Home

Rapid Diagnostic Tools for Phytophthora on Horticultural

1. Add EDTA to 70 ml water and stir vigorously Adjust pH to 8 0 with NaOH Adjust to 100 ml volume and autoclave Te Buffer pH 8 0 50ml 10 mM Tris HCl 0 5 ml of 1 M Tris HCl pH 8 0 0 1 mM EDTA 0 01 ml of 0 5M EDTA H O 49 49 ml TE Buffer pH 8 0 50ml 10 mM Tris HCl 0 5 ml of 1 M Tris HCl pH 8 0 0 1 mM EDTA 0 1 ml of 0 5M EDTA HO 49 4 ml 70 Ethanol 73 ml 95 ETOH 27 ml H o Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 29 10 11 12 13 14 15 16 DNeasy Plant Mini Kit Extraction Before starting preheat a water bath or heating block to 65 C Make sure 96 100 ethanol has been added to the AW1 and AW2 buffers Buffer AP1 and AW1 pre ethanol may form precipitates during storage which can be rectified by warming to 65 C Grow mycelia in pea broth culture 7 10 days or until sufficient mycelia Place approximately 100mg wet weight mycelia into a microcentrifuge tube Add 400uL Buffer AP1 and 4uL RNAse A solution Grind mycelia with sterile Konte pestle Vortex vigorously Incubate at 65 C for 10 minutes Invert the tube two or three times during incubation to mix Add 130uL Buffer P3 mix and place on ice for 5 minutes Centrifuge the lysate for five minutes at 14 000 rpm Pipet the supernatant into a purple QIAshredder mini spin column in a 2mL collection tube Centrifuge for 2 minutes at 14 000 rpm Transfer the flow through into a new tube without disturbing
2. may be visible in as little as 5 minutes Lower titer samples may take up to 30 minutes Remove test strip from extract amd bag interpret results see illustration IF only the control line IC is visible this Extract the sample by rubbing it gently indicates a negative result lso present at any the test is invalid m Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 47 Home Glossary Index Site Map User Guide FTA Technology q gt Home gt DNA Extraction amp Quantitation gt Other Extraction Techniques gt Other Techniques gt FTA Technolegy 00 VA ES FTA is an acronym tor fast technology for analysis of nucleic acids It was originally developed by Burgoyne and Fowler at Flinders University in Australia in the 1980s Fra as a means of protecting nucleic acid Classe Card 3 samples from degradation by nucleases and _ s other processes The concept was to apply a sss weak base chelating agent anionic surfactant or detergent and uric acid or a urate salt to a cellulose based matrix filter paper A sample containing DNA could then be applied to the treated filter paper for preservation and long term storage Whatman licenses the FTA technology from Flinders University They offer a line of products using this technology most notably filter paper cards Click here to read more about filter paper car
3. semipapillate or nonpapillate number of apices shape and size can be observed and measured Length and breadth width of 10 sporangia are measured with an ocular micrometer and length breath ratio s are calculated Sporangiophore Sporangiosphores are the hyphal strands on which sporangia are borne Morphology of sporangia can be observed using a binocular microscope from the agar disks described above 2 Sporangiophores can be branched or unbranched to form compound or simple sympodia The sporangiophore emerges from the base of previous sporangium in either a lax or close manner in a simple sympodium Sporangia can form in umbels an inverted umbrella like cluster of sporangia on the sporangiophore or very long irregular branches Sporangia may proliferate internally through previously formed sporangia on the sporangiophore Sporangia can be borne in tight or botryose clumps on the sporangiophore Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 13 4 Cauducity Sporangial disks produced as described above 2 are placed on a microscope slide and agitated to dislodge sporangia in water Cauducous sporangia will break or tall away from the sporangiophore readily when agitated and can be observed Pedicel sporangial stalk length is measured The pedicel isthe hyphal strand left attached to the sporangium in cauducous species Pedicel lengths can be grouped into small lt 5 um medium 5 1o um and long gt
4. 10 Allow DNA to precipitate overnight at 20 C 11 Centrifuge to pellet DNA 10 min 12K rpm room temperature Pour off supernatant 12 Wash pellet twice with 70 Ethanol 13 Dry pellet in speed vacuum 14 Resuspend pellet in Te buffer pH 8 0 Extraction Buffer 250 ml per L Formula FW 0 35 M Sorbitol 15 94 g 63 778 C6H406 182 2 0 1 M Tris 3 03 g 12 11g CHyNO 121 1 0 005 M EDTA pH 7 5 0 47 8 1 86 g CioH 4 N208Na2 2H20 372 0 02 M Sodium Bisulfite 0 95 g 3 8 g Adjust pH to 7 5 with HCl Do not autoclave and store at 4 C CTAB Nuclei Lysis Buffer 250 ml per L Formula FW 0 2 M Tris 6 05 g 24 28 C H NO 121 1 0 05 MEDTA pH 7 5 4 65 8 186g ColHuNoOsNa 2H O 372 2 2 0 M NaCl 20 2 g 116 88g NaCl 58 44 2 CTAB 58 20 g CioHy2N Br 364 5 cetyltrimethylammonium bromide 5 Sarkosyl 5 g N lauryl sarcosine per 100 ml HO Autoclave 3M Sodium Acetate 250 ml per L Formula FW 3M Sodium Acetate 61 52 g 246 09 g C H 0 Na 82 03 Adjust pH to 8 0 with HCl and adjust volume to 1 liter Dispense and autoclave Store at room temperature Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 28 Buffers 1M Tris HCl pH 8 0 100 ml per L Formula FW 1M Tris HCl 15 76 g 157 6 g C HuNO HCl 157 6 Add Tris into 80 ml H O Adjust pH with HCl Bring to final 100ml volume Sterilize by autoclaving 0 5 M EDTA pH 8 0 100 ml per L Formula FW 0 5 M EDTA 18 6 g 186g CioH 4N O8Na2 2H 0 372
5. 1o um categories 5 Oospores Oospores of heterothallic isolates are produced by placing an agar disk containing mycelium of an unknown isolate 2 3 cm apart from a tester isolate on clarified V8 CV8 agar or lima bean agar Tester isolates of known opposite mating type A1 or A2 are needed for pairing with each unknown isolate and serve as controls Homothallic isolates do not require pairing and should produce oospores in single culture Cultures are incubated in the dark at 20 22 C for approximately 1 mo Oogonia and antheridia should form within 7 days but oospore formation may take longer Oospores formed in a distinct band between opposite mating types will confirm heterothallic species 6 Oogonia and oospore diameter can be measured Oospore diameter is measured using the outer wall of the oospore Oogonial diameter is measured using the outer oogonial wall contained within the oospore Measurements in two directions are usually done and at least 10 oospores or oogonia should be measured 7 Antheridial characters should be observed The antheridium is the male gametangium and is a multinucleate swollen hyphal tip that can be affixed to the basal side of the oogonium paragynous or the oogonial stalk can grow through the antheridium so that the antheridium surrounds the oogonial stalk amphigynous Antheridia may be 1 or 2 celled 8 Hyphal characteristics including hypha swellings and presence of chlamydospores can be observed in
6. Base on the value of nmole on the tube we add 10 times of that value of ddH O to make 100uM stock soln BSA 20mg ml Roche Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 16 Primers ITS region e ITS6 GAAGGTGAAGTCGTAACAAGG e ITS4 TCCTCCGCTTATTGATATGC ITS6 ITS4 BOL region e FM8oRC TTTCAACAAATCATAAAGATATT e FM85 AACTTGACTAATAATACCAAA BOL o gt 4 FM80RC FM85 VI REFERENCES Blair J E Coffey M D Park S Y Geiser D M and Kang S 2008 A multi locus phylogeny for Phytophthora utilizing markers derived from complete genome sequences Fungal Genetics and Biology 45 266 277 Bonants P J M Hagenaar de Weerdt M van Gent Pelzer M Lacourt I Cooke D E and Duncan J M 1997 Detection and identification of Phytophthora fragariae Hickman by the polymerase chain reaction Eur J Plant Pathol 103 345 355 Bonants P J M van Gent Pelzer M P E Hooftman R Cooke D E L Guy D C and Duncan J M 2004 A combination of baiting and different PCR formats including Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 17 measurement of real time quantitative fluorescence for the detection of Phytophthora fragariae in strawberry plants European Journal of Plant Pathology 110 689 702 Cooke D E L Drenth A Duncan J M Wagels G and Brasier C M 2000 A molecular phylogeny of Phytophthora a
7. as P ramorum Sudden Oak Death and P kernoviss The test is also suitable for detection of Phytophthore species that affect other important crops such as P frageriae in strawberry or P infestans in potato Technical Information Related Products Source https orders agdia com InventoryD asp loc IN amp collection ISK 2092601 amp attribut e Size 25 Phytophthora spp ALERT LF Categories Phytophthora spp Phytophthora spp ALERT LE ALERT LF offers a range of devices for the detection of key fungal pathogens in symptomatic plant material These kits provide real time meaningful results promoting rapid disease identification and decision making No other equipment required all materials included No training or laboratory skills required Source http plant neogeneurope com product asp strParents amp CAT ID 161 amp P ID 614 amp numCurrencyID 2 Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 49 Data File 11 0026 07 AB Polymerase chain reaction PCR PuReTaq Ready To Go PCR Beads Description Sepak a Sie Sasa e ilustro PuRetog Reodu To Gol4 PCR Baads are pramixed predispensed single dose reactions optimized for performing standard PCR amplifications The use of racambinant PuReTog DNA Polymerase and other high Purity reagents ensures reliable and robust performance in both end point and real time fluorascence basad PCR amplification and ensures the low
8. sympodia simple J long irregular umbellate internal proliferation J o JL basalsweling J Tooo o S O intercallary swelling J clumps A Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 54 EE Ie BoIUI juosqe juosqe juosqe juosqe yuasoid sdumnpo ur pews juosqe juosqe juosqe juosqe oeydAy piol u1oo IJB J juosqe juosqe SUITPAS Ieud H pue eurula IJB J AJe e919 ut pue eurula quoursid UMOJQ TeoLIoyds P9 8M Y 00U1IS punoi aoe ULIOJLI d 0 eorrouds UJOOUIS pue punos S19ISN 9 oyI odeis IJB J yuasoid QUIOS s1odsopAueyy a 8 a posodey ATusIr s V N aseq podeys ouuny peotoyds aseq podeys jouuny eououds aseq oy PILMO SULIodr JO eououds eououds pruosooO snou A3tydure snou A3tydure snoudAseied snou A3tydure snou A3tydure snou A3tydure snoudAseied snouAsiydure snouAsiydure snou A3tydure snoudAseied snou A3tydure snou A3tydure snoudAseied snou A3tydure BIpLayyUy onoJo de Ea SonoJj de A SOUL s orodsooO lje idedrur s 91 8Y10 19 9 snoonpeo i gwded snoonpes 82 47 ssa Sureulouro TW S snoonpeouou Oc SI Hey u gwded snoonpes O Z MEYI Teyp EJ N sjoorped unIpou Si eu o1o1 ou
9. the cell debris pellet Add 1 5 volumes of Buffer AW1 to flow through and mix by pipetting e g if there is 450uL of flow through add 675uL Buffer AW1 Pipet 650uL of the mixture to a clear DNeasy mini spin column in a 2mL collection tube Centrifuge for 1 minute at 8000 rpm or greater Discard flow through and reuse tube and column in next step Repeat step 10 with the remainder of the mixture Discard the flow through and collection tube save the column Place the column in a clean 2mL collection tube and add 500uL Buffer AW2 Centrifuge for 1 minute at 8000 rpm or greater Discard flow through and reuse tube Add 500uL Buffer AW2 and centrifuge for 2 minutes at 14 000 rpm This will dry the membrane Transfer the column to a clean 1 5 2mL microcentrifuge tube Pipet 100uL Buffer AE directly onto the DNeasy membrane Incubate for five minutes at room temperature Centrifuge for 1 minute at 8000 rpm or greater to elute Repeat step 15 once Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 30 Phytophthora spp identification using PCR RFLP technique PCR allowed the amplification of DNA fragments DNA fragments are used to identify species using restriction enzymes Restriction enzymes cut specific sites inside the amplificated fragments and generate a band pattern that allowed the identification of specific organisms according to the band length On this laboratory we will identify Phytophthora spp u
10. thin plates of lima bean agar E Stock cultures Stock cultures of most species can be maintained on cornmeal agar or lima bean agar slants covered with sterilized mineral oil at 20C Agar disks of most species can also be stored in sterilized water containing autoclaved hemp seed in 1 ml vials at room temperature Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 14 References Erwin D C and Ribeiro O K 1996 Phytophthora diseases worldwide Amer Phytopathol Soc Press St Paul MN 562 pp Gallegy M and Hong C 2008 Phytophthora Identifying species by morphology and DNA fingerprints American Phytopathological Society Press St Paul Mn 158pp Jeffers S N and Aldwinkle H S 1987 Enhancing detection of Phytophthora cactorum in naturally infested soil Phytopathology 77 1475 1482 Larkin R P Ristaino Jean B and Campbell C L 1995 Detection and quantification of Phytophthora capsici in soil Phytopathology 85 1057 1063 Masago H Yoshikawa M Fukada M and Nakanishi N 1977 Selective inhibition of Pythium spp on a medium for direct isolation of Phytophthora spp from soils and plants Phytopathology 67 425 428 Ribeiro O K 1978 A source book of the genus Phytophthora J Cramer Vaduz Liechtenstein 417 pp Tooley P W 1988 Use of uncontrolled freezing for liquid nitrogen storage of Phytophthora species Plant Dis 72 680 682 Rapid diagnostic tools for Ph
11. through cheesecloth pour into bottles and autoclave This is a general broth for growing mycelia cultures of Phytophthora species C Production of structures for morphological identification 1 Growth Isolates can be tested for growth on lima bean agar at a range of temperatures of 2o 25 3o and 35 C Sporangia Sporangia are the cells or vessels in which zoospores are formed Agar disks containing mycelium from cultures removed from either lima bean or V 8 juice agar are placed in sterile petri dishes and covered with a thin layer of sterile distilled water or sterile or non sterile soil extract Non sterile soil extract is prepared by adding 1000 ml distilled water to 15 g air dried field soil Soil is stirred vigorously for at least 4 hr and allowed to settle overnight The supernatant is filtered through two layers of cheesecloth centrifuged at 1935 g for 15 min filtered through coarse filter paper and can be either autoclaved or used non sterile Non sterile soil extract is more effective then sterile soil extract for sporangia production Store in the refrigerator at 4 C Jeffers and Aldwinkle 1987 A thin layer of sterile distilled water or soil extract is added to petri plates containing disks removed from cultures Do not submerge the disks Plates are incubated under cool white fluorescent light for 1 3 days and observed daily under the dissecting scope for sporangia Slides can be made and sporangia type papillate
12. Crops ic Tools gt ma i E O S E 9 QU y Rap l a Rapid Diagnostic Tools for Phutophthora on Horticultural Crops Authors Jean Beagle Ristaino Ph D North Carolina State University Raleigh North Carolina Jean ristaino ncsu edu Kelly Ivors PhD Cal Poly San Luis Obisbo Peter Bonants PhD Plant Research International Wageningen NL peter bonants wur nl Monica Blanco PhD Unversidad de Costa Rica San Jose Costa Rica monica blancomeneses ucr ac cr David Cooke Ph D The James Hutton Institute Invergowrie UK david cooke hutton ac uk Pallem Chowdappa ICAR Banaglore India cover illustration Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 2 Rapid Diagnostic Tools for Phutophthora on Horticultural Crops Table of Contents Isolation growth and morphology of Phytophthora p 4 p 15 PCR protocols used in Lucid key p 16 p 20 Molecular identification of Phytophthora p 21 p 24 Quick NaOH extraction from dried leaf samples p 25 PCR with Ready To Go PCR beads p 26 p 27 CTAB extraction of DNA p 28 p 29 DNEasy plant mini kit extraction p 30 Phytophthora spp identification using PCR RFLP technique p 31 p 32 All Phytophthora Taqman PCR p 36 p 38 12 plex microsatellite genotyping of P infestans p 39 p 41 Detection of P ramorum using LAMP p 42 P 43 Rapid assay product information p 44 p 52
13. H is a good choice but anything with antibiotics should work 2 Cut the plate into quarters with a sterile scalpel and set aside 3 Using a sterile scalpel remove a thin layer of media from the growing hyphal edge of the contaminated culture The circumference of the sliver should be about that of a pencil eraser 4 Place this sliver in the center of an empty sterile Petri dish 5 Using a sterile spatula place a quarter piece of the antibiotic media on top of the sliver Fig 3 6 Allow 2 4 days for the Phytophthora mycelia to grow up through the media The bacteria should not be able to move vertically through the media 7 Using a sterile scalpel remove a thin layer of media containing uncontaminated hyphae being careful not to penetrate too deeply through the media 8 Transfer this wedge onto nutrient agar to make sure that the decontamination was successful Y m Fig 1 A quarter piece of PARP is placed on top of a piece of contaminated Phytophthora culture Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 7 Protocol from the lab of Kelly Ivors North Carolina State University 2oo4 Isolation and detection of Phutophthora using Rhododendron leaf baits This protocol is used to detect and or isolate Phytophthora from infested soil or tissue samples PART 1 Leaf Bait Preparation 1 2 a 4 5 Collect unblemished leaves from native Rhododendron Rinse in 10 Clorox for 1
14. L 25mg ml 8 0ml Fungicides PCNB 75 WP 5o mg L 67mg ml 1 0ml Benomyl 50 WP 100 mg L 10mg ml 2 oml Dissolve ampicillin in 70 ethanol Add amendments separately in a laminar flow hood while stirring to media after sterile and cooled to 50 C All fungicides and antibiotics should be prepared aseptically and stored at 5 C or frozen in sterile plastic vials in aliquots for 1 liter Surface sterilize tissue in 70 Ethanol 15s then 10 Clorox 2 5 min Rinse in distilled water Plate sporangia from lesions on media and incubate plates at 18 C in the light 2 Soil Dilution Plating for isolation of soilborne species Soil dilution plating can be performed to isolate some species with a soilborne phase ie P capsici P nicotianae P cinnamomi P ramorum Forty grams of soil is added to 160 ml 0 25 sterile water agar stirred for 5 min and 1 mlaliquots are plated onto each of 5 plates of Masago s selective medium At higher inoculum levels additional 1 5 serial dilutions are needed Plates are incubated in the dark at 24 C for 72 hr rinsed under running water to remove soil residue and colonies are counted Gravimetric soil water content g water g dry soil of the soil samples is determined at the time of soil dilution and used to calculate inoculum density per g dry soil Masago s Phytophthora isolation from soil Masago et al 1977 Potato Dextrose Agar 39g L PPM Stock Use PCNB 96ai 25 mg L 5 2 mg ml s o ml Be
15. NA from the infected leaf tissue to tube 3 d Add 8 ul of the positive control DNA from the positive control to tube 4 4 Gently mix the reagents in each tube by pipeting the mixture up and down several times 5 Place on ice 6 When everyone s reactions are set up and the machine is programmed and ready to go place the tubes in the thermal cycler and run the following PCR program Cycling Parameters Inititial denaturation 94 C 2min 35 Cycles 94 C 15 sec 55 C 15 sec 72 C 15 sec Final extension 72 C 5min Hold A C Primers Primers can be ordered from Invitrogen at http www invitrogen com Forward primer ITS5 GGAAGTAAAAGTCGTAACAAGG Reverse primer PINF2 CTCGCTACAATAGCAGCGTC Preparing Primer stock soln 100 uM Base on the value of nmole on the tube we add 10 times of that value of ddH O to make 100uM stock soln Preparing 5 uM Primer soln from primer stock soln Add 10 ul of 100 uM primer stock soln into 190 ul of sterilized distilled water Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 26 Ready To Go PCR beads can be ordered from GE healthcare with cat 27 9559 01 at http www gelifesciences com webapp wcs stores servlet productById en GELifeScience s us 27955901 Gel Preparation 1 Seal the ends of the gel tray with tape and inset the comb 2 Make a 1 5 molten agarose at approximately 55 65 C and add 5 ul of gel red 3 Pour the molten agarose into the tray to form a ge
16. Phytophthora species ID worksheet p 53 p 54 Phutophthora species characters p 55 Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 3 Protocol derived from this reference National Plant Diagnostic Network NPDN News 4 Vol 2 Issue 3 Gail Ruhl Plant and Pest Diagnostic Laboratory Purdue University Float incubation technique for Phutophthora and Pythium diagnostics This float incubation technique is an excellent way to induce the production of sporangia as well as mycelial growth from herbaceous tissue for diagnostic purposes A 1 unsterilized soil extract solution works well for stimulating sporangia production from Phutophthora infected tissue This float technique may also be used to stimulate sporangia production from mycelium growing on agar plugs 1 A Prepare a 1 unsterilized soil extract by swirling 10 g soil and 1 L distilled water together in a 2 L flask Slowly pour extract solution through filter paper lined funnel into media storage bottle and store in refrigerator until needed Wash funnel and replace filter paper for each bottle Pour enough refrigerated soil extract solution into Petri dish containing herbaceous roots stems and or leaves to just cover the plant material Cover Petri dish and incubate on benchtop for 24 hrs Examine herbaceous material with a compound microscope while it is still floating in the soil extract solution Look for sexual oogonia with anth
17. TIONS OF SUPPLY The tests are supplied subject to Neogen Europe Ltd terms and conditions of supply Copy available on request Particular attention is drawn to the following The tests supplied are for the detection of the pathogen stated on the foil pack The tests should be used to provide the basis for a presumptive diagnosis A negative result cannot be taken as conclusive evidence of freedom from the specific pathogen under test If in doubt repeat the test or submit to a diagnostic laboratory for confirmation These products are for diagnostic use only They are supplied and service information and advice rendered on the understanding that the customer is solely responsible for determining the suitability for the intended purpose Neogen Europe Ltd shall not be liable for any indirect special or consequential damages of any kind resulting from their use The sole and exclusive remedy of the customer is limited to the replacement of goods shown to be substandard Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 45 Additional Sampling Instructions Choosing and Collection Choosing plants to test 1 Select a plant or plants showing symptoms which you consider typical of the problem Avoid using dead plants if possible 2 If several plants are affected take material from each and bulk together for testing 3 When there is a history of disease outbreaks sample as soon as there are any indications of
18. TTCAGCGGCTGTTTCGAC FwdVIC ATGAAAATACGTCAATGCTCG Rev CGTTGGATATTTCTATTTCTTCG Rev TCGCCACAAGATTTATTCCG FwdVIC ATGACGAAGATGAAAGTGAGG Rev CGTATTTTCCTGTTTATCTAACACC Rev GTTTGCTTGGACTGCGTCTTTAGC Rev GCAAGCGAGGTTTGTAGATT Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 39 Instead of individually pipetting each primer into the master mix a 10X multiplex primer mix is made that includes all primers The primer mix is made as follows makes 4ooul Primer Volume of 100uM primer stock ul PiG11F PiG11R 2 N ON OV NIN NIN NIN NIN A Pio2F Pi02R PinfSSR11F 2 PinfSSR11R 2 PinfSSR4F 2 PinfSSR4R 2 Pi04F Pi04R P170F P170R PinfSSR6F 2 PinfSSR6R 2 Pi63F Pi63R PinfSSR2F 2 PinfSSR2R 2 D13F Di3R PinfSSR8F 12 PinfSSR8R 12 N Pi4BF Pi4BR Combine with 303 2uL of 10 mM Tris buffer pH 8 0 to make 400ul of primer mix Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 40 The master mix can be made using either the Qiagen multiplex PCR kit Qiagen cat No 2o6145 orthe Qiagen Type it Microsatellite PCR kit Qiagen cat No 206243 For the purposes of this protocol we use the Type it microsatellite PCR kit Reagent Volume per reaction ul 2X Type it master mix 6 25 10X multiplex primer mix 1 25 PCR grade water 4 Total reaction mix volume per sample ul 11 5 1ul of template DNA is added to bring the total volume per samp
19. Using a 6 or large cork borer or larger transfer multiple plugs of the suspected Phytophthora isolate into an empty Petri dish Itis best to use cultures less than 7 days old isolates growing on corn meal agar work best Cultures on PARP have worked okay sometimes but many Phytophthora species do not sporulate well on media containing antibiotics Flood the Petri dish with 2 soil extract solution or dilute V8 until the solution covers the surface of the agar plugs Label Petri dish and incubate at room temperature Using a dissecting scope continually check agar discs 48 96 hours after flooding to look for mycelial growth and sporangia production Once sporangia are detected the agar plugs can be magnified using an inverted scope or removed from the flooded Petri dish and smashed on a slide with lacto phenol blue to observe sporangial morphology at higher magnification Sporangia of Pythium species tend to be globose to oval or have an irregular shape while sporangia of Phytophthora species are typically lemon shaped Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 6 Original protocol published in Inoculum 56 6 2005 by Susan Kaminskyj Purification of Phytophthora cultures contaminated with bacteria This protocol can be used to purify Phytophthora cultures that are contaminated with bacteria 1 Choose a plate of media containing antibiotics that was poured thinly lt 1 cm thick PARP
20. ae ided snoonpnes purypowoy aye pided snoonpvouou pl oeyoo uou SNOINPRIVOU Heypwoy ee IMTBUJOULO uou SNOINPRIVOU Te qrouIoy aye pided UOU snoonpeouou TO IS TPI aye pided snoonpvouou snoonpeouou oo asa orpepowoy snoonpeouou aye pided UOU snoonpeouou TO IS Teyp adeys ur qpupA sroorpad Suo J9A ayepided snoonpes TO IS sjaorped jIOYs va N ayepprded snoonpes oO EIES orpepowoy ZE ST onepowoy O duro sjaorped jIOYs yo rIded snoonpneo vIiguvIods X9 SUDISIfUL d siyvoido dq IDSUIAKS d pioaujvd q npvow q IDUDIJOIIU d IDIADIDAS d D21 d so 1 642 d 119 SYIDAP d DAOYIYAOAN19 q 010314112 d Huotupuul2 d 1918d09 d UNAOJIDI d 9DIL9MYIOA d samads Page 55 Rapid diagnostic tools for Phytophthora on horticultural crops 2015
21. ageno at concentrations well above ther working concentrations used for gel siaming Furhermore environmental safety tests showed that GelRed and GelGreen are nonhazar dous and nortaxic to aquatic life s a result GelRed and Gel6reen can be disposed of down the drain or m regular trash For more information please download the GelRediGe Green Safety Report on Biotium website GelRed and Ge Sreen are highly sensitive ether as precast ge stains or post gel stains Designed primarily for use with a 312 302 mm U transil urmenator GelRed is much more sensative than Etsr and at least as sensi tive as or brighter than SYBR Gold in post gel staining Unlike SYBR Gold GelRed can aso be used as a highly sensitive precast gel stain GelGreen s developed to meet the needs of researchers who use a 485 nm laser based gel scanner or a Dark Reader that uses a visible blue light for excitation GelGreen is spectrally similar to SYBR Safe but is far more sensitive than the latter Another major advantage of GelRed and Ge Green is thew remarkable stability You can handle the two dyes the same way you do with EtEz The means that the dyes are perfectly stable in water at room temperature for ong term storage and they can be microwaved for making precast gels Both dyes are also very photostable permitting their use under normal room bght without exercising special precaution A compete fst of GelRed and GelGreen products is shown in Table 1 ge
22. ation if required info neogeneurope com Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 46 Q agdia Leading the way to healthy crops USER GUIDE Phytophthora lmmunoStrip Product Number 92601 KIT INFORMATION Intended Use The Phytophthora Immunostrip is designed for on site testing of plant tissues suspected of infection with Phytophthora species The test is recommended for use as a preliminary screening tool in survey programs for Phytophthora species such as P ramorum Sudden Oak Death and kemoviae The test also suitable for detection of Phytophthora species that affect other important crops such as P frogorioe in strawberry or E infestons in potato complete list of detectable phytopthora species can be found on Page 2 of this document Storage of Kit immuncostrips should be stored refrigerated 4 C between uses and tightly sealed in the desiccated container at all times Test strips and 5EB1 sample extrachon bags if applicable should be warmed to room temperature prior to use PERFORMING THE ASSAY special Attention Required Prepare Sample Perform Assay Collectasample section thatis approximately 1 inch square in size O EL Samples should be taken from areas of the ka of N plant that exhibit symptoms of disease It A f s is best to select tissue from areas where symptomatic tissue comes into contact with areas that appear healthy Cut open the sample extra
23. be 83 nM 5 uM 0 5 ul MQ X ul gDNA 100 ng 1pg 211 Forward Primer FITS 15Ph Phos 5 Phosphate TGC GGA AAG GAT CAT TAC CAC ACC Reverse Primer RITS 279Ph Phos 5 Phosphate GCGAGCCTAGACATCCACTG Probe All phy probe 5 FAM TTGCTATCTAGTTAAAAGCA MGBNEFQ 3 PCR program 2 min 50 C 10 min 95 C 40 cycles 95 C 15sec 60 sec 60 C Samples to run in the 96 well plates do 3 reps 1 Use ano template control buffer and no pathogen DNA 2 Unknown Phytophthora DNA from each of 12 groups 3 Positive control P infestans DNA One group will set up a dilution series of P infestans DNA at known concentrations Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 36 All Phytophthora TaqMan PCR with Internal Amplification Control The generic All Phytophthora TaqMan PCR will be performed with 2 ul DNA extract as published by Kox et al 2oo7 and described below Real time TaqMan PCR will be performed on the ABI75oo instrument in o6 well plates In all cases 2 ul of the DNA extract will be used in 3o ul master mix Negative controls with Milli Q water will be run as negative controls in each run Real time TaqMan PCR will be performed with TaKaRa Premix Lonza Verviers Belgium Internal amplification control primers and probe will be included as described by Klerks et al 2006 Kox Linda Heurneman Ilse Vossenberg van den Bart Beld van den Ineke Bonants Peter and Gruyter de Hans 2007 Diagnosti
24. c values and utility of immunological morphological and molecular methods for in planta detection of Phytophthora ramorum Phytopathology 97 1119 1129 Klerks M M van Bruggen A H C Zijlstra C Donnikov M 2006 Comparison of methods of extracting Salmonella enterica serovar enteritidis DNA from environmental substrates and quantification of organisms by using a general internal procedural control Applied and Environmental Microbiology 72 6 pp 3879 3886 Positive or negative results will be based upon the cycle threshold Ct value number of cycles after which a positive real time PCR signal has been obtained The Cr value will be calculated by the software of the real time PCR machine AB7500 Final conc Stock X1 Premix TaKaRa 1X 2X 15 ul ROX Dye II 1X 50x 0 6 ul F ITS 15Ph Phos 250nM 10 UM 0 75 ul RITS 279Ph Phos 250 nM 10 UM 0 75 ul All phy probe 83 nM 5 uM 0 5 ul FPgfp 75 nM 5 UM 0 45 ul RPgfp 75 nM 5 UM 0 45 ul PYYefp 50 nM 5 UM 0 3 ul IAC DNA 1 7 pg ul 1ul MQ X ul gDNA 100 ng 1pg 2ul Forward Primer FITS 15Ph Phos 5 Phosphate TGC GGA AAG GAT CAT TAC CAC ACC Reverse Primer RITS 279Ph Phos 5 Phosphate GCGAGCCTAGACATCCACTG Probe All phy probe 5 FAM TTGCTATCTAGTTAAAAGCA MGBNFO 3 Forward Primer FPgfp 5 TGGCCCTGTCCTTTTACCAG 3 Reverse Primer RPgfp 5 TTTTCGTTGGGATCTTTCGAA 3 Probe PYYgfp 5 YY AACCATTACCTGTCCACACAATCTGCCC 3 Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Pag
25. ction bag along the top of the label SEB1 Buffer is required to perform this assay Insert the sample between the mesh linings near the bottom of the sample extraction between the mesh linings with a blunt object such as a pen or permanent marker If the test line T is a Depending on the sample type the color positive result of the solution will turn a light brown or green color once the sample is adequately If no lines are present extracted see troubleshooting EB Interpret Results intensity of pink purple this indicates a Aglia Inc 30380 County Road 6 Elkhart IN 46514 Phone 574 264 2615 or toll free 300 622 4342 Fax 574 206 9360 Web www agdia com Email info agdia com ImmunoStrip Kit ISK Includes ImmunosStrips 5EB1 sample extrachon bags User guide Immunostrips 57 purchased separately do not include buffer filled mesh bags What s required to perform the assay Scissors knife or razor blade SEBI sample extraction buffer Sample extraction device Agdia sample extraction bags are recommended Letter holder or other device to hold sample extraction bags Insert the ImmunoStrip into the channel portion no mesh of the buffer filled bag sure to insert the sample end of the strip no more than or to the white line on the ImmunoStrip label Allow the ImmunoStrip test to remain in the sample extract for 30 minutes Positive results
26. ds on Whatman s website Biological samples such as blood and saliva adhere to the paper through the mechanism of entanglement while the mixture of chemicals lyses cells and denatures proteins Because nucleases are inactivated the DNA is essentally stable when the sample is properly dried and stored Nucleic ecid damage from nucleases oxidation ultraviolet light UV damage microbes and fungus is reduced when samples are stored on the FTA card 10 A marketable advantage of the FTA technology is that samples spotted on treated cards may be stored at room temperature The chemicals on the FTA cards enhance the preservation of the DNA and inactivate many dangerous pathocers that may be found ir liquid blood samples or dried biclogical stains Because the cards are small in size approximately 3 5 x 5 they are easily packaged shipped and stored for databasing lt Previous Page Next Page gt Source http www nfstc org pdi Subjecto3 pdi_so3_mo4_02 d htm Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 48 Product Overviow Test Label N Test Format ImmunoStrip Capture Reagent Polyclonal Detection Reagent Monoclona Intended Use The Phytophthora ImmunoStrip is designed for on site testing of plant tissues Suspected of infecton with Phytophthora species The test is recommended for use as a preliminary screening tool in survey programs for Phytophthora species such
27. e 37 IAC DNA is a mix of genomic DNA trom the E coli host and the gfp containing plasmid DNA PCR program 2 min 50 C 10 min 95 C 40 cycles 95 C 15sec 60 sec 60 C Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 38 12 plex Microsatellite SSR Genotyping of Phytophthora infestans Microsatellites can be used for genotyping lineages of P infestans Li and Cooke 2013 have developed a protocol that multiplexes 12 diagnostic SSR primer sets in a single tube for more rapid analysis and genotyping The protocol uses fluorescently labeled primers which can then be read by a capillary analyzer for analysis This protocol is optimized for use with an ABI 3730xl DNA analyzer with a 5 dye set 6 FAM VIC NED PET and LIZ size standard The following protocol is from Li and Cooke with modifications implemented by the lab of Bill Fry at Cornell University Li Y Cooke D E L Jacobsen E van der Lee T 2013 Efficient multiplex simple sequence repeat genotyping of the oomycete plant pathogen Phytophthora infestans Journal of Microbiological Methods 92 316 322 Primers 5 3 bp PiG11 NED 130 206 FwdNED TGCTATTTATCAAGCGTGGG Rev GTTTCAATCTGCAGCCGTAAGA Pio2 NED 255 275 FwdNED ACTTGCAGAACTACCGCCC Rev GTTTGACCACTTTCCTCGGTTC Rev GTTTAGACAATTGTTTTGTGGTCGC moat moan s Rev GCTCGAATTCATTTTACAGACTTG Rev GTTTACAAGATACACACGTCGCTCC Rev GTTTCACTTCGGGAGAAAGGCTTC FwdVIC AGCGGCTTACCGATGG Rev GT
28. e compound microscope to find sporangia oogonia or oospores If none are preset allow the tissue samples to continue floating in water Note Lack of mycelial growth or reproductive structures does not always rule out the presence of Pythium and Phytophthora Growth of pathogens can be influenced by temperature and light Further evaluation may be needed Identification of Pythium and Phytophthora A shared morphological characteristic of Pythium and Phytophthora spp is coenocytic hyphae lacking cross walls Most true fungi produce hyphae with septa although some true fungi also lack septa The presence of coenocytic hyphae provides evidence for Pythium and Phytophthora but in itself is not conclusive In order to make a conclusive identification reproductive structures must be observed Pythium and Phytophthora have similar sexual reproductive structures Asexual reproductive structures are sporangia and allow for an easier differentiation between Pythium and Phytophthora Sporangia of Pythium are globose to oval or may have an irregular shape while sporangia of Phytophthora are typically lemon shaped These are general characteristics that can be used to identify Pythtum and Phytophthora however diversity within each genus can make identification much more complicated Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 5 General lab protocol Stimulating sporangia formation of Phytophthora in vitro 1
29. e gel make your own calculations for the agarose to prepare 50 ml TBE 0 5X gel Dissolve the agarose in the gel and heat in the microwave be careful it is not boiling and getting out from the tube Add 5 ul of Gel Red and mix When is getting warmer close to 60 C put inside the chamber and put the comb in 4 Add buffer TBE 0 5X inside the electrophoresis chamber 5 Use 8 ul from each sample and add 2 ul of loading dye blue inside each well At the end add 6 ul of ladder molecular marker of 100 bp on the first one and annotate the order of your samples on the next table a to fo A 6 Connect the cables correctly Turn on the power and program the electric field to 90V 7 Once the blue bands get close to the inferior border close to 1cm stop the power and look at the gel under UV Light Take a picture Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 32 RFLP 1 Prepare the enzymatic mixture as follows For ig reactions SED Tango Buffer 2 Take 2 ul from the enzymatic mixture and add 8 ul from the PCR product 3 Incubate at 37 C for 1 h 4 Repeat steps 3 7 from last section Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 34 RFLP Band Patterns for 16 Species of Phutophthora Note Species 2 15 were run using a 1oobp ladder Species 16 17 were run using a 5obp ladder 8 9 10 11 12 13 14 15 Lad P cactorum P capsici P cinnamom
30. eridia or double walled oospores or asexual sporangia Pythium globose and Phytophthora lemon shaped reproductive structures Note Do not confuse protozoans which thrive on herbaceous material floating in unsterilized soil extract solution with sporangia or zoospores Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 4 Protocol from the lab of Jason H Brock and Glenn H Beard University of Georgia 2oo2 Reference Miscellaneous Publication 1o4 The Cooperative Extension Service University of Georgia College of Agricultural and Environmental Science A Simplified Technique for recovering Pythium and Phytophthora from infected plant tissue Materials needed Petri Dish Scalpel or knife Sterile water Acid Fuschin stain preferred over water Compound microscope Procedure 1 Wash the plant tissue under a gentile stream of tap water 2 Slice multiple sections of tissue from the plant Select tissue from the border of diseased and healthy areas To prevent contamination use a blade that has been flamed over a burner 3 Place the sectioned tissue in the Petri dish containing sterile water and cover 4 Leave the dish undisturbed for 24 hr Pythium and Phytophthora spp should begin producing sporangia between 24 and 48 hr after being placed in water 5 Remove one section including mycelial growth from the dish Use the scalpel or blade to macerate the tissue in the acid fuschin stain 6 Use th
31. escriptions of how to use search functions in PD and of how data can be moved from one analysis tool to another can be found in the user manual at the PD web site The BLAST tool allows for the identification of an unknown isolate by querying the sequence database in PD and GenBank using one or more of the marker sequences described above Given the comprehensive set of ITS sequences available for the archived isolates we suggest users to begin the identification process using this locus which should establish its identity at or near the species level 1 Grow single spore isolate and extract genomic DNA 2 PCR using Internal Transcribed Spacer ITS primers and conditions described below Internal transcribed spacer ITS ITS5 Amplicon length 754 834 nucleotides 18s rRNA 26s rRNA ITS4 PCR Amplification Conditions amp Primers Forward ITSS GGA AGT AAA AGT CGT AAC AAG G Position 54 32 from ITS1 region Reverse ITS4 TCC TCC GCT TAT TGA TAT GC Position 39 59 of 26s rRNA Sequencing primers same as ITS5 and ITS4 White et al 1990 n PCR Protocols a guide to methods and applications M A Innis D H Gelfand J J Sninsky amp T J White eds 315 322 Academic Press Inc New York PCR conditions Program Epicentre FailSafe PCR 2X premix F buffer 5 min 94 Primers 0 01 uM 1 min 94 Taq 2 Unit 1 min 48 35 cycles Template DNA 50 ng 1 min 72 5 min 72 3 Check for positive PCR amp
32. ese marker loci including the sequences and positions of primers used can be found in the Genetic Markers section of PD and are hyperlinked from marker names throughout the PD user interface A comprehensive phylogenetic analysis was performed using Pythium vexans as an outgroup to establish evolutionary relationships among the characterized species Blair et al 2007 in which sequences of seven loci all the markers described above except the ITS and cox regions derived from 228 isolates from 83 species were utilized The result is shown in the form of a genus wide phylogenetic tree via individual species pages in PD and will be updated periodically Sequences employed in this analysis and sequence alignments are available for downloading Data search and analysis tools in PD Fig 7 include BLAST Phyloviewer a program for building phylogenetic trees using sequences of selected isolates and Virtual Gel a program for generating expected restriction patterns for given sequences The PD also provides a customized means of storing and sharing data via the web Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 21 II Sequence Based Strain Identification The following flowchart protocol will provide a descriptive and pictorial explanation of how to use DNA sequence data along with the Phytophthora Database PD http www phytophthoradb org and GenBank search functions in order to identify new isolates Detailed d
33. est match may suggest that you have a novel species Given the intensive curation performed on the data archived in PD the first problem is unlikely but not impossible The second situation illustrates why it is often necessary to take the search process further by generating an alignment with the top closest matches and performing a base by base visual sequence comparison to determine if there are true differences If the closest match exhibits substantial sequence differences from your sequence it is possible that the unknown isolate may belong to a new species In the latter case one may sequence all or some of the seven loci used for the genus wide phylogenetic analysis Blair et al 2007 to investigate this possibility further Characterization of morphological and biological traits e g growth characteristics pathogenicity on plants will also be needed to formally describe a new species Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 23 wan Bo A BLAST Search B Sequence Alignment C Phylogenetic Tree E Marker Sequences Database JODODODI TOOND lt lt Fig 3 Overview of the functionality and data flow in PD This diagram illustrates A BLAST B Clustal W a tool that will align and illustrate a base by base comparison between your isolate and the closest matches C Phyloviewer a tool to visualize the evolutionary relationship between your isolate a
34. est possible levels af contaminating proka mgotic and eukaryotic nucleic acid PuRaTaq Reody To Go PCR Beads ore preformuloted to ensure greater reproducibility between reactions minimize pipetting steps ond reduce the potential for pipetting errors and contamination The only additional reagents required ara watar primers and template DNA The beads are Fig L PCR omplificotions were performed with tro different commercial provided predispensed into either 0 2 ml ar 0 5 ml PCR a ee pi A OERE E O tubes The 0 2 rnl tubes are also supplied in o 36 wall 8 12 ened aes ee ee ec plate format that allows individual strips of aight tubes to be stondord PCR protocol with 25 ml reactions 95 C for min followed by easily removed This flexibility allows use of either the entire 42 cycles of 95 C for 30 s 55 C for 30 s and 72 C for 1 min Reactions 96 wall plate strips of aight or individual Q 2 ml tubes ee Source https www gelifesciences com gehcls_images GELS Related 20Content Files 131 4750913712 litdoc11002607AB_20110831023628 pdf Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 50 PPEP PP Blotlu Gales and GelSreen are a new generation of fluorescent nucleic acid gel stains designed to replace te highly toxic ethidium bromide EtBr Developed by scoentisis at Bictum GalRed and GelGreen are superior io EtBr and other EiBr altematves by having a combination of low toxicity high senstivity and except
35. f Phutophthora species infecting potatoes Appl Environ Microbiol 63 1467 1475 Trout C L Ristaino J B Madritch M and Wangsomboondee T 1997 Rapid Detection of Phutophthora infestans in late blight infected tissue of potato and tomato using PCR Plant Disease 81 1042 1048 Wang H Qi M and Cutler A J 1993 A simple method of preparing plant samples for PCR Nuc Acids Res 21 4153 4154 White T J Burns T Lee S and Taylor J 1990 Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics Pages 315 322 in Innis M A Gelfand D H Sninsky J J and White T J eds PCR Protocols A guide to Methods and Applications Academic Press San Diego CA Other useful detection method papers Choi Y J Beakes G Glockling S Kruse J Nam B Nigrelli L Ploch S Shin H D Shivas R G Telle S Voglmayr H Thines M 2015 Towards a universal barcode of oomycetes a comparison of the cox1 and cox2 loci Mol Ecol Res DOI 10 1111 1755 0998 12398 Martin F N Abad Z G Balci Y Ivors K 2012 Identification and detection of Phytophthora Reviewing our progress identifying our needs Plant Disease 96 1080 1103 Miles T D Martin F N Coffey M D 2015 Development of rapid isothermal amplification assays for detection of Phytophthora spp in plant tissue Phytopathology 105 265 278 Robideau G P de Cocks A W A M Coffey M D Voglmay
36. for an isolate to mature enough to develop identifying characteristics Because time is often of the essence in identifying and assessing the potential risk of a newly isolated pathogen DNA sequence based identification is frequently used to augment and complement morphological data To serve as a baseline for identification classification and risk assessment of new Phutophthora isolates PD cataloged genotypic and phenotypic information on isolates of previously described species in a web accessible and searchable format To support the identification of new Phytophthora isolates via comparison of their sequences at one or more loci with the corresponding sequences derived from the isolates archived in PD sequence data from up to nine loci have been generated from more than 2 000 isolates from known and novel species 94 in total and deposited the data in PD so that these loci can be used for species identification Blair et al 2007 Park et al 2008 The characterized loci include the following 1 two loci in the nuclear ribosomal RNA rRNA encoding genes the internal transcribed spacer ITS regions and the 5 portion of the large subunit rRNA gene 11 nuclear genes encoding 60S ribosomal protein L10 beta tubulin enolase heat shock protein oo TigA fusion protein and translation elongation factor 1 alpha and iii a mitochondrially encoded coxII gene and spacer region between cox and coxII PCR reaction conditions for amplifying th
37. hora on horticultural crops 2015 Page 43 adgen W ALERT LF Phytophthora spp C3 A D B 2 Y k q E T ELLE Positive Negative Invalid Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 44 O FOR USE Remove a sample 3cm 4cm square part of a lesion and neighbouring tissue from the infected root leaf and add to the extraction bag on one side of the mesh B Smaller pieces of material from several parts of the plant may give better results 2 Add the contents of the extraction bottle A to the extraction bag B containing the plant sample Use the extraction device C to macerate the sample Do not add too much material to the extraction bag 3 Remove the lateral flow device D from the foil pack 4 Draw into the transfer pipette E about half of the liquid from the extraction bottle from the side of the mesh opposite to the beet sample 5 Add 2 drops to the sample well on the lateral flow device Maintain the device in a horizontal position The drops should be absorbed in about 30 seconds and a blue dye should appear in the viewing window If this does not happen add one more drop to the well Do not add any more 6 Wait until the blue control line C appears and read the test 2 3 minutes If the control line does not appear repeat the test with a new device 7 If the control line does not appear and the sample material is high in tannins and other contaminants then repeat the tes
38. i P citricola P citrophthora P drechsleri P erythrosepitica P fragariae P infestans P infestans P nicotianae P palmivora P syringae P tropicalis P meadii P boehmeriae Rapid diagnostic tools for Phutophthora on horticultural crops 2015 Lad 16 17 Lad Page 35 All Phutophthora TaqMan PCR The generic All Phytophthora TaqMan PCR will be performed with 2 ul DNA extract as published by Kox et al 2oo7 and described below Real time TaqMan PCR will be performed on the ABI75oo instrument in o6 well plates In all cases 2 ul of the DNA extract will be used in 3o ul master mix Negative controls with Milli Q water will be run as negative controls in each run Real time TaqMan PCR will be performed with TaKaRa Premix Lonza Verviers Belgium Positive or negative results will be based upon the cycle threshold Ct value number of cycles after which a positive real time PCR signal has been obtained The Cr value will be calculated by the software of the real time PCR machine AB7500 Kox Linda Heurneman Ilse Vossenberg van den Bart Beld van den Ineke Bonants Peter and Gruyter de Hans 2007 Diagnostic values and utility of immunological morphological and molecular methods for in planta detection of Phytophthora ramorum Phytopathology 97 1119 1129 Final conc Stock x1 Premix TaKaRa 1X 2x 15 ul ROX Dye II 1X 50x 0 6 ul F ITS 15Ph Phos 250nM 10 UM 0 75 ul RITS 279Ph Phos 250 nM 10 UM 0 75 ul All phy pro
39. ional stability EtEr has been the predominant dye used for nucleic acid gel staining for decades because of its low price and generally sufficsent sensitwiy However EtBr is a highly mutagenc material The safety hazard and costs associated wih decontamination and waste disposal can ukimately make the dye expensive to use For this reason altemative gel stains such as SYBR dyes have become commercially available in recent years Although these atematve dyes have reduced mutagenicity they often have to sacrifice other aspects of he dyes For example SYBR Safe has very limited sensitivity whde SYBR Green and SYBR Gold are much less stable than Et8r SYBR dyes also enter cells rapidly to stain mitochon dria and nuclear DNA making it more likely for the dyes to be toxic a high enough concentrations Indeed STBR Green is known to siromgly potentiate mutabon caused by UY fight or another mutagen Ohta et al Mutat Res 492 9102001 To make GelRed and Ge Sreen safe scientsts at Bichum used a novel yet very simpe concept reducing genotoxicity by preventing the dyes from entering living cells Wee believe that a DNA binding dye can be made non mutagenic or substantially so by denying s chance to be in contact with genomic DNA in living cells Thus we engineered the chemical struciures of GelRed and GelGreen such that the dyes are incapable of crossing cel membranes The Ames test confirmed that GelRed and GelGreen are nonmut
40. l approximately one quarter inch thick Allow the gel to solidify completely The gel should be cloudy when 1t is completely solidified This takes at least 20 minutes 4 Carefully remove the combs from the gel and place the gel into the gel rig and cover 1t with 1X TBE buffer Expected Results 1500 bp 600 bp Figure 4 Amplified PCR products from Phytophthora infestans DNA from mycelium and potato leaf tissue Lanes 1 and 6 are 100 bp ladder 2 negative no template control 3 P infestans DNA positive control 4 dried healthy potato leaf 5 dried potato leaf infected with P infestans Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 27 CTAB Extraction of Fungal DNA 1 Grow mycelia in pea broth culture 7 10 days or until sufficient mycelia 2 Harvest mycelia by vacuum filtration and freeze at 20 C 3 Add 150 ul Extraction Buffer vortex Grind mycelia with sterile Konte pestle 4 Add 150 ul Nuclei Lysis Buffer and 60 ul 5 Sarkosyl vortex to mix 5 Incubate at 65 C for 15 30 min 6 Add 1 volume 300 ul Chloroform CHCI Isoamyl Alcohol 24 1 invert to mix 7 Centrifuge 15 min 12K rpm room temperature 8 Transfer aqueous phase to a new microfuge tube Repeat chloroform extraction Centrifuge 15 min 12K rpm room temperature Q Transfer aqueous phase to a new tube To aqueous phase add o 1 volumes 3M Sodium Acetate NaOAc pH 8 0 and 2 volumes of cold 100 Ethanol
41. le to 12 5 ul Thermocycling program 1 cycle o5C 5 min 95 30 sec 30 cycles 58C 90 sec 72C 20 sec 1 cycle 60C 30 min Before loading on a DNA analyzer samples must be prepared with the LIZ size standard Applied Biosystems LIZ500 cat No 4322682 and suspended in an appropriate loading solution For use on an ABI 3730xl DNA analyzer we use highly deionized formamide hi di formamide Applied Biosystems cat No 4311320 Check with your local source for fragment analysis for preparation and submission protocols specific to their facilities Master mix for analysis preparation Reagent Volume per reaction ul Hi di formamide 10 LIZ500 size standard 0 3 Total volume per sample ul 10 3 Add 0 5 ul of template DNA to bring the total volume per sample to 10 8 ul Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 41 Detection of Phytophthora ramorum using loop mediated isothermal amplification Loop mediated isothermal amplification LAMP is a form of DNA amplification that can be run at a single temperature instead of requiring a cycling heating and cooling program As a result it can be run in either a programmable thermocycler or a water bath held at the appropriate temperature LAMP protocols are being used for the rapid diagnosis of diseases including Phytophthora The following is a protocol for detecting P ramorum based off the methods of Tomlinson et al 2007 Tomlinson J A Ba
42. lification on an electrophoresis gel purify PCR products and sequence I Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 22 4 Manually edit sequence data using appropriate program I 5 Compare target isolate sequence to other ITS sequences using the BLAST tool in PD www phytophthoradb org or GenBank http blast ncbi nlm nih gov Blast cgi I 6 Evaluate the search results Once you have submitted your target sequence the BLAST tool will compare your sequence to sequences contained in your database of choice The output you will receive will be a list of the CLOSEST but not necessarily EXACT matches for example If your sequence represents a new species you may not have an exact match In PD you will also be provided with links to individual species names and descriptions in the order of the closest matches to your submitted sequence It is important to look at the output you receive as a COLLECTIVE body of information that suggests what your isolate is most closely related to rather than a single answer consisting of the top closest match There are several reasons why this is important 1 the top closest match may be a misidentified isolate therefore using this match as a single identifier for your isolate may be perpetuating a mistake 11 even if your isolate has 99 sequence identity to an already described species several small or singular sequence differences between your isolate and the clos
43. mately 1 2 minutes You will still see fine particles of leaf in the liquid 4 Immediately transfer 3 ul of the solution with the ground leaf tissue to a new tube containing 300 ul 100 mM Tris buffer pH 8 0 use 1 10 dilution of 1M Tris HCl pH 8 0 stock from above Vortex briefly to mix or shake vigorously until tube contents are well mixed Place tube on ice 7 Repeat steps 1 6 for infected leaf tissue Sample tissue from the visible lesion on the leaf Make sure you use a clean pellet pestle to grind the sample and also a clean pipette tip each time you work with a new sample ON Ol 0 5 N NaOH 100 ml per L Formula FW 0 5 N NaOH 2g 20g NaOH 40 Add to 100 ml H20 Reference Wang H Qi M and Cutler A J 1993 A simple method of preparing plant samples for PCR Nuc Acids Res 21 4153 4154 Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 25 PCR with Ready To Go PCR beads 1 Obtain 4 tubes containing a Ready To Go PCR bead The bead contains a Taq polymerase the enzyme that catalyzes the reaction b nucleotides the building blocks of DNA c MgCl it brings more ions to the reaction solution d buffer it buffers the reaction 2 Add 13 ul sterile water and 2 ul of each primers to each tube 3 Label 4 tubes and add reagents as follows a Add 8 ul of sterile water to tube 1 b Add 8 ul of diluted DNA from the healthy potato leaf to tube 2 c Add 8 ul of diluted D
44. min Triple rinse with distilled water Blot dry and place in plastic bag Store at 4 C refrigerator overnight PART 2 Leaf Baiting and Isolation L 2 3 4 5 Remove leaves from sample blot and gently wipe soil from leaf surfaces with Set incubator temperature at 12 C both day and night Turn lights OFF Place soil or plant tissue to be baited in large gallon ZIPLOC bag Float two rhododendron leaves per soil sample one bottom side up and the other bottom side down Incubate baited leaves at 12 C in total darkness for 4 days paper towel Infected leaves will have water soaked tissue Fig 4 however the water soaking can dry out if culturing is delayed and prime isolation sites can disappear Plate water soaked sections of each rhododendron leaf onto PARP or PARPH by completely submerging leaf sections in agar Check plates for hyphal growth starting at 3 4 days up until 14 days Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 8 Methods of isolation of Phytophthora species A Introduction to methods of culture Some species of Phytophthora such as P capsici are readily cultured via simple surface disinfestation and plating on a selective media Other species such as P infestans from tomato are more recalcitrant and require passage through a living clean tomato leaf before isolation of sporangia onto antibiotic amended agar All species can be simply stored on lima bea
45. ml 2 0ml Add amendments separately in a laminar flow hood while stirring to media after sterile and cooled to 50 C Dissolve ampicillin and rifampicin in 70 ethanol and PCNB in 95 ethanol All fungicides and antibiotic stock solutions should be prepared aseptically and stored at 5 C or frozen in sterile plastic vials in aliquots for 1 liter Hymexazol is added to suppress Pythium species PCNB is used to suppress soil fungi and is useful for soil dilution plating Can use Terraclor PCNB 75 WP as an alternative to the active ingredient c Modified P oVP Corn Meal Agar Add to one liter of corn meal agar 17g L PPM Stock Use Pimaricin 10 mg L 20 mg ml 1 0ml Vancomycin 200 mg L 50mg ml 4 0ml PCNB 96ai 100 mg L 5 2mg ml 20ml Optional Hymexazol 99 5a1 25 mg L 25 1 mg ml 1 0ml Add amendments separately in a laminar flow hood while stirring to media after sterile and cooled to 50 C Dissolve PCNB in 95 ethanol All fungicides and antibiotics should be prepared aseptically and stored at 5 C or frozen in sterile plastic vials in aliquots for 1 liter Hymexazol is added to suppress Pythium species d Goodwins Media for isolation of Phytophthora infestans from plant tissue Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 10 After preparing 1o V 8 Juice Agar add Antibiotics PPM Stock Use Rifamycin 2o mg L 10mg ml 2 oml Polymixin B Sulphate 50 mg L 50 mg ml 1 0ml Ampicillin 200 mg
46. n Prepare V 8 juice broth V 8 juice 2ooml distilled water 800ml CaCO 2g Add 25oml V 8 broth to 5oocm3of vermiculite in 1 qt mason jars and autoclave for 1 hour with a vented lid plugged with foam stopper in water filled pan on two successive days Alternatively standard laboratory Erlenmeyer flasks can also be used Cool and cover lid with a plastic bag Seed vermiculite with inoculum plug of Phutophthora sp Shake after 2 or 3 weeks This vermiculite media is useful for inoculation of soil with soilborne species to conduct Koch ss postulates d Clarified V 8 Juice Agar A good medium for observing oospores Clarify V 8 juice by centrifuging at 4340 g for 10 minutes Mix 200 ml V8 supernatant CaCO 2g distilled water Soo ml and filter through Whatman 1 filter paper Then add 17g agar and autoclave Optional 2 ppm beta sitosterol 0 8ml of 25 ETOH for oospore production Add before autoclaving e V 8 Rye Agar A medium for growth of P infestans Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 12 Soak 50g rye seed nonfungicide treated in 1100m 1 distilled water at 24 C for 24 36 hours followed by autoclaving for 30 minutes Filter supernatant through 4 layers of cheesecloth adjust final volume to 1000 ml with distilled water Add 5 V 8 0 02 CaCO 2 Bacto agar Autoclave f Pea Broth Autoclave 120 g of frozen peas in 1 L of water for five minutes Filter the supernatant
47. n or corn meal agar disks in sterile water with sterile hemp seed for long term storage More elaborate and expensive cryostorage in liquid nitrogen can also be done Tooley 1988 The following methods and media are provided to assist in the isolation of a Phytophthora species in culture and are not meant to be an inclusive list Further methods can be found in Erwin and Ribeiro 1996 Gallegly and Hong 2008 and Ribeiro 1978 Contamination by bacteria is common in cultures and should be eliminated before production of asexual and sexual structures for identification Plating isolates on antibiotic amended media is useful and then transfer to nonamended V 8 or lima bean agar should be done to confirm that bacteria have been eliminated from cultures Once a clean isolate is obtained production of asexual sporangia chlamydospores and sexual structures are needed in order to proceed with morphological identification See methodologies recommended in Erwin and Ribeiro 1996 Gallegly and Hong 2008 and described briefly below for production of structures for morphological identification B Isolation Most Phytophthora species can be isolated from small pieces of infected plant tissue after surface disinfestation in 0 05 sodium hypochlorite for 3 5 minutes followed by rinsing in sterile distilled water and blotting on sterile paper towels Phytophthora species can also be baited from soil or water with rhododendron leaf disks Erwin and Ribie
48. nd related Oomycetes Fungal Gen Biol 30 17 32 Forster H M P Cummings and Coffey M D 2000 Phylogenetic relationships of Phytophthora species based on ribosomal ITS I DNA sequence analysis with emphasis on Waterhouse groups V and VI Mycol Res 104 1055 1061 Gallegy M and Hong C 2008 Phytophthora Identifying species by morphology and DNA fingerprints American Phytopathological Society Press St Paul Mn 158pp Kang S Blair J E Geiser D M Khang C Park S Gahegan M O Donnell K Luster D G Kim S H Ivors K L Lee Y Lee Y Grunwald N J Martin F N Coffey M D Veeraraghavan N Makalowska I 2006 Plant pathogen culture collections It takes a village to preserve these resources vital to the advancement of agricultural security and plant pathology Phytopathology 96 920 925 Kong P Hong C Richardson P A and Gallegly M E 2003 Single strand conformation polymorphism of the ribosomal DNA for rapid species differentiation in the genus Phytophthora Fung Gen Biol 39 238 240 Kroon L P N M Bakker F T van den Bosch G B M Bonants P J M and Flier W G 2004 Phylogenetic analysis of Phytophthora species based on mitochondrial and nuclear DNA sequences Fungal Genet Biol 41 766 82 Martin F N and Tooley P W 2003 Phylogenetic relationships among Phytophthora species inferred from sequence analysis of mitochondrially encoded cytochrome oxidase I and II genes Myc
49. nd related described species and D the Virtual Gel which displays predicted RFLP patterns from selected sequences your own and the closest sequence matches Another helpful feature of PD is that your sequence information along with the closest matches alignments phylogenetic trees and virtual gels can be stored in a personal folder E You can also restrict or share this data with personalized options III Literatures Cited Blair JE Coffey MD Park S Y Geiser DM Kang S 2007 A multi locus phylogeny for Phytophthora utilizing markers derived from complete pathogen genomes Fungal Genet Biol 45 266 277 Park J Park B Veeraraghavan N Blair JE Geiser DM Isard S Mansfield MA Nikolaeva E Park S Y Russo J Kim SH Greene M Ivors KL Balci Y Peiman M Erwin DC Coffey MD Jung K Lee Y H Rossman A Farr D Cline E Grunwald NJ Luster DG Schrandt J Martin F Ribeiro OK Makalowska I Kang S 2008 Phytophthora Database A cyberinfrastructure supporting the identification and monitoring of Phytophthora Plant Dis 92 966 972 Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 24 Quick NaOH DNA Extraction from Dried Leaf Samples 1 Using forceps or your fingers remove a piece of leaf tissue from the healthy leaf that is approximately 2 mm in diameter and place it in a clean 1 5 ml tube 2 Add 90 ul of 0 5 N NaOH 3 Grind tissue using a clean konte pestle until the sample is liquified approxi
50. nomyl 50 wp 10 mg L 10 mg ml 2 0ml Ampicillin 100ai 500 mg L 25 mg ml 20 0 ml Rifampicin 100ai 10 mg L 10 mg ml 1 0 ml Nystatin 100a1 25 mg L 25mg ml 1 0ml Hymexazol 99 5ai os mg L 25 1mg ml 1 0ml Dissolve ampicillin and rifampicin in 70 ethanol and PCNB in 95 ethanol Add separately to media after sterile and cooled to 50 C in a laminar flow hood while stirring All fungicides and antibiotics should be prepared aseptically and Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 11 stored at 5 C or frozen in sterile plastic vials in aliquots for 1 liter Hymexazol will inhibit most Pythium species 3 Growth media Most species of Phutophthora will grow on lima bean agar or V 8 juice agar a Fresh Lima Bean Agar A good general media for most species of Phutophthora Boil 200g lima beans for 30 minutes in 1 liter of water Strain through cheesecloth and bring up to 1liter Add 1g glucose and agar 17g L Autoclave Optional 2 ppm beta sitosterol 0 8ml of 25 ETOH for oospore production Add before autoclaving b V 8 CaCO Agar A good growth medium for most species and useful for sporangia formation but difficult to see through media for observation of sexual oospores V 8 juice 2ooml 800ml distilled water CaCO 2g and agar 17g L All ingredients are mixed and autoclaved for 3o minutes c V 8 Broth for Vermiculite Culture Used to prepare inoculum for soil infestatio
51. ologia 95 269 284 Mills S D Forster H and Coffey MD 1991 Taxonomic structure of Phytophthora cruptogea and P dreschsleri based on isozyme and mitochondrial DNA analysis Mycol Res 95 31 48 Park J Park B Veeraraghavan N Jung K Lee Y Blair J Geiser D Isard S Mansfield M Nikolaeva E Park S Russo J Kim S Greene M Ivors K Balci Y Peiman M Erwin D C Coffey M B Rossman A Farr D Cline E Gr nwald N J Luster D G Schrandt J Martin F Ribeiro O Makalowska I and Kang S 2008 Phytophthora Database A Forensic Database Supporting the Identification and Monitoring of Phytophthora Plant Dis 92 966 972 Ristaino J B Madritch M Trout C L and Parra G 1998 PCR amplification of ribosomal DNA for species identification in the plant pathogen genus Phytophthora Appl Environ Microbiol 68 948 954 Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 18 Ristaino J B 2012 A Lucid Key to the common species of Phytophthora Plant Disease 96 897 903 Schena L Duncan J M and Cooke D E L 2oo8 Development and application of a PCR based molecular tool box for the identification of Phytophthora species damaging forests and natural ecosystems Plant Pathology 57 64 75 Tooley P W Bunyard B A Carras M M and Hatziloukas E 1997 Development of PCR primers from Internal Transcribed Spacer region 2 for detection o
52. ols for Phytophthora on horticultural crops 2015 Page 52 Phutophthora Species ID Worksheet x DR E S Name j x S E S Morphological Identification o 4 4 r L C O E E O 5 Asexual Structures Sexual Structures _ Chlamydospores hyphae culture characteristics _Sporangia Reproductive behavior Chlamydospores Papillate Homothallic Present Semipapillate Heterothallic Absent o Nonpapillate Antheridia _ Hyphal Swellings Number apices Amphigynous S Present one CSL CS Paragynous Absent more than one jOogoniaSie Culture growth habit Caducous 3 3 3 lt om rosette yes CY OO Tnotrosette n O LT O AA Cuituregrowthrrate PedicelLength sw OS short upto5um Oogonium features not slow medium upto10um omamented long upto ltaperedbase Temperature Optimum O iwezze Sporangium shape Oospore size moderae22 28C spherical o lt 20um Y high gt 280 elipsoid 080m oo ovoid um S G O obpyrifom um o fo obturbinate od pobovoid spores OO distorted plerotic J C aperto o Sporangium base J S y O tapered fd ps A A _ AA Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 53 Phytophthora Species ID Worksheet ctd Asexual Structures Ctd o o oO Coo S S S Sporangium length dessthan45um o j 456um gt 75um S gt 5 um Sporangiophorefeatures J sympodia compound ss
53. ops 2015 Page 51 DNeasy Plant Mini Kit Print J Share For isolation of up to 30 pg total cellular DNA from plant cells and tissues or fungi m Pure DNA fre from contaminants and enzyme inhibitors m Rapid isolation of ready to use DNA m No organic extraction no ethanol precipitation The ONeasy Plant Mini Kit provides fast and easy siiica Dased DINA purification in convenient spin column format Typical yields are 3 30 yg of high quality DNA Q depending on the samples used Purification of DNA using the DNeasy Plant Mini Kit can be automated on the QlAcibe Source http www qiagen com Products Catalog Sample Technologies DNA Sample Technologies Genomic DNA DNeasy Plant Mini Kit Gentra Puregene Yeast Bact Kit A Print CJ Share For purification of archive quality DNA from yeast and Gram positive or Gram negative bacteria m Archive quality DNA for long term storage m Reproducible DNA purification e Acomplete solution for sampla lo storage punticaton m Convenient scalable purification procedure The Gentra Puregene Yeast Hact Kit enables purification of high molecular weight Q 100 200 kb DNA suitable for archiving The scalable purification procedure gently removes contaminants and inhibitors and allows samples to De purified foi use as long term references Source http www qiagen com Products Catalog Sample Technologies DNA Sample Technologies Genomic DNA Gentra Puregene YeastBact Kit Rapid diagnostic to
54. poor plant health 4 Plants showing any type of symptom e g yellowing wilting stunting dieback leaf or stem lesions root rotting may be tested Sample collection 1 Leaf lesions Collect several small areas of affected tissue Avoid leaf tissue that has dried out or that is soft and wet Note Leaf symptoms such as yellowing may indicate a problem at the stem base or roots and not a direct attack on its leaves Check the base of the plant and test tissue from it if root rot or stem lesions are found 2 Stem lesions If dark sunken areas are present on the stem scrape away bark tissue and look for discoloration taking several slivers of affected tissue If crown tissue is affected include pieces of it 3 Root rots Wash the roots thoroughly under running water to remove soil or compost and blot them dry Collect several pieces of affected root and ensure some pieces from near the crown area are included If crown tissue affected use knife to include pieces of it 4 Stembase lesions and crown rots Concentrate particularly on slivers from the stem base crown area plus several pieces of affected root Scrape away the bark tissue and look for discoloration Remove ant discoloured tissue for testing For larger plants take a 5cm length of stem or crown including discoloured tissue and cut it transversely to expose the pith and cortex Place in bag and macerate as best as possible Contact Neogen Europe Ltd for further inform
55. r H Bonants P J M Ristaino J B Chitty D Rintoul T D saulniers N Eggertson Q Bala K Gachon C M M Smith M L L vesque A 2011 DNA barcoding of oomycetes with cytochrome c oxidase subunit I COI Mol Ecol Res 11 1002 1011 Sikora K Verstappen E Mendes O Schoen C Ristaino J and Bonants P 2012 A Universal Micro array Detection Method for identification of Multiple Phytophthora Species using Padlock Probes Phytopathology 102 635 645 Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 19 Van Doorn R Slawiak M Szemes M Dullemans A M Bonants P Kowalchuk G A Schoen C D 2ooo Robust detection and identification of multiple oomycetes and fungiin environmental samples by using a novel cleavable padlock probe based ligation detection assay Applied and Environmental Microbiology 75 12 pp 4185 4193 Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 20 Protocol from the lab of Seogchan Kang Michele Mansfield and Seogchan Kang Penn State University 2008 Molecular identification of Phytophthora isolates using a DNA Sequence Based Approach I Introduction Many Phutophthora species can be difficult to identify based on morphology due to a lack of physically distinguishing characteristics and variability of morphological characteristics under different culture conditions Additionally it may take several days or weeks
56. rente and DAR and ther uses are covered by WS patent numbers 120258 7202343 and 233051 EYER Is a acemark of Molecular Frotes inc Glowing Products for Sclence A 5 min incubation B 30 min incubation Figure 4 HeLa cells were incubated sk 37 S with 1X of ETER Green STERP Safe iseliGreen and GeRied respectively images were taken following incubation for gt min panel 4 and 30 min panel B respectively SYBR Green and STERE Safe entered ir o cells spidi as evwdesk from the bight green maclar staining images from STAR Sate not shown However a ri and Gellereen were enable do cross cel membranes as shown by the lack of any fluorescence seining 1000 DSYAR Green o E Sr a 750 BGelGreer EGRE coo E 5 350 0 Di 05 I E 10 E Dose ug plate Figure 5 Gelfled and Gel6reen are norrautsgenia Comparison of mulsqenity among Sel GaRed Y SYER Green and Erin 1 frameshA Zalmonells indicator sin 1490 in dh presence of SS action STERS Green became croton at30 uginimis Fomore information dowload the GelRied and GelGreen Safely Report sk wwa biodum com Table 1 Gel Stain Product List 41003 Gar ed 10 000 in H 0 q 41003 1 GaRed 10 000 in H O 3001 Gelred SX in H 0 Source http www biotium com product product_info flyer GelRed 20 amp 20GelGreen 2 OFlyer pdf Rapid diagnostic tools for Phytophthora on horticultural cr
57. rker I Boonham N 2007 Faster simpler more specific methods for improved molecular detection of Phytophthora ramorum in the field Applied and Environmental Microbiology 73 4040 4047 Primers 5 3 CTAAAAACTTTCCACGTGAAC CTTCATCGATGTGCGAGC CTTCATCGATGTGCGAGC ISS Pram FIP TCAAGCGCTCGCCATGATAGAGTCAAAACCCTTAGTTGGGGGCT Pram BIP ACTTTTTAAACCCATTCCTAAATACTGAACATCCACTGCTGAAAGTTGC Pram F CGAAGCCAGCCGAACAGA Loop GTGGGGACGAAAGTCTCTG Loop LAMP uses a different polymerase known as Bst polymerase New England Biolabs cat No Mo275S Unlike Taq polymerase it does not require cycles of heating and cooling to amplify DNA and is suitable for isothermal PCR techniques Master Mix concentration Concentration Reaction ul buffer MgsO __ 50mM__ omM__ da 2 uM 2 uM Betaine 5M h m 6 o Bst polymerase 8U u 032U d o o amo o o s oOo Y O Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 42 Add 1 ul of DNA to 24 ul of master mix per reaction To run the reaction incubate at 65 C for an hour in either a thermocycler or a water bath and then increase to 80 C for 5 minutes to inactivate the Bst polymerase Samples can be visualized on a gel or through the use of a visual dye such as SYBR green which turns from orange to green in the presence of dsDNA Add 1ul of 1000X SYBR green directly to the product for visualization Rapid diagnostic tools for Phytopht
58. ro 1996 Larkin et al 1995 Small pieces of surface disinfested plant tissue are plated on antibiotic amended media such as TPT PAR PH or P VP media Phytophthora species are Oomycetes and have coenocytic hyphae First mycelium growing from tissue pieces should be observed for coenocytic hyphae Then proceed to observe morphological characters of asexual and asexual structures 1 Isolation Media a Triple P media TPT Add amendments to one liter of corn meal agar 17g L after autoclaved and cool PPM Stock Use Penicillin G sodium salt 50 mg L 50 mg ml 1 0ml Polymyxin B Sulfate 50 mg L 50mg ml 1 0ml Pimaricin 50ai store in dark 30 mg L 20 mg ml 3 0ml Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 9 Add amendments separately in a laminar flow hood while stirring to media after sterile and cooled to 5o C Fungicide and antibiotic stock solutions should be made in sterile bottles with sterile distilled water and stored at 5 C or frozen in sterile plastic vials in aliquots for 1 liter Pimaricin is sold under the trade name Delvocid 50ai from Nelson Jameson Inc Marshfield WI b PAR PH Media for Phutophthora Add to one liter of corn meal agar 17g L or V 8 Agar see below PPM Stock Use Pimaricin 50ai 10 mg L 20mg ml 1 0 ml Ampicillin 250 mg L 25mg ml 10 0ml Rifampicin 10 mg L 10 mg ml 1 0 ml Optional PCNB 96ai 100 mg L 5 2mg ml 20ml Hymexazol 99 5a1 50 mg L 25 mg
59. sing the PCR RFLP technique using restriction enzymes For the PCR we will use two specific primers A2 forward and I2 reverse from Drenth et al 2006 table 1 Drenth A Wagels G Smith B Sendall B O Dwyer C Irvine G Irwin J A G 2006 Development of a DNA based method for detection and identification of Phytophthora species Australasian Plant Pathology 35 147 159 Table 1 Specific primers used for the genera Phytophthora identification Primer Sequence 5 3 A2 forward ACTTTCCACGTGAACCGTTTCAA I2 reverse GATATCAGGTCCAATTGAGATGC Later we will use the PCR product to make a digestion using the Msp I enzyme PCR 1 Prepare 2 DNA samples and a negative control water each reaction will have a final volume of 25 ul Prepare the master mix according to the next table make calculations for 3 reactions A wz 3X dsHO E ATT C Buffer00X L o o dNTPs 2mMeach ou primerA2 104M ou primeri2 104M oo MgCl 50mM a Taq polymerase 5U u o4Wl J o ooo Subtotal ee Total reaction_______ 25 x 2 Close the tubes and put them in the thermocycler using the following program Initial denaturation 94 C for 5 min Rapid diagnostic tools for Phytophthora on horticultural crops 2015 Page 31 35 Cycles Denaturation 94 C for 30s Annealing 65 C for 45 s Extension 72 C for 2 min Final Extension 72 C for 10 min 3 Once the amplification is over prepare a 1 6 agaros
60. t with a diluted sample This is achieved by adding approximately 1ml from the initial extract to a fresh extraction solution bottle using the graduated transfer pipette provided Positive result intensity of the blue colour on the sample line 7 will vary depending on amount of pathogen in the sample extract If the control line is a strong blue colour then a faint sample line should be interpreted as positive Negative result the target pathogen was not present at detectable levels in the sample tested May also mean that the sample tested is not representative of the infection or that the area of sampling from the plant was only recently infected Invalid result conduct a further test with a fresh device If in doubt conduct another test If still in doubt submit a sample to a laboratory IMPORTANT INFORMATION Preservatives The extraction buffer contains sodium azide 0 05 This is a toxic substance and should be handled accordingly Avoid ingestion and contact with skin Materials Safety Data Sheet available on request A small sachet of silica gel is enclosed in each foil pouch Avoid contact with skin and keep away from children STORAGE AND HANDLING OF DEVICES Sealed foil pouches can be stored at room temperature for up to 12 months Once opened use the devices as soon as possible to avoid deterioration Each device should be used once only Take care when handling devices not to touch the test window TERMS AND CONDI
61. ytophthora on horticultural crops 2015 Page 15 PCR Protocols used in Lucid Key This PCR protocol can be used to amplify ITS sequences and the 5 end of the mitochondrial cox 1 gene BOL Barcode of Life Region to identify species of Phutophthora The primers ITS6 and ITS4 amplify both spacer regions and the 5 8S rDNA White et al 1990 Restriction digestion of the amplified ITS region with restriction enzymes can be done instead of sequencing for identification of some species Ristaino et al 1998 See further methods for use of restriction analysis fingerprints at http phytophthora id org files Phytophthora ID 20sequencing 20protocols pdf See ITS and BOL maps of gene regions amplified with primers below Master mix for each 50ul reaction Final concentration ddH20 35 25 ul 10X PCR buffer 5 ul 20 mM Tris HCl 50 mM KCl dNTPs 2mM each 2 5 ul 0 1 mM of each DNTP Primer F 10uM 2 ul 0 4 uM Primer R 10uM 2 ul 0 4 uM MgCl 50mM 1 8 ul 1 8 mM BSA 20mg ml 0 25 ul 0 1mg ml Tag 5U ul 0 2 ul 1U Add 49 ul of master mix to 1ul template DNA 5 10 ng Cycling parameters Initial denaturation 96 C 2 min 35 cycles 96 C 1 min 56 C 1 min 72 C 2 min Final extension 72 C 10 min Reagents 10X PCR buffer 200 mM Tris HCl pH 8 4 500 mM KCl amp 50 mM MgCl come with Taq DNA polymerase Invitrogen 2 mM dNTPs 300 ml Add 24 ul of dNTPs mix 100 mM Bioline to 276 ul ddH20 Primer stock soln 100 uM

Rapid Diagnostic Tools for Phytophthora on Horticultural

Contents

Download Pdf Manuals

Related Search

Related Contents