes by molecular function biological process and cellular component GO IDs and vocabulary terms may be input to find the genes with an interested function as well as their corresponding SNPs In this function CGAP database human and mouse Chromosomes and GO term are available for input Fig 8 1 In order to get m
8. 31788026 0 254 shown in the HapMap Fig 6 3 The results for tagSNPs information query using HUGO gene name BRCA2 as the setting for Fig 6 1 The ten tagSNPs retrieved in SNP RFLPing 2 top view Animation jg the same as shown in HapMap bottom view Animation Please click the Animation box to demonstrate 36 Updated 2009 11 03 SNP RFLPing 2 User Manual 7 Function Transcript ID miRNA 7 1 Overview MicroRNAs miRNAs are a family of small RNAs that complement to the transcripts of protein coding genes repress translation or decrease mRNA stability The dysfunction of miRNA can impact many targets and thus affect cell physiology and cancer progression Polymorphisms in the miRNA pathway may affect gene expression lead to change complex phenotypes and have the potential to be disease markers for personalized medicine In this function the polymorphism in microRNA Target Site PolymiRTS database is applied to provide transcript ID and miRNA number of human and mouse to query SNPs Fig 7 1 7 2 Example Use transcript ID and miRNA number to analyze Transcript ID miRNA srPlease input transcipt ID or miRNA for SNP RFLP analysis mIRSNP database human mouse Transcipt ID vi 1 Transcipt ID 1 NM _ 015658 2 B01939034 3 AK127333 4 CR749296 5 D87072 Tra ipt ID miRNA examples Fig 7 1 The interface for Transcript ID miR
9. ID input Fig 2 13 page 11 The following operation not shown is similar as described above TGGGGTGGGG GGGTGGTGGGCC TGCC TTCCAATGGA TCACAGTTTC Fig 5 3 The results for SNPs information query using HUGO gene name TP53 here limit only show 20 SNPs and three SNPs is picked in the figure 34 Updated 2009 11 03 SNP RFLPing 2 User Manual 6 Function TagSNP from HapMap 6 1 Overview To reduce the necessary amount of SNPs for genotyping it is believed that a subset of the SNP in a region tagSNPs can be chosen to represent most of the remaining SNP variants The International HapMap Project is very helpful in providing the tagSNPs in the human genome for several races including YRI Yoruba in Ibadan Nigeria JPT Japanese in Tokyo Japan CHB Han Chinese in Beijing China and CEU CEPH Utah residents with ancestry from northern and western Europe As shown in Fig 6 1 and Fig 6 2 the HapMap database versions population pairwise methods tagger pairwise or tagger multimarkers R square cut off and MAF minor allele frequency cut off are adjustable Position between chromosome accession number gene name cytoband position and ENCODE ENCyclopedia Of DNA Elements region can be queried The tagSNPs information from HapMap is retrieved online and the mining function of RFLP restriction enzymes for the tagSNP is implemented The current online linked tagSNP database is the HapMap Data Rel 23a phaselI Mar08
10. and the other is HapMap tagSNP Through clicking the SNPs and tagSNPs images the SNPs information will be inquired The SNP query function is similar as described above off CGAP GO Info Query The program is running The page will update after 3 seconds OOOO Flease wait some minutes Thanks Fig 8 3 Wait for CGAP GO information query 41 Updated 2009 11 03 SNP RFLPing 2 User Manual Fig 8 4 The results for query Gene Ontology vocabulary term positive regulation of interleukin 2 biosynthetic process 42 Updated 2009 11 03 SNP RFLPing 2 User Manual 9 Function File upload for input 9 1 Overview This function is similar to 2 SNP ID input and 3 SNP in fasta sequence input functions SNP ID rs and ss and SNP in fasta sequence format file txt are acceptable to query the SNP REFLP information User can select either SNP IDs or SNP fasta sequences option and then through the button browse to get an available input file in local machine Fig 9 1 Finally click the button Put In to perform this function For more detail formats and steps for operating please reference to 2 SNP ID input and 3 SNP in fasta sequence input functions 9 2 Example Up
11. miRNA 7 1 Overview 7 2 Example Use transcript ID and miRNA number to analyze 8 Function Gene Ontology based annotation for SNPs 8 1 Overview 8 2 Example Query Gene Ontology vocabulary term 9 Function File upload for input 9 1 Overview 9 2 Example Upload interface for SNP IDs and SNP fasta sequences 10 Appendix 10 1 Definitions 10 2 Related links p 2 p 2 p 3 p 4 p 4 p 4 p 4 p 10 p 11 p 12 p 13 p 14 p 17 p 18 p 20 p 20 p 20 p 29 p 29 p 29 p 33 p 33 p 33 p 35 p 35 p 35 p 37 p 37 p 37 p 40 p 40 p 40 p 43 p 43 p 43 p 44 p 44 p 44 Updated 2009 11 03 SNP RFLPing 2 User Manual 1 Introduction 1 1 Background PCR restriction fragment length polymorphism RFLP assay is a cost effective method for SNP genotyping and mutation detection but the manual mining of restriction enzymes 1s challenging and cumbersome Three years after we constructed SNP RFLPing a freely accessible analysis tool for restriction enzyme mining of SNPs significant improvements over the 2006 version have been made in the latest version SNP RFLPing 2 The primary aim of SNP RFLPing 2 is to provide a comprehensive PCR RFLP information for SNPs in multiple fields such as SNPs for multiple species multiple kinds d1 tri tetra and indel gene centric search HapMap tagSNPs gene ontology based search miRNAs and SNPS500Cancer The RFLP restriction enzymes and their corresponding PCR primers of natural and mutagenic types f
12. wait some minutes Thanks Fig 2 14 Waiting for the SNP RFLP recognition After the waiting page is disappeared the result for SNP RFLP recognition is appearing Fig 2 15 The result information of SNP RFLP includes SNP ID rs short SNP flanking sequence 52 bp in total result for sense strand and anti sense strand whether recognized by restriction enzymes or not TaqMan primer set and enzymes information The SNP ID is hyperlinked to NCBI Entrez SNP for further information In this SNP rs11540652 its TaqMan probe is not provided in both NCBI and SNP500Cancer and the natural primer set i e the primers are the regular primers and the RFLP restriction enzymes are available is available CAGTTCCTGC ATGGGCGGCA TGAACC sequencel A G No TaqMan Result The SNP in sequence can be distinguished Result the SNP in sequence can be distinguished Enzymes Information Fig 2 15 The result for SNP RFLP recognition is the sense strand and is the antisense strand Smile symbol means that the RFLP enzymes are available in the SNP RFLPing 2 analysis 11 Updated 2009 11 03 SNP RFLPing 2 User Manual 2 2 4 Example 4 Natural primers information acquiring Clicking the icon of Natural the natural primer set information is appearing Fig 2 16 The natural primer set information contains SNP ID strand orientation recognized allele restriction enzymes natural primer pair informatio
13. 0 gt 1 11540652 CAGTTCCTGCATGGGCGGCATGAACC A G GAGGCCCATCCTCACCATCATCACA rs28934875 iCCCTCAACAAGATGTTTTGCCAACTG C G SNP fasta sequences CCAAGACCTGCCCTGTGCAGCTGTG gt rs62068667 ACATGCCTGTAATCCCAGCACTTTIGG AIG AGGCCAAGGTGGGCGGATCACCTGA nas 2 Multiple fasta sequences aay 1 Sample Caran en 3 Multiple fasta sequences IUPAC 1 sample 4 Special sequences 1 in del 2 trzallelic 3 tetra allelic Fig 3 4 Multiple fasta sequences with SNPs in dNTP1 dNTP2 format with line press the enter key of keyboard which are ignored in the system When the sequence is too long the part of the sequence will list in the next line automatically The system is able to regard them as the single sequence input SNP Fasta Sequences NP fasta sequences for SNP RFLP analysis the maximum load is 60 dis 5 gt 1 11540652 CAGTTCCTGCATGGGCGGCATGAACCRGAGGCCCATCCTCACCATCATCACA gt 1S28934875 CCCTCAACAAGATGTTTTGCCAACTGSCCAAGACCTGCCCTGTGCAGCTGTG rs62068667 ACATGCCTGTAATCCCAGCACTTTGGRAGGCCAAGGTGGGCGGATCACCTGA 1845541837 SNP fasta sequences CTTGCTTGCCCTCTATTGCAGAATAASAAGGGGCTTIAGCCACAGGAGTTGCT gt 1 55863639 GAAGCCAGCCCCTCAGGGCAACTGACMGTGCAAGTCACAGACTTGGCTGTCC input J eiear 1 sample 2 samples le fasta sequente S ANTES CM ample 2 sample2 1 Single fasta sequence vit 2 Multi examples Fig 3 5 Regular multiple fasta
14. 11 03 SNP RFLPing 2 User Manual SNP IDs 1 Single ID 1 rs115406 41834 Sar 2 Multiple rs 1 samolet 2 samole 3 Cane 3 Multiple ss 1 sample 2 sample2 3 sample3 4 Mixed rs and ss 1 sample1 2 sample2 3 sample3 Fig 2 2 Single ID input with ss en ins il Ple pase e input Ref ere anc e SNF IDs rs 5 0 r r Subn mitte r SNP SH for SNP P RFL a P analysis th e maximum load ts 50 11540652 rs28934875 rs62068667 rs45541837 rs55863639 SNP IDs Coven Ec 1 Sing le 1D 1 rs154 52 2 51318703 3 5538341834 4 ss1717832 example EL a 2 sample2 3 sample3 Sulipiess ie ample 2 sample2 3 sample3 4 Mixed rs and ss 1 sample4 2 sample2 3 sample3 Fig 2 3 Multiple rs input with the comma symbols to separate 5 Updated 2009 11 03 SNP RFLPing 2 User Manual rs11540652 rs28934875 re62068667 rs45541837 rs55863639 j BN Lauen J _Clear 1 Single ID 1 rs115406 3 3 2838341834 4 ss1717832 _ 2 Multiple rs 1 sample 2 sample2 P samole3 example 3 Multi Multiple ss 1 sample 1 2 Satnipies 3 sample3 4 Mixed rs and ss 1 sample 2 sample2 3 sample3 Fig 2 4 Multiple rs input with space to separate example 2 Multiple re rst 1 sample 2 sample 3 Multiple ss 1 sample4 2 samp eamp 4 Mixed rs and ssi 1 sample 2 sample2 3 samp
15. 202183 ap A i SET a ye eam TU dal ee a el 7 7 i Ma a A LL ei aes ATLL i a E I L aa lan re ya ar bar eg a ee 7 z ae ee Ti gt en a sed TaqMan Result The SNP in sequence t can be distinguished Fig 2 28 The icon of TaqMan appears in rs1202183 which is in SNP ID example 4 ss1717832 Result D The SNP in sequence can be distinguished User can click the icon of TaqMan and then TaqMan information for this SNP will be represented Fig 2 29 and Fig 2 30 show the available TaqMan information for rs1318703 and rs 1202183 respectively TaqMan Information TaqMan Assays for A2BP1 01 rs1318703 Assay number A 044704 Not Validated ABI order number BCAC3 04 Fig 2 29 The TaqMan information for rs1318703 is shown after clicking the icon of TaqMan in Fig 2 27 18 Updated 2009 11 03 SNP RFLPing 2 User Manual Thermocycling conditions TEVMGB60 Fig 2 30 The TaqMan information for rs1202183 is shown after clicking the icon of TaqMan in Fig 2 28 19 Updated 2009 11 03 SNP RFLPing 2 User Manual 3 Function SNP in fasta sequence input 3 1 Overview SNP in fasta sequence format is acceptable to query the SNP RFLP information in SNP RFLPing 2 Single fasta sequence multiple fasta sequences with SNPs in ACNTP1 dNTP2 or IUPAC formats and special sequences with SNP in the indel insertion and deletion tri allelic and tetra allelic formats are a
16. Fig 2 12 for a moment and the result for SNP information will appear Fig 2 13 The result for SNP information includes reference SNP ID rs organism short SNP flanking sequence 52 bp in total chromosome information clinical LSDB associated PubMed citing SNP gene sequence viewer SNP 3D OMIM heterozygosity frequency validated and genotype data such as NCBI Entrez SNP Furthermore HGVS Names are provided for Homo sapiens The program is running The page will update after 1 seconds Please wait some minutes Thanks Fig 2 12 Waiting for the SNP information query ea SNPs Results 1 All selected selected All unselected unselected Analyze sequence Sequence rs11540652 Homo sapiens CAGTTCCTOCATGOGCGGCATGAACE A GAGGCCCATCCTCACCATCATCACA i MapView Gene View seqview DIA Baana nan annarra HGVS Names MM _000546 3 0 743GA wE 000537 3p R2460 NT _010718 150 71746660 gt 7 Fig 2 13 The result for SNP information 10 Updated 2009 11 03 SNP RFLPing 2 User Manual 2 2 3 Example 3 SNP RFLP analysis Subsequently user can check SNP for further analysis In this example a SNP rs11540652 is chosen to check Fig 2 13 and users can click the Analyze sequence button to execute SNP REFLP function When the Analyze sequence button is clicked a waiting page will appear Fig 2 14 The program is running The page will update after 5 seconds OTT Please
17. GAAGAACCGAAA 5 3 CACGGTAGAAAAGGAACCACCCACAGCTGAATTTICTGGTTGAAGAACCGAAA 5 3 CACGGTAGAAAAGGAACCACCCACAGATGAATTICTGGTTGAAGAACCGAAA 5 C show all Non Commercial Non IUPAC IUPAC Sequence t 3 a NOMIUPAC sm Sequence 1 PAC i A IUPAC at Non IUPAC 1 SLATGAA TUPAC J Sequence 3 Fig 3 16 The available restriction enzyme information for the sense strand with SNP in the tetra allelic format In this case the enzymes for the antisense strand are chosen as indicated by red arrow in the top In the left side three red arrow lines indicate that three nucleotides are distinguished between each other The sequence 1 is unable to find the suitable enzyme but it is still distinct to others because it is unable to cut by the enzymes listed for sequences 0 2 and 3 28 Updated 2009 11 03 SNP RFLPing 2 User Manual 4 Function Multiple SNPs within one sequence 4 1 Overview In the function for multiple SNPs within one sequence up to 50 SNPs representing in the dNTP1 dNTP2 or IUPAC formats within the input sequence are acceptable for analysis The flanking sequences for two nearby SNPs should not be overlapped within 6 nucleotides There are two input areas in the function one is Description which is a title for describing input sequence and the other is Sequence which is input multiple SNPs sequence Fig 4 1 and Fig 4 2 are two SNPs within one sequence in t
18. GAAGAGTA 8144848 Homo sapiens ACTTCCACTCTCAAAGGGCTTCTGAT G T TOCTACATTTGAATCTAATGGATCA HGVS Names Mi_000059 3 33964 gt G WP_000050 2 p K1132K NT_024524 13 g 13891887A gt G 4 8206146 Homo sapiens ctgaagtggggcaaaggaaatagagg A G aaaggaggaatgatagtgaatatag No omm LIIM A HGVS Names MiM_000059 3 c 9256 2475G gt A NT_024524 13 g 13936757G gt A TTAATTAGGTTCCAGTTACATACTGA G AATGAACAATATCTAAAGCTTAGCT M Say A 5 rs206081 Homo sapiens taggtttttatgaagttttcatagtc A GJatttcctctaggttcctttctgcta NoOMM nan hy The tagSNPs provided by the HapMap are selected from different blocks In the same block the international HapMap Project Tue Aug 18 08 35 32 2009 HapMap tag SNPs 10 tag SNPs picked out for population CEU chri3 31787616 31871808 using the algorithm Tagger pairwiseTagging picked tagSNP may be different from time to time at tag SNPs Chromosome Pos mat int h rs4942505 chri3 31861707 0 442 some intervals SUCN as rs9943888 chri3 31826202 0 208 z ae rsi801406 chri3 31809888 0 317 Interval 1 Animation same as top view rs206146 chri3 31854757 0 292 3 7 Animation rs206081 aaa Ee ees og Interval 2 partly different to Interval 1 Ani 4 rs542551 chri3 31857534 0 263 i i FHOEETSE2 SES OTD nage Since the SNP RFLPing 2 is retrieved online to the rs144848 chri3 31804729 0 292 wv asda ida ddaioni pees HapMap therefore it has the same condition as rs9562605 chri3
19. GGICICCI GGAGGCAAGS AGCCACAGGA GIIGCICGCA AGGACCAGIC GGGCTIICCAA GGACACAGC CGGASGCAGC GACAGAAICI GIAGCIGArs CCITIGCIIT TTICCITITA IGCAGCITAA AIGAIGGIGA GICAIIGIII CCCCAACAIA CICICICACA TICIICIGAG GGAAGCGAGI G CIGGAGGGIT AGAAGGGICC AGAGITIGAA GCIGCITACA AGCCICAGAT AGIGICAICI ARGCICAGGC ACTITATAAC ACGACTCAGA ARAIGAACGGCA CCAACCACCC CGACCTIGCI ASIGGAAAGA AIGCATAATG TCRARTCTOS AGCIGGGGIG AAATCATAGC GGACIGICCI GCAITCCAAGA CTG Ea mn EE LTE L Fig 2 26 The restriction enzymes and natural primer set information for rs45541837 The mutagenic position is underlined with green color in the F of primer pair field Both forward and reverse primers are underlined with red color and the SNP is indicated by an arrow line is the sense strand and is the antisense strand 17 Updated 2009 11 03 SNP RFLPing 2 User Manual 2 2 8 Example 8 TaqMan information providing In above SNP rs11540652 its TaqMan probe is not provided in both NCBI and SNP500Cancer Fig 2 15 However some SNPs such as rs1318703 which is shown on SNP ID example 2 Fig 2 27 and rs1202183 which is shown on SNP ID example 4 ss1717832 Fig 2 28 provide TaqMan probe When a SNP provide TaqMan probe the icon of TaqMan will appear in the result of SNP RFLP analysis sequence Result The SNP in sequence can be distinguished Result The SNP in sequence can be distinguished SNP ID rs1
20. NA When users click the button Query this miRSNP information will be queried and the waiting page will be shown Fig 7 2 After the query finished the results for miRSNP will be shown Fig 7 3 and Fig 7 4 show the result for query transcript ID NM_015658 of human and the results for query transcript ID miR 198 of human respectively The provided information contains transcript ID SNP ID rs Location SNP position in transcript ID Chr Pos chromosome position Ancestral Allele Allele miR ID miRNA ID Support miR Site miRNA site and FuncClass function class e miRSNP Info Query The program is running The page will update after 2 seconds Please wait some minutes Thanks Fig 7 2 Wait for miRSNP information query 37 Updated 2009 11 03 SNP RFLPing 2 User Manual miR ID M NM 015658 rs839 2051 869549 i 0 teTTTGAAtattt 0 A aeea o aeoe E NM 198576 rs2799073 6632 980668 G miR 525 0 CTCTGGAccetge c G Tane DEN zee ee E miR 198 O tcacgtCTGGACA C miR 1 mreti yall a ls miR 198 0 teacgtCTGGACA C 2312 47167933 A nea De LCS eaies lee Cc miR488 2 atogATCTGGAcc D 1163 148029723 C miR 198 3 ategaTCTGGACc D T 4093 180809448 T c 0 cCTGGACAtgtca C miR 198 miR 101 G miR 199a 0 ataCTGGACAatg C 2197 8156297 T miR 144 miR 493 5p 10 aTACTGTAcaatg D 9 atacTGTACAAtg D miR 198 miR 101 G miR 1499a 0 ataCTGGACAatg C 2194 8156297 T miR 144 miR 493 5p T
21. NPbI26 CEU w Tagger Pairwise Hacker Data Rel 16c Lihesel Tane0S on NCBI B34 seni abSNP bl 24 HapMap Data Rel 21 phasell Jul06 on NCBI B35 assembly dbSNP b125 on NCBI B36 assembly dbS NP b126 Tagger Multtumxkex Haph fap Data Fel 22 fphas el A pully Fig 6 2 The results for SNPs information query using HUGO gene name BRCA2 here limit only show 20 SNPs and three SNPs is picked in the figure HapMap Database HapMap Data Rel 22 phasell Apr07 on NCBI 836 assembly dbSNP b126 Population CEU Pairwise Methods Tagger Pairwise RSquare cut off 0 8 MAF cut off 0 2 Sanan SNPs 10 1 LA O ggatatagaatttgtagttgataatt C T tttetttcagtacttgaaaaatatt rs542551 Homo sapiens AAAGTACTTTGAAGGAGCTCTGGCCA A G TACGTCCATGCAGACCTTTGTCTIT No oum SEINT i HGVS Names Mf_000059 3 9257 51 19C gt T NT_024524 13 g 13943707C gt 7 BBE Homo sapiens C GTTTTGGAGACTTTTTTTGAGGAATC A G GGAAGAGGTAAAACCAGTAAAAGAT HGVS Names MiM_000059 3 7008 7964 gt G NT_024524 13 g 13908202A gt G MER Pubtics Conwvow TSei view SRS e HGVS Names AM4_000059 3 9256 52524 gt G NT_024524 131g 13939534A gt 6 9567552 Homo sapiens TAATTGCTGTATTOCGAAGACATGCT G T J ATGGGAATTACCAGGOGGOGTTGGT HGVS Names WA4_000059 3 c 39 332G T NT_024524 13 g9 13870227G gt T 3 1801406 Homo sapiens C CAGTTTGAATTTACTCAGTTTAGAAA A G CCAAGCTACATATTGCA
22. SNP RFLPing 2 User Manual SNP RFLPing 2 an updated and integrated PCR RFLP tool for SNP genotyping User Manual pet ONR REUPing anjupdated andjintegrated PCR RELP database toollfonSNPgenotypingy AXC aR a a eS Contact changhw kmu edu tw yuhuei cheng qmail com chuang isu edu tw chyang cc kuas edu tw Updated 2009 11 03 SNP RFLPing 2 User Manual Table of content 1 Introduction 1 1 Purpose 1 2 System workflow 1 3 Function overview 2 Function SNP ID for input 2 1 Overview 2 2 Example A complete operation using SNP ID to analyze the SNP RFLPing 2 2 1 Example 1 SNP IDs input 2 2 2 Example 2 Query SNPs information 2 2 3 Example 3 SNP RFLP analysis 2 2 4 Example 4 Natural primers information acquiring 2 2 5 Example 5 Available restriction enzymes request 2 2 6 Example 6 Further restriction enzyme information description 2 2 7 Example 7 Mutagenic primer information acquiring 2 2 8 Example 8 TaqMan information providing 3 Function SNP in fasta sequence for input 3 1 Overview 3 2 Example Use SNP in fasta sequence format to analyze 4 Function Multiple SNPs within one sequence for input 4 1 Overview 4 2 Example Multiple SNPs within one sequence input 5 Function GenBank accession no for input 5 1 Overview 5 2 Example Use HUGO gene name TP53 to analyze 6 Function TagSNP from HapMap 6 1 Overview 6 2 Example Use HUGO gene name BRCA2 to analyze 7 Function Transcript ID
23. TACAAAA AAAAATIAGC CGGGCGIGGI GCIGGGCACC IGIAGICCCA GCTACTCGGG 000241 AGGCIGAGGA AGGAGAATGG CGIGAACCIG GGCGGIGGAG CIIGCAGIGA GCIGAGATCA 000301 CGCCACIGCA CICCAGCCIG GGCGACAGAG CGAGATICCA TCTCAAAAAA AAAAAAAAAA 000361 GGCCICCCCI GCTIGC 000421 TATCICCTAG GTIGGCICKNE ACIGIACCAC CATCCACTAC AACTACATGI GIAACAGTIC 000481 CIGCAIGGGC GGCAIGAACC RGAGGCCCAT CCICACCAIC ATCACACIGG AAGACICCAG 000541 GICAGGAGCC ACTIGCCACC CIGCACACIG GCCIGCIGIG CCCCAGCCIC IGCITGCCIC 000601 IGACCCCIGG GCCCACCICI TACCGAITIC TICCATACIA CIACCCATCC ACCICICATC 000661 ACATCCCCGG CGGGGAATCT CCTTACTGCT CCCACICAGI ITICTITICI CTGGCTTTGG 000721 GACCICIIAA CCIGIGGCIT CICCICCACC TACCIGGAGC IGGAGCTIAG GCICCAGARA 000781 GGACAAGGGI GGTIGGGAGI AGATGGAGCC IGGITIITIA AATGGGACAG GIAGGACCIG 000841 AITICCIIAC IGCCICIIGC TICICTITIC CIATCCIGAG IAGIGGIAAT CIACIGGGAC 000901 GGAACAGCIT IGAGGIGCGI GITIGIGCCT GICCIGGGAG AGACCGGCGC ACAGAGGAAG 000961 AGAATCTCCG CAAGAAAGGG GAGCCICACC ACGAGCIGCC C Fig 2 16 The restriction enzymes and natural primer set information for rs11540652 Both forward and reverse primers are underlined with red color and the SNP is indicated by an arrow line is the sense strand and is the antisense strand 12 Updated 2009 11 03 SN P RELPing 2 User Manual 2 2 5 Example 5 Available restriction enzymes request In order to further get full enzymes information users can click the Enzymes Information button Fig 2 17 shows only the available sense strand
24. TP2 format When the sequence is too long the part of the sequence will list in the next line automatically The system is able to regard them as the single sequence input If the SNP is marked in IUPAC code the sequence is continued as shown in Fig 4 6 31 Updated 2009 11 03 SNP RFLPing 2 User Manual Multiple SNPs Description GATGG GTAGTAGTATGCUGAAATCGRTAAGAGGTGGGCCCAGTTAGCACCGCGGGTCGCT ACGGGCTI GCTGTCGCGGGATTTCGGTCCACT GAGAGGTGGATGGGTAGTAGTATGGM AGASATCGGTSAGAGGTGGGCCCAG Sequence 1 Two SNPs 1 dNTPs sequence 2 IUPAC 5 gt examples 2 Three SNPs 1 dNTPs sequence AF se 3 Four SNPs 1 dNTPs s Fig 4 6 Four SNPs within one sequence in the IUPAC format After inputting multiple SNPs within one sequence users can click the Query button this system will separate multiple SNPs into specific SNP fasta sequence Fig 4 7 User can select the interested SNPs to to perform SNP RELP analysis after clicking the button Analyze sequence The following steps are the same as the function of 3 SNP in fasta sequence input page 19 and they are shown here In Fig 4 7 the All selected button provides convenience to check all SNPs and the Clear button provides cancel all SNP checked nite its nput SNP Fasta Resi All selected Clear_ ji f 1 wo SNP 5 _Analyze sequence Fig 4 7 Four SNPs within one sequence in the IUPAC format 32 Upd
25. The SNP in sequence can be distinguished _ Enzymes Information _ Result T The SNP in sequence can t be distinguished N TaqMan Result the sup in sequence can t be distinguished Enzymes Information Fig 3 12 The results for SNP RFLP recognition When uses input a fasta sequence with SNP in the in del insertion and deletion tri allelic and tetra allelic formats their results are described as follows For SNP in the in del format the results are similar to di allelic SNP Fig 3 13 and Fig 3 14 For SNP in the tri allelic format the results for restriction enzymes information will present three sequence IDs with their corresponding available restriction enzymes for three different alleles Fig 3 15 For SNP in the tetra allelic format the results for restriction enzymes information will present four sequence IDs with their corresponding available restriction enzymes for four different alleles Fig 3 16 For input SNP in fasta sequence format the results for SNP RFLP recognition will show the natural or mutagenic design results because the SNP flanking sequence is not provided by the user input sequence sequence Result The SNP in sequence can be distinguished Result The SNP in sequence can be distinguished Fig 3 13 The result for SNP RFLP recognition with SNP in the in del farmat 26 Updated 2009 11 03 SNP RFLPing 2 User Manual
26. ated 2009 11 03 SNP RFLPing 2 User Manual 5 Function GenBank accession no for input 5 1 Overview SNPs within the sequence information for the input accession no of GenBank includes reference SNP ID rs submitter SNP ID ss accession version HUGO gene name local link ID gene ID and Local SNP ID The classification of dbSNP in NCBI for function class coding nonsynonymous reference intron coding synonymous locus region MRNA UTR and splice site SNP class heterozygous indel mixed multinucleotide polymorphism named locus no variation and snp and heterozygosity are selectable Furthermore the TaqMan for non limit SNP500Cancer ABI and SNP500Cancer ABI are available All the information from GenBank is retrieved online for all available species Fig 5 1 and Fig 5 2 5 2 Example Use HUGO gene name TPS53 to analyze Accession Key y SNP RFLP analysis of the input accession no Organism All __ Function Class All ms Moss aL Heterozygosity TaqMan 1 Non limit O 2 SNP500Cancer 3 ABI 4 SNP500Cancer ABI Accession Reference SNP ID 1 Reference SNP ID 1 rs11540652 2 rs28934875 3 rs62068667 4 rs45541837 5 rs55863639 2 Submitter SNP ID 1 58389341834 2 ss90566964 3 5576882845 4 5639341846 5 5574801690 examples 3 Accession version 1 NM_173728 2 2 NP_O00537 3 3 XM _ 868342 2 4 NW 876255 1 5 NT 010718 15 4 Gene Name 1 TP53
27. bMed Nucleotide Protein Genome Structure OMIM PMC Journals Books Search PubMed v for bspeni Advanced Search Save Search Limits Preview Index History Clipboard Details Your search for Ssp NCI retrieved no results However a search for speni retrieved the following items Display AbstractPlus v Show 20 Sort By Sendto all 1 Review O Ea j FULL TEXT AYAILABLE ONLINE j 1 1 Anim Breed Genet 2009 Apr 126 2 134 41 Links WinterScience Related articles Associations of the variation in the porcine myogenin gene with muscle fibre characteristics Impact of MYOD family genes on pork traits in Large White and lean meat production and meat quality traits Landrace pigs J Anim Breed Genet 2007 Characterization expression profiles intracellular distribution Kim JM Choi BD Kim BC Park SS Hong KC and association analysis of porcine PNAS BMC Genet 2008 Division of Biotechnology College of Life Sciences and Biotechnology Korea University Seoul South Indications of associations ofthe porcine FOS proto Korea oncogene with skeletal muscle fibre traits Anim Genet 2002 Pig breeding is aimed at improving lean meat production ability as well as meat quality and gt GEAG Cracking the genomic piggy bank identifying secrets muscle fibre characteristics may be important for enhancing these traits Therefore new of the pig genome Genome Dy
28. delity HF restriction enzymes OF Does BsmAl replace an enzyme previously sold A7 Yes Alw26I O8 Is BsmaAl blocked by CpG methylation AS Yes at sites with overlapping Isoschizomers NEB a GGATC 4 5 AclWI BspPI Alw21I GWGCW C BsiHKAl ROS70 GWGCW C Bbvizl BsiHKAl Alw261 GTCTC 1 5 BsmAI ROS29 TETE 1 5 BemAl BeoMAl Alw44IG TGCAC ApaLl 14 Updated 2009 11 03 SNP RFLPing 2 User Manual Fig 2 20 The search results for Alw26l in NEW ENGLANE BioLabs REBA Gi M a REBASE Suppliers 08 11 2009 PER Suppliers for Bsisl Suppliers Buffer Reaction Temperature Minotech Biotechnology Minotech Unique Buffer 4 55 Fig 2 21 Commercial enzymes option is Suppliers Clicking the BsiSl enzyme will link to REBASE Suppliers and show the suppliers for BsiSI Y i i ice k mec return Fig 2 22 For enzyme BsiSl no any price is provided Show Enzyme Price 1 Hpall Update Time 2007 08 13 18 50 18 0 Size Concentration Price 40 000 units 40 000 units US 224 00 ROW 1M 10 000 units 50 000 units US 224 00 R017155 2 000 units 10 000 units 1US 56 00 Fig 2 23 For enzyme Hpall the price is provided from NEB 15 Updated 2009 11 03 SNP RFLPing 2 User Manual amp service of the U S National Library of Medicine and the National Institutes of Health NCBI Sign In Register 2 NCBI PubNiwled www pubmed gov All Databases Pu
29. ed Result CS The SNP in sequence can t be distinguished Enzymes Information Fig 2 25 No any available restriction enzymes for SNP rs45541837 the icon of Mutagenic appears in the result of SNP RFLP analysis SNP ID rs45541837 is the sense strand is the anti sense strand Strand orientation as sha Recognized allele Restriction enzymes 0000 Nhaal position length bp GCno GC tm C tm diff C 480 500 21 9 4286 60 primer pair F T CCCTCTCTTGCAGAAIT C AAS product length bp 21 8 109 R CTGCGTTCCCATTATGC 592 608 17 9 5294 52 129 000001 000061 000121 000181 000241 000301 000361 000421 000461 000541 ogg gl 000661 000721 000781 000841 000901 000961 ICTATTAGCC CATTGCAGIT CAGCIAGGCA CCAGAAGAAR AGGCCAIAGS CCICAAGCCA CAGCAGCCCC CAGCAICAGI IGCCCICICI AGAACAAATG GGAACGCAGA CCICACGAAG IGIAGIIGAT SCCIGCIGAA CAAAGGGGET ACCACAAGAT AGTICCTAGC ATRAACAGIC GnAACGIAIT CAGAGTIGAGC TITAAAGICC SAGCIGAGCI GGCCAGGCCE AACCIGCACA IGCAGAATAA GIGAGCAGCA AAGGCCAIGI CIAGGGGCIA GGIGGCCTIT ATAAAATATIA AGGCAGAAAC GCICIGIGAC GAGAGTCCAG CATCCICCTIA CAICCCIGGC TCAACTCCCA AGTIGAACAS ARAAGGGCIC GACIICCCIG C TCCCAGIGG cICTICTcce SAAGGGGCIT GIGCCGTITA GCAGATAGA AAAGACGAGT TTACCICTGI ACTTIGGGIG SCCITIGCiIT GCITIGGAGC TGGCICAAAG ACIGIIGGAT TATCITIIICI AAC ISITICA ICTIACAACT ARAITICIAC CCCACGITIG CGCCCAGGCE ACGGCGGCIGCA GGCACAGGGE GACGGCGAT TA
30. entioned above users can click the Input button and all information which is not belong to A T C T ANTP1I dNTP2 dNTPn or IUPAC will be filtered out The results for SNP fasta sequence input are shown as Fig 3 10 including 1 All selected 2 Clear 3 Analyze sequence 4 the description for sequence and 5 SNP sequence Users can check the desired SNPs and click the Analyze sequence to next step If the all SNPs need be analyzed the All selected button provides convenience to check all SNPs The Clear button provides cancel all SNP checked ASUS Analyze sequence Fig 3 10 The results for SNP fasta sequence input When clicking the Analyze sequence users need to wait for the analysis of SNP RFLP recognition Fig 3 11 Then the results for SNP RFLP recognition will be presented Fig 3 12 Finally users can select the interested SNPs as described above 6x SNP RFLP Recognition The program is running The page will update after 5 seconds Please wait some minutes Thanks Fig 3 11 Wait for SNP RFLP recognition 25 Updated 2009 11 03 SNP RFLPing 2 User Manual Result ys The SNP in sequence can be distinguished No TaqMan Enzymes Information Result The SNP in sequence can be distinguished Result The SNP in sequence t can be distinguished No TaqMan Result A
31. he ANTP1 dNTP2 and IUPAC formats respectively Fig 4 3 and Fig 4 4 are three SNPs within one sequence in the ANTP1 dNTP2 and IUPAC formats respectively Fig 4 5 and Fig 4 6 are four SNPs within one sequence in the dNTPI dNTP2 and IUPAC formats respectively 4 2 Example Multiple SNPs within one sequence input Multiple SNPs Description TTAGCACCGCGGGTCGCTACGGGCC Cm TIGCTGTCGCGGGATTICGGTCCACTG3S amp decrecaTaactacractateGc AGAAATCGGTAAGAGGTGGGCCCAG Sequence examples EE 2 IUPAC TA 3 Four SNPs 1 dNTPs re nra 1 2 IUPAC sequence Fig 4 1 Two SNPs within one sequence in the ANTP1 dANTP2 format When the sequence is too long the part of the sequence will list in the next line automatically The system is able to regard them as the single sequence input If the SNP is marked in IUPAC code the sequence is continued as shown in Fig 4 2 29 Updated 2009 11 03 SNP RFLPing 2 User Manual Multiple SNPs GGATGGGTAGTAGTAT TCGS TAAGAGGTGGGCCCAG TTAGCACCGCGGGTCGC AGAAATO t TYT TGCT GTCGCGGGATTTCGGTCCACTGAGAGGT Sequence 1 Two SNPs 1 dNTPs sequence examples 2 Three SNPs 1 dNTPs sequen T 3 Four SNPs 1 dNTPs n 2 1 IUPAC sequence2 Fig 4 2 Two SNPs within one sequence in the IUPAC format Multiple SNPs ithree SNPs Description TGAGAGGTGGATGGGTAGTAGTATGGIA C AGAAATCGGTAAGAGGTGGGCCCAGTTAGCACCGCGGETCGCTACGGGCCTICM
32. in del format When the sequence is too long the part of the sequence will list in the next line automatically The system is able to regard them as the single sequence input 23 Updated 2009 11 03 SNP RFLPing 2 User Manual SNP Fasta Sequences ATCT GGAASTTTATTAAAAAT CT AA SNP fasta sequences 1 Single fasta sequence 1 s 2 2 Multiple fasta sequences NTP 1 samel 2 sample 3 Multiple fasta sequences IUPAC W1 sample 2 sample2 4 Special sequences 1 in dell 2 tri allelic 3 tetra allelic examples Fig 3 8 Special sequence with SNP in the tri allelic format When the sequence is too long the part of the sequence will list in the next line automatically The system is able to regard them as the single sequence input GTGCCATCTTTICCTTGGTGGGTGTC AGT ACTTAAAGACCAACTTCTTGGCTIT SNP fasta sequences Crou gear 1 Single fasta sequence 1 sample 1 2 sampie tamales 2 Multiple fasta sequences dNTPs 1 sample1 g aeaa 3 Multiple fasta sequences IUPAC 1 samolet 2 4 Special sequences 1 in del 2 tri allelis Fig 3 9 Special sequence with SNP in the tetra allelic format When the sequence is too long the part of the sequence will list in the next line automatically The system is able to regard them as the single sequence input 24 Updated 2009 11 03 SNP RFLPing 2 User Manual After inputting the SNP fasta sequence as m
33. le3 Fig 2 5 Multiple rs input with lines press the enter key of keyboard to separate Updated 2009 11 03 SNP RFLPing 2 User Manual query J clear 2 181318703 3 838341834 4 51717832 ampe tiple rs 1 sample1 I 2 samole2 3 samole3 3 Multiple ss 1 sample1 2 sample2 3 sample3 4 Mixed rs and ss 1 samplei 2 sample2 3 sample3 Fig 2 6 Multiple ss input with the comma symbols to separate 38341534 ss90566964 ss 6882845 ss36341846 ss74801690 1 Single ID 1 1511540652 2 rs1318703 3 3538341834 4 51717832 2 Multiple rs 1 sample 3 sample3 3 Multiple ss 1 samplet sample3 4 Mixed rs and ss 1 sanipie tT T27 Samiple2 3 sample3 example Fig 2 7 Multiple ss input with space to separate 7 Updated 2009 11 03 SNP RFLPing 2 User Manual SNP IDs 1 Single ID 1 1511540652 2 181318703 3 3538341834 4 981717892 2 Multiple rs 1 sample 2 sample2 3 Multiple ssi 1 sample 2 sample2 4 Mixed rs and ss 1 sample1 2 sanihrez TS Sample3 example Fig 2 8 Multiple ss input with lines press the enter key of keyboard to separate SNP IDs Please input Reference SNP IDs rs or Submitter SNP IDs ss for SNP RFLP analysis rs11540652 rs28934875 ss90566964 rs45541837 ss74601690 1 Single ID 1 511540652 2 rs1318703 3 ss383418 2 Mapema imple
34. ll acceptable Fig 3 1 shows a regular single fasta sequence Fig 3 2 shows a single fasta sequence with line press the enter key of keyboard which is ignored in the system Fig 3 3 and Fig 3 5 show regular multiple fasta sequences with SNPs in AUNTP1 dNTP2 and IUPAC format respectively Fig 3 4 shows multiple fasta sequences with SNPs in AdNTP1 dNTP2 Fig 3 6 shows the IUPAC format with lines press the enter key of keyboard which are ignored Fig 3 7 to Fig 3 9 are special sequence with SNP in the in del tri allelic and tetra allelic formats respectively In the SNP fasta sequence input the uppercase or lowercase letters are acceptable 3 2 Example Use SNP in fasta sequence format to analyze SNP Fasta Sequences CAGTTCCTGCATGGGCGGCATGAACCIAIG GAGGCCCATCCTCACCATCATCACA SNP fasta sequences 1 Single fasta sequence 1 sample1 2 sample2 l Multiple fasta sequences d 1 sample1 2 sample2 examples 3 Multiple fasta sequences IUPAC 1 sample1 2 sample2 4 Special sequences 1 in del 2 tri allelic 3 tetra allelic Fig 3 1 SNP in a regular single fasta sequence 20 Updated 2009 11 03 SNP RFLPing 2 User Manual SNP Fasta Sequences ra Phi lease i inpu t SN P fa a sec equences i for SNP R RFLP l P analysis ith jtina e maximum load ii is 5 50 f 11540652 CAGTTCCTGCATGGGCGGCATGAACC AG GAGGCCCATCCTCACCATCATCACA SNP fasta sequences
35. load interface for SNP IDs and SNP fasta sequences File Upload SNP IDs rs or ss or SNP fasta sequences file for fasta format txt SNP IDs SNP IDs ME 1 Single IDs 1 singlelD file1 2 singlelD file2 2 Multiple rs 1 multiple _rs file 2 multiple _rs file2 3 multiple rs file3 3 Multiple ss 1 multiple_ss a 2 1 ss file 3 multiple ss file3 4 Mixed rs and ss 1 mixed rs amp ss 21 2 mixed rs amp ss file2 3 examples mixed rs amp ss file3 SNP fasta sequences 1 Single fasta sequence 1 singleSeg filet 2 singleSeq filez 2 Multiple fasta sequences dNTPs 1 dNTPs filet 2 dNTPs file 2 Multiple fasta sequences IUPAC 1 IUPAC filet 2 IUPAC file2 Fig 9 1 The interface for File upload function 43 Updated 2009 11 03 SNP RFLPing 2 User Manual 10 Appendix 10 1 Abbreviations SNP Single nucleotide polymorphism RFLP Restriction Fragment Length Polymorphism CGAP Cancer Genome Anatomy Project PolymiRTS Polymorphism in microRNA Target Site database HUGO Human Genome Organisation IUPAC The International Union of Pure and Applied Chemistry YRI Yoruba in Ibadan Nigeria JPT Japanese in Tokyo Japan CHB Han Chinese in Beijing China CEU CEPH Utah residents with ancestry from northern and western Europe MAF Major Allele Frequency miRNA GO Gene Ontology ENCODE ENCyclopedia Of DNA Elements 10 2 Related links
36. n 2006 molecular markers have been demanded for selecting lean meat production ability and meat gt EQ Research progress on myogenin gene quality in live animals Myogenin belongs to the MyoD gene family and is a candidate gene Yi Chuan 2004 responsible for muscle fibre characteristics We identified a new single nucleotide polymorphism SNP site in the 5 upstream region of the myogenin gene nucleotides C and See reviews See all T total of 252 pigs of three breeds were genotyped by polymerase chain reaction Fig 2 24 Clicking the non Commercial enzymes will be sent to NCBI PubMed to search related documents 16 Updated 2009 11 03 SNP RFLPing 2 User Manual 2 2 7 Example 7 Mutagenic primer information acquiring Some SNPs are not recognized by any restriction enzymes Alternatively the mutagenic primer may be designed by the SNP RFLPing 2 system When a SNP does not have any restriction enzymes the icon of Mutagenic will appear after SNP RFLP analysis Fig 2 25 Clicking the icon of Mutagenic the mutagenic primer set information is appearing Fig 2 26 The mutagenic primer set information contains SNP ID strand orientation recognized allele restriction enzymes mutagenic primer pair information and mutagenic primer visualization mma E i em CTCTATIGCA GAATAA f RACGGCCIIA GCOCACAGGAS IIGCI No TaqMan Y Mutagenic Result t ine SNP in sequence can t be distinguish
37. n and natural primers visualization SNP ID rs11540652 strand orientation Recognized allele S A C Restriction enzymes BspNcI Drdli StyLTl Asp 4el Bba179l Bea l Bco 7l Beil BsaWl Bsazl BShMl Bsisl Bspl Bsp47l Bsp4el Bsp1161 Bspi59 ll Bst40l Bsti4 sl Bsu1192l BsuFl Chol Cecel PLOSposkly Finl Hapll Hinl Hinds Heal HoyVill HeyF 42l Mnill Mino Mspl BshDI BshEI BshFI BsiAl BsiDI BsiHI Bsnl Bsp23l Bsp44ll Bsp1371 Bsp211l Bsp226l Bspseil Bsp12611 Bsp1593 Bsp4013l1 Bsp2362l Bsp 5001 BspANl BspBDG2l BspBRI BspBSE18l BspBakell BspCHE 15 Bsp GHA BspH106il EsabCe4l Esavvetl Fins Foul M H l Hael Haelll Hhal Hpyigslll Hpyt evil HpyFi0V HpyF26ll HpyF291 HpyF33ll HpyF4e2l HpyF4 6y HpyF4agly HpyF 53l HpyFo l HpyFesl HpyFesl HpyF Fel HpyF Zall MchAll MSA Mnil Moll Manli MthTI NgoAll NaoCll M NgoSli NgoNi NaoPll Nacl NaoTll Nial NspLKI Ochi Fail Spill Sual Sull Tsp132l Tsp266l Tsp27 2l Tsp281 Tsp560l Tsp2Nl TteAl Tinl Ubati Ubas bab Ubaidgri Ubaidi Ubai146l Ubaii14 7 Ubai150l primer pair position length bp GCno GC tm C tm diff C product length bp F CAAGGCGCACTGGCCTC 388 404 R GGGGATGTGATGAGAGG 651 667 17 12 7059 58 113 4 168 17 10 58 82 54 280 000001 GTITAACTAT IGCACAGTIG AAAAAACTGA AGCITACAGA GGCTAAGGGC CICCCCTGCT 000061 IGGCIGGGCG CAGIGGCICA TGCCTGTAAT CCCAGCACTT IGGGAGGCCA AGGCAGGCGG 000121 ATCACGAGGI IGGGAGATCG AGACCAICCI GGCTAACGGI GAAACCCCGT CICTACTGAA 000181 AAA
38. nout Cercar 1 Single fasta sequence 1 sa E 2 Multiple fasta sequences dNTPs 1 sam _ 2 sample2 et 3 Multiple fasta sequences IUPAC ai e 2 sanacie 4 Special sequences 1 in del 2 tri allelic 3 tetra allelic Fig 3 2 SNP in a single fasta sequence with line press the enter key of keyboard which is ignored in the system When the sequence is too long the part of the sequence will list in the next line automatically The system is able to regard them as the single sequence input SNP Fasta Sequences CAGTTCCTGCATGGGCGGCATGAACCIAIGIGAGGCCCATCCT CACCATCATCACA rs26934875 CCCTCAACAAGATGTTTTGCCAACTG C G ICCAAGACCTGCCCTGTGCAGCTGTIG rs62068667 ACATGCCTGTAATCCCAGCACTTTGG A GIAGGCCAAGGTGGGCGGATCACCTGA rs45541837 CTTGCTTGCCCTCTATTGCAGAATAAIC GIAAGGGGCTTAGCCACAGGAGTTGCT fs55663639 GAAGCCAGCCCCTCAGGGCAACTGACIA CIGTGCAAGTCACAGACTTGGCTGTCC SNP fasta Sequences 1773 7778 1 Sas fasta sequence 1 ae a es examples a seq 21 4 Special s sequences 1 in del 2 tri allelic 3 tera alelic Fig 3 3 Regular multiple fasta sequences with SNPs in ANTP1 dANTP2 format 2l Updated 2009 11 03 SNP RFLPing 2 User Manual SNP Fasta Sequences Please input SNP fasta sequences for SNP RFLP a d i S tha maximum load is 50 ll Coen eltall Sed ten te aximu jel ee dis 5
39. on the NCBI B36 assembly dbSNP b126 When users input query term for example Gene Name BRCA2 and click the button Query this system will query tagSNP from HapMap and sent a waiting page Fig 2 12 Then the results for HapMap database versions population pairwise methods R square cut off and MAF cut off and tagSNP sequence information will be shown Fig 6 3 The following operation is similar as described above 6 2 Example Use HUGO gene name BRCA2 to analyze Tag SNP HapMap Database Population CEU w YRI Yoruba in Ibadan Nigeria JPT Japanese in Tokyo Japan CHB Han Chinese in Beijing China CEU CEPH Utah residents with ancestry from northern and western Europe Pairwise Te Methods Tagger Pairwise vi RSquare cut 3 off 08 w MAF cut off 02 w Query term BRCA2 1 Positions between chromosome Chro 690 000 730 000 2 Accession number NM 173728 example 3 Gene Name BRCA2 4 Cytoband position 5q31 5 ENCODE region ENm010 Fig 6 1 The results for SNPs information query using HUGO gene name BRCA2 in the setting of the HapMap database of HamMap Data Rel 22 phasell Apr07 on NCBI B36 assembly dbSNP b126 and other parameters as shown in this figure The result is shown in Fig 6 3 35 Updated 2009 11 03 SNP RFLPing 2 User Manual HapMap Database Population Pairwise Methods eta Data Rel 22 phasell anit on NCBIB36 dUS
40. or each SNP are simultaneously analyzed All the prices of the RFLP restriction enzymes are provided for selection Furthermore the previously encountered updating problems for most SNP related databases are resolved by an online retrieval system The user interfaces for the functional SNP analyses have been substantially improved and integrated SNP RFLPing 2 offers a new user friendly interface for RFLP genotyping in association studies and is freely available at http bio kuas edu tw snp rflping2 rflpUL jsp 1 2 System workflow The workflow of SNP RFLPing 2 was illustrated in Figure 1 see next page The system was divided into nine modules including 1 input module 2 data retrieve module 3 sequence process module 4 SNP RFLP module 5 data query module 6 remote database module 7 primer design module 8 output module and 9 SNP RFLP database module according to MVC Model View Controller architecture Input and Output modules are served with the graphical user interface GUI to operate and analyze 2 Updated 2009 11 03 SNP RFLPing 2 User Manual Input Module Data Retrieve Module _ Remote database Module SNP IDs Retrieve data from remote 5 ked 1 Single ID rs or ss database a __ NCBI NCBI 2 Multiple rs a Nucleotide dbSNP _ 3 Multiple ss a 7 TEREN 4 Mixed rs and ss EEE Sequence Process Module esa HapMap SNP fasta sequences eae 1 Single fasta sequence Filt labl l 2 Multiple fasta se
41. ore GO terms users can link to CGAP GO Browser http cgap nci nih gov Genes GOBrowser Fig 8 2 8 2 Example Query Gene Ontology vocabulary term CGAP GO Please input transcipt ID or miRNA for SNP RFLP analysis CGAP database human mouse 1 2 4 4 5 i e 7 v e k 9 k 10 e 11 43 Chromasomes 13 14 45 16 7 44 K 49 E 20 E 34 22 4 x E y ll Unknown SalactAll Unselect All 60 term positive regulation of interleukin 2 biogynihetic process 4 Gene Ontology identifier 1 0030530 2 0045627 3 0019674 4 0093754 5 0004a 4 2 Gene Ontology vocabulary term 1 positive u ati f intedeuki E teas 2 ingulinike growth factor binding ii 3 tryptophan 2 3 dionygenase actiity 4 trrosine phosphorylation of Statt protein 5 muscannle aceiichndliing recaptar elganaling pathwa 3 More Gand Ontology tants reference to CGAP GO Browser Fig 8 1 The interface for the input of Gene Ontology based annotation for SNPs 40 Updated 2009 11 03 SNP RFLPing 2 User Manual CGAP GO Browser Heed helpl Fthis is Sur firit ime wing the GO Browser and yon need help understanding its organin and eooindlogy pee vii All about he oo Eerie Ea _blologicsl_praess IHs 0 Mm ITA fae anabomioal ciructume Jomnadtion Hs 1080 Pim B21 biological adhesion Hs T5S5 him S22 a blialicgical weg baton Re Sed Lim Ter B coll killing He 14 Mim 2 DA cellular cemponent bicge
42. pe Alw26l Sequence ID Recognition Enzyme In Sequence 0 S CAGTTCCTOCATGOGCOGCATGAACCAGAGGCCCATCCTCACCATCATCACA 3 S CAGTTCCTOCATGOGCOGCATGAACCOGGAGGCCCATCCTCACCATCATCACA 3 Recognition P Commercial D Enzyme Name Microorganism Source Sequence Methylation Site Availability 1 Alw26l Acinetobacter Iwofi RFL26 A Janulaitis GTETC 1 5 3654 46 SEITE HEI International lnc Bacteroides coprocola OSM 2 Bcobdl 17136 DSM 17136 GTGT TES 3 Bscall Bacillus species 4304 O Clark ETETE 4 Bsm l Bacillus stearothermophilus ABB4 Z Chen GTCTC 15 75 a 5 EsoM l Bacillus stearothermophilus MWA 5 6K Degtyarew GTCTOM SS 6 BstMAlI Bacillus stearothermophilus WA 5 6K Degtyarev GTCTOM SS Fig 2 19 The different enzyme names with the same recognition sequence GTCTC shopping cart a TECHNICAL CUSTOMER MY NEB search go PRODUCTS REFERENCE SERVICE ACCOUNT j Inc CONTACT NEB ABOUT US SITE MAP LITERATURE REQUEST INTERNATIONAL ORDERS FREEZER PROGRAM QUICH ORDER Home gt Search Search Start new search Search these results Search entire Web Search Help Advan ced Results for Alw26 1 Document count Alw2 6I 3 2 results found sorted by relevance hide summaries 1 3 BamAl aw Storage Temperature 20 C Diluent Compatibility Diluent B Notes General notes BsmaAl is an isoschizomer of Alw261 Incubation at 37 C results in 50 activity and at 65 C FAQs for EsmAl es High Fi
43. quences dNTPs gt BGT UA Vale Sequence 3 Multiple fasta sequences IUPAC r Primer Design Module Multiple SNPs 1 Multiple dNTPs l Design natural PCR RFLP 2 Multiple IUPAC primers 3 2 Design mutagenic PCR Accession Key RFLP primers l Reference SNP ID ____SNP RFLP Module Module P 2 Submitter SNP ID l 3 Accession version KBEa Mining available restriction 4 Gene Name enzymes Output Module 5 LocusLink ID tp 6 Local SNP ID n Output available restriction Tag SNP l Positions between chromosome 2 Accession number 3 Gene Name 4 Cytoband position 5 ENCODE region enzymes and primers Data Query Module SNP RFLP database Module PAR Module Cl amp ae A Transcript ID miRNA rire date trom databases SS SS 1 Transcipt ID Tey lt REBASE miRSNP 2 miRNA z eerr ee a CGAP GO no l Gene Ontology identifier CGAP GO SNP RELP 2 Gene Ontology vocabulary term SS i File Upload SNP500Cancer l SNP IDs file _Assays_SNPs 2 SNP fasta sequences file ia be Fig 1 1 System structure and flowchart for SNP RFLPing 2 1 3 Function overview SNP RFLPing 2 provides eight major functions to assist and analyze the RFLP restriction enzymes and its corresponding primers for SNPs in all SNP related fields including 1 SNP ID input 2 SNP in fasta sequence input 3 Multiple SNPs within one sequence 4 GenBank accession 5 TagSNP from HapMap 6 Transc
44. resa Heia Mm eE ag celular compencnt oganization He 2801 Him 2044 cellular process Hx 1224 4 Mm 12207 E death Hs 8 him 447 E sevslopmantal paces He 2025 firm 2540 Ei establishment of looslization Hs 400 E inn 26 a ow Hia Tu Tes f Immune syilem pirosas Ha SES kim TER ay localization Hx 3465 Mim 208M B locomotion 359711 him Sra BE matabolie process Mi 7213 Mim 7779 ea multi mgan erm process HAr ima EA mutica lular organismal process H3114 Himni Ea pigmentation Hs 48 Jr ES E reproduction HATH Mm ATF E reproductive process HINON Mmirsa A mporn 10 rlimulus He 24402 Mm 2460 OF rhythmic proces Hs 82 Mirm i Bra fe production ETH him 11 Es Cellular component Hs B Fa Mim 1728 BB oea funcion Hesa fhvin 171681 Fig 8 2 More GO terms can be found in CGAP GO Browser Users can copy and paste the interested GO term to the window of GO term to search the SNP information for specific GO term Animation Please click the Animation box to demonstrate When users input GO term for example positive regulation of interleukin 2 biosynthetic process the waiting page for querying CGAP GO information will be shown Fig 8 3 Waiting for a moment the results which contain UniGene Gene Symbol Locus ID Cytoband OMIM sequence and SNP Information for the query GO term will be presented Fig 8 4 In SNPs information two types for SNP query are available one is NCBI SNPs
45. restriction enzymes information When the checkbox for anti sense strand is checked the restriction enzymes information for both the available sense and anti sense strands are shown in Fig 2 18 Sequences are defaulted to show sense strand If needed please click to show antisense strand SNP ID rs11540652 Sequence RFLP w 0 5 CAGTTCCTOCATGOGCOGCATGAACCAGAGGCCCATCCTCACCATCATCACA 3 S CAGTTCCTGCATGOGCOGCATOCAACCLCAGGCCCATCCTCACCATCATCACA 3 CI show all Non Commercial Commercial Sequence Ip Recognition Sequence Non Commercial Suppliers NEB Price Sequence 1 Man IUFAC 1 ALC GE 3 Esisi Hapll Hpall Mspl Aspf4 l Bco2z7l Bsazl IWIPAC ly Ss eee a Bsa Bhat Sl Bear tl Bett Fig 2 17 The available sense strand restriction enzymes information for rs11540652 is the sense strand and is the antisense strand 0 and 1 indicate the alternative nucleotide for the same SNP Sequences are defaulted to show sense strand If needed please click L to show antisense strand RFLP w CAGTTCCTGCATGGGCGGCATGAACCAGAGGCCCATCCTCACCATCATCACA 3 CAGTTCCTGCATGGGCCGGCATGAACCGGAGGCCCCATCCTCACCATCATCACA 3 RFLP w GTCAAGGACGTACCCGCCGTACTTGGTCTCCGGGTAGGAGTGGTAGTAGTGT s GICAAGGACGTACCCGCCGTACTTGGCCTCCGGGTAGGAGTGGTAGTAGTGT s O show all Non Commercial Non IUPAC Sequence 1 a AC 1 SUCC Non IUPAC 7 IUPAC Sequence
46. ript ID miRNA 7 Gene Ontology based annotation for SNPs 8 File upload 3 Updated 2009 11 03 SNP RFLPing 2 User Manual 2 Function SNP ID input 2 1 Overview SNP ID rs and ss is acceptable to query the SNP RFLP information Single ID multiple rs multiple ss and mixed rs and ss are available for SNP ID input For multiple SNP IDs three symbols which are comma SNP IDs is limited to fifty space and line can be used to separate SNPs The maximal input 2 2 Example A complete operation using SNP ID to analyze the SNP RFLPing 2 2 1 Example 1 SNP IDs input Fig 2 1 and Fig 2 2 show a single ID input for rs and ss respectively Fig 2 3 Fig 2 4 and Fig 2 5 show the multiple rs input with the comma symbol space and line press the Enter key in keyboard to separate respectively Fig 2 6 Fig 2 7 and Fig 2 8 show the multiple ss input with comma symbol space and line to separate respectively Fig 2 9 Fig 2 10 and Fig 2 11 show the multiple rs and ss input with comma symbol space and line to separate respectively rs11540652 SNP IDs Sir 1 1511540652 2 1318703 3 5338341834 4 851717832 example 2 Multiple ist 1 samplet 2 sample2 3 sample3 3 Multiple ss 1 sample1 2 sample 3 sample3 4 Mixed rs and ss 1 sample1 2 sampled 3 samples Fig 2 1 Single ID input with rs 4 Updated 2009
47. sequences with SNPs in IUPAC format 22 Updated 2009 11 03 SNP RFLPing 2 User Manual SNP Fasta Sequences SNP fasta sequences examples rs11540652 CAGTTCCTGCATGGGCGGCATGAACC R GAGGCCCATCCTCACCATCATCACA gt r528934675 CCCTCAACAAGATGTTTTGCCAACTG S CCAAGACCTGCCCTGTGCAGCTGIG rs62068667 ACATGCCTGTAATCCCAGCACTTTGG R AGGCCAAGGTGGGCGGATCACCTGA 1 Single fasta sequence 1 sample1 2 sample2 2 Multiple fasta sequences dNTPs 1 sample 2 Sample 3 Multiple fasta sequences IUPAC 1 samplei 2 sample2 4 Special sequences 1 in del 2 tri allelic 3 tetra allelic Fig 3 6 Multiple fasta sequences with SNPs in IUPAC format with line press the enter key of keyboard which is ignored in the system R G or A S G or C When the sequence is too long the part of the sequence will list in the next line automatically The system is able to regard them as the single sequence input SNP Fasta Sequences SNP fasta sequences examples IP fasta sequences for SNP RFLP analysis tne maximum load is 50 gt rs66134313 GTGGGGGTGGTGGGCCTGCCCTTCCA A TGGATCCACTCACAGTTTCCATAGG input crear J 1 Single fasta s quence 1 Sample4 2 sample2 2 Multiple fasta sequences dNTPs 1 sample 2 sample2 3 hall fasta soens IUPAC 1 sample1 2 sample2 1 in del K2 tri allelic 3 tetra allelic Fig 3 7 Special sequence with SNP in the
Download Pdf Manuals
Related Search