Contents
Contents
1. CR Instrument Parameters Follow the guidelines as detailed for your specific Real time instrumentation The following parameters tested by SBI were performed on an Applied Biosystems 7300 Real time PCR System but can also apply to an ABI 7500 or an ABI 7900 96 well system The details of the thermocycling conditions used in testing at SBI are shown below A screenshot from SBI s instrument set up is shown on the right Default conditions are used throughout except for those cases where the Forward Primers Tm is below 55 C then the annealing temperature in Step 2 of Stage 3 is lowered from 60 C to 50 C qPCR cycling and data accumulation ieee Co ega A conditions eS Beer sere geg Bock 1 50 C 2 min En cence ae ela Rep 2 95 C 10 min i Tae lanes sm 3 95 C 15 sec earn a 4 60 C 1 min Thermal Profle Auto Increment Ramp Rate 40 cycles of steps sons 3 and 4 data read at 60 C 15 sec tamoe 2 J Reve an Step gold rectangle Add Cycle Add Hold Add Step Add Dissociation Stage Heo Sng Sangle Vome k D Run Mode Standaed 7500 l Data Colecton Stage 3 Step 2 60 0 1 01 An additional recommendation is to include a melt analysis after the qPCR run to assess the Tm of the PCR amplicon to verify the specificity of the amplification reaction Refer to the User Manual for your specific instrument to conduct the melt analysis and the data analyses of the amplification plots a2. Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual ll Protocol Real time qPCR For end point PCR reactions please refer to the Section IE above Use of the miRANDA Universal cDNA template A qPCR Reaction Set up To determine the expression profile for your miRNA under study mix the following per well For Single well determination 12 5 ul 2X SYBR Green qPCR Mastermix buffer 1 ul User designed Forward Primer 10 uM t 05 ul miRANDA Universal Reverse Primer 10 uM 16 ul Nuclease free water 30 ul Total well We recommend making a SYBR Green qPCR Mastermix to evaluate the 18 tissue expression profile as follows For 18 tissue miRNA expression profiling with single well determination per tissue 250 ul 2X SYBR Green qPCR Mastermix buffer 20 1 User designed Forward Primer 10 uM 10 ul miRANDA Universal Reverse Primer 10 uM 320 ul Nuclease free water 600 ul Total enough for 20 wells with 30 l well The Mastermix contents can be scaled down or up depending upon on your experimental needs Once reagents are loaded into array wells cover the plate with the optical adhesive cover provided and spin briefly in a centrifuge to bring contents to bottom of wells Place plate in the correct orientation well A1 upper left into the Real time qPCR instrument and perform analysis run Page 8 ver 3 061101 www systembio com miRANDA qPCR Ready MicroRNA Array Kit Cat RA600A 1 B Real time qP
3. NA sets are quality controlled using Real time PCR and SYBR green reagents using the default parameters recommended by the manufacturers specifications and described earlier in the manual s U6 O wv E 5 I pa 9 I i at i Bi _ 123 456 7 8 9 10 1112 1314 1516 1718 1ladipose 7 heart arasta Human U6 snRNA Control 2 bladder 8 kidney 14 skeletal muscle 3 brain 9 liver 15 small intestine Forward Primer Sequence gt 4 cervix 10 tung Tfspleen 5 a h 3 5 colon 11 ovary _ 17 testes Tm 62 C amplicon size 79 bp 6lesophagus 12 placenta 18 thymus Fig 4 Real time qPCR normalization data using a forward primer specific for Human U6 snRNA provided in kit was used to detect and normalize the cDNA set Quality control results for the balanced set are depicted The Real time amplification plots to the left and a bar graph of tissue cDNA and Ct values derived from the Real time data with the U6 snRNA transcript is shown on the right The sets are balanced to approximately 1 Ct of each other 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual C Specificity Tests To assess the specificity and proper orientation of the miRNA array oligonucleotide primers are synthesized both in the sense and the antisense orientation An example for the known documented miRNA miR 542 3p is detailed below Has miR 542 3p Ma
4. RNAs has gained increasing attention in recent years particularly due to the discovery of micro RNAs miRNA Micro RNAs are short typically 19 24 nucleotides single stranded RNAs that regulate the expression of target genes by interacting with complementary sites in the 3 UTR of the target mRNAs and inhibiting translation miRNAs are a conserved group of non coding RNAs with very important regulatory roles Mature miRNAs are excised from stem loop precursors which are themselves transcribed as part of longer primary transcripts These primary miRNAs appear to be first processed by the RNase Drosha in the nucleus after which the precursor miRNAs are exported to the cytoplasm where the RNase Dicer further processes them These enzymes are also involved in the generation of mature small inhibitory RNAs siRNA from exogenously transferred double stranded siRNA precursors The current standard method for detecting and quantifying novel miRNA molecules involves Northern blottting with hybridization Detecting and quantitating known miRNAs can be done using pre designed reverse priming and reverse transcription followed by primer sets built for the specific miRNA for Real time PCR analysis These sets require many steps and can take several hours to complete and trouble shoot The miRANDA kit provides immobilized anchored tailed small non coding RNAs from 18 separte Human tissues in an array format The user simply only needs to design the for
5. concerning licenses for commercial use contact SBI Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2006 System Biosciences SBI Page 18 ver 3 061101 www systembio com
6. e Include the U6 control Forward primer in a separate reaction as PCR control Too many PCR bands using user designed Forward Primer with miRANDA Universal cDNA template Alter thermocycle conditions elevate annealing temperature Include the U6 control Forward primer in a separate reaction as PCR control No qPCR signals using user designed Forward Primer Test U6 control Forward primer with Universal Reverse Primer on miRANDA Universal cDNA template on qPCR instrument Correct size band and larger PCR band s observed in end point PCR tests Potential precursor pri miRNA molecules are being amplified Page 14 ver 3 061101 www systembio com miRANDA qPCR Ready MicroRNA Array Kit Cat RA600A 1 V 1 10 11 12 13 14 15 16 References Sonthelmer E J Carthew R W 2005 Silence from within Endogenous siRNAs and miRNAs Cell 122 9 12 Zamore P D Haley B 2005 Ribo gnome The big world of small RNAs Science 309 1519 1524 Bartel D 2004 MicroRNAs Genomics Biogenesis Mechanism and Function Cell 116 281 297 Kim Narry V 2005 Small RNAs Classification Biogenesis and Function Mol Cells 19 1 15 Valencia Sanchez MA Liu J Hannon GJ Parker R 2006 Control of translation and mRNA degradation by miRNAs and siRNAs Genes Dev 20 515 525 Lewis B P Burge C B Bartel D P 2005 Conserved seed pairing often flanked by adenos
7. ines indicates that thousands of human genes are microRNA targets Cell 120 15 20 Xie X Lu J Kulbokas E J Goulub T R Mooth V Lindblad Toh K Lander E S and Kellis M Systematic discovery of regulatotory motifs in human promoters and 3 UTRs by comparison of several mammals Nature 434 338 45 Lagos Quintana M Rauhut R Lendeckel W Tuschl T 2001 Identification of Novel Coding for Small Expresses RNAs Science 294 853 858 Basyuk E Suavet F Doglio A Bordonne R Bertrand E 2003 Human let 7 stem loop precursors harbor features of RNase Ill cleavage products Nucleic Acids Res 31 6593 6597 Chomczynski P and Mackey K One hour downward capillary blotting of RNA at neutral pH 1994 Anal Biochem 221 303 305 Shi R Chiang V L 2005 Facile means for quantifying microRNA expression by real time PCR BioTechniques 39 519 525 Ding Y Chan C Y and Lawrence C E 2005 RNA secondary structure prediction by centroids in a Boltzmann weighted ensemble RNA 11 1157 1166 Griffiths Jones S Grocock R J Van Dongen S Bateman A Enright A J 2006 miRBase microRNA sequences targets and gene nomenclature Nucleic Acids Research 34 D140 D144 Shingara J Keiger K Shelton J Laosinchai Wolf W Powers P Conrad R Brown D Labourier E 2005 An optimized isolation and lebeling platgorm for accurate microRNA expression profiling RNA 717 1461 1470 He L Thom
8. inutes and then visualize An example of end point PCR primer tests and gel electrophoresis is shown in Fig 3 m miRNA like Sequences m10 es a b a b c M M miR 16 4 7 Fig 2 miRANDA end point PCR for miR 16 and seven newly identified miRNA like sequences by SBI Numbers on the top of the gel correspond to cDNA clone number Letters indicate specific sequence found in corresponding clone Include a DNA size ladder with markers in the range of 50 2 000 bp e g Bio Rad AmpliSize DNA Ladder Cat 170 8200 M denotes DNA Marker lanes 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual F List of Components Each miRANDA qPCR Ready MicroRNA Array Kit contains the following 4 components i miRANDA cDNA array plate with lyophilized cDNAs in the well positions detailed below The plate itself is an optical qPCR plate suitable for use with Applied Biosystems Real time PCR systems 7300 7500 and 7900 96 well format An optical adhesive cover is also provided ii One 0 5 ml tube containing lyophilized miRANDA Universal cDNA template resuspend with 20 ul nuclease free water enough for 20 PCR reactions iii One 0 5 ml tube containing lyophilized miRANDA Universal Reverse adapter Primer resuspend with 50 ul nuclease free water to make 10 uM concentration enough for 100 reactions iv One 0 5 ml tube containing lyophilized Human U6 snRNA control Forward Primer re
9. miRANDA qPCR Ready MicroRNA Array Kit Cat RA600A 1 Contents l Introduction and Background AS SOVERVICW 0 coc4 po bof nednet ened meer geo aa eter ad ea 2 B Importance of MicroRNAs and Other Small RNAs 2 C Overview Of Protocol ee ceeceessseeceseseeeeesesseneeeees 3 D Primer Design Considerations hk eo 4 E Use of the miRANDA Universal cDNA template ss 5 F ListofComponents ss 6 G Additional Required Materials 7 ll Protocol A qPCR ReactionSetup rnana 8 B Real time qPCR Instrument Parameters d 9 lll Quality Control and Sample Data A How the cDNAs are synthesized foon an 10 B miRANDA cDNA set Normalization sss 11 C Specificity Tests hF an 12 D Sample Dates i sil yh deatciesenaeduasetdey Uasaeteaeentoclea dai 13 IV Troubleshooting aL 14 Vi Ref eI eS A coeds Le 15 VI Related products ss O Oa L 16 Vil Technical Support aa 17 VIII Licensing and Warranty Statement 18 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual I Introduction and Background A Overview This manual provides details and information necessary to use the miRANDA gPCR Ready miRNA Array Kit to detect and quantify small non coding RNAs from 18 separate Human tissue cDNAs To ensure optimal results please read the entire manual before using the reagents and material supplied with this kit B Importance of MicroRNAs and Other Small Non Coding RNAs The field of non coding
10. nd Cycle Threshold Ct calculations In general Cycle thresholds should be set within the exponential phase of the amplification plots with software automatic baseline settings 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual lll Quality Control and Sample Data A How the cDNAs are synthesized All of the Human miRNA cDNAs are prepared by a 3 RACE method as illustrated in Fig 3 3 RACE miRNA RT PCR Method miRNA 5 3 polyA polymerase pA tailed 5 ANAAAAAAA 3 RNA Denature at 95 C 10 min 5 AAA NV T es Anneal oligo dT adapter 37 C 10 min 5 _ _ AAAAAAAAA 3 2 es 5 RT to create first strand cDNAs at 42 C 30 min cDNA pool of anchor tailed RNA a a 5 cDNA templates Reverse Primer ready for qPCR r provided 2 m i 5 ae MIRNA specific F omard primer Fig 3 Illustration of the 3 RACE method for the synthesis of miRNA cDNA sequences The protocol follws the methods of Shi R Chiang V L 2005 Page 10 ver 3 061101 www systembio com miRANDA qPCR Ready MicroRNA Array Kit Cat RA600A 1 B miRANDA cDNA set Normalization The anchor tailed cDNAs are deposited then lyophilized on the array in the format depicted in Fig 1 The sets are then normalized using a primer specific for U6 snRNA transcript Control Forward primer supplied with kit The array cD
11. pecies across 18 tissues 2 miRNA species across 18 tissues in duplicate or 1 miRNA species across 18 tissues along with the positive normalization transcript in separate wells for U6 snRNA across 18 tissues both reactions performed in duplicate your choice The kits are shipped dry and should be stored at ambient temperature Once the miRANDA Universal cDNA template Universal Reverse Primer and the Human U6 snRNA Control Forward Primer are resuspended they should be stored at 20 C Properly stored kits are stable for 1 year from the date received G Additional Required Materials Nuclease free water Thermocycler with heated lid Thermocycler PCR tubes or plates for end point reactions PCR Mastermix including Taq polymerase for PCR 3 0 3 5 Agarose Gel in Tris Borate EDTA TBE or Tris Acetate EDTA TAE Buffer e DNA Size Ladder with markers from 50 to 2 000 bp Bio Rad AmpliSize DNA Ladder Cat 170 8200 e Real time qPCR Instrument IMPORTANT Recommended 2X SYBR Green qPCR Mastermixes SBI has tested and recommends SYBR Green Master mix from three vendors Power SYBR Master Mix Cat numbers 4368577 4367650 4367659 4368706 4368702 4368708 4367660 from Applied Biosystems SYBR GreenER qPCR SuperMix for ABI PRISM instrument from Invitrogen Cat numbers 11760 100 11760 500 and 11760 02K and RT Real Time SYBR Green ROX PCR Cat numbers PA 012 and PA 112 from SuperArray 888 266 5066 Toll
12. rimers specific for 2 known miRNA molecules miR 1 heart and skeletal muscle specific and miR 122a abundant in liver The amplification plots and corresponding expression bar graphs are shown in Fig 5 Panels A and B miR 1 p a f t 7 i ee ee N 123 456 7 8 9 10 1112 1314 1516 1718 EEEE Sete ott F FE os miR 122a miR 122a 3 a a 123 45 6 7 8 9 10 1112 1314 1516 17 18 Fig 5 Real time qPCR data using primers specific for Human miR 1 Panel A and for miR 122a Panel B The amplification plots are shown on the left with the resulting expression profile bar graphs based on Ct values is shown on the right The defualt qPCR cycling conditions were used with an annealing temperature of 60 C in Step 2 of Stage 3 These two known miRNAs miR 1 and mir 122a have very specific tissue expression patterns Real time qPCR data confirmed that miR 1 is restricted to skeletal muscle and heart The sensitivity of the assays also reveals very low but detectable signals in additional tissues miR 122a is known to be highly abundant in liver 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI IV Troubleshooting User Manual Problem Possible Solution No PCR bands using user designed Forward Primer with miRANDA Universal cDNA template Alter thermocycle conditions lower annealing temperatur
13. roximately 1 week 9 steps Pre Made MicroRNA Enriched cDNAs Cat RA500A 1 RA509A 1 Tissue specific amplified cDNA generated by SBI using the MicroRNA Discovery Kit can be used for cloning microRNA Global MicroRNA Amplification Kit Cat RA400A 1 Simple amplification kit allows cDNA amplification for RT PCR and microarray studies from as little as 50 ng of starting total RNA Full Spectrum Complete Transcriptome RNA Amplification Kit Cat RA101A 1 The Full Spectrum RNA Amplification Kit provides an inexpensive method to amplify reverse transcribed RNA in a sequence independent unbiased and uniform manner with better representation of 5 end of mRNA sequences This approach maintains the relative levels of each transcript in the starting mRNA samples even when using starting amounts of RNA as low as 5ng or when using heavily degraded RNA Full Spectrum MultiStart Primers for T7 IVT Cat RA300A 2 Extract more data from your RNA than currently available primers in nearly all commercially available T7 IVT kits using Full Spectrum technology Just replace the existing T7 primer with the Full Page 16 ver 3 061101 www systembio com miRANDA qPCR Ready MicroRNA Array Kit Cat RA600A 1 Spectrum primers Compatible with Affymetrix GeneChip hybridization VII Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http ww
14. son J M Hemann M T Hernando Monge E Mu D Goodson S Powers S Cordon Cardo C Lowe S W Hannon G J Hammond S M 2005 A microRNA polycistron as a potential human oncogene Nature 435 828 833 Lai E C Wiel C Rubin G M 2004 Complementary miRNA pairs suggest a regulatory role for miIRNA miRNA duplexes RNA 10 171 175 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual 17 18 19 Vi Ambros V Bartel B Bartel D P Burge C B Carrington J C Chen X Dreyfuss G Eddy S R Griffiths Jones S Marshall M Matzke M Ruvkun G Tuschl T 2003 A uniform system for microRNA annotation RNA 9 277 279 Obernosterer G Leuschner P J F Alenius M Martinez J 2006 Post transcriptional regulation of microRNA expression RNA 12 1 7 Dostie J Mourelatos Z Yang M Sharma A Dreyfuss G 2003 Numerous microRNPs in neuronal cells containing novel microRNAs RNA 9 180 186 Related Products miRANDA Universal miRNA cDNA template Cat RA650A 1 Pool of all 18 Human miRNA cDNAs enough for 20 50 ul reactions A universal reverse adaptor primer 10 uM A positive control forward primer U6 snRNA 10 uM MicroRNA Discovery Kit Cat RA410A 1 Rapid identification of new MicroRNAs and MicroRNA like molecules Amplification and cloning can be initiated in a single day 3 steps 1 day The alternative method takes app
15. suspend with 50 ul nuclease free water to make 10 uM concentration enough for 50 reactions Each miRANDA gPCR Ready MicroRNA Array Kit provides enough material to perform 20 Primer designs using the miRANDA Universal cDNA template with end point PCR analysis SBI s miRANDA MicroRNA qPCR Array includes 4 complete sets of 18 different Human cDNAs arrayed in the format detailed in Fig 1 and listed in Table format below Format of Human cDNA arrangement on the miRANDA qPCR Ready miRNA Array 1 2 3 4 5 10 7 8 9 10 11 12 AlAdipose__ Bladder__ Brain ICervix Colon Esophagus Heart Kidney lLiver lLung lOvary Placenta BlAdipose__ Bladder__ Brain ICervix Colon Esophagus Heart Kidney lLiver lLung Ovary Placenta ISkeletal Small C Prostate__ Muscle___ intestine__ Spleen__ Testes Thymus _ Water Skeletal Small D Prostate __ Muscle___ intestine __ Spleen___ Testes Thymus _ Water ElAdipose__ Bladder__ Brain ICervix Colon Esophagus Heart Kidney lLiver lLung Ovary Placenta FlAdipose__ Bladder__ Brain ICervix Colon Esophagus Heart Kidney lLiver lLung Ovary Placenta ISkeletal Small G Prostate Muscle Intestine Spleen Testes Thymus Water Skeletal Small H Prostate _ Muscle Intestine __ Spleen Testes Thymus Water Page 6 ver 3 061101 www systembio com miRANDA qPCR Ready MicroRNA Array Kit Cat RA600A 1 The array allows for the examination of 4 individual miRNA s
16. table forward primer we suggest performing an initial PCR test using the kits Universal cDNA template and analyze PCR products using gel electrophoresis see below in Section E Use of miRANDA Universal cDNA template Page 4 ver 3 061101 www systembio com miRANDA qPCR Ready MicroRNA Array Kit Cat RA600A 1 E Use of the miRANDA Universal cDNA template The miRANDA kit comes with a tube containing a pool of all 18 Human cDNAs lyophilized to allow for a primer design pre test proceeding a full array experiment Simply hydrate the miRANDA Universal cDNA template with 20 ul nuclease free water and use 1 ul per 25 50 ul PCR reaction The following PCR reaction conditions are recommended 1 ul miRANDA Universal cDNA template 0 5 ul miRANDA Universal Reverse Primer 10 uM 1 ul miRNA specific Forward Primer 10 uM user designed 2 5 ul 10X PCR Buffer with 2 5 mM MgCle 20 ul nuclease free water Total of 25 ul Prepare reaction in a suitable PCR tube or plate and thermocycle as follows Heat denature at 95 C 10 min Heat denature at 95 C 15 sec Anneal Primers at 60 C 1 30 cycles Hold at 15 C optional Prepare and pour a 3 5 agarose 3 5 g agarose in 1X TAE boil or 1X TBE gel with a suitable stain Ethidium Bromide etc Add 2 5 ul of 10X Loading dye mix and load 10 ul into a well of the gel Also run a suitable DNA size marker 50 2 000 bp along with your samples Take care to only electrophorese your gels for 10 15 m
17. to perform the end point or qPCR reactions MicroRNAs typically range in size from 19 24 nt We recommend using the exact sequence of the miRNA being studied when designing the forward primer If the miRNA under study is known and documented using the miRBase database can be an easy starting point http microrna sanger ac uk sequences search shtml An example of the known and documented miRNA Human miR 16 is shown below Hsa miR 16 Mature sequence MIMATO000069 Pee eam MIMATO000069 Simple Directly use sequence of mature miRNA as forward Piensa primer in oligo design 14 uagcagcacguaaauauuggcg 35 ROERE experimental cloned 1 5 7 Northern 1 6 The mature miRNA sequence 5 uagcagcacguaaauauuggcg 3 can be simply converted to a DNA sequence and used directly as the forward primer for end point and qPCR analysis Forward primer for hsa miR 16 5 TAGCAGCACGTAAATATTGGCGG 3 Tm 58 9 C 45 GC and length 22 bases If the user is developing a new assay for a novel miRNA follow the guidelines of the example above Design the primer to have a Tm of at least 55 C and to have a length of at least 18 bases If the primer being designed for the miRNA to be studied has a Tm below 55 C lower the annealing temperature in your cycling conditions for end point and qPCR instrument settings An example of successfully using this approach is demonstrated in Fig 5 Once the user has designed a sui
18. ture sequence MIMAT0003389 Sequence of mature miRNA eei MIMATOOOS389 as forward primer in sense BIB hsa miR 542 3p oligo design and then 53 ugugacagauugauaacugaaa 74 designed in the antisense Sequence oligo as control SOENE experimental cloned 1 The mature miRNA sequence 5 ugugacagauugauaacugaaa 3 can be converted to a DNA sequence along with designing its complement or antisense primer sequence Forward sense primer for hsa miR 542 3p 5 TGTGACAGATTGATAACTGAAA 3 Forward antisense primer for hsa miR 542 3p 5 TTTCAGTTATCAATCTGTCACA 3 Tm 49 6 C 32 GC and length 22 bases miR542 3p Sense and Antisense Signal Profiles miR542 3p Sense Primer miR542 3p Antisense Primer Signal Undil 1 2 141 5 1 10 NTC Undil 1 2 1 5 1 10 NTC Fig 5 Sense and anitsense test of the miRANDA cDNA Dilutions of the miRANDA Universal cDNA template as well as no template controls NTC were tested with either sense or antisense orientation for the miR 542 3p molecule Quantitative results are observed for the sense orientation of miR 542 3p No signals are observed in the antisense or no template controls The annealing temperature for the qPCR cycling conditions was lowered to 50 C Page 12 ver 3 061101 www systembio com miRANDA qPCR Ready MicroRNA Array Kit Cat RA600A 1 D Sample Data The cDNA sets were also tested with 2 p
19. w systembio com For additional information or technical assistance please call or email us at System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual Vill Licensing and Warranty Statement Limited Use License Use of the miRANDA qgPCR Ready miRNA Array Kit i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein SBI has pending patent applications related to the Product For information
20. ward primer which corresponds to the miRNA of interest and provide Real time PCR SYBR green master mix for Real time PCR or typical PCR mastermix for End point PCR expression profiling Recently previously unknown germline specific classes of miRNA like molecules were identified in mouse testes and mouse oocytes illustrating the need for continued and in depth miRNA discovery efforts across a wide range of tissues These facts taken together demonstrate an ever increasing need for simple robust and sensitive methods that enable discovery and quantitation of microRNAs and their precursors Page 2 ver 3 061101 www systembio com miRANDA qPCR Ready MicroRNA Array Kit Cat RA600A 1 C Overview of Protocol miRANDA qPCR ready miRNA Arrays Your miRNA specific miRANDA Universal Forward Primer y y Reverse Primer SYBR qPCR Mastermix ws OTO OOo amp O c O amp Adipose Ovary Bladder Placenta Brain Prostate Cervix Skeletal Muscle Colon Small Intestine Esophagus Spleen Heart Testes Kidney Thymus Liver No RNA cDNA Lung ee End point PCR and Gel Analysis Real time PCR Analysis or Fig 1 Workflow schematic for a typical miRANDA MicroRNA qPCR Array experiment 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual D Primer Design Considerations The user needs only to design the forward sense orientation primer
Download Pdf Manuals
Related Search
Contents contentstrack contentstack contentsquare contents track login contents meaning contents synonym contents insurance contents page contents and devices contents tracker contents insurance for shared renters contents insurance uk contents collaboration contents of a box labeled smtwtfs contents of big beautiful bill contents home insurance contents manager contentshake contentscale ai contents picture contentspeed contents page powerpoint contents insurance quotes contents square contents of a cv