High Definition Digital Satellite Receiver and Media
Contents
1. key to select the values There are 4 levels of 25 transparency 25 75 and 100 and 0 means no transparency function 3 Remote mode Enables to set remote mode is RC1 RC2 or RC1 2 4 Press EXIT key to draw back from the Miscellaneous Setting menu 11 1 7 Conditional Access When you enter to Conditional Access Menu you will see a screen like below 1 Conax Control conax block whether or not useableness 2 Press EXIT key to draw back from the conditional access menu 11 1 8 contact When you enter to contact menu you will see a screen like below 1 Name This item to use note provider s name Press ENTER key to enter to the selected item Press ENTER key to enter to the selected item press red button to confirm 2 Telephone This item to use note provider s telephone Press ENTER key to English enter to the contact rename menu press numeric keys input number then press red button to confirm 3 Website This item to use note provider s website Press ENTER key to enter to the contact rename menu press up down left right key to move highlight and press ENTER key to input characters then press red button to confirm 4 Press EXIT key to come back contact 11 1 9 System information When you enter to system information menu you will see a screen lick below 1 This menu to show prarameters about the STB 2 Press ENTER2. you cannot modify 22K 10 1 1 4 0 12V Optional You can use lt gt key to switch OV 12V When this item switches to 12V receiver will receive TV and radio input signal from 12V port If the item switches to OV the receiver will receive all signals from OV port 10 1 1 5 Power In Polarity item lt gt key to switch or press ENTER key to enter list for selection among OFF 13 18 13 18 13 5 18 5 and 13 5 18 5 10 1 1 6 Motor Motor In motor item you can press lt gt key to switch OFF DiSEqC 1 2 USALS Functions In Satellite item press lt key to switch satellite that you want to scan or press ENTER key to enter satellite list for selection 10 1 2 Edit TP When you enter to Transponder menu there will display the screen like below 20 1 In Transponder menu you not only can use TT ill key to select transponder but also can use Add and Delete functions e When you press GREEN key it will display New TP in Transponder menu You should set the parameters of Frequency and Symbol Rate for this new transponder The parameters of TP Frequency and Symbol Rate can set by number keys The available range are 3000713450 MHz and 1000 45000Ks s e When you press yellow key it will display Edit TP menu you could rejigger the parameters of TP e Wh
3. 720P and 1080i FAV FAVORITE To set receiver to the favorite server mode display the favorite channel FOLDER Press this button to enter the Record Manager menu directly AUDIO Red Key Audio channels setup to select audio mode Left Right Stereo Mono OPTION GREEN KEY Shows NVOD information of the current channel supports SAT Display the satellite list at normal picture ua Play Mode Select the play mode in MP3 or JPEG player 7 English USB To remove the USB Hard Disk safely TMS Time Shift Press this button to display Time Shift info bar gt Play To play the MP3 JPEG or Record files m Stop To stop the Time Shift recording or MP3 JPEG player u PAUSE Used to select the freeze function Press once to freeze the screen picture FB To start Fast Backward function gt gt FF To start Fast Forward function 41 SB No function i gt SF No function a PREV To play the former file in play list To jump the head place in timeshift playback gt gt NEXT To play the next file in play list To jump the end place in timeshift playcback English 5 Front panel POWER KEY To switch the receiver power on stand by MENU KEY Displays the Main Menu on the screen or return to the previous menu or status lt gt KEY To adjust volume level or to move cursor left or right in the menu A v KEY To change channels or to move cursor up or down in the menu OK KEY To see
4. Ben Patterson Newly leaked snapshots of a purported PlayStation Phone would appear to confirm that Sol Unknown Author Wed 27 Oct 2010 22 53 24 GMT US regulators scold Google for taking e mails AP The Federal Trade Commission is scolding Google Inc without punishing the Internet search leader for Unknown Author Wed 27 Oct 2010 21 19 35 GMT Sort Delete OK Enter RSS http us rd yahoo com dailynews rss tech http news yahoo com s ap 20101027 ap_on_hi_te us_oracle_sap_ As trial looms Oracle taking aim at HP s new CEO AP Oracle Corp CEO Larry Ellison is escalating his attacks on his friend turned foe He wlett Packard Co Page 1 1 1 Press red key to add rss web 2 Press green key to delete the rss web of highlight 3 Press up down key to move the highlight 4 Press ENTER key to display the summary of the new that highlight 5 Press EXIT key to come back 35 English 18 Trouble Shooting If you suspect there is a fault with your receiver please check the following trouble shooting guide before calling authorized service agent Warning Under no circumstances attempt to repair the receiver yourself Tampering with the receiver may result in fatal electric shock and will invalidate your warranty Settings you made in the The receiver lost power before being able to enter into standby menu have not change mode some of the Settings saved by user can be deleted partly or fully No signal T
5. 3 Name Press ENTER key to rename for the file 11 4 2 Upgrade from USB When you enter to Upgrade from USB menu you will see a screen like below 28 In this menu you can select the Upgrade type among app no channel list database app database You can select the appropriate upgrade file on Upgrade type item After you select the Upgrade type and folder press red button the receiver can upgrade automatically lf you want come back to factory default press green key English 12Menu Conditional Access 1 When you enter to Conditional Access menu you will see a screen like below Receiver provide one CA slot for user to use Receiver has build in smart card module with CONAX system By using cards in this system provided by operators it is possible to watch many scrambled channels coded in this system This menu shows detailed information about card inserted into card reader module It allows inserted according to help messages visible on the bottom of the screen Event Status Tokens Status Change CA PIN Maturity Rating About Conax CA Note All information showed in this menu and submenu are coming from inserted card In case if anything is wrong it could be card problem After inserting the card correctly at any time a message box will show on the screen with message about detecting the 29 card in card info menu all available informa
6. 5 Press FAV FAVORITE key when cursor is active in left or right window to choose actual FAV list 6 You can press EXIT key to enter full 5 Service Show the channel if you want change press ENTER key 6 Event name Show event default name you also press red key to rename it 7 Start date Show start date of event you screen playing mode can press number keys to change it 8 Start time Show start time of event you 9 3 Organizing Timer can press number keys to change it In Organizing timer menu there will display 9 End date Show end date of event you the screen like below can press number keys to change it 10 End time Show end time of event you can press number keys to change it Stop Time Repeat Mode 11 Repeat Show the event transact times press left right key to switch among once everyday a week workday weekend 12 Timer mode Type of the event it has change service and HDD record 1 You can move highlight by press TTAUI keys and press ENTER key to confirm to the desired items 2 Press color key to implement the corresponding function Delete Edit New 3 You can press EXIT key to enter full screen playing mode When you enter to timer configuration Menu you will see a screen like below English 10 Menu Installation When you enter to Installation menu there will display the screen like below FastScan Satellite 10 1
7. button to delete the server that you select Press right button to select edit icon and press ENTER button to edit the server that you select then do next When you enter to In browse server file list menu menu you will see a screen like below Press right button to select disconnect icon and press ENTER button to disconnect the server Press right button to select refresh icon and press ENTER button to refresh the file list right icon and press ENTER button to connect Press button to select connect the server that highlight 32 Press right button to select download icon and press ENTER button enter to information menu then do next and press red button to confirm Press info button or press right button to select info icon and press ENTER button to display the information of the file that you highlight 15 2 Downloading list When you enter to Downloading list menu you will see a screen like below Press right button to select start icon and press ENTER button to start download the role that you select Press right button to select stop icon and press ENTER button to stop download the role that you select Press right button to select delete icon and press ENTER button to delete download the role that you select Press info button or press right button to select info icon and press ENTER button to display the file that highlight 15
8. key to draw back to system information 11 2 PVR HDD Setting When you enter to PVR HDD Setting menu you will see a screen like below Note lf no USB Hard Disk insert to the receiver this menu is not available 26 1 Press 1 4 key to select menu items among HDD Format USB Speed Testing Record Setting Timeshift Setting 2 Press ENTER key to enter the selected item 11 2 1 HDD Format In HDD Format menu you will see a screen like below 1 Press red button and select the file system between win 95 FAT 32 and ext3 then press ENTER to straight format disk 2 Press green button to partition for the disk then format disk In this submenu Press green key to add a new subarea Press yellow key to delete a subarea Press red key to save and partiton the disk The end press blue key to format disk Note If you format the HDD all the files include JPEG and the record files will be deleted from the HDD English 11 2 2 Usb speed testing When you enter to Usb speed testing menu You will see the write soeed and read speed of you disk according this information you can know what operation your disk can support like below 11 2 3 Record Setting When you enter to Record Setting menu you will see a screen like below 1 Record Path Using change path of record file save 2 Duration Press left right key to switch the time of the record 3 Extend
9. servicing WARNING Do not use this STB where contact with or immersion in water is a possibility Do not use near flower vase washbowls kitchen sinks laundry tubs swimming pools etc WARNING Do not put the candle or lamp stand on the cabinet otherwise there is the danger of fire WARNING The unit should be connected to a power supply only of the type described in the operating instructions or as marked on the unit If you are not sure of the type of power supply for example 120 or 230 V to your home consult your local dealer or local power company WARNING This product install diodes Do not open the cabinet or touch any parts in the inner mechanism Consult your local dealer for technical service if the opening is required Note To ensure proper use of this product please read this User manual carefully and retain for further reference Note This product install diodes Do not open the cabinet to avoid the unit direct exposure to radiation Unit Cleaning After the unit power is turned off you can clean the cabinet panel and remote control with a soft cloth lightly moistened with a mild detergent solution Attachments Never add any attachments and or equipment without the manufacturer consent as such additions may result in the risk of fire electric shock or other personal injury Locating Slots and openings in the cabinet are provided for ventilation to protect it from overheating Do not block thes
10. the picture like the below OF wih A Note If no USB Hard Disk insert to the receiver this menu is not available 14 1 File List In this menu you can check the files and folders of the USB storage and you can view files from 6 categories Music Record picture movie Software All 14 2 Storage Information Press ENTER button to enter the HDD Information menu like the below picture in 31 this menu you can see the details information about the HDD If you want to change the type of the file list display press red button Press green key to sort for the file list Press yellow key to delete the files that you want In software file press blue key to upgrade Press find key to find the file 15 Menu download In main menu choose download icon and press ENTER to enter to download menu 15 1 Browse server Press red button to switch among browse server downloading list and downloaded list Press green button to select the server or file Press yellow button to config the max number of allow download When you enter to browse server server list menu you will see a screen like below Press button to select connect right icon and press ENTER button to connect the server that you select Press right button to select add icon and press ENTER button to enter to add server menu and do next Press right button to select delete icon and press ENTER
11. 3 Downloaded list When you enter to Downloaded list menu you will see a screen like below Press right button to select delete icon and press ENTER button to delete the role that you select Press info button or press right button to select info icon and press ENTER button to display the file that highlight 16 Menu Pulg in This menu is allow user install software by self It support the number of software by the hardware It only has a calculate at first When you enter to pulg in Menu you will see a screen like below 1 Press up down and left right keys then press number and color keys to input Pree ENTER key to enter calculate interface at calculate Item 2 press ENTER key to input you need or immediacy 3 If you need clear input press EPG key 4 Press EXIT key to come back 17 Menu Net working 17 1 youtube This menu is some internet applications youtube can play stream media in www youtube com When you enter to this menu you will see a screen like below You Tube 00 06 30 RARA Featured Option OK Play Play Mode You Tube kh 00 00 12 00 03 12 1 Press up down key to move highlight 2 Press ENTER key on one item it will be play pertinent video The video will show on top left cormer Press ENTER again it only has video in mid of screen Now press zoom key the video will play in full screen 3 Press vol vol to control vol
12. No Info 0004 Daystar Television No Info 0005 tv gusto 00 30 Echt lecker 0006 1 2 3 tv 15 00 Alles f r die Frau No Info 0009 SIXX 12 47 Infomercials Group Option Timer gt Switch Date Change Item r A 18 35 2000 Jun 08 15 00 16 05 Wake Up Fatburner Wake Up Fatburner Dieses neuartige Programm 0001 El kombiniert die effektivsten Bodyshapin gezieltem Training der tief li 0002 D Durch Oberfl 0003 F Sti 0004 so verbe 0005 t funkti nz o Einsteiger genauso wie f r ambitionierte Fitness Fans 0006 1 0008 ii 0009 Switch Date 3 Press RED key to open the Group window You can press 4 key to move highlight and press ENTER key to select group of channels 4 Press GREEN key to open Options window You can press 4 key to move highlight and press ENTER key to select EPG events display mode Now EPG Next EPG More Schedule a i A 5 e Wetz l Baet Me onaocy _ Moe fiir dia Fr p ex BE a if A 7 2010 Aug 16 s lt t gt E 1 2 3 tv Mon 16 Aug 2010 08 00 12 00 lt lt SENDEPAUSE von 02 06 Uhr gt gt 12 00 13 00 Best Of 14 00 15 00 Haushalts Extra 15 00 16 00 Alles f r die Frau 16 00 17 00 Mode Outlet 17 00 18 00 Schmuck Spezia 18 00 19 00 Schmuc k Spezi Group Switch Date 5 Press YELLOW key to open Timer window User can save a timer as he want More about timers You can read in Organizing Time 13 6 Press REC key to
13. SAME aida 21 English O Ie MENS YO TEM orreee 21 TEIN SYSTEM MEN KEE EN RRE A ADD SETTING EEN 26 RIES NET ENT e EE 27 E A CON II 28 12 MENU CONDITIONAL ACCESS isscansarnraacaraacania ciar ni cnnia cnica 29 13 GPAPk nenene een 29 13 A SE 29 13 2 UPGRADE SOFTWARE ccoo rra 29 SS WEATHER FORECAST cents iio 30 E SE A o o a o o aio 30 E USER MANUAL e neon e de e e e e id 30 A A A N 30 E Sg ere le EE 30 E A CIR e We H e EN n RILE GS WEE EN 14 STORAGE INFORMATION EE EN t5 MENUDO No 31 1o BROWSE SERVER EE 31 MZ Re TK Ee EE 32 15 3 DOWNLOADED LIST ini errar 32 16 MENU PULG IN Looe ccc ccccececececececececucucucucueueeeaeanavauavananananas 33 17 MENU NET WORKIN GT ss 33 Wis ei D REI EE 33 A o ld O 34 RS FCA EE 34 EE EE 35 le TROUBLE ele HK Ir O ee 36 9 SPRORFOA TON KEEN 37 IT DOLBY Manufactured under license from Dolby Laboratories DIGITAL Dolby and the double D symbol are trademarks of Dolby Laboratories English 1 Safety precautions CAUTION d RISK OF ELECTRIC SHOCK DO NOT OPEN The lightning flash with Warning The exclamation point within an arrowhead symbol within an To reduce the risk of electric equilateral triangle is intended equilateral triangle is intended shock don t open the cabinet to to alert the user to dangerous Refer servicing to qualified alert the user to important voltage and to prevent froma personnel only operating and maintenance risk of electric shock
14. Satellite Installation 1 Satellite Press ENTER key to enter the Satellite list 2 Press T key to select satellite Press Page Page key to page up or page down In this menu Press GREEN button to rename for this satellite Press GREEN button to enter into edit satellite Menu Press YELLOW button to enter into Transponder Menu Press BLUE button to auto Diseqc 10 1 1 Edit In satellite menu press GREEN key to enter into edit satellist menu In this menu Press RED button to scan channels Press GREEN button to rename for this satellite Press YELLOW buiton to enter into motor Menu Press BLUE button to auto Diseqc 10 1 1 1 LNB In this item press lt to switch among C Band 5150 KU Band 11300 One Cable L One Cable H Uni 9750 10600 Uni 9750 10750 Lo w Band 9750 and High Band 10600 mode 10 1 1 2 DISEqC DiSEqC You can use lt key to switch options There are several options for your selection e OFF without DiSEqC e 1 4 2 4 3 4 4 4 4 ports DiSEqC e 1 16 2 16 16 16 16 ports DiSEqC 10 1 1 3 22K You can use lt gt key to switch ON Off When this item is switched to ON receiver will receive TV and radio input signal from 22K port If the item is switched to Off the receiver will receive all signal from OK port English Note When you choose LNB type Universal
15. TV Radio channel list or to confirm in the menu Remote Sensor Detects infrared signal from remote control unit Display LED type Indicates operating status of receiver POWER Indicator while the receiver is power on and at standby mode Card Slot One slot CA Interface for Conax Insert the smart card chip side up 6 Rear Panel Please refer to the diagram above for all possible connections of your receiver Do not connect the unit to the mains socket until all other connections have been made and checked Your configuration can vary depending on model LOOP This enables the connection of another receiver LNB IN This port is to connect the coaxial cable from satellite antenna AUDIO R L These RCA connectors are used to connect any external audio amp or system TV This is used to connect your TV through SCART cable HDMI Audio and Video output socket for TV set with HDMI Input Jack only CVBS Component video output socket for TV set S PDIF Audio output socket for speaker set with PDIF USB USB 2 0 Host connect to USB hard disk or flash disk RS 232C This is used to connect your receiver to a computer through a serial cable 0 12A 50MA This is used to Connectors 12V to an external OV 12V switch POWER To switch ON OFF the receiver power supply ETHERENT This is used to connect internet 7 Connecting Your System There are three ways to connect the receiver to your existing TV system We recommend using one of th
16. in full screen you e E Le senn gt APRA can open teletext amp subtitle menu and choose y AA teletext then press ENTER key on the Confirm Prev ex Slear Fi Switch Keyboard EXIT Exit T channel which has teletext information Channel Find Keyword Z 0002 ZDF Lu ABCA DEF 0003 ZDFinfokanal e 0004 Fdokukana GHI m MNO 004 ZDFdokukanal 0005 ZDFtheaterkanal PQRSR TUVU WXYZ 8 L TV RADIO RECALL E FL Switch Keyboard a EXIT Exit OK Con x E TT EE EEN 1 Press X FIND key in full screen can information it will show No Teletext on the SE EES EE EECH resrd then press number keys to input the screen H p y p seles lt gt 7 4 keys to move highlight and press ENTER key or press F1 key to swich keyboacted symbol or letter into the dialogue Irak Zwei Deutsch Daimler streicht 6 EE 2 After input each character the program list on the left will search the channel according your input and list the matched channel 3 Press red button Move highlight to you Subtitle select channel and press ENTER key to 1 Press YELLOW key in full screen you switch chiannel from the channels list can open teletext amp subtitle menu and choose fdirectly subtitle then press ENTER key on the Zoom channel which has subtitle information 2 Ifthe channel has no subtitle information it will show No subtitle on the screen Find 14 English 1 The ZO
17. key function POWER To switch your receiver on from standby or standby to on CX MUTE Used to enable or disable the audio NUMERIC KEYS Used to select channels or enter programming parameters OU TV RADIO Receiver switches between TV and Radio mode A ZOOM Press amp key select zoom times from X1 to X16 RECALL Return to the previous menu or status TV SAT Receiver switches between TV and receive mode INFO INFORMATION To display channel status or various program information of current service EPG Electronic Program Guide Display the Programs guide on screen when available MENU Displays the Main Menu on the screen or return to the previous menu or status EXIT Cancel the user selection and return to the viewing mode from a menu OK To select menu option or to updated on entry lt gt KEY To adjust volume level or to move cursor left or right in the menu A v KEY To change channels or to move cursor up or down in the menu PAGE PAGE To move up the cursor to the next or previous page in the menu or channel list REC To start recording Has different functions per menu Teletext Shows teletext information of the current channel supports Subtitle Subtitle Display Q FIND Use to prompt find channels sort by character OTIMER Press timer key you can setup up the Standby time V FORMAT Press P N button to switch the display mode among By source By native TV 480i 480P 576i 576p
18. multiple antennas to be connected to the receiver at the same time lf you have two or more fixed antennas or LNBs then we recommend you use a DiSEqC 1 0 switch Connect the coaxial cable from the first LNB to the LNB 1 or LNB A input connector of the DiSEqC switch Do the same for any other LNBs that you have connect the other end to the LNB IN socket on the receiver To the digital receiver you can connect either a single satellite antenna directly or LNB of multi feed equipment 10 English 8 Basic operations Turn on STB First press the O0 POWER to turn on the unit When the STB is first used there will play the first channel from the default Channel List If the STB is not first used STB will play the same channel as last time before turning off Frequently Asked Question Q The power of my STB has been turned on and not in Standby mode but the TV screen showed nothing A Make sure the TV set has been set to the correct video input not the TV channels For example if you have connected the unit with the Video1 input of the TV set the TV set has to be switched to Video1 Q The power of my STB has been turn on and not in Standby mode but the TV screen showed nothing except popup window with No Signal information A That means the channel which you select is no signal Check connection of signal cable or contact operator Power 1 Press OPOWER Key can enter the Standby state 2 In
19. of satellite Group on the left of the screen which you can watch like below 2 Youcan press 7 1 keys to select different Favorite Group 3 Press Exit key to exit the current window 1 2 eg A Frequently Asked Question Q Why the screen displays No Favorite Channel after pressing FAV FAVORITE key A It is because that you haven t set any channels as favorite channel Please refer to Favorite Audio 1 In full screen press AUDIO key can open the Audio window on the screen 2 You can modify the audio track by press lt gt key and modify the audio mode by press lt gt key 3 Mode Left Right Stereo Mono Information 4 5MByte Vid aud pid Per pmt pid 110 120 110 100 Satellite 12150 30805 H bici LZ DN In full screen press Z INFORMATION key can open infobar Dress again to display EPG information screen then press red key to display information screen in the window shows the parameters of current channel EPG 1 The STB has an Electronic Program Guide EPG to help you navigate channels through all the possible viewing options The EPG supplies information such as channel listings and starting and ending times for all available channels Press EPG key to display Program Guide English 18 35 2000 Jun 08 E 3800 23571 H 0001 ERF eins 13 00 ERF Pop Der Morgen 0002 Dr Dish TV 15 00 VIDEOWEB TV 0003 Press TV
20. record time Using add time for the record at the fist and end Press left right key to switch the time 4 Press EXIT key to come back 11 2 4 TimeShift Setting When you enter to TimeShift Setting menu you will see a screen like below 27 1 Enable Press left right key to switch on or off If it on this function automatism run when in full screen or change channel Or this function is fofbid 2 TimeShift Path Using change the path of timeshift file save 3 Time Press left right key to set timeshift time 4 Press EXIT key to come back the pvr hdd setting menu 11 3 Net setting When you enter to Net setting menu you will see a screen like below 1 DHCP Press left right button to set it on or off If it on sto will auto get the IP network mask gate way and DNS in has DHCP function net Or it need manual config with number keys 2 Press EXIT key to come back English 11 4 Upgrade When you enter to Upgrade Menu 1 Press 1 4 key to select menu items between backup system to hdd and upgrade from USB 2 Press ENTER key to enter the selected item 11 4 1 Backup system to HDD When you enter to Backup system to HDD menu you will see a screen like below 1 type It the type of the backup file Press left right key to change among App Datebase and App Database 2 Path It the place of the file save Press ENTER key to switch it
21. Dolby and Language If Dolby mode is selected AC3 audio track will be played even if track language not correspond to selected one in above functions First and Second Audio 4 EDV Language Press lt gt keys to select EPG language 5 Subtitle Language It is an item for changing the language of the Subtitle As long as the services support it the Subtitle language is changeable by subtitle menu on full screen 22 The supported language can be changed without any notice 6 Teletext Language Press lt gt keys to select TXT language As long as the services support it the Teletext language is changeable by teletext menu on full screen The supported language can be changed without any notice 7 Subtitle display Press lt keys to select subtitle display model if set auto it will automatically display subtitle in has subtitle stream or it need press yellow key and select subtitle to display 8 You can press EXIT key to enter full screen playing mode 11 1 2 Parental Control You can set a password for anyone who wishes to operate in the Installation menu And you can also set the password for the lock channels How to set the lock channel please refer to LOCK Here will show you how to setting and how to revising the password 1 In Parental Control function if Parental Lock is ON press ENTER key there will pop an dialogue for you to input the password When you i
22. English AAA High Definition Digital Satellite Receiver and Media Player Weather Forecast amp RSS Reader Functions Online User s Manual amp F A Q Software Upgrade support via USB RS232 or Internet High Definition digital satellite Receiver amp Media Player Conax Embedded Card Reader FullHD 1080P Output via HDMI YouTube SHOUTcast Radio and Picasa Compatible English EE CONTENTS t SAFETY AE ENEE 4 2 INTRODUCTION ccc cccccececececececececucucucecauavavauavavauaeauaeaenenenenenes 5 3 FEATURES E 5 4 HEMOTIECONTROL 7 5 FRONT PANEL 2 cece cece ccc ececececececececucecucucucucaeacaeauavavauavaeauauauaenenenenenenes 9 6 REAR PANEL ccc cece cccccccccececececececececucucucucucucacauauaeauavavauauauaeaenenenenenes 9 7 CONNECTING YOUR SYSTEM cccccccececsceccececececsceceecesncaness 9 6 BASIC CREP ATION Sree e 11 9 MENU fe ie NC LE Me 16 9 1 ORGANIZING SERVICES cccccccececcccecececececaecececucucaeaesececucueauaeaeseeeeeeaeaeaenenseeeananas 16 92 ORGANIZING Ae ICH 17 9 3 ORGANIZING IMER EE 18 10 MENU INSTALLATION ccc cece ececececececececucucucecuceeevavauavavavanaees 19 10 1 SATELLITE INSTALLATION cece ececscecseeceeeeeaeanaeananananas 19 O O 19 A a O e anton 19 TOA A o e o Os 19 A EE 19 VOTA UE OPTIONAL o 20 ba pe Eh Cer gt Ae eee SRN eee Om Be RE toe Me AED See RE Mere ne ROMO RIS eee ae Ane ee ee eee 20 a age Ka dene EE 20 10 1 2 EDIT IR 20 be a CS PRIN AA 21 ee 21 102 FASTSCAN
23. OM key allows you to magnify a certain area on the images 2 Press A ZOOM key again the image will enlarge rotate as x1 x2 x4 x6 x8 x12 x16 3 In x2 x16 mode using gt 7 keys to move the image center area you want to see 4 In zoom mode press EXIT to close Zoom Window NVOD Press GREEN key in full screen it display NVOD menu if it has NVOD Or it will show no option channal TV SAT Press TV SAT key can switch between TV mode and STB mode Menu Press MENU key can open the menu exit the current menu to last menu or close the window Video Format Press V FORMAT key under Full Screen playback continuously press this key system will switch its outputting video resolution by sequence Auto N P gt 480 gt 576 gt 720 gt 1080 Time Shift 1 If you connect the USB HDD and enable the Time Shift function in the menu Main Menu USB PVR Setting Time Shift it will start the Time Shift function automatically after you switch the program and when you press the play button the Time Shift info bar will displayed as the following picture 2 You can press n button to pause the video 3 You can press lt lt Jor gt gt button to Fast Backward or Fast Forward 4 Press lt or gt button to jump to different position 5 Press m button to exit the playback a Record 1 If you connect the USB HDD You can press e button to start record fu
24. Standby state press O POWER Key again can call back the unit and go on play the previous channel 3 User can also disconnect the device s main power to end the Standby state Channel Up Channel Down In full screen press f 4 to change channel Volume Up Volume Down In full screen press lt gt or vol vol to adjust volume Number In full screen use number key and press ENTER on the Remote Control Unit to change channel Mute 1 Press XK MUTE key to mute the sound and the screen will show up mute OSD 2 Press MUTE key again to restore sound Pause 1 In playing mode press n PAUSE key the picture will be paused but the sound of the channel will still continues 2 Press PLAY key the screen s picture will skip over to the current playing picture and the sound of the channel will corresponding playing Recall Press ORECALL key will directly switch to the previous channel that you played before current channel Favourite 1 In full screen press FAV FAVORITE key it will display a window of Favorite Group on the left of the screen which you can watch like below English 2 You can press lt gt keys to select different Favorite Group Pressing Page Page keys can implement the Page up Page down function 3 Press Exit key to exit the current window SAT 1 In full screen press SAT key it will display a window
25. an to conduct the overall safety check to ensure the machine is In the proper condition 2 INTRODUCTION Thank you for purchasing the HD Receiver This HD Receiver is fully compliant with the international DVB standard and thus transmits digital images sounds information guides and teletext directly to your TV through the broadcasting Now you can comfortably see and receive digitally transmitted music news movie and sports broadcasts in your office or at your home In service search section both the automatic service search method and the manual search mode are provided You can save up to Endless TV and Radio services and work around with the favorite Lock Delete Move and Sort functions The menu is very modern and supports multiple languages All functions can be carried out using the remote control and some of the functions can also be carried out using the front panel The HD Receiver is easy to use and adaptable for future advances Please be aware that new software may change the functions of the HD Receiver If you have any difficulties concerning the operation of your HD Receiver please refer to the relevant section of this manual including the Troubleshooting This Manual will provide you with useful information on using the HD Receiver LA FEATURES MPEG Fully DVB S DVB S2 HD compliant Endless channels TV and Radio programmable Multilingual menu text support Channel list editing Favourite channel list ed
26. data Press green button to add city Press yellow button to delete the current city Press blue button to change units 13 4 Faq When you enter to Faq menu you will see a screen like below 30 A ALONLINE WEATHER FORECAST mer upress green button and than import the city pr 1099 ess fed button end iw to change the record time LV YSTEM gt PVR HDD SETTING RECORD an he A In Ri SETTING menu press legt or right button on DURATION Press left right button to switch frame Press up dowm button to change item Press ENTER or play button to download and play video at has video item 13 5 User manual When you enter to User manual menu you will see a screen like below Press left right button to switch item Press up dowm button to change item Press ENTER button to play picture at right column 13 6 E book In E book menu Press left right button to switch frame Press up down button to change item Press ENTER button to play E book like USER MANUAL 13 7 config When you enter to Manage user menu you will see a screen like below English Press ENTER button to enter edit name telephone addresser email language Press red button to login and save Press green button to setup sth Press yellow button to clear online data and reboot 14 Menu file list If you enter to the file list Menu you will see
27. ding your situation Search Type you can select the search type as HD or SD Auto DiSEqC if set to ON it will check the signal automatically and find the signal from which port of the DiSEqC switch LCN if set to ON the channel number will display according the information from the stream if set to OFF the channel number will display normally 11Menu System When you enter to system menu you will see the screen like below 11 1 In system menu 1 Press TU and lt gt keys to select menu items among basic setting PVR HDD setting Net setting upgrade and them s submenu 2 Press ENTER key to enter the selected item basic setting English 11 1 1 Language When you enter to Language menu you will see the screen like below 1 Menu Language Press lt gt keys to select OSD menu language 2 Audio Language Some channels have more than one audio language for choosing by this function you can set the first audio for this channel If the playing channel has the same audio as the First Audio you set system will play this audio language as default If the channel hasn t the suited audio language then the default language of current channel will be played automatically The selections of audio languages include English French German Russian Arabic Portuguese Turkish Spanish Polish and Italian 3 Audio Priority You can select the Audio Priority among
28. directly add timer for recording event 7 In EPG menu press EXIT to close EPG screen TV RADIO In TV mode pressing 4 A TV RADIO key can switch to Radio mode In Radio mode press M4 A TV RADIO key to switch to TV mode TV List 1 In full screen press ENTER key to enter TV List All NDS Videoguarc FAV Irdeto Satellite Free 0062 ZDFinfokanal 0063 ZDFdokukanal A Z Unknown 0064 ZDFtheaterkanal Provider 0065 3sat CAS 0066 KiKa HD 0067 EuroNews 0068 Eurosport Satellite 12150 H 30805 EPG Now Switch frame 2 Press BLUE key to open the Sort window There are five kinds of sorting ways 3 Press GREEN key to recall shortcut to EPG actual event details 4 Press YELLOW key to enable shortcut to channel parameters edition 5 Press T key to move highlight and press ENTER key to play the highlighted channel 6 Press Page Page key to page up and page down 7 Press EXIT key to exit the channel list Sleep 1 This function can set sleep timer When you set a sleep timer and the time arrive the system will enter to standby automatically 2 Press O SLEEP key to switch the mode between Sleep Timer Off 10 30 60 90 120 minutes Page Up Page Down English 1 In Channel list press Page Page key can page up and page down the channel list 0005 Found Channels Find channe name 0002 ZDF AAA FR 0003 ZDFinfokanal 1 Press YELLOW key
29. e PCM and then output 6 Press EXIT key to draw back from A V Control Menu 11 1 5 factory default When you input to factory default menu you will see a screen like below 1 Load from factory default When you press ENTER key it diplay a warn information select yes to come back factory default 2 Factory reset When you want come back the factory default press ENTER key on this item English 3 Save As Factory default when you want save current datebase as default datebase press ENTER key on this item 4 Delete All Channel This item to use delete all channels 5 Press EXIT key to draw back main menu Frequently Asked Question Q IF I incautiously delete all channels what should do A There are two ways to restore To re search all channels in Installation function Use Default Value function to restore all channels in Tools function 11 1 6 Miscellaneous setting When you input to Miscellaneous Setting menu you will see a screen like below 1 Banner diplay Time When you switch channels in full screen there will show up some information about current channel on the lower of the screen And regarding to the duration of these information show up on the screen you can press lt gt key to set the time The range of the duration is 1 20 seconds 2 OSD Transparency You can set the transparency of OSD You can press lt gt
30. e following cases for the best result 1 Ifyou have a high definition television set you should use a HDMI cable for best result Plug one end of the cable into the HDMI socket on the receiver and the other end into the matching socket on your television In this case you do not have to make audio connections because the HDMI connector can output stereo audio or Dolby digital audio 2 Connect one end of SCART cable to the TV SCART jack on the back of the receiver and the other end to a SCART jack on your TV 9 English 3 Connect one end of RCA cable to the RCA jack on the back of the receiver and the other end to a RCA jack on your TV ETHERNET Finally connect the coaxial cable from the operator to the CVBS jack on the receiver With External Audio Hi Fi System To connect any external Audio Hi Fi system the receiver has been provided with two RCA connectors at the back of the receiver marked with Audio L and R Connect an RCA stereo cable from the AUDIO L R jacks on the back of the receiver to the LINE AUX SPARE OR EXTRA input jacks on your Hi Fi System 7 1 TV with Motorized System DiSEqC 1 2 Connect one end of your coaxial cable to the LNB IN connector on the receiver and the other end to the REC or Receiver connector on the DiSEqC 1 2 motor Connect the coaxial cable from the LNB to the LNB connector on the DiSEqC 1 2 motor All our receivers are designed to be DiSEqC 1 0 and DiSEqC 1 2 compatible This allows
31. e openings or allow them to be blocked by placing the STB on a bed sofa or other similar surface nor should it be placed over a radiator or heat register Power Cord Protection Place the power supply cord out of the way where it will not be walked on Please take special attentions to cords at plugs convenience receptacles and the point where they exit from the unit Object and Liquid Entry Never put objects of any kind into this STB through openings as they may touch dangerous voltage points or short out parts that could result in a fire or electric shock Never spill any liquid on the STB English Note Moisture may be formed on the lens In the following conditions when the unit is suddenly moved from a cold environment or an air condition room to a warm place immediately after a heater has been turned on in a steamy or very humid room lf the moisture forms inside the unit it may not operate properly To correct this problem turn on the power and wait about two hours for the moisture to evaporate Parts Replacement When the unit parts need to be replaced user should make sure the service technician use the replacement parts specified by the manufacturer or having the same characteristics as the original part Unauthorized replacement may put the unit In the risk of fire electric shock or other hazards Safety Check After all the maintenances and repairs are done user is required to request the service technici
32. en you press blue key there will show up a warning message for reminding whether you will delete the current transponder or not If you select Yes the current transponder will be deleted and the total account of transponder will reduce 1 correspondingly 2 For the existed transponder you also can use number keys to modify the parameters of TP Frequency and Symbol Rate 3 When you complete your modification Press RED key it will show up a dialog to ask you scan mode program type scan type English and NIT Search on off After you set up press ENTER key to start scanning 4 Inthe TP Scan item press EXIT key to exit the scanning and save the current parameters 10 1 3 Single Scan 1 Press RED key it will show up a dialog to ask you scan mode means you want to scan all channels or only scan free channels program type means you want to scan all channels or only scan TV Radio channels scan type means preset scan that is searching the existed TP Automatic Scan means blind scan It is no need existed TP info and NIT Search on off After you set up press ENTER key to start scanning 10 1 4 Auto Diseqc This function will try to analyze Your dish LNB configuration and automatically scan for founded settings 21 10 2 FastScan Satellite In this menu you can search the channels fast by set the following parameters Provider can select the provider accor
33. he level of signal is weak LNB is out of order The cable from the LNB or Terrestrial is incorrectly Connected short circuit or open circuit The position of dish is aligned incorrectly Receiver is on but no picture Channel is not available or sound except the following Channel is scramble messages NO TV program Receiver not responding to RCU batteries are dead or inserted incorrectly remote control unit The RCU is pointing toward wrong direction Poor picture Quality The level of Signal strength is low No sound The cable is connected incorrectly The Volume level is low Muting function is active No display on the LED Display The power cord is not plugged in correctly No picture on the screen Receiver is in Standby mode RCA Jack or cable is not connected firmly to the video output port of television Incorrect channel or video output is selected on television Brightness level of your TV set is incorrectly defined 36 nglish 19 Specifications SYSTEM RESOURCES DVB S DVB S2 LNB Power amp Polarization DiSEqC Contra TTT raron 10 111 USALS Ralanie P42 2 3 3 4 5 6 7 8 1 4 1 3 2 5 3 5 4 5 8 9 9 10 and Auto POWER SUPPLY Input Voltage Power Consumption Free Voltage 100 240V AC 50 60Hz 20W MAX oor 720 576P l 1280 720p 1920 1080i A V amp DATA INPUT OUTPUT VER1 2 HDMI Type A PHYSICAL SPECIFICATION USB Vee SOS eeh ooo LA N English Size W H D 220mm 46mm 169mm Net Weigh
34. ices Mark the desired services using ENTER button use gt and f 4 button to choose Skip mode and press ENTER button to confirm 9 1 6 Group RED It is very useful to select services with different Groups 9 1 7 Options GREEN It is very convenient function to Mark the desired services with different options 9 1 8 Find lt is an item to locate certain service by name quickly Press D I button to display the Channel Find submenu use keyboard to enter service name and press red button to complete input and select the desired services 9 2 Organizing favourites When you enter to Organizing favourites menu there will display the screen like below lt Free gt Grou Option b e 4 Switch frame Change Item Exit K r emm wa lt a bal 1 You can move highlight by press T J keys in the left and right side list window English 2 Youcan press Page Page keys to implement the Page Up Page Down function a 3 You can use lt gt key to switch e SS between list of all channels at the left list of aie Sat 2000701 00 06 Sat 2000 01 01 channel in actual selected FAV list at the right 1X Change Service and edit functions in the middle of the screen Add Remove Move Rename 4 Press color key to implement the corresponding function Group Options 4 Number Display the order of current Find described in previous chapter item
35. iting True color On Screen Display OSD Full Picture In Graphic PIG function Electronic Program Guide EPG for on screen channel information Subtitle supported Teletext supported by software emulation Parental lock facility by channel and program event Program and Channel information transfer from receiver to receiver 5 English S PDIF for digital audio or Dolby digital bitstream output DiSEqC 1 0 1 1 1 2 and USALS HDMI HD Video Audio Output USB 2 0 Host LED Display for service information RTC Real Time Clock Time Shift Video Recording Recording one channel and Time Shifting another channel optional Conax Embedded Card Reader FullHD 1080p output via HDMI AVI MKV MPG TS WMA WMV M2TS FLV DAT ASF MP3 playback YouTube SHOUTcast Radio and Picasa Compatible Weather forecast amp Rss Reader Functions Software Upgrade support via USB RS232 or Internet Endless possibilitier with Plug In support Message FAQ and User Manual support Download files from FTP server Base on LINUX English d O TV SAT 7 ghi 4 7 TV RADIO FOLDER PAUSE il PREV leq lt l V FORMAT ZOOM I gt USB 2 jkl 5 tuv DA STOP E PAGE lt lt NEXT gt gt PLAY MODE nie AUDIO OPTION FAV SAT TTX IX Q 3 6 Z RECALL Y SUBTITLE 4 Remote Control You can power on off the receiver operate on screen menu and use a variety of hot
36. l setting date and time 2 GMT Offset This item is valid only when the setting of auto update is On You can press lt gt keys to switch GMT Offset value and the range is 12 00 12 00 increase each half hour progressively 3 Summer You can press lt gt to control Summer time on or off 4 Date and Time items are valid only when the auto update setting is off You can use number keys to input directly If the current channel provides the correct time information you will see the current time while you enter Time menu If the channel doesn t provide time information you have to input the date and time information manually 5 Wake up sleep Config the STB turn on and off lf these are setting on the stb will turn on off at the wake up time sleep time if set wake up channel it turn on at the channel or it at the last channel before stb turn off 6 Press EXIT key to draw back from Time Setting menu 11 1 4 A V Output When you enter to A V Output menu you will see the screen like below English LETTER BOX 1 User can switch display resolution in view mode using V FORMAT button Also Display Mode is for switching the system outputting video resolution Move highlight on it and press left or right key it will switch video resolution circularly by the sequence 480 lt gt 576 lt gt 720 lt gt 1080 lt gt Auto N P Auto N P means syste
37. m will set the video output resolution according to the program it s playing different resolution programs switching perhaps will makes TV screen flickering 2 Screen ratio is for switching the screen aspect ratio mode Now we provide below options 4 3 16 9 Auto You can press lt gt key to select each mode circularly 16 9 will provide user pillar box mode it means user use 16 9 TV to display but need to see a 4 3 full display picture System will force press wide screen picture to be narrow and there re black band on left and right site Auto means system wont do any aspect ratio translation 16 9 picture source will be good display on a 16 9 TV but will be too narrow on a 4 3 TV and 4 3 picture source will be too wide in a 16 9 TV but will be good display in a 4 3 TV 3 Video Output Press lt to select CVBS or RGB 24 4 Conversion Press lt gt to select LETTER BOX PAN SCAN COMBINED or IGNORE 5 SPDIF is for setting the both SPDIF and PCM audio output mode it has options PCM and Auto You can press Left Right Key to select each mode circularity PCM Out means system will decode no PCM audio track data to be PCM digital audio decoder or HDMI TV will get PCM digital audio data Auto means system will detect which the connected HDMI TV can decode and then output that data If HDMI TV can decode AC3 system just output RAW data if HDMI TV can decode PCM only system will just decode AC3 or PCM to b
38. nction as following picture 2 Press gt button to display the record info bar when you recording 3 Press e button again to pause the record time 4 You can press n button to pause the video 5 You can press lt lt or gt gt button to Fast Backward or Fast Forward 6 Press lt or gt button to jump to different position 7 Press m button to stop the recording b Exit Press EXIT key can exit the current menu to last menu or close the window quickbar In full screen press F1 button to enter quickbar like below It show weather message time and state of NET and USB and has shortcut to enter to weather menu It also has message box 9 Menu Channel When you press Menu key to enter menu there will display the picture like below 1 Press T 4 and gt key to select menu pages among channel Install System CA Spark file list donwload and plug in 2 Press ENTER key to enter the selected item In channel menu 1 Press 1 4 key to select menu items among Organizing channel Organizing Favourites and Organizing Timer 2 Press ENTER key to enter the selected item 9 1 Organizing Services When you enter to Organizing Channel menu there will display the screen like below 0062 ZDFinfokanal 0063 ZDFdokukanal 0064 ZDFtheater kanal 0066 KiKa 0067 EuroNews 0068 Eurosport 1 You can move highlight by p
39. nput the correct password you will see a screen like below English 2 Parental Lock determining that when user wish to enter menu whether have to input Password or not If the setting of Parental Lock is Yes which means user have to key in password set No means unlock 3 Censorship Classification Lock determining that when user wish to lock channels If the setting is view all play channels not need password If it setting lock all play channels with password Setting 7 12 15 18 these are determining that different stream whether have to input password 4 Time control is off it not need password to play channel if it setting on channels are not need input password in allow time or all channel are need input password to watch 5 New Password is used for revising password you can input the new password in this item by using number keys directly After you filled in 4 digital numbers the highlight will auto skip to Confirm Password and ask you to input the new password again If the password is correct the screen will show up a message of Change password successfully 6 You can press EXIT key to enter full screen playing mode 11 1 3 Time setting When you enter to Time Setting menu you will see the screen like below 23 1 Auto update this item is use setting date and time of STB if it setting on the time as the same with current channel or it need manua
40. ress T J keys and press ENTER key to confirm to preview the current highlighted program in the left side preview window 2 You can press Page Page keys to implement the Page Up Page Down function 3 You can use lt gt key to switch between list of channels and list of channel edit functions Move Lock Delete Rename Skip 4 Press color key can implement the corresponding function Group Options Find 5 You can press Exit key to enter full screen playing mode 9 1 1 Move You can reorder and move the service to the preferred position Mark the desired services using ENTER button use gt button to choose Move mode and press ENTER button then use T buttons to move and press ENTER button to confirm 9 1 2 Lock You can restrain and lock the services Mark the desired services using ENTER button use gt and N button to choose Lock mode and press ENTER button to confirm 9 1 3 Delete You can delete the services Mark the desired services using ENTER button use gt and f 4 button to choose Delete mode and press ENTER button to confirm 9 1 4 Rename Mark the service you want to rename use ENTER button to select one Rename item use gt and 1 4 button to choose rename icon and press ENTER button to display keyboard and rename it After renaming it press red button on keyboard to save 9 1 5 Skip You can restrain and Skip hide the serv
41. s vol vol to control volume 34 4 Press stop or EXIT key to stop radio 5 Press red key to switch class 6 Press yellow key to add highlight item to favourite 7 Press green key to show favourite radio 8 Press yellow key in favorites menu to delete the higtlight favourit radio 8 Press find key to find radio 17 3 Picasa This menu is picture in www picasa com when you enter to this menu you will see a screen like below S d y RA w e d Ia RK l Zeg 1 Press up down key to move highlight 2 Press ENTER key to show the picture in full screen 3 Press left rifght key to switch picture 4 Press EXIT key to come back 5 Press red key to show the featured pictures 6 Press green key to show the user s album of the highlight picture 7 Press yellow key to display the album of the highlight picture 8 Press find key to find picture English 17 4 Rss This menu is display rss web When you enter to this menu you will sea a screen like below N RSS WU i rss news yahoo com A http rss news yahoo com rss tech Subscription Unsubscibe OK Enter N RSS http rss news yahoo com rss tech The choice for e reader users LCD or e paper Ben Patterson The latest Nook e reader from Barnes amp Noble delivers a pair of key features lacking on the Unknown Author Wed 27 Oct 2010 23 15 19 GMT Android powered PlayStation Phone revealed
42. t 1 0KG Operation Temperature OC 45 C Storage Temperature 10C 70 Storage Humidity 5 95 RH Non Condensing 38
43. tion will be displayed 13 spark In main menu choose spark icon and press ENTER button to enter to online menu Press ENTER button to enter child menu Press up down button to switch item Upgrade Software Weather Forecast FAQ User Manual 13 1 message When you enter to message menu you will see a screen like below You can see the message list ENTER button to see the infromation of the message that the highlight message Ppress Press red button to sort messages Press green button to delete message Press yellow button to delete all messages In list 13 2 Upgrade software When you enter to Upgrade software menu English you will see a screen like below Press left right button to switch the type in software list and database list Press up down button to choose item Press red button to upgrade with choose item Press ENTER button to display information of highlight item 13 3 Weather forecast When you enter to Weather forecast menu you will see a screen like below 4 4 Berlin Berlin Update 2010 11 05 02 20 00 0000 FriNov 5 2010 Sat Nov 6 2010 Sun Nov 7 2010 e gt Mostly Cloudy Mostly Cloudy High 13 C High 10 C Mostly Cloudy Temp 15 C Humidity 77 Wind W at 24 mph Low 8 C ow 1 C Add City Press left right button to switch date Press up down button to change city Press red button to update the
44. ume 4 Press pause key to pause video or press stop key to stop play 5 Press red key to display the featured video 6 Press green key to sort of site and English duration The site has Germany worldwide Poland and so on Duration has all time this week this month and so on 7 Press yellow key to switch group These are game news tech move and so on 8 Press blue key to display the top video These are top favourites top rated most views most recent and so on 9 Press REC key to display relate videos about the highlight video 10 Press X FIND key in full screen can open the Find window You can presrd then press number keys to input the seles gt P v keys to move highlight and press ENTER key or press F1 key to swich keyboacted symbol or letter into the dialogue Then press red key to find 17 2 Shoutcast This menu is radio in www shoutcast com when you enter to this menu you will see a screen like below d SHOUTcast 002 Roots of Rock dot US ROOTSofROCK US Decades 40s 50s Oldies Blues C 003 001 ABACUS VINTAGE Abacus fm 20s 30s 40s Big Band 004 Radio Collector s MPB A sua fonte de classicos Brasil MPB old time 30s 40s 50s 005 The 1940s UK Radio Station Big Band 8 Swing Jive Jazz 20s 30s 40s 50s 20s 30s 40s 50s Big Band 8 Sw 112kbps 20s 30s 40s Big Band 1 Press up down key to move highlight 2 Press ENTER key to play the audio 3 Pres
Download Pdf Manuals
Related Search