SMART RACE cDNA Amplification Kit User Manual
Contents
1. 7 ul 3 RACE CDS Primer A 3 CDS 12 uM 5 AAGCAGTGGTATCAACGCAGAGTAC T 3 V N 3 N A C G orT V A G or C 7 ul 5 RACE CDS Primer A 5 CDS 12 uM 5 T o5V N 3 N A C G orT V A G or C e 20 ul 5X First Strand Buffer 250 mM Tris HCI pH 8 3 375 mM KCI 30 mM MgCl e 20 ul Dithiothreitol DTT 20 mM 1 ml Deionized H O 5 amp 3 RACE PCR e 400 ul 10X Universal Primer A Mix UPM Long 0 4 uM 5 CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT 3 Short 2 uM 5 CTAATACGACTCACTATAGGGC 3 e 50 ul Nested Universal Primer A NUP 10 uM 5 AAGCAGTGGTATCAACGCAGAGT 3 Control Reagents 5 ul Control Human Placental Total RNA 1 ug pl e 25 ul Control 5 RACETFR Primer 10 uM e 25 ul Control 3 RACETFR Primer 10 uM Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 9 SMART RACE cDNA Amplification Kit User Manual ll List of Components continued General Reagents e 90 ul dNTP Mix dATP dCTP dGTP and dTTP each at 10 mM e 2X1 ml Tricine EDTA Buffer 10 mM Tricine KOH pH 8 5 10 mM EDTA NucleoTrap Gel Extraction Kit Cat No 636053 e 100 ul NucleoTrap Suspension 6ml Buffer NT1 6ml Buffer NT2 e 7ml Buffer NT3 concentrate 5ml Buffer NE User Manual PT3169 1 Ill Additional Materials Required The following reagents are required but not supplied e MMLV Reverse Transcriptase Please see Addendum PT3980 4 for de2. 5 m NBAAAAA gm 3 a0 i NV TTT pp m 1 5 S c T INBAAAAA 5 umr 1 3 Short UP 2 NTT y 5 Remaining rounds of PCR Amplification of 3 fragment 5 E T a 3 3 1 T T 1 5 Double stranded 3 RACE fragment Figure 6 Detailed mechanism of the 3 RACE reactions Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 37 SMART RACE cDNA Amplification Kit User Manual Appendix C Suppression PCR and Step Out PCR In our initial SMART based 5 RACE experiments we tended to observe a heavy background amplification We determined that undesired bands were produced by nonspecific priming of reverse transcriptase by the SMART Il A oligo during synthesis of the 5 RACE Ready cDNA When reverse transcription and template switching are completed these cDNAs contain the SMART sequence at both ends Figure 7 As a result RACE PCR using primers based on the SMART sequence amplifies these cDNAs in addition to the desired gene specific fragment This problem was overcome with the use of suppression PCR and step out PCR In suppression PCR Siebert et al 1995 an inverted repeat is incorporated in the ends of DNA sequences to prevent amplification during PCR The sup pression effect occurs when these inverted repeats anneal intramolecularly to form panhandle structures which cannot be amplified by PCR see the bottom of the flow chart in Figure 7 The SMART RACE Ki
3. 5 and 3 RACE sample results At Clontech we have used the SMART RACE Kit to amplify 5 and 3 RACE fragments of many different genes starting with poly A and total RNA This gel shows several representative 5 and 3 RACE amplifications starting with total RNA Lanes 1 amp 4 interferon y receptor Lanes 2 amp 5 transferrin receptor Lanes 3 amp 6 HPRT The control PCR reactions described for transferrin receptor amplification should produce the RACE products in lanes 2 amp 5 The 5 product will be 2 6 kb the 3 product will be 2 9 kb As seen here a minor 0 6 kb product will occasionally be generated in transferrin receptor 3 RACE Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual IX Rapid Amplification of cDNA Ends RACE This procedure describes the 5 RACE and 3 RACE PCR reactions that gen erate the 5 and 3 cDNA fragments We recommend that you also perform positive control 5 and 3 RACE using the TFR primers UPM and control RACE Ready cDNAs as described in Section VIII Although the Nested Uni versal Primer A NUP is provided nested PCR is generally not necessary in SMART RACE reactions Please note that all RACE PCR reactions have been optimized for use with the Advantage 2 Polymerase Mix 1 Prepare enough PCR Master Mix for all PCR reactions and one extra reaction to ensure sufficient volume The same Master M
4. Table Il Setting up the positive control RACE experiment 19 Table Ill Setting up 5 RACE PCR reactions 21 Table IV Setting up 3 RACE PCR reactions 22 Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 SMART RACE cDNA Amplification Kit User Manual l Introduction amp Protocol Overview The SMART RACE cDNA Amplification Kit provides a method for performing both 5 and 3 rapid amplification of cDNA ends RACE This kit integrates our Marathon cDNA Amplification Kit Chenchik et al 1995 1996 with our SMART Switching Mechanism At 5 end of RNATranscript cDNA synthesis technology This powerful combination allows you to isolate the complete 5 sequence of your target transcript more consistently than ever before Furthermore SMART technology eliminates the need for problematic adaptor ligation and lets you use first strand cDNA directly in RACE PCR a benefit that makes RACE far less complex and much faster Chenchik et al 1998 The SMART RACE Kit also includes advances in PCR technology that both increase the sensitivity and reduce the background of the RACE reactions As a result you can use either poly At or total RNA as starting material for constructing full length cDNAs of even very rare transcripts SMART technology provides a mechanism for generating full length cDNAs in reverse transcription reactions Zhu et al 2001 This is made possible by the joint action of the SMART
5. confusion and wasted effort in your subsequent experiments even when both RACE reactions produce single major products This analysis is especially important if you have multiple RACE products or suspect that you are working with a member of a multigene family Note on full length cDNAs No method of cDNA synthesis can guarantee a full length cDNA particularly atthe 5 end Determining the true 5 end requires some combination of RNase protec tion assays primer extension assays and cDNA or genomic sequence information Many SMART RACE cDNAs include the complete 5 end of the cDNA however severe secondary structure may block the action of RT and orTaq DNA polymerase in some instances In our experience SMART RACE products and full length cDNAs compare favorably in this regard with cDNAs obtained by conventional RACE or from libraries To obtain the maximum possible amount of 5 sequence we recommend that you sequence the 5 end of 5 10 separate clones of the 5 RACE product Clontech Laboratories Inc www clontech com Protocol No PT3269 1 8 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual ll List of Components Store Control Human Placental Total RNA and SMART II A Oligonucleotide at 70 C Store NucleoTrap Gel Extraction Kit at room temperature Store all other reagents at 20 C First strand cDNA Synthesis 7 ul SMART II A Oligonucleotide 12 uM 5 AAGCAGTGGTATCAACGCAGAGTACGCGGG 3
6. II A Oligonucleotide and the Moloney Murine Leukemia Virus Reverse Transcriptase MMLV RT The MMLV RT upon reaching the end of an RNA template exhibits terminal transferase activity adding 3 5 residues predominantly dC to the 3 end of the first strand cDNA Figure 1 The SMART oligo contains a terminal stretch of G residues that anneal to the dC rich cDNA tail and serves as an extended template for RT MMLV RT switches templates from the mRNA molecule to the SMART oligo generating a complete cDNA copy of the original RNA with the additional SMART sequence at the end Since the dC tailing activ ity of RT is most efficient if the enzyme has reached the end of the RNA template the SMART sequence is typically added only to complete first strand cDNAs This process guarantees that the use of high quality RNA will result in the formation of a set of cDNAs that have a maximum amount of 5 sequence Table Please see Addendum PT3980 4 for details on the choice of RT enzyme Poly A RNA 5 NNDADDADNDNDNDANS polyA 3 GG 5 Oligo dT primer onasida de First strand synthesis coupled with dC tailing by RT y a ai AO polyA Figure 1 Mechanism of SMART cDNA c synthesis First strand synthesis is primed using a Template switching modified oligo dT primer After reverse transcrip and extension by RT tase reaches the end ofthe mRNA template it adds y several dC residues The SMART II A Oligonucle 5 mmm GGG AAAA polyA otide
7. RACE reactions in Section IX use only a fraction of this material for each RNA of interest There is sufficient single stranded cDNA for PCR amplification of multiple genes If you intend to use LD PCR to construct your full length cDNA after complet ing 5 and 3 RACE be sure to set aside an aliquot of the 5 RACE Ready cDNA to use as a template in the PCR reaction Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 SMART RACE cDNA Amplification Kit User Manual VIII Positive Control PCR Experiment Prior to performing 5 and 3 RACE reactions with your cDNA we strongly recommend that you perform the following positive control RACE PCR ex periment using the RACE Ready cDNAs generated from the Control Human Placental Total RNA These reactions will amplify the ends of the transferrin receptor TFR cDNA This procedure can save you considerable time by ensuring that the SMART RACE protocol works with your thermal cycler If problems arise later in the protocol the results of this experiment will help you determine immediately if the problem is with your RACE PCR e g different thermal cycler or with your cDNA We recommend that you first perform SMART RACE PCR reactions using the Advantage 2 Polymerase Mix Cat Nos 639206 amp 639207 If your cDNA of interest has high GC content you can use the Advantage GC 2 Polymerase Mix Cat No 639114 or PCR Kit Cat Nos 639119 amp 63912
8. RACE is synthesized using a modified lock docking oligo dT primer and the SMART II A oligo as described above The modified oligo dT primer termed the 5 RACE CDS Primer A 5 CDS has two degenerate nucleotide positions at the 3 end These nucleotides position the primer at the start of the poly At tail and thus eliminate the 3 heterogeneity inherent with conventional oligo dT priming Borson et al 1994 The 3 RACE cDNA is synthesized using a traditional reverse transcription procedure but with a special oligo dT primer This 3 RACE CDS Primer A 3 CDS primer includes the lock docking nucleotide positions as inthe 5 CDS primer and also has a portion of the SMART sequence at its 5 end By incorporating the SMART sequence into both the 5 and 3 RACE Ready cDNA populations you can prime both RACE PCR reactions using the Universal Primer A Mix UPM which recognizes the SMART sequence in conjunction with distinct gene specific primers Positive Control RACE Experiment Section VIII Prior to performing RACE with your template we strongly recommend that you perform the positive control RACE experiment using the Control Human Placental Total RNA provided in the kit RACE PCR Reactions Section IX After you generate RACE Ready cDNAs you will have enough material to perform 5 and 3 RACE with many different genes simply by using different gene specific primers All PCR reactions in the SMART RACE protocol are optimized f
9. contents and spin the tubes briefly in a microcentrifuge Incubate the tubes at 70 C for 2 min Cool the tubes on ice for 2 min Spin the tubes briefly to collect the contents at the bottom Add the following to each reaction tube already containing 5 ul 2 ul 5X First Strand Buffer 1 ul DTT 20 mM 1 ul dNTP Mix 10 mM 1 ul MMLV Reverse Transcriptase 10 ul Total volume Please see Addendum PT3980 4 for details on the choice of RT enzyme 8 Mix the contents of the tubes by gently pipetting 9 Spin the tubes briefly to collect the contents at the bottom 10 Incubate the tubes at 42 C for 1 5 hr in an air incubator or a hot lid Oooh WH Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual VII First Strand cDNA Synthesis continued thermal cycler Note Using a water bath or thermal cycler for this incubation may reduce the volume of the reaction mixture due to evaporation and therefore reduce the ef ficiency of first strand synthesis 11 Dilute the first strand reaction product with Tricine EDTA Buffer e Add 20 ul if you started with lt 200 ng of total RNA e Add 100 ul if you started with gt 200 ng of total RNA e Add 250 ul if you started with poly At RNA 12 Heat tubes at 72 C for 7 min 13 Samples can be stored at 20 C for up to three months At this point you have 3 and 5 RACE Ready cDNA samples The
10. fragments may be due to a failure of the reverse transcription reaction you can check the quality of first strand cDNA if generated from poly A RNA using a P labeling procedure To do this repeat the first strand synthesis substituting 1ul of 0 1 uCi ul a 22P dATP or dCTP for one of the micro liters of water Run the reaction products on an alkaline agarose gel and examine the banding pattern by autoradiography If the first strand reaction was successful you should see a similar banding pattern to that produced by your RNA Mammalian poly A RNA typically pro duces a smear from 0 5 12 kb Mammalian total RNA usually exhibits two bright bands at 4 5 and 1 9 kb Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual XII References Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Borson N D Sato W L amp Drewes L R 1992 A lock docking oligo dT primer for 5 and 3 RACE PCR PCR Methods Applic 2 144 148 Chenchik A Moqadam F amp Siebert P January 1995 Marathon cDNA amplification A new method for cloning full length cDNAs Clontechniques X 1 5 8 Chenchik A Moqadam F amp Siebert P 1996 A new method for full length cDNA cloning by PCR In A Laboratory Guide to RNA Isolation Analysis and
11. the nested primers The difference in mobility of the products should correspond to the positions of the GSP and NGSP in the cDNA structure If none of the above suggestions works you may want to try repeating cDNA synthesis using a GSP or random hexamers instead of the CDS Primer provided with this kit J RACE cDNA product is smeared Note Some SMART RACE reactions produce very complex patterns of bands that appear almost as smears In most cases of true smearing a problem has occurred prior to the RACE reaction especially if the 3 RACE reaction produces a smear Smearing of only the 5 RACE reaction products may indicate a diffi cult template for reverse transcription or degraded RNA Smearing of both reactions is a strong indication of contamination of your starting RNA or a problem in reverse transcription In these cases we recom mend repeating the entire procedure after repurifying your RNA or confirming that your RNA is intact and clean See Section VI for more details Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued If smearing is apparently not due to a problem that occurred prior to RACE try optimizing your RACE reactions using the troubleshooting tips described above for multiple bands K Analyzing the quality of first strand cDNA If you suspect that problems amplifying your RACE
12. to multiple RACE fragments via at least three mechanisms e Alternative splicing can cause multiple products in 5 or 3 RACE e Use of different transcription initiation sites causes multiple 5 RACE products e Use of different polyadenylation sites causes multiple 3 RACE products Alternatively the gene may be a member of a multigene family in which case your gene specific primers may simultaneously amplify several highly homologous cDNAs Distinguishing true polymorphic forms of an RNA is a matter for sci entific investigation However you may be able to find an alternative source of RNA in which one form is more abundant than others Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 31 SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued Sources of artifacts Multiple bands often do not correspond to actual complete transcripts These artifact RACE products can be divided into two classes incom plete and nonspecific There are several possible sources of incomplete fragments which are generated from correctly primed sites Premature termination of first strand cDNA synthesis caused by RT pausing generally causes multiple 5 RACE products This problem is common with larger RNAs and is difficult to overcome because it is due to an intrinsic limitation of RT Degradation of the RNA used as starting material generally causes mu
13. we increase the extension time up to 10 min Note Figure 4 in Section VIII shows TFR sample results Clontech Laboratories Inc www clontech com Protocol No PT3269 1 22 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual IX Rapid Amplification of cDNA Ends RACE continued Program 1 preferred use if GSPT gt 70 C e 5 cycles 94 C 30 sec 72 C 3 min e 5 cycles 94 C 30 sec 70 C 30 sec 72 C 3 gt min e 20 cycles Poly A RNA OR e 25 cycles Total RNA 94 C 30 sec 68 C 30 sec 72 C 3 min If fragments gt 3 kb are expected add 1 min for each additional 1 kb Program 2 if GSPT 60 70 C e 20 cycles Poly A RNA OR e 25 cycles Total RNA 94 C 30 sec 68 C 30 sec 72 C 3 gt min If fragments gt 3 kb are expected add 1 min for each additional 1 kb 6 Optional If the primary PCR reaction fails to give the distinct band s of interest or produces a smear you may wish to perform a Southern blot using a A cDNA probe b A nested primer as a probe Or you may wish to perform a secondary or nested PCR reaction using the NUP primer supplied and a NGSP See the discussion in Section V a Dilute 5 ul of the primary PCR product into 245 ul of Tricine EDTA buffer b Repeat Steps 1 5 above using e 5 ul of the diluted primary PCR product in place of the RACE Ready cDNAs e 14ul ofthe NUP primer and 1 ul of your nested GSPs e 15 20 cycles of Progra
14. which are then sold to third parties or 3 constructing databases which are then sold to third parties Reproduction amplification modification reformulation or resale of the reagents provided in PCR Select products is not permitted For information on licensing PCR Select for commercial purposes please contact a licensing representative by phone at 650 919 7320 or by e mail at licensing clontech com NucleoBond and NucleoTrap are registered trademarks of MACHEREY NAGEL GmbH amp Co K G GeneAmp is a registered trademark of Applera Corporation or its subsidiaries in the US and or certain other countries Clontech the Clontech logo and all other trademarks are the property of Clontech Laboratories Inc unless noted otherwise Clontech is aTakara Bio Company 2007 Clontech Laboratories Inc Clontech Laboratories Inc www clontech com Protocol No PT3269 1 40 Version No PR782357
15. 0 for subsequent analysis For applications in which the highest fidelity prod uct is desired the Advantage HF 2 PCR Kit Cat Nos 639123 amp 639124 can amplify templates up to 3 5 kb For more information see Section XI Troubleshooting Guide 1 Prepare enough Master Mix for all PCR reactions and 1 extra reac tion to ensure sufficient volume For each 50 yl PCR reaction mix the following reagents 34 5 ul PCR Grade Water 5 ul 10X Advantage 2 PCR Buffer 1 ul dNTP Mix 10 mM in SMART RACE or Advantage 2 PCR Kit 1 ul 50X Advantage 2 Polymerase Mix 41 5 ul Total volume 2 Mix well by vortexing without introducing bubbles then briefly spin the tube in a microcentrifuge 3 Prepare PCR reactions as shown in Table Il Add the components to PCR tubes in the order shown and mix gently Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual VIII Positive Control PCR Experiment continued TABLE II SETTING UP THE POSITIVE CONTROL RACE EXPERIMENT Tube No 1 2 3 4 Description 5 RACE 3 RACE Internal Internal Control Control Control Control Component 5 cDNA 3 cDNA Control 5 RACE Ready cDNA 25ul 25m Control 3 RACE Ready cDNA 25w 254 S RACETFR Primer iow tH a 1m _ S RACETFR Primer wou om o 1 _ wmon f o fe fT Cd mw o o Too oo a a 4 Overlay the contents of each tube wi
16. 1 Poly A RNA samples from mammalian cells should produce smears from 0 5 12 kb with much weaker ribosomal RNA bands Size distribution may be smaller with nonmammalian tissue sources Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 SMART RACE cDNA Amplification Kit User Manual VII First Strand cDNA Synthesis The two 10 ul reactions described below convert 50 ng 1 ug of total or poly A RNA into RACE Ready first strand cDNA We recommend that you use poly A RNA whenever possible However if you have less than 50 ug of total RNA we do not recommend purification of poly At RNA because the final yield will be too small to effectively analyze the RNA quantity and quality For optimal results use 1 ug of poly A RNA or 1 ug of total RNA in the reactions below We strongly recommend that you perform a positive control cDNA syn thesis using the included Human Placental Total RNA in addition to your experimental reactions This cDNA will be used in the positive control RACE reactions in Section VIII 1 Combine the following in separate microcentrifuge tubes For preparation of For preparation of 5 RACE Ready cDNA 3 RACE Ready cDNA 1 3yul RNA sample 1 3 ul RNA sample 1 ul 5 CDS primer A 1 ul 3 CDS primer A 1 ul SMART IIA oligo at the control synthesis use 1 ul of Control Human Placental Total RNA 1 yg ul Add sterile H O to a final volume of 5 ul for each reaction Mix
17. 373 9377 Frohman M A Dush M K amp Martin G R 1988 Rapid production of full length cDNA from rare transcripts Amplification using a single gene specific oligonucleotide primer Proc Natl Acad Sci USA 85 8998 9002 Kellogg D E Rybalkin l Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TaqStart Antibody Hot start PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase BioTechniques 16 1134 1137 Matz M Lukyanov S Bogdanova E Diatchenko L amp Chenchik A 1999 Amplification of cDNA ends based on template switching effect and step out PCR Nucleic Acids Res 27 6 1558 1560 Roux K H 1995 Optimization and troubleshooting in PCR PCR Methods Applic 4 5185 5194 Sambrook J amp Russell D W 2001 Molecular Cloning A Laboratory Manual Third Edition Cold Spring Harbor Laboratory Cold Spring Harbor NY Siebert P D Chenchik A Kellogg D E Lukyanov K A amp Lukyanov S A 1995 An improved method for walking in uncloned genomic DNA Nucleic Acids Res 23 6 1087 1088 Zhu Y Y Machleder E M Chenchik A Li R amp Siebert P M 2001 Reverse transcriptase template switching ASMART approach for full length cDNA library construction BioTech niques 30 892 897 Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 35 SMART RACE cDNA Amplification Kit User Man
18. 50 70 GC e T 265 C best results are obtained ifT gt 70 C enables the use of touchdown PCR The relationship of the primers used in the SMART RACE reactions to the template and resulting RACE products is shown in detail in Figure 3 For the complete SMART RACE protocol you will need at least two GSPs an antisense primer forthe 5 RACE PCR and a sense primer forthe 3 RACE PCR If you are doing only 5 or 3 RACE you will only need one GSP All primers should be 23 28 nt long there is generally no advantage to using primers longer than 30 nt The primers shown in Figure 3 will create overlapping 5 and 3 RACE products If a suitable restriction site is located in the region of overlap the fragments can subsequently be joined by restriction digestion and ligation to create the full length cDNA By designing primers that give a 100 200 bp overlap in the RACE products you will also be able to use the prim ers together as a positive control for the PCR reactions However it is not absolutely necessary to use primers that give overlapping frag ments In the case of large and or rare cDNAs it may be better to use primers that are closer to the ends of the cDNA and therefore do not create overlapping fragments Additionally the primers themselves can overlap i e be complementary GSPs should have a GC content of 50 70 and aT of at least 65 C whenever possible theT should be greater than 70 C as determined by nearest neigh
19. A Figure 4 in Section VIII shows the expected results of 5 and 3 RACE using these positive controls e Tube No 3 An additional positive control using both GSPs to amplify the overlapping segment of your 5 and 3 RACE frag ments if available This reaction should give a single band cor responding to the overlap between the primers and confirms that your target cDNA is present in and can be amplified from your RACE Ready cDNA If you do not have suitable 5 and 3 GSPs i e GSPs that create overlapping 5 and 3 RACE products use the control 5 and 3 RACE TFR Primers with 5 ul of your positive control RACE Ready cDNAs if human e Tube No 4 A negative control using the UPM alone to amplify yourcDNA With fewerthan 40 cycles this reaction should produce no product If this control produces a smear or ladder of extra bands you may need to alter the cycling parameters or perform a secondary amplification using the Nested Universal Primer A e Tube No 5 A negative control using each GSP by itself This control should produce no product If this control produces a smear or ladder of extra bands you may need to alter the cycling param eters perform a secondary amplification using nested primers or redesign your original primers Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued B General
20. PCR Problems e Troubleshooting GC rich templates If the PCR product especially your 5 RACE product is not the expected size or is absent the cause may be a GC rich template Clontech offers the Advantage GC 2 Polymerase Mix Cat No 639114 and PCR Kit Cat Nos 639119 amp 639120 for efficient amplification of GC rich templates However the master mixes will need to be modified and PCR parameters may need to be optimized for these templates For more information please see the Advantage GC 2 PCR User Manual PT3316 1 Perform the initial RACE reactions with the Advantage 2 Polymerase Mix then perform the RACE reactions using the Advantage GC 2 Polymerase Mix to confirm that the product is the same size in both reactions e High fidelity PCR If you are going to use your cloned RACE products for further analysis we recommend that you generate your full length cDNA using the Advantage HF 2 PCR Kit Cat No 639123 This kit is designed to yield products of less than 3 5 kb with fidelity comparable to the leading high fidelity polymerase Again the initial RACE reactions should be performed using the Advantage 2 Polymerase Mix to confirm that the product is pres ent and that the GSPs work well e Troubleshooting touchdown PCR When troubleshooting touch down PCR begin by modifying the final set of cycle parameters i e the 20 25 cycles performed with annealing at 68 C If you do not observe an amplified product after the mini
21. SMART RACE cDNA Amplification Kit User Manual Cat No 634914 PT3269 1 PR782357 Published 27 August 2007 SMART RACE cDNA Amplification Kit User Manual Table of Contents I Introduction amp Protocol Overview 4 ll List of Components 9 Ill Additional Materials Required 10 IV General Considerations for SMART RACE Amplification 11 V Primer Design 12 VI Preparation amp Handling of Total and Poly At RNA 15 VII First Strand cDNA Synthesis 16 VIII Positive Control PCR Experiment 18 IX Rapid Amplification of cDNA Ends RACE 21 X Characterization of RACE Products 24 XI Troubleshooting Guide 27 XII References 35 Appendix A Detailed Flow Chart of 5 RACE 36 Appendix B Detailed Flow Chart of 3 RACE 37 Appendix C Suppression PCR and Step Out PCR 38 Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual Table of Contents continued List of Figures Figure 1 Mechanism of SMART cDNA synthesis Figure 2 Overview of the SMART RACE procedure 6 Figure 3 The relationship of gene specific primers to the cDNA template 13 Figure 4 5 and 3 RACE sample results 20 Figure 5 Detailed mechanism of the 5 RACE reactions 36 Figure 6 Detailed mechanism of the 3 RACE reactions 37 Figure 7 Mechanisms of suppression PCR and step out PCR 39 List of Tables Table I Additional 5 RACE sequence obtained with SMART technology 5
22. Synthesis Ed Krieg P A Wiley Liss Inc pp 273 321 Chenchik A Zhu Y Diatchenko L Li R Hill J amp Siebert P 1998 Generation and use of high quality cDNA from small amounts of total RNA by SMART PCR In RT PCR Methods for Gene Cloning and Analysis Eds Siebert P amp Larrick J BioTechniques Books MA pp 305 319 Cheng S Fockler C Barnes W M amp Higuchi R 1994 Effective amplification of long targets from cloned inserts and human genomic DNA Proc Natl Acad Sci USA 91 5695 5699 Chou Q Russell M Birch D Raymond J amp Bloch W 1992 Prevention of pre PCR misprim ing and primer dimerization improves low copy number amplifications Nucleic Acids Res 20 1717 1723 D aquila R T Bechtel L J Videler J A Eron J J Gorczyca P amp Kaplan J C 1991 Maxi mizing sensitivity and specificity by preamplification heating Nucleic Acids Res 19 3749 Don R H Cox P T Wainwright B J Baker K amp Mattick J S 1991 Touchdown PCR to circumvent spurious priming during gene amplification Nucleic Acids Res 19 4008 Farrell Jr R E 1993 RNA Methodologies A Lab Guide for Isolation and Characterization Academic Press San Diego CA Freier S M Kierzek R Jaeger J A Sugimoto N Caruthers M H Neilson T amp Tumer D H 1986 Improved free energy parameters for predictions of RNA duplex stability Proc Natl Acad Sci USA 83 9
23. ails As noted above we recommend using primers withT s gt 70 C to allow you to use the touchdown cycling programs in the protocol Non touchdown cycling programs are also included for use with primers withT s lt 70 C D Nested Primers We recommend that you do not use nested PCR in your initial experiments The UPM Primer and a GSP will usually generate a good RACE product with a low level of nonspecific background However Southern blotting with nested GSPs NGSP1 and Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 13 SMART RACE cDNA Amplification Kit User Manual V Primer Design continued NGSP2 as probes is useful for characterizing your RACE prod ucts Furthermore nested PCR may be necessary in some cases where the level of background or nonspecific amplification in the 5 or 3 RACE reaction is too high with a single GSP In nested PCR a primary amplification is performed with the outer primers and if a smear is produced an aliquot of the primary PCR product is reampli fied using the inner primers The SMART RACE protocols include op tional steps indicating where nested primers can be used The Nested Universal Primer A provided with the kit can be used for both 5 and 3 RACE Nested gene specific primers should be designed according to the guidelines discussed above If possible nested primers should not overlap with the outer gene specific primers if
24. anneals to the tail of the cDNA and serves ee CC ____ _ as an extended template for MMLV RT Clontech Laboratories Inc www clontech com Protocol No PT3269 1 4 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual l Introduction amp Protocol Overview continued Following reverse transcription the first strand cDNA is used directly in 5 and 3 RACE PCR reactions without the need for tedious second strand synthesis and adaptor ligation The incorporation of SMART technology also permits the use of universal priming in the RACE PCR amplification This method along with the techniques of suppression PCR and step out PCR ensure high specificity in amplifying your target CDNA These methods are described in detail below and in Appendix C The only requirement for SMART RACE cDNA amplification is that you know at least 23 28 nucleotides nt of sequence information in order to design gene specific primers GSPs for the 5 and 3 RACE reactions Additional sequence information will facilitate analysis of your RACE products This limited requirement makes SMART RACE ideal for characterizing genes identified through diverse methods including cDNA subtraction differential display RNA fingerprinting ESTs library screening and more SMART RACE cDNA amplification is a flexible tool many researchers use this kit in place of conventional kits to amplify just the 5 or 3 end of a particular cDNA Others p
25. bor analysis Freier et al 1986 we use the Primer Pre mier software to calculateT s In our experience longer primers with annealing temperatures above 70 C give more robust amplification in RACE particularly from difficult samples T s over 70 C allow you to use touchdown PCR Section C below Additionally designing GSP1 and GSP2 so that they have similar T s will facilitate their use in the SMART RACE protocol T s of GSP1 and GSP2 can be calculated or determined experimentally by performing PCR at different tempera tures Avoid using self complementary primer sequences which can fold back and form intramolecular hydrogen bonds Similarly avoid primers that have complementarity to the primers in the Universal Primer Mix particularly in their 3 ends See Section Il for UPM primer sequences Note Do not incorporate restriction sites into the 5 ends of the 5 and 3 GSPs In our experience these extra sequences can lead to increased background Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual V Primer Design continued Region of overlap it mm Region to be amplified by 5 RACE Region to be amplified by 3 RACE i GSP2_ NGSP2 i 5 AVIS NNAAAAA 3 z i INNTTTIT 5 NGSP1 GSP1 Generalized first strand cDNA Figure 3 The relationship of gene specific primers to the cDNA template T
26. cally primed PCR If bands are real i e the result of correct priming they should be slightly smaller in the reaction using the nested gene specific primers The difference in mobility of the products should correspond to the positions of the outer and inner nested gene specific primers in the cDNA structure If you have multiple bands with UPM and GSP1 or GSP2 some may disappear upon amplification with UPM and NGSP1 or NGSP2 Note Do not use the Nested Universal Primer A NUP in these reactions because it will cause a size decrease in all of the PCR products B Southern Blot Analysis You can obtain stronger confirmation of your RACE products by prob ing a Southern blot with an internal gene specific probe usually one of your other GSPs or NGSPs This method can be particularly useful for determining which bands are real when RACE produces multiple bands Multiple bands are more common with 5 RACE than with 3 RACE 1 Examine your RACE products on an agarose EtBr gel 2 Photograph the gel then transfer the DNA to a nylon membrane using standard blotting procedures 3 Prepare a hybridization probe that does not have sequences incom mon with GSP1 or GSP2 The probe can be end labeled NGSP1 Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual X Characterization of RACE Products continued or NGSP2 Alternatively if yo
27. cycles You may have to optimize the PCR program for your thermal cycler If these steps do not resolve the problem it may be that the cDNA synthesis and or template switch ing reaction has failed In this case try repeating the cDNA synthesis reactions You may wish to analyze the quality of your first strand cDNA using the procedure described below in Section XI K H Using your experimental cDNA sample no 5 or 3 RACE bands are produced but the TFR positive control RACE reactions Tube No 2 give the expected products e Your gene may not be abundant in your RNA sample Perform 5 more PCR cycles at the 68 C annealing temperature Repeat these additional cycles until your RACE fragments appear but do not exceed 50 cycles for touchdown PCR or 40 cycles for non touch down PCR If you still fail to produce the expected products you may have to find a new source of RNA in which your gene is more abundant e The annealing temperature is too high for your primers Lower the annealing temperature by increments of 2 C e Your primers are not suitable for PCR Check them against the criteria in Section V and design new ones if necessary Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued e The structure of the gene is difficult for PCR due to secondary con formations or high GC content Try redesigning your
28. een with cDNA made from the positive control placental RNA Your RNA may be partially degraded or may contain impurities Check the quality of your RNA against the criteria described in Section VI E No band is observed using GSP1 GSP2 but the correct product is seen using TFR1 TFR2 e This problem can be caused by the impeding of RT by strong secondary structure and or high GC content in your gene This is especially indicated if the 3 RACE does work the 5 RACE does not work and the positive control GSP1 GSP2 does not produce the expected fragment See Section XI B of the Troubleshooting Guide for help with GC rich templates Additionally you may wish to analyze the quality of your first strand cDNA using the procedure described below in Section XI K Your gene may be expressed weakly or not at all in your starting RNA You may have to find a new source of RNA The efficiency of both 5 and 3 RACE amplifications depends on the abundance of the target transcript There is a problem with your primers This could be due either to poor primer design or poor primer preparation First try lowering your annealing extension temperature If this does not work you may need to design new primers or repurify your GSPs You may be able to obtain more information by amplifying the internal fragment with GSP1 and GSP2 using genomic DNA as the template If the expected band is produced your primers are suitable and the problem is eith
29. er a the target RNA is a poor template for RT or Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued b the RNA is not expressed in the tissue source you have chosen Note however that this test is not conclusive since your primers may be separated by an intron in the genomic DNA If this is the case am plification of genomic DNA will give a larger fragment than expected or no fragment at all F The 3 RACE works but the 5 RACE does not in both experimental and TFR amplification e This is often the result of a failure in full length cDNA synthesis and or the template switching reaction Try repeating the first strand synthesis reaction You may wish to analyze the quality of your first strand cDNA using the procedure described below in Section XI K e MMLV RT Please see Addendum PT3980 4 for details on the choice of RT enzyme e Your RT may be degraded This can happen if MMLV RT is not kept on ice at all times or if it is not returned to the freezer promptly after use G No bands are observed in any RACE reactions using either gene specific or positive control primers with either experimental or control RNA samples If you still do not observe RACE products after 25 30 cycles of PCR especially in both 5 and 3 RACE reactions return the tubes to your PCR machine and perform 5 additional
30. ere optimized using the Advantage 2 Polymerase Mix which contains TaqStart Antibody for automatic hot start PCR Kellogg et al 1994 Hot start can also be performed using wax beads Chou et al 1992 or manually D Aquila et al 1991 We recommend the Tricine EDTA Buffer provided in the kit for resus pending and diluting your DNA samples throughoutthis protocol Tricine buffers maintain their pH at high temperature better than Tris based buffers Tris based buffers can lead to low pH conditions that degrade DNA Wear gloves throughout to protect your RNA samples from nucleases Resuspend pellets and mix reactions by gently pipetting the solution up and down or by tapping the bottom of the tube Then spin the tube briefly to bring all contents to the bottom Perform all reactions on ice unless otherwise indicated Add enzymes to reaction mixtures last Use the recommended amounts of enzyme These amounts have been carefully optimized for the SMART RACE amplification protocol and reagents Ethidium bromide is a carcinogen Use appropriate precautions in han dling and disposing ofthis reagent For more information see Molecular Cloning A Laboratory Manual by Sambrook amp Russell 2001 Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 SMART RACE cDNA Amplification Kit User Manual V Primer Design A Primer Sequence Gene Specific Primers GSPs should be e 23 28 nt e
31. erform both 5 and 3 RACE and many then go on to clone full length cDNAs using one of the two methods described in the latter part of this protocol In many cases researchers obtain full length cDNAs without ever constructing or screening a cDNA library TABLE ADDITIONAL 5 RACE SEQUENCE OBTAINED WITH SMART TECHNOLOGY Size of Additional Matches Includes mRNA kb sequence genomic transcription Human gene bp sequences start site a actin n a not available Compared to GenBank cDNA sequence Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 5 SMART RACE cDNA Amplification Kit User Manual l Introduction amp Protocol Overview continued Poly A or Total RNA Standard first strand cDNA synthesis Section VII SMART first strand cDNA synthesis Section VII 1 2 Days Tag 5 RACE Ready cDNA 3 RACE Ready cDNA 5 RACE PCR 3 RACE PCR Section IX Section IX 5 RACE fragment 3 RACE fragment Clone and sequence RACE fragments Section X Cloned RACE fragments Conventional Cloning End to end PCR Full length cDNA Figure 2 Overview of the SMART RACE procedure Detailed flow charts of the SMART RACE mechanisms can be found in Appendices A amp B Note that with the cloned RACE fragments you can use a restriction site in an overlapping region to con
32. experimental UPM 108 oser GSP 00 uM Control 3 RACE TFR Primer 10 uM C 41 5 ul 50 ul Skip this reaction if your RNA is nonhuman t Skip this reaction if your GSPs will not create overlapping RACE fragments For detailed descriptions of the control reactions see Section XI 4 Overlay the contents of each tube with 2 drops of mineral oil and place caps firmly on each tube Note Mineral oil is not necessary if you are using a hot lid thermal cycler 5 Commence thermal cycling using one of the following programs both programs 1 and 2 work with the positive control 5 and 3 RACE TFR and UPM Primers Be sure to choose the correct number of cycles as noted based on whether you started with poly At or total RNA Notes on cycling Because the necessary number of cycles depends on the abundance of the tran script you may need to determine the optimal cycling parameters for your gene empirically Run 20 or 25 PCR cycles first as described and analyze 5 ul from each tube along with appropriate DNA size markers on a 1 2 agarose EtBr gel If you see weak bands or no bands return the tube s to your PCR machine and perform five additional cycles according to the third set of cycles for touchdown PCR The optimal extension time depends on the length of the fragment being amplified We typically use 3 min for cDNA fragments of 2 4 kb For 0 2 2 kb targets we reduce the extension time to 2 min For 5 10 kb targets
33. his diagram shows a generalized first strand cDNA template This RNA DNA hybrid does not precisely represent either the 5 RACE Ready or 3 RACE Ready cDNAs For a detailed look at those structures see Appendices A amp B Note that the gene specific primers designed here produce overlapping RACE products This overlap permits the use of the primers together in a control PCR reac tion Additionally if a suitable restriction site is located within this region it will be possible to construct the full length cDNA by subcloning B Location of Primer Sequences within Gene We have had good success using the SMART RACE Kit to amplify 5 and 3 cDNA fragments that extend up to 6 5 kb from the GSP sites Nevertheless for optimum results we recommend choosing your prim ers so that the 5 and 3 RACE products will be 2 kb or less C Touchdown PCR We have found that touchdown PCR Don et al 1991 Roux 1995 significantly improves the specificity of SMART RACE amplification Touchdown PCR uses an annealing temperature during the initial PCR cycles that is higher than theT of the Universal Primer If theT of your GSP is gt 70 C only gene specific synthesis occurs during these cycles allowing a critical amount of gene specific product to accumu late The annealing temperature is then reduced to a level compatible with the UPM permitting efficient exponential amplification of the gene specific template See Appendices A C for more det
34. irect and less subject to com plications or artifacts With cloning it is possible to join 5 and 3 cDNA fragments derived from two different transcripts this could occur with two different forms of a polymorphic RNA or with transcripts from a multigene family In contrast with end to end PCR the 5 and 3 end primers will amplify a single cDNA without the possibility of generat ing a hybrid Virtually all cDNAs are within the range of LD PCR Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide Optimizing your 5 and 3 RACE reactions is generally advisable and often necessary This process usually consists of improving the yield of your de sired fragment s while decreasing the amount of background or nonspe cific and or incomplete bands in your RACE reactions The cDNA synthesis protocols contained in this User Manual typically produce enough 5 and 3 RACE Ready cDNA for 100 or more RACE PCR reactions Thus there is plenty of material for optimizing your RACE amplifications A Control PCR Reactions Tables III and IV in the User Manual describe several control reactions that will help you troubleshoot the reactions if yields are suboptimal These include e Tube No 2 5 or 3 RACE PCR using the positive control TFR Primer the UPM Primer Mix and the 5 and 3 RACE Ready cDNA made from your experimental RN
35. ix can be used for both 5 and 3 RACE reactions For each 50 ul PCR reaction mix the following reagents 34 5 ul PCR Grade Water 5 ul 10X Advantage 2 PCR Buffer 1 ul dNTP Mix 10 mM 1 ul 50X Advantage 2 Polymerase Mix 41 5 ul Total volume 2 Mix well by vortexing without introducing bubbles then briefly spin the tube in a microcentrifuge 3 For 5 RACE prepare PCR reactions as shown inTable Ill For 3 RACE prepare PCR reactions as shown in Table IV Add the components to 0 5 ml PCR tubes in the order shown and mix gently TABLE Ill SETTING UP 5 RACE PCR REACTIONS 2 3 4 5 5 RACE 5 TFR GSP 1 2 UPM only GSP1 only Component Sample Control Control Control Control 5 RACE Ready cDNA 2 5 ul 2 5 ul experimental UPM 0X sero 1m a GSP2 10 pM Ee aa Control 5 RACETFR Primer 10 uM 2 41 5 ul 41 5 ul 41 5 ul 41 5 ul Skip this reaction if your RNA is nonhuman t Skip this reaction if your GSPs will not create overlapping RACE fragments For detailed descriptions of the control reactions see Section XI Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 21 SMART RACE cDNA Amplification Kit User Manual IX Rapid Amplification of cDNA Ends RACE continued TABLE IV SETTING UP 3 RACE PCR REACTIONS 3 4 5 3 TFR GSP 1 2t UPM only GSP2 only Component Control Control Control Control 3 RACE Ready cDNA 2 5 ul
36. ltiple 5 RACE products Difficulty in amplifying certain genes can cause multiple products in either 5 or 3 RACE and is often a result of high GC content Nonspecific RACE products arise from nonspecific binding of the primer to multiple sites in the ds cDNA or primer dimer artifacts Suggestions If you have not already done so repeat your RACE reactions with all of the recommended controls In particular be sure that your GSPs do not give bands when used alone and that they give a single band when used together If either GSP alone gives persistent bands we recommend altering the cycling parameters or design ing nested primers as discussed below Also repeat the Positive Control RACE PCR Experiment Repeat your reactions using 5 ul of a 5 10 fold lower dilution of the RACE Ready cDNA If you have not already done so examine the size distribution of your RNA starting material as discussed in Section VI If your RNA looks smaller than expected repurify your RNA and repeat cDNA synthesis If multiple bands persist try altering the PCR cycling param eters 1 Increase the stringency of your PCR by raising the annealing temperature in increments of 2 5 C In many cases bands arising from nonspecific priming will disappear while real or incomplete products will persist 2 Reduce the cycle number Again bands arising from nonspe cific priming may disappear while real or incomplete products will persist 3 Reduce the exte
37. m 2 Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 SMART RACE cDNA Amplification Kit User Manual X Characterization of RACE Products At this point we recommend that you characterize your RACE fragments and confirm that you have amplified the desired product This procedure can preventconfusion and wasted effort when you generate the full length cDNA even if you have single major products from both the 5 and 3 RACE reac tions Characterization is especially important if you have multiple bands or if you suspect that you are working with a member of a multigene family We describe three methods for characterizing RACE products A Com parison of RACE products obtained with GSPs and NGSPs B Southern blotting and C Cloning and sequencing Options A and B require nested GSPs for analyzing 5 and 3 RACE products For more detailed blotting and cloning protocols see Sambrook amp Russell 2001 or other appropriate laboratory manuals A Comparison of RACE Products Obtained with GSPs amp NGSPs Forthe 5 RACE reaction compare the products of primary amplifications performed with the UPM Mix and GSP1 to the products obtained using the UPM and NGSP1 For 3 RACE compare the products obtained from amplifications with the UPM and GSP2 to those obtained with the UPM and NGSP2 This analysis will help determine if any multiple bands are a result of correctly primed PCR or nonspecifi
38. mum number of cycles at 68 C return your tube s to the PCR machine and run five additional cycles If the product still does not appear add an additional 3 5 cycles at 68 C If you are still unsuccessful run a new PCR experiment changing the annealing temperature in the third set of cycles from 68 C to 65 C This last program is especially useful if your GSP has aT close to 70 C Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued C No band is observed in positive control amplification of the overlap ping region of RACE products either with GSP1 GSP2 or TFR1 TFR2 This control PCR reaction is very important and if this reaction fails to produce the expected internal cDNA fragment there are at least two possible explanations e There may be a problem with your polymerase mix If you are not using the Advantage 2 Polymerase Mix consider switching The SMART RACE protocol was optimized with the Advantage 2 Polymerase Mix Be sure to perform the positive control PCR experiment in Section VIII e Your cDNA synthesis reaction may have failed Repeat the first strand synthesis reaction You may wish to analyze the quality of your first strand cDNA using the procedure described below in Section XI K D No band is observed using TFR1 TFR2 with your experimental cDNA but the correct product is s
39. nsion time Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued 4 In the case of large RACE products increasing the extension time may help eliminate extra bands e If multiple bands persist try designing a new set of primers 1 Redesign your primers so that they have a T greater than 70 C and use the cycling parameters for touchdown PCR 2 We recommend that you design new primers that will give RACE products that are slightly different in size than those expected with the original primers These new primers can either be used by themselves or in combination with the original primers in nested PCR In nested PCR the product of a PCR reaction is reamplified using a second set of prim ers that is internal to the original primers This often greatly reduces the background and nonspecific amplification seen with either set of primers alone The design of nested primers is discussed in Section V 3 Prior to performing nested RACE PCR we recommend that you perform two separate primary amplifications with the UPM and either the GSP1 or NGSP1 This test will help show if multiple bands are a result of correctly primed PCR or nonspecifically primed PCR If the multiple bands are real i e the result of correct priming they should be present in both reactions but slightly smaller in the reaction using
40. or use with the Advantage 2 Polymerase Mix The Polymerase Mix is comprised of TITANIUM Tag DNA Polymerase a Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 SMART RACE cDNA Amplification Kit User Manual l Introduction amp Protocol Overview continued nuclease deficient N terminal deletion of Taq DNA polymerase plus TaqStart Antibody to provide automatic hot start PCR Kellogg et al 1994 and a minor amount of a proofreading polymerase Advantage 2 technology enables you to perform long distance PCR LD PCR reac tions with confidence that your products will have high fidelity to the original sequences Barnes 1994 Cheng et al 1994 As a result you will be able to amplify longer templates than were possible in traditional RACE procedures Characterization of RACE Products Section X Before constructing your full length cDNA we strongly recommend that you confirm amplification of the desired target You can character ize your RACE products by one or more of the following 1 comparing PCR products obtained using GSP1 and UPM to products generated with NGSP1 and UPM 2 probing a Southern blot of your PCR products with an internal gene specific probe e g labeled NGSP1 and 3 cloning and sequencing your RACE products In general we recommend that you obtain at least some sequence information Careful characterization of your RACE products at this point can prevent
41. primers closer to the ends of the cDNA or try to avoid GC rich regions if they are known For additional tips in troubleshooting GC rich sequences see Section XI B of the Troubleshooting Guide e Your gene is too long for RT and or LD PCR Design your primers as close to the ends as possible Then repeat the 5 RACE Ready cDNA synthesis using either a GSP or random hexamers to prime reverse transcription instead of the 5 CDS Primer provided I RACE product consists of multiple bands In some cases your initial experiments will produce multiple 5 and or 3 RACE products As mentioned above you will have to determine which products are real and which are artifacts While the following guidelines will help you eliminate artifacts confirmation of real and complete bands requires additional studies such as mapping of tran scription start sites intron exon structure and polyadenylation sites and genomic sequencing Multiple fragments do not mean you cannot proceed with generating the full length cDNA However you may save time in the long run if you try to eliminate nonspecific fragments by troubleshooting the reactions If multiple fragments persist and you want to proceed you should generally start with the largest fragment from each RACE reac tion because it is most likely to be a true complete RACE product Sources of real multiple RACE products Individual genes can give rise to multiple sizes of transcripts and hence
42. products if using aT7 primer 1 Gel purify the RACE product s of interest using the NucleoTrap Gel Extraction Kit Then clone the isolated fragment s directly into aT A type PCR cloning vector 2 After you have TA cloned your RACE products identify clones containing gene specific inserts by colony hybridization using a 3 P end labeled NGSP as a probe or by sequencing from your GSP For 5 RACE products we recommend picking at least 8 10 different independent clones in order to obtain the maximum amount of sequence at the 5 end Once you have identified the clones containing the largest gene specific inserts obtain as much sequence data as you can Ideally you will be able to sequence the entire open reading frame as well as the 5 and 3 untranslated regions Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 SMART RACE cDNA Amplification Kit User Manual X Characterization of RACE Products continued Options for generating full length cDNA After RACE products have been characterized by partial or complete sequencing you can generate the full length cDNA by one of two methods 1 By long distance PCR LD PCR using primers designed from the extreme 5 and 3 ends of your cDNA and the 5 RACE Ready cDNA as template 2 By cloning overlapping 5 and 3 RACE fragments using a restric tion site in the overlapping region if available In general the LD PCR method is more d
43. r used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories Inc SMART Technology is covered by U S Patent Nos 5 962 271 and 5 962 272 For Profit and Not For Profit purchasers of SMART Products are entitled to use the reagents for internal research However the following uses are expressly prohibited 1 performing services for third parties 2 identifying nucleic acid sequences to be included on nucleic acid arrays blots or in libraries or other cDNA collections which are then sold to third parties Reproduc tion modification reformulation or resale of the reagents provided in SMART Products is not permitted For information on licensing SMART Technology for commercial purposes please contact a licensing representative by phone at 650 919 7320 or by e mail at licensing clontech com Clontech PCR Select cDNA Subtraction products are covered by U S Patent Nos 5 565 340 and 5 759 822 as well as pending foreign patent applications For Profit and Not For Profit purchasers of PCR Select products are entitled to use the reagents for internal research in cluding identification of molecular markers or differentially expressed genes however the following uses are expressly prohibited 1 performing services for third parties 2 identify ing nucleic acid sequences to be included on nucleic acid arrays blots or in libraries or other cDNA collections
44. s of PCR Inverted repeat is incorporated into both ends of all SMART flanked cDNAs Inverted repeat flanked double stranded cDNA r m Suppression PCR effect _ Intramolecular hybridization of inverted repeat sequences prevents Panhandle DNA structure binding of Short Universal Primer Result No amplification Zs oe Figure 7 Mechanisms of suppression PCR and step out PCR On occasion a reverse tran scription reaction can be nonspecifically primed by the SMART II A oligonucleotide This will result in the synthesis of acDNA containing the SMART sequence at both ends Through the technique of step out PCR suppression PCR inverted repeat elements are incorporated next to all SMART sequences During PCR these inverted repeats anneal to each other in tramolecularly This rapid first order reaction out competes the second order binding of the Short Universal Primer to the cDNA As a result panhandle like structures which cannot be amplified are formed Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 39 SMART RACE cDNA Amplification Kit User Manual Notes Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale o
45. struct a full length cDNA by sub cloning Alternatively you can sequence the 5 end of the 5 product and the 3 end of the 3 product to obtain the sequences of the extreme ends of the transcript Using this information you can design 5 and 3 gene specific primers to use in LD PCR with the 5 RACE Ready cDNA as template to generate the full length cDNA Clontech Laboratories Inc www clontech com Protocol No PT3269 1 6 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual l Introduction amp Protocol Overview continued Overview of the SMART RACE cDNA amplification protocol An overview of the SMART RACE cDNA amplification is presented in Figure 2 Detailed mechanisms of the RACE reactions are provided in Appendices A amp B Primer Design Section V You must design gene specific primers for the 5 and or 3 RACE reactions GSP1 and GSP2 respectively As described nested primers NGSP1 and NGSP2 will facilitate analysis of your RACE products They can also be used for nested RACE PCR if necessary Primer design is discussed in detail in Section V Figure 3 shows the relationship of primers and template used in SMART RACE reactions First strand cDNA synthesis Section VII Since the 5 elongation benefits of SMART technology are only relevant for 5 RACE the SMART RACE Kit includes a protocol for the synthesis of two separate cDNA populations 5 RACE Ready cDNA and 3 RACE Ready cDNA The cDNA for 5
46. t uses the tech nique of step out PCR to add these inverted repeats and thus suppress the amplification of cDNA species that were synthesized by SMART II A oligo priming during reverse transcription Step out PCR uses a mixture of two primers to incorporate additional sequence at the end s of template DNA Matz etal 1999 One of these primers is exceptionally long and contains the additional sequence as a non annealing overhang The overhang sequence is incorporated into template DNA ends in the early rounds of PCR After overhang addition the second primer which is only complementary to the overhang sequence takes over and serves as an efficient primer for PCR amplification This short primer is essential because the bulky incorporation primer is inadequate for effective amplification The short primer is included at a higher concentration than the long primer so that it out competes the long primer in annealing to template DNA during PCR In this same manner the Universal Primer A Mix adds suppression PCR inverted repeat elements to ends of cDNAs in SMART RACE One of the prim ers in the mix the Long Universal Primer UP is complementary to the SMART sequence at its 3 end and also has a 5 heel of 20 bp which contains the suppression sequence Figure 7 During the early rounds of RACE PCR this primer incorporates the suppression sequence onthe 5 side of all SMART sequences present in the cDNA population As a result all cDNAs tha
47. t were correctly primed by oligo dT and only have one SMART sequence at the 3 end of the first strand cDNA will contain one suppression sequence at that end Conversely all cDNAs that were primed by the SMART IIA oligo and which were consequently flanked by the SMART sequence become flanked again by the inverted repeat and are subject to suppression PCR Therefore cDNAs that have the SMART sequence on only one end and the gene specific sequence will be amplified exclusively As described above the Short UP which is present at five times the concentration of the Long UP only contains the 5 heel sequence of the Long UP and simply serves as an efficient PCR primer after incorporation of the inverted repeat Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual Appendix C Suppression PCR and Step Out PCR continued poly At RNA 8 AN NNAAAAA 3 GG mm 46 ame algo Occasional priming of RT by the SMART II A oligonucleotide SMART WA log AU 3 RNA DNA hybrid w GBS SA NNARAAA RT template switching Creates first strand cDNA with SMART sequence at both ends SMART flanked mE G G G A 3 first strand cDNA T ma EE VV A NINAAAAN 3 5 RACE PCR 5 mm G G G SV NNAAAAA 3 Long UP ap First round of PCR Incorporation of suppression PCR inverted repeat elements by Long Universal Primer 5 mm GG es 3 Remaining round
48. tails on the choice of RT enzyme e Advantage 2 PCR Kit Cat Nos 639206 amp 639207 PCR reaction tubes Mineral oil e g Sigma Cat No M 3516 Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual IV General Considerations for SMART RACE Amplification PLEASE READ ENTIRE PROTOCOL BEFORE STARTING The cycling parameters throughout this protocol were optimized with an authorized hot lid thermal cycler the Advantage 2 Polymerase Mix and the reagents and TFR controls provided in the SMART RACE Kit The optimal cycling parameters may vary with different polymerase mixes templates gene specific primers and thermal cyclers Prior to performing 5 and 3 RACE with your experimental sample you should perform the positive control PCR experiment Section VIII These reactions which use cDNA generated from the Control Human Placental Total RNA and the Control 5 and 3 RACE TFR Primers will help determine if you need to alter the PCR program for your thermal cycler Please note that the efficiency of RACE PCR depends on the abundance of the mRNA of interest in your RNA sample Additionally different primers will have different optimal annealing extension temperatures Refer to Section XI for suggestions on optimizing PCR conditions You must use some form of hot start in the 5 RACE and 3 RACE PCR reactions The following protocols w
49. th 2 drops of mineral oil and place caps firmly on each tube Note Mineral oil is not necessary if you are using a hot lid thermal cycler 5 Commence thermal cycling using the following program for touchdown PCR e 5 cycles 94 C 30 sec 72 C 3 min e 5 cycles 94 C 30 sec 70 C 30 sec 72 C 3 min e 27 cycles 94 C 30 sec 68 C 30 sec 72 C 3 min 6 Analyze 5 ul of each sample on a 1 2 agarose EtBr gel Store the remaining 45 ul of each reaction at 20 C until you are sure the control experiment has worked Protocol No PT3269 1 www clontech com Clontech Laboratories Inc Version No PR782357 19 SMART RACE cDNA Amplification Kit User Manual VIII Positive Control PCR Experiment continued Expected results see lanes 2 and 5 of the gels in Figure 4 The 5 RACE control reaction should produce a 2 6 kb band The 3 RACE control reaction should produce a 2 9 kb band If you do not observe these bands return the tube s to your PCR machine and try cycling the remaining portion of the reaction for 5 additional cycles If you still do not see the desired product consult Section XI for troubleshooting Before you attempt 5 and 3 RACE with your primers and experimental cDNA we recommend that the positive control reactions produce single strong bands of the correct size in 42 or fewer total cycles 5 cycles annealing at 72 C 5 cycles at 70 C 32 cycles at 68 C 5 RACE 3 RACE 1 2 3 M 4 5 6 Figure 4
50. they must overlap due to limited sequence information the 3 end of the inner primer should have as much unique sequence as possible Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual VI Preparation amp Handling of Total and Poly A RNA A General Precautions The integrity and purity of your total or poly At RNA starting material is an important element in high quality cDNA synthesis The follow ing precautions will help you avoid contamination and degradation of your RNA e Wear gloves e Use freshly deionized e g MilliOQ grade H O directly without treatment with DEPC diethyl pyrocarbonate e Rinse all glassware with 0 5 N NaOH followed by deionized H O Then bake the glassware at 160 180 C for 4 9 hr e Use only single use plastic pipettes and pipette tips B RNA Isolation Clontech offers several kits for the purification of total RNA such as the NucleoBond RNA DNA Mini Kit Cat No 635945 Many procedures are available for the isolation of poly At RNA Farrell 1993 Sambrook et al 1989 C RNA Analysis We recommend that you examine your RNA by electrophoresing a sample on a denaturing formaldehyde agarose EtBr gel Mammalian total RNA typically exhibits two bright bands at 4 5 and 1 9 kb these bands correspond to 28S and 18S ribosomal RNA respectively The ratio of intensities of these bands should be about 1 2
51. ual Appendix A Detailed Flow Chart of 5 RACE i NBAAAAA 3 poly At RNA 5 ONTT 5 CDS SMART first strand synthesis SMARTA X ligo A 3 RNA DNA hybrid _w GGG Naana ai RT template switching v 5 RACE Ready cDNA 5 mmm G G G SVS NBAAAAA 3 3 m C C C INVTTTT T 4 5 RACE PCR 5 mmm G G G SV NBAAAAA 3 Long UP 3 C C Ci NVTTTTT a 5 First round of PCR Incorporation of suppression PCR inverted repeat elements by Long Universal Primer 5 et INBAAAAAg 3 GSP1 3 INV TTTTT 8 Second round of PCR ene specific synthesis _ NBAAAAA j 3 Short UP i 2 T T 1 5 Remaining rounds PCR Amplification of 5 fragment c i T 3 3 0 bE T 5 Double stranded 5 RACE fragment Figure 5 Detailed mechanism of the 5 RACE reactions Clontech Laboratories Inc www clontech com Protocol No PT3269 1 Version No PR782357 SMART RACE cDNA Amplification Kit User Manual Appendix B Detailed Flow Chart of 3 RACE poly At RNA Sew NBAAAAA 3 Standard first strand synthesis SMART II A sequence 3 RACE Ready cDNA BAA NBAAAAA 3 3 RACE PCR 5 A NBAAAAA 3 GSP2 s NVI pp n 5 First round of PCR Gene specific synthesis NBAAAAA p m3 Long UP 3 1 NV TTTTT p5 gt 5 Next rounds of PCR Incorporation of suppression PCR inverted repeat elements by Long Universal Primer
52. ur GSPs define overlapping 5 and 3 fragments GSP2 can be used as a probe to characterize your 5 RACE products and GSP1 can be used as a probe to characterize your 3 RACE products Nick translated or random primed internal restriction fragments from a previously cloned partial cDNA can also be used 4 Hybridize the probe to the Southern blot wash under moderate to high stringency conditions and expose x ray film 5 Compare the hybridization pattern to the photograph of the agarose EtBr gel Generally you will want to isolate the RACE product s that correspond s to the largest band s onthe Southern blot There may be larger RACE products that appear on the agarose gel but that do not hybridize to the gene specific probe These bands are generally due to nonspecific priming Smaller bands that hybridize to your probe may be the result of incomplete reverse transcription however you cannot exclude the possibility that some of these shorter bands are real and correspond to alternatively spliced transcripts transcripts derived from multiple promoters or other members of a multigene family 6 Once you have pinpointed the band s of interest isolate the DNA from the gel using the NucleoTrap Gel Extraction Kit provided and proceed with your experiments C Cloning amp Sequencing RACE Products Note The Universal Primer contains aT7 priming site Using a clon ing vector that contains aT7 site will generate multiple sequencing
Download Pdf Manuals
Related Search