PrecisionX Tagged Cas9 SmartNuclease Vector User Manual
Contents
1. 1 Design two DNA oligonucleotides that are sense and antisense sequences of the target DNA which is 20bp upstream of the PAM 5 NGG 3 Page 14 ver 2 140507 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 2 Anneal the two oligonucleotides to generate a duplex 3 Clone the duplex into the provided linearized Cas9 vector by ligation reaction 4 Transform into competent cells and grow in LB Kanamycin plate 50 ug ml 5 Confirm positive clones by direct sequencing 6 Transfect sequence verified all in one construct into mammalian cells using standard transfection protocols 7 Perform Surveyor Nuclease assay or other suitable mismatch cleavage assays to check the site specific genome cleavage or perform homology recombination assays for genome modification using a suitable donor vector 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual lbp target sequence 5 1 Deagn of two aligas coding target pequance 3 POONAM AA S 4 2 pagal af twa aligo minnha CAAS E 5 3 Ligation b tetanic ee ere Ot ee ere ee ee nT T a on OM tal ir TA a SENS T T d aa m TTT a gt ie a CAS7xx vector I 4 Trawifeemotion 4 5 Sequencing j Tramifection Ee Fig 7 General Workflow for RNA Guided Cas9 SmartNuclease Nickase Expression System B Selection of Target DNA Sequence The selection of the target DNA sequence is not limit2. Cong et al 2013 Mali et al 2013 Cho et al 2013 In addition several mutant forms of Cas9 nuclease have been developed to take advantage of their features for additional applications in genome engineering and transcriptional regulation Biochemical characterization of a mutant form of Cas9 nuclease D10A functions as a nickase Jinek et al 2012 generating a break in the complementary strand of DNA rather than both strands as with the wild type Cas9 This allows repair of the DNA template using a high fidelity pathway rather than NHEJ which prevents formation of indels at the targeted locus and possibly other locations in the genome to reduce possible off target toxicity effects while maintaining ability to undergo homologous recombination Cong et al 2013 Recently paired nicking has been shown to reduce off target activity by 50 to 1 500 fold in cell lines and to facilitate gene knockout in mouse zygote without losing on target cleavage efficiency Ran et al 2013 Finally tandem knockout of both RuvCl and HNH nuclease domains which control cutting of the DNA strands shows that the null nuclease mutant double mutant can act as a transcriptional repressor Qi et al 2013 with minimal off target effects which leads to possibilities for studying site specific transcriptional regulation Taken together the RNA guided Cas9 system defines a new class of genome engineering tools creating new opportunities for research across
3. to know in advance but if it happens repeatedly it may be necessary to follow up with another gRNA sequence or perhaps sequence verifying the genomic target prior to design of gRNA constructs 4 Length of time before assaying We suggest a minimum of 48 hours post transfection to begin assaying for cleavage of a DNA Page 22 ver 2 140507 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 target however in certain cases it may be useful to wait up to 1 week to observe the full effect of cleavage Q We want to perform HDR applications using the Cas9 SmartNuclease system but we do not have the corresponding donor vectors What are our options in this case There are several options for performing HDR of a donor vector into cells that have been targeted with the Cas9 SmartNuclease system Option 1 Design an HDR donor vector containing the region of DNA to be inserted or corrected into target cells Typically this vector contains 5 and 3 arms homologous 800bp to the desired insert correction region and may contain selection or fluorescent markers for selection of cells after HDR In addition single stranded oligo donor vectors can be constructed with areas of small homology lt 50bp flanking the cutting site and containing an small oligonucleotide sequence in the middle These can be combined with Cas9 Nickase GFP or RFP expression vectors for FACS sorting to study those cells that have bee
4. 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual Q How many guide RNA constructs do you have to design to target a DNA sequence of interest Due to the unpredictable efficacy of a particular guide RNA construct for optimal results we suggest designing multiple 2 or more constructs targeting a particular DNA sequence of interest By designing several constructs following the simple design rules outlined in Section Il B and C one has increased chances of finding a construct s to cleave target DNA with the highest efficiency Q We designed a guide RNA construct to transfect into target cells and there is no evidence of activity What are the possible reasons for this There are many possibilities of why a particular guide RNA does not show any measureable effects Some of the possibilities include the following 1 Poor transfection efficiency of target cells For certain cell types e g primary stem suspension cells passive transfection may not be very efficient In these cases active transfection systems e g NucleoFection may provide better results 2 Errors in guide RNA design The sequences of oligo duplexes targeting the DNA should be carefully checked to follow design rules 3 Mutation s in DNA sequence targeted In certain cases the DNA sequence targeted may contain mutations which affect recognition of the gRNA sequence leading to failure of cleavage It is difficult
5. SSBI System Biosciences PrecisionX Cas9 SmartNuclease Vector System Catalog s CASxxx series User Manual Store at 20 C upon receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 Contents les TINTPODUCTION esrara ae edie 2 A Overview of CRISPR SySteM cccceeeeeeeeceeseeeeeeteeteeeeeaes 2 B Product Information and Vector Maps ceeeeeeeeeeeeeeeeees 4 C Validation Data for Cas9 SmartNuclease and Nickase Vectors Cat CAS7XXA 1 ecccceccceceeeeeseeeeeeeeeseeeeeteaeeesaeeeeneeees 10 D Key Advantages of the Cas9 SmartNuclease System 12 E Applications of the Cas9 SmartNuclease Expression SVSLOM tans fereetad tt eat a ae tal tee ote aa a eats 13 F List Of Components 0 ceceeeceeeeeeeeeeeeeaeeeeeeeseeeeeseaeeeeeeeeenees 13 H Additional Materials Required 13 G Related Products cccecsceeeeeeceeeeeeeeeeeeeeeseeeeeseaeeesaeeeeneeees 14 H Shipping and Storage Conditions for Kit ceceeeeenes 14 II Protocol for the Cas9 SmartNuclease Expression System ccecee 14 A Quick Overview of the Protocol cccceeeceeeeeeeeeeeeeneeees 14 B Selection of Target DNA Sequence cccceecceseeeeteeeees 16 C Design of Guide RNA Oligonucleoti
6. SmartNuclease vector 0 5 ug and HR donor vector 0 5 wg for HDR applications Fig 6 In general we suggest Page 20 ver 2 140507 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 optimizing the amounts and ratios of Cas9 SmartNuclease and donor vectors for optimal results in a target cell line 3 Allow at least 12 hours before changing transfection media to complete growth media 4 Assay for cleavage activity using Surveyor Nuclease mutation characterization by genotyping analysis or HDR activity if using donor vector in parallel 48 72 hours after transfection 5 If assaying for HDR of donor vector select cells with targeted insertion of donor vector using FACS based sorting of fluorescent marker or antibiotic selection e g Puro Neo using a suitable concentration of antibiotics for the targeted cell line lll Frequently Asked Questions Q We prepared oligos according to the protocol ligated the oligos to the vector and transformed into competent cells Very few colonies showed up in the plate What is the reason for this 1 Please use very high efficiency competent cells for the reaction e g cells with efficiencies of gt 1 x 10 9 CFUs ug of pUC18 plasmid 2 Please make sure to not freeze thaw stock plasmid as damage to the plasmid may result Either store the plasmid at 4C for short term use 1 2 weeks or aliquot each reaction into separate tubes for storage at 20C 888 266
7. al 2013 To achieve high cleavage efficiency using Cas9 Nickase with paired gRNAs make sure each gRNA is able to efficiently induce indels when coupled with wild type Cas9 C Design of Guide RNA Oligonucleotides Design two DNA oligonucleotides a top strand and a bottom strand according to the following structure shown below 5 ATCCNNNNNNNNNNNNNNNNNNNMNN 3 3 NNNNNNNNNNNNNNNNNNNNCAAA 5 Please note that the adaptor sequences for the CAS7xx series have changed from the previous generation vectors CAS9xx series Please check to make sure the oligo pairs contain the correct sequences 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual The top strand has an ATCC overhang at its 5 end followed by the selected target sequence The bottom strand has an AAAC overhang at its 5 end followed by a target sequence complementary to the top strand Example If your target sequence is AGCGAGGCTAGCGACAGCATAGG AGG PAM sequence then the oligo sequences would be Top strand oligo 5 ATCCAGCGAGGCTAGCGACAGCAT 3 Bottom strand oligo 5 AAACATGCTGTCGCTAGCCTCGCT 3 D Cloning into the Cas9 SmartNuclease Vector 1 Anneal the two single strand DNA oligonucleotides Dilute you primer at the concentration of 10uM using dH20 and set up the annealing reaction as follows Materials Amount 10uM Top strand oligo 5 ul 10uM Bottom strand oligo 5 u
8. and CAG versions of the Cas9 SmartNuclease and Nickase vectors are also available 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual Fig 3 Vector maps of Cas9 SmartNuclease and Nickase Expression Vectors with T7 promoter and built in GFP or RFP markers Cat CAS7xxA 1 C Validation Data for Cas9 SmartNuclease and Nickase Vectors Cat CAS7xxA 1 Fluorescent Phase CAG hspCas9 T2A GFP H1 sgRNA CAG hspCas9 T2A RFP H1 sgRNA Fig 4 GFP and RFP expression data for selected CAG hspCas9 expression vectors Cat CAS720G 1 and CAS721R 1 in HEK2983T cells Representative data regarding the cleavage efficiency of selected gRNAs e g human AAVS7 and luciferase using wild type Cas9 expression vectors can be found here http www systembio com genome engineering cas9 crispr smartnuclease gene editing http www systembio com genome engineering cas9 crispr smartnuclease gene knockout Page 10 ver 2 140507 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 Using our Cas9 SmartNuclease Expression System EF1a T7 hspCas9 T2A RFP H1 Cat CAS701R 1 we cloned in a guide RNA sequence targeting human AAVS7 gene Fig 5A and looked at the ability to induce homology directed repair HDR using a GFP repair donor in an engineered cell line called EGIP Enhanced Green Fluorescent Inhibited Protein The EGIP cell line contains a stop codon in the m
9. basic sciences biotechnology and biomedicine B Product Information and Vector Maps Page 4 ver 2 140507 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 To make the RNA directed Cas9 system more efficient affordable and convenient to use SBI has developed the all in one programmable PrecisionX Cas9 SmartNuclease and Nickase expression vectors including a human codon optimized Cas9 hspCas9 or Cas9 mutant Cas9 Nickase along with a custom guide RNA gRNA consisting of a chimeric crRNA tracrRNA transcript expressed from a single construct Fig 2 and Fig 3 In addition these vectors offer built in fluorescent markers GFP or RFP for tracking transfection efficiency into target cells as well as a T7 promoter for in vitro transcription of the Cas9 and gRNA for preparation of MRNA and IVT gRNAs for in vivo applications e g oocyte microinjections SBI s all in one SmartNuclease and Nickase expression constructs include the following core features 1 The hspCas9 and Nickase used in this system include two nuclear localization signals NLS at the N terminus and C terminus to ensure efficient import of the hspCas9 protein into the nucleus 2 The expression vectors also contain a Myc tag at the N terminus for ease of detection and purification of the recombinant Cas9 protein 3 To facilitate diverse applications of the system hspCas9 and Nickase may be expressed from a number of different com
10. ckase expression construct with the following features All in one vector system combining codon optimized hspCas9 Nickase and gRNA cloning and scaffolding sequences no need for multiple plasmid constructs Pre linearized vector is ready to use no need to prepare or modify the vector backbone Precise directional cloning of the gRNA insert into vector backbone Rapid highly efficient cloning with low background 99 cloning efficiency Cloning compatibility the same gRNA insert can be easily exchanged into other Cas9 linearized vectors with a one step cloning reaction Page 12 ver 2 140507 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 E Applications of the Cas9 SmartNuclease Expression System We have developed the all in one expression system to target a wide range of researchers who are interested in the following but not limited to research areas e Genome editing and engineering of model organisms e Synthetic biology applications e Gene Cell based therapy F List of Components The kit contains enough reagents to perform up to 10 ligation reactions in an easy to use format Table 2 Table 2 List of components included in the Cas9 SmartNuclease Nickase Expression System Reagent Amount Linearized 10 ul SmartNuclease Nickase Vector H 5x ligation buffer 10 pl Fast ligase 2 5 pl Fwd Sequencing primer 5 uM 20 ul 5 GTCATCAACCCGCTCCAAGG 3 H H Addit
11. des cceeeeeee 17 D Cloning into the Cas9 SmartNuclease Vector 2 18 E Transfection of the Cas9 SmartNuclease Construct into Target Cells aiaa Satan cboes ct ca ube casas RE telbutewt abcess 20 III Frequently Asked Questions cceeceeeeeeeeeeteeeeteeeeeeeeees 21 IV References neiii ariin A E TATA EAE 24 V Technical Support cccecceeceeeeeeseeeeeneeeeeeeeseeeesaeeseeeeeaes 25 VII Licensing and Warranty information eeeeeeeeeeeeeee 26 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual Introduction A Overview of CRISPR system In the past decade a great deal of progress has been made in the field of targeted genome engineering Technologies such as designer zinc finger nucleases ZFNs transcriptional activator like effector nucleases TALENs and homing meganucleases have made site specific genome modifications a reality in many different model organisms ranging from zebrafish to mammalian cells Based on the results to date however genome editing tools that are efficient flexible and cost effective have remained elusive to the general research community The recent discovery of the type Il prokaryotic CRISPR Clustered Regularly Interspaced Short Palindromic Repeats system originally discovered in the bacterium Streptococcus pyogenes as a mechanism to defend against viruses and foreign DNA has provided yet another tool for tar
12. e covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty Page 26 ver 2 140507 www systembio com
13. ed by any constraints with exception of a PAM sequence in the form of 5 NGG 3 where N any base immediately following the target sequence The typical length of the target sequence is 20bp as shown here 5 NNNNNNNNNNNNNNNNNNNNNGG 3 In order to enhance genome editing specificity paired gRNA with Cas9 Nickase constructs CAS75x CAS77x and CAS79x vectors can be used to generate double nicking with 5 overhangs Please follow the guideline below for paired gRNA selection and design Page 16 ver 2 140507 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 9 ie S eo J gRNA1 sie Targeting site TAGCCGTAACGAATGGCAAT 5 7 SICSGCATTGCTTACCETTA CGTAAGCTTACGCGATGCAC A re EN Yo caso D108 NickassS wv NGG_ ________ _ __s 4 eee a Cas9 D10A Nickase jf is AONUI 2 i 3 NNTAGCCGTAACGAATGGCAAT N GCATTCGAATGCGCTACGTG 5 5 CGTAAGCTTACGCGATGCAC __ gRNA2 Pa 5 o 3 3 oS 5 overhang Choose your gRNA1 from the anti sense strand upstream of your targeting site Choose your gRNA2 from the sense strand downstream of your targeting site Fig 8 Schematic illustration of generating 5 overhang double strand DNA breaks using paired gRNAs with Cas9 Nickase adapted from Ran et al 2013 Please note that only gRNA pairs creating 5 overhangs with less than 8bp overlap between the guide sequences were able to mediate detectable indel formation Ran et
14. geted genome engineering this time taking advantage of a system that uses small RNAs as guides to cleave DNA in a sequence specific manner With its ease in designing guide sequences to target specific sequences unlike ZFNs and TALENs where construct assembly can be laborious and time consuming as well as its targeting efficiency this system has the potential to be a disruptive technology in the field of genome engineering The CRISPR CRISPR associated Cas system involves 1 retention of foreign genetic material called spacers in clustered arrays in the host genome 2 expression of short guiding RNAs crRNAs from the spacers 3 binding of the crRNAs to specific portions of the foreign DNA called protospacers and 4 degradation of protospacers by CRISPR associated nucleases Cas A well characterized Type Il CRISPR system has been previously described in the bacterium Streptococcus pyogenes where four genes Cas9 Cas1 Cas2 Csn1 and two non coding small RNAs pre crRNA and tracrRNA act in concert to target and degrade foreign DNA in a sequence specific manner Jinek et al 2012 The specificity of binding to the foreign DNA is controlled Page 2 ver 2 140507 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 by the non repetitive spacer elements in the pre crRNA which upon transcription along with the tracrRNA directs the Cas9 nuclease to the protospacer crRNA heteroduplex and induces double st
15. iddle of an EGFP coding region thus truncation of full length EGFP as well as a 53bp sequence from the human AAVS1 gene Fig 5B for targeting by the gRNA Our data indicates successful transfection of the vector into cells as evidenced by RFP expression as well as significant levels of HDR 8 10 as early as two days post transfection Fig 6 indicating functionality of the system A EF1a T7 hspCas9 T2A RFP H1 AAVS1 gRNA SmartNuclease Vector T2A gt Tee a PETE AVS B EGIP reporter cell line taeQICCCCTICEACCOCACAGIGGGOCCALTAGGGALAGGAT TGOGIGALAGAAAAG o a Target u Region X X C EGFP HR Donor Fragment 4 Homologous Recombination gt SS Fig 5 A Schematic diagram of EF1a T7 hspCas9 T2A RFP AAVS1 gRNA vector B Diagram and strategy for HDR of GFP donor vector in EGIP cell line containing a premature stop codon and AAVS1 gRNA target site engineered into the EGFP sequence 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual 2 days post transfection 5 days post transfection Gm GFP donor Fig 6 Data showing transfection of the EF1a T7 hspCas9 T2A RFP AAVS1 gRNA vector into EGIP HEK293T cells right panes and HDR of GFP donor vector middle panes at days 2 and 5 post transfection D Key Advantages of the Cas9 SmartNuclease System Each kit provides enough materials for 10 reactions to generate your own Cas9 SmartNuclease Ni
16. ional Materials Required 1 LB Agar and Broth containing 50ug mI Kanamycin 2 Any high transformation efficiency E coli competent cells 3 Zyppy Plasmid MiniPrep Kit Zymo Research Cat D4019 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual 4 Qiagen EndoFree Plasmid Maxi Kit Qiagen Cat 12362 5 PureFection Transfection Reagent System Biosciences Cat LV750A 1 or equivalent G Related Products SBI offers a number of Homologous Recombination HR Donor Vectors including the popular PrecisionX HR Targeting Vectors Cat HR1xxPA 1 for generating gene knockouts and knockins as well as the piggyBac HR Donor for seamless excision of selection cassette Cat PBHR100A 1 The full selection of HR Donor vectors may be viewed on the following webpage http www systembio com genome engineering precisionx HR vectors ordering H Shipping and Storage Conditions for Kit PrecisionX Cas9 SmartNuclease Nickase Expression System components are shipped on blue ice Upon receiving store the kit at 20 C Shelf life of the product is 1 year after receipt if stored in 20T ll Protocol for the Cas9 SmartNuclease Expression System A Quick Overview of the Protocol The general workflow of the cloning validation and transfection of the Cas9 gRNA SmartNuclease Nickase expression constructs into cells is depicted in Fig 7 Briefly here are the steps involved in the process
17. l Total volume 10 ul Incubate reaction mixture at 95 C for 5 minutes can be done in PCR machine Remove the tube and leave it on bench at room temperature to cool down 10 minutes 2 Ligation of Oligo Duplex into Vector Page 18 ver 2 140507 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 Since the tubes might be placed upside down during the shipping and some of reagents may end up at the top of tubes we recommend a brief spin to bring all the reagents down to the bottom of tubes before opening the tubes Note Due to the sensitivity of the vectors to repeated freeze thaw cycles please store the vectors at 4C for short term usage or aliquot to individual tubes for long term storage 3 a Set up the ligation reaction as follows Materials Amounts Linearized vector 1 ul Mix reaction well and incubate for 5 7 minutes at room temperature If you are making several constructs at the same time we strongly recommend adding ligase and buffer separately and individually to the linearized vector i e do not make and aliquot a pre mixture of ligase and buffer to the linearized vector Transformation Reaction Add a vial of competent cells to the ligation mix Place cells on ice for 15 minutes Heatshock cells at 42 C for 50 seconds then immediately transfer cells to ice for 2 minutes Add 250 ul SOC medium and incubate at 37 C for 1 hour with shaking 888 266 5066 Toll F
18. monly utilized promoters that are active in mammalian cells See Table 1 4 The hspCas9 and Nickase is followed by a regulatory element called WPRE Woodchuck virus post transcriptional regulatory element to boost gene expression and stabilize the mRNA transcript To avoid reconstituting the CRISPR Cas9 RNA processing machinery a custom gRNA crRNA tracrRNA chimeric transcript can be generated from the pre cut ready to use linearized vectors 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual through the use of annealed oligonucleotide duplexes encoding the 20bp target sequence upstream of PAM with the gRNA expressed under the control of a robust H1 polymerase Ill promoter Our programmable all in one vector format allows for highly flexible targeting of any genomic loci in the form of No NGG Table 1 List of available all in one Cas9 SmartNuclease and Nickase Vectors with built in T7 promoter and GFP or RFP fluorescent markers Cat CAS700G 1 Description EF1 T7 hspCas9 T2A GFP H1 gRNA linearized SmartNuclease vector Size 10 rxn CAS701R 1 EF1 T7 hspCas9 T2A RFP H1 gRNA linearized SmartNuclease vector 10 rxn CAS720G 1 CAG T7 hspCas9 T2A GFP H1 gRNA linearized SmartNuclease vector 10 rxn CAS721R 1 CAG T7 hspCas9 T2A RFP H1 gRNA linearized SmartNuclease vector 10 rxn CAS740G 1 CMV T7 hspCas9 T2A GFP H1 gRNA linearized Sma
19. n successfully transfected Option 2 SBI provides a full suite of off the shelf HDR cloning vectors containing multiple MCS for cloning in of homology arms and insert sequences as well as selectable fluorescent and antibiotic selection markers Please inquire for availability of these vectors Option 3 SBI can build a custom HR donor vector targeting any sequence of interest as part of our custom cloning services Please inquire with services AT systembio com to discuss a custom project or request a quotation 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI User Manual IV References Carr PA Church GM Genome engineering Nat Biotechnol 2009 Dec 27 12 1151 62 doi 10 1038 nbt 1590 Bhaya D et al CRISPR Cas systems in bacteria and archaea versatile small RNAs for adaptive defense and regulation Annu Rev Genet 2011 45 273 97 doi 10 1146 annurev genet 110410 132430 Terns MP Terns RM CRISPR based adaptive immune systems Curr Opin Microbiol 14 321 2011 Curr Opin Microbiol 2011 Jun 14 3 321 7 doi 10 1016 j mib 2011 03 005 Epub 2011 Apr 29 Makarova KS et al Evolution and classification of the CRISPR Cas systems Nat Rev Microbiol 2011 Jun 9 6 467 77 doi 10 1038 nrmicro2577 Epub 2011 May 9 Wiedenheft B et al RNA guided genetic silencing systems in bacteria and archaea Nature 2012 Feb 15 482 7385 331 8 doi 10 1038 nature10886 Jinek M et al A
20. programmable Dual RNA guided DNA endonuclease in adaptive bacterial immunity Science 2012 Aug 17 337 6096 816 21 doi 10 1126 science 1225829 Epub 2012 Jun 28 Barrangou R RNA mediated programmable DNA cleavage Nat Biotechnol 2012 Sep 30 9 836 8 doi 10 1038 nbt 2357 Mali P et al RNA guided human genome engineering via Cas9 Science 2013 Feb 15 339 6121 823 6 doi 10 1126 science 1232033 Epub 2013 Jan 3 Cong L et al Multiplex genome engineering using CRISPR Cas systems Science 2013 Feb 15 339 6121 819 23 doi 10 1126 science 1231143 Epub 2013 Jan 3 Page 24 ver 2 140507 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 Jinek M et al RNA programmed genome editing in human cells Elife 2013 2 e00471 doi 10 7554 eLife 00471 Epub 2013 Jan 29 Qi LS et al Repurposing CRISPR as an RNA guided platform for sequence specific control of gene expression Cell 2013 Feb 28 152 5 1173 83 V Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site hitp www systembio com For additional information or technical assistance please call or email us at System Biosciences SBI 265 North Whisman Rd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders sys
21. rand breakage DSB formation Additionally the Cas9 nuclease cuts the DNA only if a specific sequence known as protospacer adjacent motif PAM is present immediately downstream of the protospacer sequence whose canonical sequence in S pyogenes is 5 NGG 3 where N refers to any nucleotide Streptococcus pyogenes native type II CRISPR locus Direct repeats tracrRNA K Y Y A Cas Cast Cos Csn2 A a asi Cas2 Cs Spacers Pre crRNA expression Pre crRNA OS TZ I 4 crRNA Processing by RNaselll and other enzymes DNA Double stranded Target DNA Cleav Recognition Mediated by Cas9 tracrRNA Figure 1 Overview of the CRISPR system Figure adapted from Cong et al Multiplex Genome Engineering Using CRISPR Cas Systems Recently it has been demonstrated that the expression of a single chimeric crRNA tracrRNA transcript which normally is expressed 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual as two different RNAs in the native type II CRISPR system is sufficient to direct the Cas9 nuclease to sequence specifically cleave target DNA sequences By adapting the endogenous type Il CRISPR Cas system in S pyogenes for utility in mammalian cells several groups have independently shown that RNA guided Cas9 is able to efficiently introduce precise double stranded breaks at endogenous genomic loci in mammalian cells with high efficiencies and minimal off target effects
22. ree 650 968 2200 outside US Page 19 System Biosciences SBI User Manual e 4 Spread 100 ul of cultured cells on a pre warmed LB plate containing 50 pg ml Kanamycin and incubate overnight at 37 C Confirmation of Positive Clones Pick 1 to 2 colonies grow in LB Kanamycin medium overnight at 37 C with shaking Next day miniprep plasmid DNAs and send for sequencing using the provided sequencing primer Note Primer provided is ready to use concentrated at 5 uM simply use 1 ul per reaction Align your raw sequencing data with the top strand primer sequence E Transfection of the Cas9 SmartNuclease Construct into Target Cells 1 Plate 100 000 to 200 000 of target cells e g 293T cells into a single well of a 12 well plate in 1 ml of appropriate growth medium Include a single well of cells as negative control which can be non relevant plasmid DNA or linearized Cas9 SmartNuclease plasmid DNA Next day or when cells are 50 60 confluent transfect target cells with the Cas9 SmartNuclease vector and donor vector if HDR is desired using a_ suitable transfection reagent following the manufacturer s recommended protocol for 6 well plates The use of reduced or serum free media containing no antibiotics to dilute the vector transfection complex is highly recommended Note For 293T cells we transfected 0 5 ug of the Cas9 SmartNuclease vector into cells for cleavage of gene targets and used a 1 1 ratio of Cas9
23. ri 227 7394 9868 bp SV4O0 Poly Aj 7087 7218 chimeric gRNA 6927 7009 H1 promoter 6687 6893 WPRE 6014 6554 CopGFP 5249 6007 T2 amp 5189 5242 NLS 5141 5188 hspCas9 1040 5140 EF1a hybrid promoter 405 950 T7 promoter 963 982 NLS 989 1039 Kan 9470 3655 Origin 3334 7746 EF1 T hspCas9 RFP H1 sg SV40 ori 7149 7316 9790 bp SV40 P oly A 7009 7140 chimeric gRNA 6849 6931 H1 promoter 6609 6815 Pa WPRE 5936 6476 RFP 5249 5926 T2A 5189 5242 NLS 5141 5188 hspCas9 1040 5140 Page 8 ver 2 140507 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 Cas9 Nickase Constructs EF1a hybrid promoter 405 950 T7 promoter 963 982 Jms 989 1039 Kan 9548 3733 Origin 9412 7824 EF1 T hspCas9 nickase GFP H1 sg SV40 ori 7227 7394 9868 bp SVA40 Poly A 7087 7218 chimeric gRNA 6927 7009 H1 promoter 6687 6893 WPRE 6014 6554 CopGFP 5249 6007 T2A 5189 5242 NLS 5141 5188 hspCas3 nickase 1040 5140 EF1a hybrid promoter 405 950 T7 promoter 963 982 pa 989 1039 Kan 9470 8655 Origin 8334 7746 EF1 T hspCas9 nickase RFP H1 sg 9790 bp SV40tori 7149 7316 SV40 Poly A 7009 7140 chimeric gRNA 6849 6931 H1 promoter 6609 6815 Pa WPRE 5936 6476 RFP 5249 5926 T2A 5189 5242 NLS 5141 5188 hspCas9 nickase 1040 5140 In addition to EF 1a CMV
24. rtNuclease vector 10 rxn CAS741R 1 CMV T7 hspCas9 T2A RFP H1 gRNA linearized SmartNickase vector 10 rxn CAS750G 1 Cas9 Nickase EF1 T7 hspCas9 nickase T2A GFP H1 gRNA linearized SmartNickase vector 10 rxn CAS751R 1 Cas9 Nickase EF1 T7 hspCas9 nickase T2A RFP H1 gRNA linearized SmartNickase vector 10 rxn CAS770G 1 Cas9 Nickase CAG T7 hspCas9 nickase T2A GFP H1 gRNA linearized SmartNickase vector 10 rxn CAS771R 1 Cas9 Nickase CAG T7 hspCas9 nickase T2A RFP H1 gRNA linearized SmartNickase vector 10 rxn CAS790G 1 Cas9 Nickase CMV T7 hspCas9 nickase T2A GFP H1 gRNA linearized SmartNickase vector 10 rxn Page 6 ver 2 140507 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS7xxA 1 Cas9 Nickase CMV T7 hspCas9 CAS791R 1 nickase T2A RFP H1 gRNA linearized SmartNickase vector 10 rxn Fig 2 Schematic Expression System Target Genomic Locus SV PAM Target sequence to deave gt Your guide RNA sequence tracrRNA built into vectors 888 266 5066 Toll Free 650 968 2200 outside US Protospacer Adjacent Motif Figure of Cas9 SmartNuclease Nickase Page 7 System Biosciences SBI User Manual Cas9 SmartNuclease Constructs EF1a hybrid promoter 405 950 T promoter 963 982 NLS 989 1039 Kan 9548 8733 Origin 8412 7824 EF1 T hspCas9 GFP H1 sg SV40 o
25. tembio com 888 266 5066 Toll Free 650 968 2200 outside US Page 25 System Biosciences SBI User Manual Vil Licensing and Warranty information Limited Use License Use of the PrecisionX Cas9 SmartNuclease Expression System i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms The purchaser of the Product is granted a limited license to use the Product under the following terms and conditions e The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use e The Product may not be resold modified for resale or used to manufacture commercial products without prior written consent of SBI e This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may b
Download Pdf Manuals
Related Search