Home

PrecisionX ™ HR Targeting Vectors

Contents

1. MCS1 era orn 2A Puro PolyA Kp lmcs2 7 HR410PA 1 5840 bp Replication Amp MCS Multiple Cloning Sites D gt LoxP Sites E Insulator Sequences Figure 5 Schematic Diagram of HR410PA 1 Gene Knock out Targeting Vector MCS1 EF1a GFP T2A Puro pA MCS2 Page 14 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 Sad Kpni Nrul Nsil Bgfll p BamHi Sall Sphi Xbal Not gt RFP T2A Hygro PolyA gt vics2 HR510PA 1 193 bp Amt c Replication MCS Multiple Cloning Sites D gt LoxP Sites Insulator Sequences Figure 6 Schematic Diagram of HR510PA 1 Gene Knock out Targeting Vector MCS1 EF1oa RFP T2A Hygro pA MCS2 P BsrGI Bsal Bbsl Mlul NotI Sall mcs er GFP T2A Puro PolyA i pMics2i PGK hsv Ti HR700PA 1 i Kan MCS Multiple Cloning Sites D LoxP Sites Be Insulator Sequences Figure 7 Schematic Diagram of HR700PA 1 Gene Knock out Targeting Vector with Negative Selection Against Random Integration MCS1 EF1a GFP T2A Puro pA MCS2 PGK hsvTK 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual BsrGl Bsal Mlul Notl Sall N N csp EF1 gt RFP T2A Hygro PolyA h Mcs2 Pak hsv K HR710PA 1 Kan MCS Multiple Cloning Sites D LoxP Sites T Insulator
2. tt Extra Sequence Sequence of your 5 HA 20bp 5 HA reverse primer sequence Bsal site PiggyBac TTAA 5 gaagaaGGTCTCgTTAA 3 Extra Sequence Sequence of your 5 HA 20 bp b C e Run out the PCR product on an agarose gel Cut of the band of the correct size and isolate the fragment Cut the fragment with the 5 MCS enzyme you chose and with Bsal Clean up the reaction and quantify the DNA 2 Preparation of 3 Homology Arm 1 Page 58 PCR the 3 HA and add the BspQI site to the forward primer Add any site you wish from the 3 MCS except BspQI to the reverse primer Homology arms should be between 1 and 0 5 Kb The 5 HA cannot contain a BspQI site ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 3 HR forward primer sequence BspQI Site Sequence of your 3 HA 20 bp 5 taataaGCTCTICTIAA 3 t 1 Extra Sequence PiggyBac TTAA 3 HR Reverse primer sequence Restriction site from the 3 MCS ttottcoXXXXXX io ia Extra Sequence Sequence of your 3 HA 20bp 2 Run out the PCR product on an agarose gel 3 Cut of the band of the correct size and isolate the fragment 4 Cut the fragment with the 3 MCS enzyme you chose and with BspQI 5 Clean up the reaction and quantify the DNA 3 Preparation of PiggyBac Homologous Recombination Vector Determine
3. performing restriction digestion analysis or direct sequencing to confirm integrity of the amplified plasmids Page 22 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 E Cloning of Homology Arms into Vector For fast and efficient cloning of homology arms into the vector we suggest the use of restriction enzyme ligase free methods such as SBI s Cold Fusion Kit Cloning both of the arms into the targeting vector will require sequential cloning reactions one for each arm Please refer to the user manual for the Cold Fusion Kit for details on the cloning process http www systembio com molecular tools cold fusion cloning literature For standard cloning strategies please refer to the following protocol for more details Since there are two homology arms that need to be cloned the cloning will need to be repeated for each arm 1 PCR of homology arms a PCR amplify homology arms using proofreading PCR enzymes e g Phusion with primers containing compatible restriction sites to MCS1 for 5 homology arm and MCS2 for 3 homology arm b Run out PCR products on 1 5 2 agarose gel and extract correct size bands using a suitable gel extraction kit 2 Ligation of insert into vector a Digest the targeting vector using appropriate restriction enzymes for the homology arm being cloned and gel purify the digestion product b Dilute gel purified digested vector to 10 ng ul c Se
4. 4 min 1 cycle 94 C 0 5 min then 68 C 1 min 1 kb 25 cycles 68 C 3 min 1 cycle Depending on the size of final PCR product use a shorter or longer time g Take 5 ul of the PCR reaction and run it on a 1 5 2 agarose EtBr gel in 1X TAE buffer to identify clones with correct insert h Grow a positive clone containing insert in an appropriate amount of LB ampicillin broth and purify the construct using an endotoxin free plasmid purification kit Sequence verification of the insert is optional i Repeat the entire process with remaining homology arm to build the final targeting construct Page 48 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 E Protocol for Co Transfection of Targeting Vector with TALEN or Cas9 plasmids and Characterization of Cells Notes l Depending on the cell type being transfected please choose a transfection protocol which results in maximal transfection efficiencies For adherent cell lines such as HEK293T passive transfection methods using cationic lipid based methods e g Lipofectamine 2000 FuGene HD work very well in transfection of targeting and TALEN Cas9 plasmids For other types of cells such as primary stem or suspension cells we suggest transfection using electroporation methods NucleoFection or Neon for optimal results Il The plasmids should be mixed well in minimal serum no antibiotic media cationic lipid transfection reagent
5. larger sizes may impact transfection and homologous recombination efficiencies The targeting plasmid can be co transfected along with ZFN TALEN or Cas9 systems to have simultaneous cutting and HR based knock in at the desired genomic locus After knock in the expression cassette can be excised by expression of Cre recombinase leaving a single LoxP site in between the 5 and 3 homology arms Please note that the HR100PA 1 vector can also be utilized as a knock out vector see Section II A as the user can clone in their cassette of choice into MCS3 to target a particular gene sequence B Additional Materials Required a LB Agar and Broth containing 50 ug ml ampicillin 888 266 5066 Toll Free 650 968 2200 outside US Page 29 System Biosciences SBI User Manual b Any high transformation efficiency RecA and EndA E coli competent cells c Dulbecco s Modified Eagle s Medium D MEM high glucose with sodium pyruvate and glutamine Invitrogen Cat 11995073 d Lipofectamine 2000 transfection reagent Invitrogen Cat 11668019 e Qiagen EndoFree Plasmid Maxi Kit Qiagen Cat 12362 f Zyppy Plasmid MiniPrep Kit Zymo Research Cat D4019 g Phusion High Fidelity DNA Polymerase NEB Cat M0530S h Qiagen MinElute Gel Extraction Kit Qiagen Cat 28604 i Fetal Bovine Serum Invitrogen Cat 16000036 j Penicillin Streptomycin Invitrogen Cat 15070063 k Surveyor Mutatio
6. plates The use of reduced or serum free media containing no antibiotics to dilute the vector transfection complex is highly recommended Note For 293T cells we suggest 0 5 ug of each TALEN 1 pg total for pair or 0 5 ug of SBI s Cas9 SmartNuclease vector in conjunction with 1 yg of the HR targeting vector into cells for efficient cleavage and HR reaction For other cell types we suggest optimizing the amounts and ratios of Cas9 or TALEN to targeting vector for optimal results in a target cell line Allow at least 12 hours before changing transfection media to complete growth media Assay for positive HR events 48 96 hours after co transfection Select cells with insertion of targeting vector using fluorescent or antibiotic selection if applicable If using antibiotic selection select cells for a minimum of 5 days prior to further characterization Cutting efficiency of TALEN Cas9 can be measured by Surveyor Nuclease Assay and HR efficiency by of fluorescence signal if applicable via FACS If there is no available marker the HR efficiency can be determined by performing dilution of transfected cells and individual characterization of clones by direct sequencing Genotyping of selected cells can be done by PCR of ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 genomic DNA and homology arm sites MCS1 and MCS4 as well as the expression cassette see Section ll Fig 14 for details In
7. Cat M0530S h Qiagen MinElute Gel Extraction Kit Qiagen Cat 28604 i Fetal Bovine Serum Invitrogen Cat 16000036 j Penicillin Streptomycin Invitrogen Cat 15070063 k Surveyor Mutation Detection Kit Transgenomics Cat 706020 l Trypsin EDTA Sigma Cat T3924 m Excision only SuperPiggyBac Transposase enzyme System Biosciences Cat PB220PA 1 n Ganciclovir powder Sigma Cat G2536 0 6 and 12 well Tissue Culture Plates and Related Tissue Culture Supplies p Other specific media and additives specific for cell type of interest q Optional For difficult to transfect cells the use of an electroporation system e g Lonza s NucleoFector or Invitrogen s Neon system is highly recommended C General Considerations for PBHR100A 1 vector We recommend propagation of the PBHR100A 1 targeting vector plasmid prior to starting the experiments The plasmids can be transformed using standard conditions suitable in any high quality RecA and EndA E coli competent cell For cells transformed with any of the targeting vectors we suggest plating 50 200 ul of transformed cells on fresh Page 54 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 ampicillin plates 50 ug ml Incubate the plates at 37 C overnight Colonies picked from the transformation can be grown at 37 C overnight in 200 ml of LB media containing 50 ug ml of ampicillin After overnight gr
8. N NNNNNNNNNNNNNNNNN 3 N 5 Homology Arm sequence 18 20bp in length Cloning of both homology arms into the targeting vector will require sequential Cold Fusion cloning reactions one for each homology arm For standard cloning strategies please refer to the following protocol for more details Since there are two homology arms that need to be cloned the cloning will need be done in a sequential manner except for the initial PCR reaction 1 PCR of homology arms a PCR amplify homology arms using proofreading PCR enzymes e g Phusion with primers containing compatible restriction site s for 5 homology arm and 3 homology arm depending on the chosen targeting vector b Run out PCR products on 1 5 2 agarose gel and extract correct size bands using a suitable gel extraction kit 2 Ligation of insert into vector a Digest the targeting vector using appropriate restriction enzymes for the homology arm being cloned and gel purify the digestion product b Dilute gel purified digested vector to 10 ng ul c Set up 10 ul ligation reactions for each control and test samples as below Page 46 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 Volume Item 1 0 ul HR Targeting vector 7 0 ul 5 or 3 homology arm PCR product 70 ng or water control 1 0 ul 10X T4 DNA ligase buffer 1 0 ul T4 DNA Ligase 40 U ul 10 0 pl Total Reaction Volume d Incubate reaction
9. brief design PCR primer pairs with one of the primers in the genomic DNA region and the other located in the HR vector For the expression cassette one of the primers can be internal to the expression cassette and the other primer immediately outside of the cassette 6 Selected cells can be clonally expanded for further phenotypic characterization IV PrecisionX Targeting Vectors By Application Gene Tagging A Overview of Gene Tagging If the researcher is interested in tagging an endogenous sequence of interest with a marker to create a fusion or to co express a tag with the endogenous sequence e g tracking spatial dynamics of a protein lineage tracking etc SBI provides a collection of four tagging and co expression vectors for HR based applications Figs 16 21 Any type of DNA sequence from protein coding ORFs to non coding sequences can be efficiently tagged or co expressed with GFP and or luciferase using these vectors For protein coding genes the 3 end typically the last exon can be targeted using these vectors for efficient generation of C terminal fusion proteins or co expression of the gene and the tag via T2A or IRES elements if a fusion protein is not suitable 888 266 5066 Toll Free 650 968 2200 outside US Page 37 System Biosciences SBI User Manual 1 GFP Fusion Vector EcoRI BamHI Sphl Xbal Notl FP PolyA gt MEF J RFP T2A Puro PolyA HR1
10. cassette into the vector we suggest the use of restriction enzyme ligase free methods such as SBs Cold Fusion Kit Cloning both of the arms and the expression cassette into the targeting vector will require a total of three cloning reactions Please refer to the user manual for the Cold Fusion Kit for details on the cloning process http Awww systembio com molecular tools cold fusion cloning literature For standard cloning strategies please refer to the following protocol for more details Since there are two homology arms and an expression cassette that need to be cloned the cloning will need be done in a sequential manner except for the initial PCR reaction 1 PCR of homology arms and expression cassette 888 266 5066 Toll Free 650 968 2200 outside US Page 31 System Biosciences SBI User Manual a PCR amplify homology arms and expression cassette using proofreading PCR enzymes e g Phusion with primers containing compatible restriction sites to MCS1 for 5 homology arm MCS3 for expression cassette and MCS4 for 3 homology arm Depending on the size of the expression cassette it may be preassembled by prior cloning through fusion assembly methods e g SBI s Cold Fusion or long range PCR b Run out PCR products on 1 2 agarose gel and extract correct size bands using a suitable gel extraction kit 2 Ligation of insert into vector a Digest the targeting vector using appropriate restriction enzymes for
11. left in the target genome as an insertion and 888 266 5066 Toll Free 650 968 2200 outside US Page 55 System Biosciences SBI User Manual will likely lead to frameshifting of the coding sequence To prevent this from occurring the homology arm will need to be carefully designed such that the TTAA site at the 5 and 3 homology arms are homologous to another TTAA site or sequence that can be altered to a TTAA nearby the correction site as shown below adapted from Yusa et al 2011 Point mutation to correct from AAG to GAG 5 lt 1 oc 3 5 Homology Arm 5 NNNNNNNNNGCTGTGTTAA 3 Correction sequence in 3 Homology Arm HR arm x 5 TTAACCATCGACGAGAAAAGGGACTGAAGCTGCT 3 After co transfection with ZFN TALEN or Cas9 vectors and HR of the PBHR vector this is the expected result 5 NNNNNNNNNGCTGTGTTA TTAAGIRIEF 1 a GFP T2A Puro T2A AMR TT AACCATCGACGAGAAAAGGGACTGAAGCTGCT 3 Lastly when the Excision only SuperPiggyBac transposase is used to excise out the selection cassette it will recognize the ITR elements and lift out the entire ITR and selection cassette along with a single TTAA site and stitch the remaining sequence together as shown below Page 56 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 i Corrected sequence 5 x NNNNNNNNNGCTGTGTTAACCATCGACKIAIGAAAGGGACTGAAGCT GCT 3 In this particular example the TTAA in th
12. of GFP to the 3 end of your gene of choice The 5 homology arm GFP fusion segment is created using seamless fusion cloning technologies e g SBI s Cold Fusion Kit at the provided restriction sites The 3 homology arm can be cloned into the MCS using Cold Fusion or traditional cloning using the provided restriction sites This vector offers a Hygromycin selection marker for selection of HR positive cells The EF1a RFP T2A Hygro cassette can be excised by expression of Cre recombinase leaving only the GFP fusion protein and a single LoxP site 888 266 5066 Toll Free 650 968 2200 outside US Page 39 System Biosciences SBI User Manual Donor vector Wild type Allele Exon1 Exon2 Exon3 N terminal GFP tag Eon Eon Pon E arpana roya p gt Cre excision Exon1 H Exon2 __ Exons Roam Pp Figure 18 Utilization of HR120PA 1 GFP Fusion Targeting Vector to Specifically Tag C terminal Region of Gene of Interest 2 GFP Co Expression Vector EcoRI BamHI Sphl T2A GFP PolyA D j EFT RFP T2A Puro PolyA HR130PA 1 7735 bp Note GFP is co expressed with endogenous gene However GFP protein is not fused with endogenous protein This format is used when fusion protein will interfere with the function of endogenous protein Figure 19 Schematic Diagram of HR130PA 1 GFP Co Expression Targeting Vec
13. tad alee Hae 28 A Overview of Gene Knock In cccccccecseeeeeessteeeeeesteeeeeees 28 B Additional Materials Required cceeesseeeeerteeeeeenaes 29 C General Considerations ccccceceeseeeeeeeeeeeeeeeseeeeeneeees 30 D Cloning of Homology Arms and Expression Cassette into E Protocol for Co Transfection of Targeting Vector with TALEN or Cas9 plasmids and Characterization of Cells 30 IV PrecisionX Targeting Vectors By Application Gene MAGOING sis erica eee Nes die aetna ied Aedes 37 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual A Overview of Gene Tagging cceceeeeeeeee tenses teen eens 32 B Additional Materials Required 0 cecccceeseeeeeeeeeseeeees 43 C General Considerations ccccceeeeseeeeeeeeeteeeeteeeeeeees 44 D Cloning of Homology Arms into VeCtor ccceeeeeeees 44 E Protocol for Co Transfection of Targeting Vector with TALEN or Cas9 roll and Characterization of Cells 49 V PrecisionX Targeting Vectors By Application Gene Editing eaa aea eeen ee tev cas teaver eee 51 A Overview of Gene Editing ccccceeeeeeeeeeeteeeeteeseneeees 53 B Additional Materials Required for PBHR100A 1 vector 53 C General Considerations for PBHR100A 1 vector 54 D Design and Cloning of Homology Arms into Vector for PBHR100A 1 vector cecccececeeeeeeeeeeeeeeeeeeeeesaeeea
14. the homology arm s or expression cassette being cloned and gel purify the digestion product b Dilute gel purified digested vector to 10 ng ul c Set up 10 ul ligation reactions for each control and test samples as below Volume Item 1 0 ul HR Targeting vector 5 or 3 homology arm or expression cassette PCR product 70 ng or water control 1 0 ul 10X T4 DNA ligase buffer 1 0 ul T4 DNA Ligase 40 U ul 10 0 pl Total Reaction Volume d Incubate reactions at 25 C for 1 2 hours sticky end ligation or O N at 16 C for blunt end ligation 3 Transform E coli with the ligation product Page 32 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 Transform competent cells with a transformation efficiency of at least 1x10 colonies ug pUC19 with the whole ligation reaction 10 ul following the protocol provided with the competent cells Plate the transformed bacteria on 50 ug ml ampicillin agar plates 4 Identify clones with the correct insert a Depending on the ratio of colony numbers for the test sample vs the negative control sample randomly pick 2 or 3 colonies and grow each clone in 100 ul of LB Broth with 100 ug ml ampicillin at 37 C for 2 hours with shaking b Use 1 ul of each bacterial culture for screening homology arm inserts by PCR and continue to grow the culture for another 4 hours Store the culture at 4 C c Prepare a PCR Master Mix with PCR primers flan
15. 20PA 1 7672bp Figure 16 Schematic Diagram of HR120PA 1 GFP Fusion Targeting Vector GFP pA EF1a RFP T2A Puro MCS The HR120PA 1 targeting vector is designed to direct the in frame fusion of GFP to the 3 end of your gene of choice The 5 homology arm GFP fusion segment is created using seamless fusion cloning technologies e g SBI s Cold Fusion Kit at the provided EcoRI site The 3 homology arm can be cloned into the MCS using Cold Fusion or traditional cloning using the provided restriction sites This vector offers a Puromycin resistance marker for selection of HR positive cells An example of utilizing the HR120PA 1 vector to generate a C terminal GFP fusion construct is illustrated in Fig 18 The EF1a RFP T2A Puro cassette can be excised by expression of Cre recombinase leaving only the GFP fusion protein and a single LoxP site Page 38 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 Clal__Nhel Xho Bstar SFP ATCGATGCTAGCCTCGAGTTCGAA faig cae ec g We Asp Ala Ser Leu Glu Phe Glu Met Glo Ser Clal Nhet Xhol Bst8i BamHI Sphi m Xbal Noti B N GFP PolyA EF1 gt RFP T2A Hygro Polya H gt mcs yY HR220PA 1 8098 bp Amp p Replication Figure 17 Schematic Diagram of HR220PA 1 GFP Fusion Targeting Vector GFP pA EF1a RFP T2A Puro MCS The HR220PA 1 targeting vector is a variant of HR120PA 1 designed to direct the in frame fusion
16. Prep Kit Zymo Research Cat D4019 g Phusion High Fidelity DNA Polymerase NEB Cat M0530S h Qiagen MinElute Gel Extraction Kit Qiagen Cat 28604 i Fetal Bovine Serum Invitrogen Cat 16000036 j Penicillin Streptomycin Invitrogen Cat 15070063 k Surveyor Mutation Detection Kit Transgenomics Cat 706020 l Trypsin EDTA Sigma Cat T3924 m Promega Luciferase Assay System Promega Cat E4030 888 266 5066 Toll Free 650 968 2200 outside US Page 43 System Biosciences SBI User Manual n 6 well Tissue Culture Plates and Related Tissue Culture Supplies o Other specific media and additives specific for cell type of interest p Optional For difficult to transfect cells the use of an electroporation system e g Lonza s NucleoFector or Invitrogen s Neon system is highly recommended C General Considerations We recommend propagation of the HR targeting vector plasmid prior to starting the experiments The plasmids can be transformed using standard conditions suitable in any high quality RecA and EndA E coli competent cell For cells transformed with any of the targeting vectors we suggest plating 50 200 ul of transformed cells on fresh ampicillin plates 50 ug ml Incubate the plates at 37 C overnight Colonies picked from the transformation can be grown at 37 C overnight in 200 ml of LB media containing 50 ug ml of ampicillin After overnight growth plasmid DNA ca
17. SBI System Biosciences PrecisionX HR Targeting Vectors Cat s HRxxxPA 1 PBHR100A 1 User Manual Store Kits at 20 C upon receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 Contents ls Introduction siia niiin aed ae el da da didien 2 A Overview of Genome Engineering Tools s 2 B Overview of PrecisionX Targeting Vectors for HR Based Applications t c in tiki ie ie eet e aR e 5 C Design Considerations for Homologous Recombination AUIS Spi sc ceca he eee Agata etn ees eaten ater dae tap ce ae See 9 ll PrecisionX Targeting Vectors By Application Gene Knock UE o e E rere cre rrritee rere A etree torre 12 A Overview of Gene Knock Out cccccceceecessteeeeeesteeeeeees 12 B Validation Data for HR110PA 1 eeeeeeeeeeeeeeeeeeeteees 17 C Additional Materials Required cccecceseeeesseeeeeneeees 21 D General Considerations cccccccseeeseeceeeeseeeeeseeeeeeees 22 E Cloning of Homology Arms into VeCtor ccceeeeeeees 23 F Protocol for Co Transfection of Targeting Vector with TALEN or Cas9 plasmids and Characterization of Cells 26 Ill PrecisionX M Targeting Vectors By Application Gene Knock eshte ies aed att set colt Shea tee ht Sate Pani At ata ol ties
18. Sequences Figure 8 Schematic Diagram of HR710PA 1 Gene Knock out Targeting Vector with Negative Selection Against Random Integration MCS1 EF1a RFP T2A Hygro pA MCS2 PGK hsvTK BsrGl Bsal Bbsl Mlul Notl Sall mcs1p ap ert Blasticidin PolyA p mcs2l pax Yhsvtk HR720PA 1 Kan MCS Multiple Cloning Sites D LoxP Sites Insulator Sequences Figure 9 Schematic Diagram of HR720PA 1 Gene Knock out Targeting Vector with Negative Selection Against Random Integration MCS1 EF1a Blasticidin pA MCS2 PGK hsvTK Page 16 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 EN arro rova MPAA donor vector EE E wie ype alele BE E E Rep r2a Puro polya gt EED KO with KI Allele ere Note simple robust and optional removal of positive selection markers Figure 10 Example of HR110PA 1 Gene Knock out Targeting Vector Utilized for Gene Targeting B Validation Data for HR110PA 1 1 Functionality of Dual Selection Markers The dual positive selection markers RFP and Puromycin resistance gene have been functionally validated in human HEK293T cells Cells become RFP and puromycin resistant 48 hours after initial transfection Fig 11 EF1a promoter is a robust promoter that is active most cell types including primary and stem cells 888 266 5066 Toll Free 650 968 2200 outside US Page 17 Sys
19. Transfection of a CRE GFP Construct Results in Efficient Abrogation of Floxed RFP Puro Cassette Expression in HEK293T Cells 4 Validation of HR By Genotyping We have designed a series of PCR primer pairs for the 5 and 3 homology arms to confirm the HR event has occurred in the targeted locus of interest By using one of the primers in the primer pair to bind to the genomic site either 5 or 3 ends flanking the cassette this allows for specific detection of HR events based on the expected sizes of the PCR amplicons Fig 14 Page 20 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 Left 830 bp Right 1281 bp a a aa o eN N LoxP msa EFA RFP T2A Puro PolyA i LoxP MM Con GT110L Con GT110R MM kd Figure 14 PCR Genotyping Analysis Demonstrating Successful HR Reaction in HEK293T cells C Additional Materials Required a LB Agar and Broth containing 50 ug ml ampicillin or Kanamycin b Any high transformation efficiency RecA and EndA E coli competent cells c Dulbecco s Modified Eagle s Medium D MEM high glucose with sodium pyruvate and glutamine Invitrogen Cat 11995073 d Lipofectamine 2000 transfection reagent Invitrogen Cat 11668019 e Qiagen EndoFree Plasmid Maxi Kit Qiagen Cat 12362 f Zyppy Plasmid MiniPrep Kit Zymo Research Cat D4019 g Phusion High Fidelity DNA Polymerase NEB Cat M0530S h Qiagen MinE
20. aetaeseaeseaeeneees 55 E Protocol for Gene Editing with TALEN Cas9 system and PiggyBac HR VECtOr eea inini i AEN 61 VI Referentes omia aeiee aa a a ANa 63 VII Technical Support ssessssesessieesirssrresrnssrrssrnssrrssrnssrresrn 65 VII Licensing and Warranty Statement ccceeeeeneees 65 Introduction P A Overview of Genome Engineering Tools Recent advances in tools available for precise genome engineering of target cells have revolutionized the field of biology The first of these revolutionary tools zinc finger nuclease ZFN technology has demonstrated that it can be successfully employed to introduce a double stranded DNA break at a defined location in the mammalian genome to age 2 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 introduce transgenes by homologous recombination HR Hockemeyer ef al 2009 This finding has since spurred follow up studies using HR based approaches to disrupt endogenous gene function and track cells that have been modified by ZFNs However inherent limitations of the ZFN technology have driven researchers to look at other alternatives that would be able to 1 target any sequence of interest with efficiencies rivaling ZFNs 2 increased predictability of targeting and 3 cost effective to implement for routine use in laboratories around the world Recent work with transcriptional activator like effector nucleases TALENs first described i
21. approaches by using either the 5 or 3 homology arm for single nucleotide modifications and inserting the selection cassette into a nearby intronic sequence This approach while technically not footprint free may be a more convenient method to generate lines harboring the desired change s with the flexibility of having a functional selection cassette located in a region of the genome that is not expected to have deleterious effect s on cell biology After generating clonal lines the selection cassette can also subsequently be excised using Cre recombinase leaving behind only a single LoxP site SBI s Knock Out vectors are a good choice for many gene editing applications and can be used following the guidelines for transfection of target cells in Section II F pg 26 B Additional Materials Required for PBHR100A 1 vector a LB Agar and Broth containing 50 pg ml ampicillin b Any high transformation efficiency RecA and EndA E coli competent cells c Dulbecco s Modified Eagle s Medium D MEM high glucose with sodium pyruvate and glutamine Invitrogen Cat 11995073 d Lipofectamine 2000 transfection reagent Invitrogen Cat 11668019 888 266 5066 Toll Free 650 968 2200 outside US Page 53 System Biosciences SBI User Manual e Qiagen EndoFree Plasmid Maxi Kit Qiagen Cat 12362 f Zyppy Plasmid MiniPrep Kit Zymo Research Cat D4019 g Phusion High Fidelity DNA Polymerase NEB
22. ctor format are built into the HR vectors The EF 1a alpha promoter is chosen to drive the dual marker expression because EF 1a promoter tends to be active in most cell types including primary and stem cells Insulation To ensure the expression of knock in genes insulation sequences are placed on both sides of the expression cassette This feature ensures the knock in cassette minimally impacts neighboring genes and is not silenced by the local environment where the knock in cassette has been placed Page 8 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 3 Built in LoxP Sites The built in LoxP sites allow for conditional knock in knock out In addition by removal of knock in genes via CRE the HR targeting vector can be reused to knockout another allele if double knockouts have not been achieved during the first attempt Extra MCS Extra MCS are available for researchers who wish to implement more complicated applications such as gene correction expression monitoring and gene therapy For HR7xx series vectors These specialized HR donor vectors contain a negative selection marker hsvTK that is located OUTSIDE of the 3 MCS to select against randomly integrated donor vector please see Section II A for additional details Note Above features do not apply to PBHR100A 1 vector except for insulators _PBHR100A 1 vector requires the use of the Excision Only SuperPiggyBac transp
23. ctor in conjunction with 1 yg of the HR targeting vector into cells for efficient cleavage and HR reaction For other cell types we suggest optimizing the amounts and ratios of Cas9 or TALEN to targeting vector for optimal results in a target cell line Allow at least 12 hours before changing transfection media to complete growth media Assay for HR events 48 96 hrs after co transfection Cutting efficiency of TALEN Cas9 can be measured by Surveyor Nuclease Assay and HR efficiency by FACS based on of GFP positive cells Puromycin selection can start 5 days after co transfection Continue growing cells in puromycin until distinct colonies begin to form 5 7 days depending on cells When large enough pick colonies to individual well of a 6 well plate under puromycin selection Isolate genomic DNA from each line and screen by PCR for clones that have the PBHR vector integrated at the correct location Design one genomic primer ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 outside each homology arm and on in the PBHR vector 8 Transfect lines with correct integrations with the Excision only SuperPiggyBac transposase using recommended amount for transfection 0 2ug 6 well plate Note To increase the chance for excision it is recommended to switch to media w o puromycin for 3 4 days which decreases selection pressure on cells to retain the PB cassette 9 Split cells 48 72 hours after
24. diately following the guide RNA sequence thus homology arms should be designed so that it is close as possible to the cut site lt 10bp at both ends for efficient HR reaction 5 Homology Arm 0 5 1 kb 3 Homology Arm 0 5 1 kb Til Cas9 Target sequence to cleave 1 Your guide RNA tracrRNA Figure 2 Schematic Diagram of Cas9 mediated Homologous Recombination HR Process 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual ll PrecisionX Targeting Vectors By Application Gene Knock Out A Overview of Gene Knock Out For HR based applications needing the disruption of a particular protein coding or non coding gene of interest a gene knockout targeting vector would be desirable This vector would include homology arms 0 5kb 1kb in length at the 5 and 3 regions immediately flanking the DNA sequence of interest e g exonic sequence to specifically direct the targeting vector to insert an expression cassette where the targeted sequence lies leading to the knock out of the sequence by gene addition SBI s gene knockout targeting vectors are designed to be vectors of choice for this application Gene specific homology arms can be cloned into MCS1 and MCS2 to direct ZFN TALEN or Cas9 mediated gene disruption Correctly disrupted cell lines are selected as RFP positive GFP for HR210PA 1 and HR410PA 1 and puromycin resistant colonies hy
25. e such applications have been demonstrated to correct single basepair mutations they often leave residual sequences behind such as oxP FRT sites van der Weyden et al 2002 or even selection markers with potentially unknown effects on transcription of neighboring genetic elements Meier et a 2010 The ideal system would be amenable for HR based correction of the mutation followed by a footprint free removal of selection cassettes or any recombinase artifacts Previous work on the piggyBac transposon system originally derived from baculovirus infecting moths has demonstrated that it can efficiently act as a transposon to insert and remove transgenes in mammalian cells by specific recognition of inverted terminal repeats flanking the transgene Lacoste et al 2010 By exploiting this aspect of the piggyBac 888 266 5066 Toll Free 650 968 2200 outside US Page 51 System Biosciences SBI User Manual system researchers have designed an HR targeting vector containing piggyBac inverted terminal repeats in conjunction with ZFNs to specifically target the A1AT locus in human iPSC cells to correct a single mutation responsible for a antitrypsin deficiency in a footprint free manner Yusa et al 2011 Nhel Swal Notl Bsal BspQI BamHI Spel EcoRI EF10H GFP 2A Puro 2A hTK pA M mcs PBHR100A 1 7925 bp MCS Multiple Cloning Sites amp Insulator Sequences Fi
26. e 5 homology arm is inserted into a site 10bp upstream of the correction site whose nucleotide sequence can be altered from CTG to TTA as a silent mutation The TTAA in 3 the homology arm shares the homology as well and contains the corrected base downstream The net result is seamless footprint free correction of the genomic sequence IMPORTANT NOTE When using ZFN TALE Nuclease or Cas9 mediated cleavage of the target genome please make sure that the recognition sequence is NOT PRESENT in its entirety in one of the homology arms in the PBHR vector If this occurs the donor vector along with the target genome will be cut leading to reduced or minimal HR efficiency Please make sure that the recognition sequence spans the 5 and 3 arms of the PBHR vector or mutate the recognition site present in the donor vector to minimize any possible cutting of the donor vector The detailed protocol for cloning of homology arms is shown below 1 Preparation of 5 Homology Arm a PCR the 5 HA and add any restriction site you choose from the 5 MCS except Bsal to the forward primer Add a Bsal site and the sequence GTTAA to the 3 end of the reverse HR primer Homology arms 888 266 5066 Toll Free 650 968 2200 outside US Page 57 System Biosciences SBI User Manual should be between 0 5kb to 1kb The 5 HA cannot contain a Bsal site 5 HA forward primer sequence Restriction site in 5 MCS of vector
27. ectors will assist the researcher in obtaining a higher frequency of correct clones positive for HR without background integration without the need for extensive optimization Finally SBI also offers a customizable version of HR110PA 1 without the RFP T2A Puro selection cassette Cat HR100PA 1 see Section Ill This vector contains a MCS which allows the user to insert their own cassette of choice to knock out a particular sequence of interest EcoRI Sacl Kpnl Nrul Nsil Bglll BamHI Sphi Xbal Not N Mcs1 EFD RFP T2A Puro PolyA gt MCS2 HR110PA 1 5767 bp Amp Replication MCS Multiple Cloning Sites gt LoxP Site Note M Experimentally Verified 8 Insulator Sequences Excellent Performer 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual Figure 3 Schematic Diagram of HR110PA 1 Gene Knock out Targeting Vector MCS1 EF1a RFP T2A Puro pA MCS2 Spel BsrGl Bsal Mcsip i EF1 gt GFP T2A Puro P2A TK PolyA mcs HR210PA 1 6903 bp Replication MCS Multiple Cloning Sites gt LoxP Sites 8 Insulator Sequences Figure 4 Schematic Diagram of HR210PA 1 Gene Knock out Targeting Vector MCS1 EF1a GFP T2A Puro P2A TK pA MCS2 EcoRI Sacl Kpni Nrul Nsil Bill Bardi Sal Sphi Xbal Noti
28. ene of your choice The gene of interest will be fused to GFP and will express luciferase as a separate protein for applications where quantitative measurement of endogenous gene expression is necessary The 5 homology arm GFP T2A Luciferase fusion segment is created using seamless fusion cloning technologies e g 888 266 5066 Toll Free 650 968 2200 outside US Page 41 System Biosciences SBI User Manual SBI s Cold Fusion Kit at the provided EcoRI site The 3 homology arm can be cloned into the MCS using Cold Fusion or by traditional cloning using the provided restriction sites The EF1a RFP T2A Puro cassette can be excised by expression of Cre recombinase leaving only the GFP Fusion T2A luciferase construct and a single LoxP site 4 GFP Co Expression Vector via Internal Ribosomal Eniry Site IRES EcoRI Sacl Nrul Nsil BamHI Sphi Xbal IRES GFP PolyA EF1 gt RFP T2A Puro PolyA HR180PA 1 7565 bp Replication Note Endogenous transcripts will be transcribed along with IRES GFP sequences This format simplify the design and allow easy implementation Useful for non coding RNA studies when fusion protein is not an option Figure 21 Schematic Diagram of HR180PA 1 IRES GFP Co Expression Targeting Vector IRES GFP pA MCS1 EF1o0 RFP T2A Puro MCS2 The HR180PA 1 vector is designed for coupled expression of the gene of interest to an eGFP marker by the use of an IRES elemen
29. g of SBI s Cas9 SmartNuclease vector in conjunction with 1 yg of the HR targeting vector into cells for efficient cleavage and HR reaction For other cell types we suggest optimizing the amounts and ratios of Cas9 or TALEN to targeting vector for optimal results in a target cell line Allow at least 12 hours before changing transfection media to complete growth media Assay for positive HR events 48 96 hours after co transfection Select cells with insertion of targeting vector using FACS based sorting of RFP GFP marker or Puromycin Hygromycin Blasticidin selection If using antibiotic selection select cells for a minimum of 5 days prior to further characterization Cutting efficiency of TALEN Cas9 can be measured by Surveyor Nuclease Assay and HR efficiency by FACS based on of RFP or GFP positive cells Genotyping of selected cells can be done by PCR of genomic DNA insert junctions at 5 and 3 ends of HR 888 266 5066 Toll Free 650 968 2200 outside US Page 27 System Biosciences SBI User Manual site see Fig 14 for details In brief design PCR primer pairs with one of the primers in the genomic DNA region and the other located in the HR vector Both 5 and 3 integration ends can be confirmed for complete verification of insertion 6 Selected cells can be clonally expanded for further phenotypic characterization lll PrecisionX Targeting Vectors By Application Gene Knock In A Overview of Gene Knock I
30. geting Vector cassette 10 pg 4 Gene Editing Cat PBHR100A 1 Description piggyBac based HR Donor Vector with GFP Puro markers and TK for negative selection Size 10 pg HR110PA 1 HR Targeting Vector w Dual Selection Markers RFP Puro 10 pg HR210PA 1 HR Targeting Vector w Dual Selection Markers GFP Puro and TK for negative selection 10 pg HR410PA 1 HR Targeting Vector w Dual Selection Markers GFP Puro 10 pg HR510PA 1 HR Targeting Vector w Dual Selection Markers RFP Hygromycin 10 pg 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual Cat Description Size HR Targeting Vector w Dual Selection Markers HR700PA 1 GFP Puro and Negative 10 ug Selection TK Against Random Integration HR Targeting Vector w Dual Selection Markers HR710PA 1 RFP Hygro and Negative 10 ug Selection TK Against Random Integration HR Targeting Vector w Single Selection Marker HR720PA 1 Blasticidin and Negative 10 ug Selection TK Against Random Integration Key Features 1 Dual markers Homology directed recombination using an exogenously supplied vector can result in targeted gene addition To facilitate the enrichment and selection of HR modified cells fluorescent markers RFP and GFP and positive selection markers Puromycin or Hygromycin depending on ve
31. gromycin for HR510PA 1 An example of targeting by HR110PA 1 targeting vector is shown in Figure 10 In addition the selection cassette is fully removable by expression of Cre recombinase not included In addition SBI also offers a series of three HR targeting vectors Cat HR700PA 1 HR710PA 1 and HR720PA 1 please see Figs 7 8 and 9 respectively for vector maps containing a PGK hsvTK selection cassette that is located outside of the 3 MCS homology arm cloning site The major advantage of these vectors is to help reduce random integration events associated with plasmid transfection by using negative selection hsvTK to eliminate cells that have integrated the donor plasmid not Page 12 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 via homologous recombination through nuclease mediated dsDNA breaks When the constructs are randomly integrated into the genome the PGK hsvIK cassette will be active and these cells will be sensitized to ganciclovir or fialuridine when added to the culture medium If the constructs are correctly targeted via HR the PGK hsvIK cassette is not incorporated into the genome because it is outside of the homology arms targeting the desired genomic locus thus making correctly targeted cells insensitive to TK mediated negative selection While the frequency of random integration can be mitigated by careful titration of the donor vector the use of these specialized v
32. gure 22 Schematic Diagram of PBHR100PA 1 HR Targeting Vector MCS1 5 PB_ ITR EF1a GFP T2A Puro T2A hsvTK pA MCS2 3 PB ITR SBI s PBHR100A 1 HR based gene editing vector Fig 22 has been designed to facilitate such precision correction of target genomes in a footprint free manner leaving only the native sequence behind after excision of the selection cassette when utilized in conjunction with ZFN TALEN or Cas9 systems By cloning of homology arms at the 5 and 3 end of the cutting site and one of the homology arms containing the desired correction this vector can be co transfected into target cells with ZFN TALEN or Cas9 vectors for HR based placement into the target genome The existing GFP and Puro positive selection markers driven by a robust EF1a promoter can be used to select for cells that are positive for HR followed by the use of the Excision only SuperPiggybac transposase enzyme Cat Page 52 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 PB220PA 1 to remove the selection cassette and any residual elements between the inverted terminal repeat elements flanking the selection cassette In addition a hsvTK negative selection marker is present in the selection cassette to select out any cells that have not excised the cassette when ganciclovir or fialuridine is added to the cells Alternatively SBI s Gene Knock Out vectors can also be utilized for gene editing
33. ibiotic selection markers and 2 a gene fragment of interest to knock in knock out or correct a wild type sequence will be extremely useful for obtaining a homogeneous population of cells whose genomes have been modified by ZFN TALEN or Cas9 systems These vectors when co transfected into target cells along with ZFNs TALEN or Cas9 vectors will take advantage of intrinsic homologous recombination HR processes conserved across all organisms for accurate repair of DSBs and insertion of Page 4 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 exogenous gene or marker of interest This is made possible by the fact that HR efficiencies are increased gt 1000 fold in the presence of a homologous donor sequence in mammalian cells Choulika et al 1995 making this a tractable approach to characterize phenotypic changes associated with gene targeting and potentially useful as a platform for gene therapy applications B Overview of PrecisionX Targeting Vectors for HR Based Applications We have generated a suite of homologous targeting vectors suitable for the purpose of engineering both protein coding and non coding genes including microRNAs and LncRNAs see Table 1 Table 1 List of Available PrecisionX HR Targeting Vectors By Application 1 Gene Knock Out Cat Description Size HR Targeting Vector HR110PA 1 w Dual Selection Markers 10 ug RFP Puro HR Targeting Vector w Dual Selecti
34. ications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2014 System Biosciences SBI Page 66 ver 16 122914 www systembio com
35. ition 19 5 yl 195 ul Nuclease free water 24 0 ul 240 pl Totalvolume _ d Mix the master mix very well and aliquot 24 ul into each well of 96 well PCR plate or individual tubes e Add 1 ul of each bacterial culture from step b into each well or tube f Proceed with PCR using the following program 94 C 4 min 1 cycle 94 C 0 5 min then 68 C 1 min 1 kb 25 cycles 68 C 3 min 1 cycle Depending on the size of final PCR product use a shorter or longer time g Take 5 ul of the PCR reaction and run it on a 1 5 2 agarose EtBr gel in 1X TAE buffer to identify clones with correct insert h Grow a positive clone containing insert in an appropriate amount of LB broth containing antibiotics and purify the construct using an endotoxin free plasmid purification kit Sequence verification of the insert is optional i Repeat the entire process with remaining homology arm to build the final targeting construct 888 266 5066 Toll Free 650 968 2200 outside US Page 25 System Biosciences SBI User Manual F Protocol for Co Transfection of Targeting 1 Page 26 Vector with TALEN or Cas9 plasmids and Characterization of Cells Notes Depending on the cell type being transfected please choose a transfection protocol which results in maximal transfection efficiencies For adherent cell lines such as HEK293T passive transfection methods using cationic lipid based methods e g Lipofecta
36. king the insert 10 rxn OTEN OS Tuls JulPoRpimerigoum nea 0 5 ul 5 u PCR primer2 10M 19 5 ul 195 l Nuclease free water 24 0 i 240 p Total volume _ _ d Mix the master mix very well and aliquot 24 ul into each well of 96 well PCR plate or individual tubes e Add 1 ul of each bacterial culture from step b into each well or tube f Proceed with PCR using the following program 888 266 5066 Toll Free 650 968 2200 outside US Page 33 System Biosciences SBI User Manual 94 C 4 min 1 cycle 94 C 0 5 min then 68 C 1 min 1 kb 25 cycles 68 C 3 min 1 cycle Depending on the size of final PCR product use a shorter or longer time g Take 5 ul of the PCR reaction and run it on a 1 5 2 agarose EtBr gel in 1X TAE buffer to identify clones with correct insert h Grow a positive clone containing insert in an appropriate amount of LB ampicillin broth and purify the construct using an endotoxin free plasmid purification kit Sequence verification of the insert is optional i Repeat the entire process with remaining homology arm or expression cassette to build the final targeting construct Page 34 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 E Protocol for Co Transfection of Targeting Vector with TALEN or Cas9 plasmids and Characterization of Cells Notes l Depending on the cell type being transfected please choose a transfec
37. lular repair machinery to drive non homologous end joining NHEJ processes in absence of homologous sequences whose error prone nature often leads to formation of indels in the targeted DNA sequences The main advantage of the CRISPR Cas9 system over the TALEN system is that it only requires an oligonucleotide sequence complementary to the target sequence in the format NeaNGG where N any nucleotide to effect cleavage which is much easier and less time consuming than other technologies With a simple design of an oligo sequence to target any gene or non coding sequence this opens up possibilities for precise multiplexed genome engineering that would have been unthinkable even a few years ago However in order to fully leverage the powerful nature of these genome engineering platforms there needs to be a set of ancillary tools that will allow detection of cells that have been modified by ZFN TALEN or Cas9 systems The majority of genome editing events affect only a percentage of the total population of transfected cells estimated at 1 80 for mono or bi allelic modifications depending on the platform the cell type and the DNA target of interest Due to the wide variation in activity performing downstream phenotypic assays in a background of wild type cells is challenging especially if the phenotype in question is subtle or difficult to discern Therefore tools in the form of donor or targeting vectors that contain 1 fluorescent or ant
38. lute Gel Extraction Kit Qiagen Cat 28604 888 266 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual i Fetal Bovine Serum Invitrogen Cat 16000036 j Penicillin Streptomycin Invitrogen Cat 15070063 k Surveyor Mutation Detection Kit Transgenomics Cat 706020 l Trypsin EDTA Sigma Cat T3924 m 6 well Tissue Culture Plates and Related Tissue Culture Supplies n Other specific media and additives specific for cell type of interest 0 Optional For difficult to transfect cells the use of an electroporation system e g Lonza s NucleoFector or Invitrogen s Neon system is highly recommended D General Considerations We recommend propagation of the HR targeting vector plasmid prior to starting the experiments The plasmids can be transformed using standard conditions suitable in any high quality RecA and EndA E coli competent cell For cells transformed with any of the targeting vectors we suggest plating 50 200 ul of transformed cells on fresh ampicillin or kanamycin plates 50 ug ml depending on the HR vector Incubate the plates at 37 C overnight Colonies picked from the transformation can be grown at 37 C overnight in 200 ml of LB media containing 50 ug ml of the appropriate antibiotic After overnight growth plasmid DNA can be harvested from culture using an endotoxin free DNA plasmid maxiprep kit For confirmation of the plasmid we recommend
39. mine 2000 FuGene HD work very well in transfection of targeting and TALEN Cas9 plasmids For other types of cells such as primary stem or suspension cells we suggest transfection using electroporation methods NucleoFection or Neon for optimal results The plasmids should be mixed well in minimal serum no antibiotic media cationic lipid transfection reagent or electroporation buffer to maximize efficiency of delivery For selection of target cells we strongly recommend testing different concentrations of puromycin on untransfected cells to determine the optimal concentration of selection agent which is kills 90 100 of cells within 48 72 hours after drug administration Plate 200 000 to 300 000 cells e g 293T cells into a single well of a 6 well plate in 2 ml of appropriate growth medium Include a single well of cells as ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 negative control which can be non relevant plasmid DNA Next day or when cells are 50 60 confluent co transfect target cells with either TALEN or Cas9 plasmid s and the HR targeting vector using a suitable transfection reagent following the manufacturers recommended protocol for 6 well plates The use of reduced or serum free media containing no antibiotics to dilute the vector transfection complex is highly recommended Note For 293T cells we suggest 0 5 ug of each TALEN 1 pg total for pair or 0 5 u
40. n For targeted insertion of any expression cassette into a specific location in the genome such as a safe harbor locus Sadelain et al 2011 for stable expression with minimal context dependent effects a HR based vector encoding for homology arms at 5 and 3 ends with an expression cassette between the homology arms would be desirable This strategy will require co transfection of ZFN TALEN or Cas9 plasmids with the knock in targeting vector into a safe harbor locus e g human AAVS7 or mouse Rosa26 SBI s gene knock in targeting vector Cat HR100PA 1 is designed to be the vector of choice for this application Fig 15 Page 28 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 EcoRI Sacl KpnI Nrul Nsil Bglll BamHI Sall Sphl Hindill Xbal Notl BstBl Sacil mcs1 mcs2 MCS3 H pA HE Mcs4 HR100 PA 1 3856 bp Amp Replication Multiple Cloning Sites gt LoxPSite is Insulator Sequences Figure 15 Schematic Diagram of HR100PA 1 Gene Knock in Targeting Vector This is the most basic HR targeting vector which allows the most flexibility for the end user Homology arm sequences of 0 5kb to 1kb can be cloned into MCS1 5 HA and MCS4 3 HA and an expression cassette of your choice can then be cloned into MCS3 The maximal size of the expression cassette can be upwards of 6 8kb
41. n media to complete growth media Assay for positive HR events 48 96 hours after co transfection Select cells with insertion of targeting vector using FACS based sorting of RFP or antibiotic selection markers Puromycin or Hygromycin depending on the HR donor vector If using antibiotic selection markers select cells for a minimum of 5 days prior to further characterization Cutting efficiency of TALEN Cas9 can be measured by Surveyor Nuclease Assay and HR efficiency by FACS based on of RFP positive cells Genotyping of selected cells can be done by PCR of genomic DNA and vector for 5 and 3 homology arms In brief design PCR primer pairs with one of the ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 primers in the genomic DNA region and the other located in the HR vector Both 5 and 3 integration ends can be confirmed for complete verification of insertion In addition the junction between the targeted exon and the ORF for GFP or T2A can be sequenced to confirm successful in frame fusion 6 Selected cells can be clonally expanded for further phenotypic characterization V PrecisionX Targeting Vectors By Application Gene Editing A Overview of Gene Editing One of the most challenging applications for genome engineering using HR mediated approaches is gene editing or the ability to correct or insert a single base e g SNP in presence of excess genomic background Whil
42. n Detection Kit Transgenomics Cat 706020 l Trypsin EDTA Sigma Cat T3924 m 6 well Tissue Culture Plates and Related Tissue Culture Supplies n Other specific media and additives specific for cell type of interest o Optional For difficult to transfect cells the use of an electroporation system e g Lonza s NucleoFector or Invitrogen s Neon system is highly recommended C General Considerations We recommend propagation of the HR targeting vector plasmid prior to starting the experiments The plasmids can be transformed using standard conditions suitable in any high quality RecA and EndA E coli competent cell Page 30 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 For cells transformed with any of the targeting vectors we suggest plating 50 200 ul of transformed cells on fresh ampicillin plates 50 ug ml Incubate the plates at 37 C overnight Colonies picked from the transformation can be grown at 37 C overnight in 200 ml of LB media containing 50 ug ml of ampicillin After overnight growth plasmid DNA can be harvested from culture using an endotoxin free DNA plasmid maxiprep kit For confirmation of the plasmid we recommend performing restriction digestion analysis or direct sequencing to confirm integrity of the amplified plasmids D Cloning of Homology Arms and Expression Cassette into Vector For fast and efficient cloning of homology arms and expression
43. n be harvested from culture using an endotoxin free DNA plasmid maxiprep kit For confirmation of the plasmid we recommend performing restriction digestion analysis or direct sequencing to confirm integrity of the amplified plasmids D Cloning of Homology Arms into Vector In general for all of the tagging and co expression vectors with a single EcoRI site excluding HR180PA 1 the cloning of the 5 homology arm is best achieved through fusion cloning strategies such as SBI s Cold Fusion Kit Please refer to the user manual for the Cold Fusion Kit for Page 44 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 details on the cloning process http www systembio com molecular tools cold fusion cloning literature For these vectors the 5 homology arm may be designed to be immediately adjacent to a stop codon of the last exon being targeted allowing the construct to be in frame with the GFP or T2A sequence PCR amplicon size 0 5kb to 1kb As an example for cloning the following sequence is for the HR120PA 1 vector If using SBI s Cold Fusion kit to clone the 5 homology arm in frame with the GFP in the targeting vector the following would be the primer sequences Forward Primer 5 AAAACGACGGCCAGT SAMIR NNNNNNNNNNNNNNNNNN 3 888 266 5066 Toll Free 650 968 2200 outside US Page 45 System Biosciences SBI User Manual Reverse Primer 5 GRSSRSSSSTSSATGAAIIG
44. n the plant pathogen Xanthomonas sp have shown that researchers can efficiently target any genomic DNA sequence using a pair of custom TALEN proteins whose DNA binding modules can recognize individual DNA nucleotides based on an elegant amino acid cipher Boch et al 2009 Based on the explosion of recent publications that have successfully demonstrated the utility of the TALEN platform in many eukaryotic model organisms ranging from zebrafish to humans it has quickly established itself as the de facto platform for genome engineering While TALEN technology has been gaining acceptance in the research community the continual advances being made in this field has uncovered another novel yet potentially powerful tool for genome engineering based on a bacterial system for combating invading viral and nucleic acid sequences termed CRISPR Cas9 Originally discovered in the pathogenic bacterium Streptococcus pyogenes this system uses an unusual series of short RNAs collectively termed as guide RNA to specifically target a complementary DNA sequence and upon binding leads to recruitment of an endonuclease called Cas9 to specifically induce a double stranded break DSB in the DNA sequence targeted by the guide RNA 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual Bhaya et al 2011 Jinek et al 2012 Similar to TALENs the introduction of DSBs in the DNA leads to recruitment of the cel
45. nd TALEN Cas9 plasmids For other types of cells such as primary stem or suspension cells we suggest transfection using electroporation methods NucleoFection or Neon for optimal results The plasmids should be mixed well in minimal serum no antibiotic media cationic lipid transfection reagent or electroporation buffer to maximize efficiency of delivery For selection of target cells we strongly recommend testing different concentrations of puromycin on untransfected cells to determine the optimal concentration of selection agent which is kills 90 100 of cells within 48 72 hours after drug administration Plate 200 000 to 300 000 cells e g 293T cells into a single well of a 12 well plate in 1 ml of appropriate growth medium Include a single well of cells as negative control which can be non relevant plasmid 888 266 5066 Toll Free 650 968 2200 outside US Page 61 System Biosciences SBI User Manual N Page 62 DNA Next day or when cells are 50 60 confluent co transfect target cells with either TALEN or Cas9 plasmid s and the HR targeting vector using a suitable transfection reagent following the manufacturers recommended protocol for 12 well plates The use of reduced or serum free media containing no antibiotics to dilute the vector transfection complex is highly recommended Note For 293T cells we suggest 0 5 ug of each TALEN 1 pg total for pair or 0 5 ug of SBI s Cas9 SmartNuclease ve
46. new DNA in the human genome Nat Rev Cancer 2011 Dec 1 12 1 51 8 Van der Weyden L et al Tools for targeted manipulation of the mouse genome Physiol Genomics 2002 Dec 3 11 3 133 64 Meier ID et al Short DNA sequences inserted for gene targeting can accidentally interfere with off target gene expression FASEB J 2010 24 1714 1724 Lacoste A et al An efficient and reversible transposable system for gene delivery and lineage specific differentiation in human embryonic stem cells Cell Stem Cell 2009 Sep 4 5 3 332 42 Yusa K et al Targeted gene correction of a1 antitrypsin deficiency in induced pluripotent stem cells Nature 2011 Oct 12 478 7369 391 4 Page 64 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 Vil Technical Support For more information about SBI products or to download manuals in PDF format please visit our website http www systembio com For additional information or technical assistance please call or email us at tech systembio com 650 968 2200 Vill Licensing and Warranty Statement Limited Use License Use of the PrecisionX HR Targeting Vectors i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms The pu
47. on Markers 10 GFP Puro and TK for Hg negative selection HR Targeting Vector HR410PA 1 w Dual Selection Markers 10 ug GFP Puro HR Targeting Vector HR510PA 1 w Dual Selection Markers 10 ug RFP Hygromycin HR210PA 1 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual HR Targeting Vector w Dual Selection Markers HR700PA 1 GFP Puro and Negative 10 ug Selection TK Against Random Integration HR Targeting Vector w Dual Selection Markers HR710PA 1 RFP Hygro and Negative 10 yg Selection TK Against Random Integration HR Targeting Vector w Single Selection Marker HR720PA 1 Blasticidin and Negative 10 ug Selection TK Against Random Integration 2 Gene Knock In Description Basic HR Targeting Vector HR100PA 1 For Gene Knock In or 10 yg Knock Out MCSs only 3 Reporter Gene Tagging amp Co Expression Description GFP Fusion HR120PA 1 HR Targeting Vector 10 ug w EF1a RFP T2A Puro cassette Page 6 ver 16 122914 www systembio com PrecisionX Vectors HR130PA 1 T2A GFP Co Expression Cat HRxxxPA 1 PBHR100A 1 HR Targeting Vector 10 pg HR150PA 1 Co expressed Luciferase GFP T2A Luciferase HR Targeting Vector GFP Fusion with 10 pg HR180PA 1 IRES GFP Co Expression HR Targeting Vector 10 pg HR220PA 1 w EF1a RFP T2A Hygro GFP Fusion HR Tar
48. or electroporation buffer to maximize efficiency of delivery III For selection of target cells we strongly recommend testing different concentrations of puromycin on untransfected cells to determine the optimal concentration of selection agent which is kills 90 100 of cells within 48 72 hours after drug administration 1 Plate 200 000 to 300 000 cells e g 293T cells into a single well of a 6 well plate in 2 ml of appropriate growth medium Include a single well of cells as negative control which can be non relevant plasmid 888 266 5066 Toll Free 650 968 2200 outside US Page 49 System Biosciences SBI User Manual Page 50 DNA Next day or when cells are 50 60 confluent co transfect target cells with either TALEN or Cas9 plasmid s and the HR targeting vector using a suitable transfection reagent following the manufacturers recommended protocol for 6 well plates The use of reduced or serum free media containing no antibiotics to dilute the vector transfection complex is highly recommended Note For 293T cells we suggest 0 5 ug of each TALEN 1 pg total for pair or 0 5 ug of SBI s Cas9 SmartNuclease vector in conjunction with 1 yg of the HR targeting vector into cells for efficient cleavage and HR reaction For other cell types we suggest optimizing the amounts and ratios of Cas9 or TALEN to targeting vector for optimal results in a target cell line Allow at least 12 hours before changing transfectio
49. osase enzyme Cat no PB220PA 1 for removal of selection cassette present in the vector Design Considerations for Homologous Recombination Arms With several different genome engineering tools available to induce targeted DSBs such as SBI s EZ TAL TALEN kit http Awww systembio com tale effector technology nuclease and Cas9 SmartNuclease system http www systembio com genome engineering cas9 crispr smartnuclease there is a need for suitable vectors that will serve as the guide template to induce HR in cells that have been targeted using the aforementioned tools A general targeting vector will contain the following features 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual 1 Homologous sequences to the template with DSBs at 5 and 3 ends of the DSB site 2 An expression cassette bearing a promoter insert cDNA microRNA non coding RNA etc fluorescent marker or selection agent to select cells that have undergone HR The 5 and 3 homologous sequences termed homology arms should be exactly homologous to the template with the DSB and preferably adjacent to the actual DSB site For TALEN mediated cleavage this would entail designing homology arms that are adjacent to the spacer region between TALEN binding sites which spans 15 30bp and is the site of the DSB An example of homology arm design is shown in Figure 1 Genomic DNA c Ta
50. owth plasmid DNA can be harvested from culture using an endotoxin free DNA plasmid maxiprep kit For confirmation of the plasmid we recommend performing restriction digestion analysis or direct sequencing to confirm integrity of the amplified plasmids D Design and Cloning of Homology Arms into Vector for PBHR100A 1 vector In general cloning of the 5 and 3 homology arms is best achieved through fusion cloning strategies such as SBI s Cold Fusion Kit Please refer to the user manual for the Cold Fusion Kit for details on the cloning process http www systembio com molecular tools cold fusion cloning literature The cloning of the homology arms into the PBHR100A 1 vector has some special considerations that need to be followed for successful cloning The design necessitates that the 5 homology arm terminates with TTAA and the 3 homology arm begins with TTAA This is purposely designed to mimic the insertion of a transgene cassette into the genome by the piggyBac transposase which recognizes a TTAA site in the genome and inserts the cassette flanked by inverted tandem repeats into this site The inserted cassette now will be flanked by two TTAA sites one at the 5 end and at the 3 end When the piggyBac transposase is added to excise the cassette it will leave a single TTAA site behind in the genome lf this TTAA site does not have a homologous sequence in the genome nearby the desired correction site it will be
51. rchaser of the Product is granted a limited license to use the Product under the following terms and conditions e The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use e The Product may not be resold modified for resale or used to manufacture commercial products without prior written consent of SBI e This Product should be used in accordance with the NIH guidelines developed for stem cell research 888 266 5066 Toll Free 650 968 2200 outside US Page 65 System Biosciences SBI User Manual SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specifications described in this manual If it is proven to the satisfaction of SBI that the Product fails to meet these specif
52. rgeting Vector TCCCCTCCACCCC CAGGATTGGTGACAGAAAA y 0 8kb 0 8kb Genomic DNA Targeting Vector TOCCCTCCACKE ae Homologous Recombination Genomic DNA TACTAGGGACAGGATTGGTGACA Excised DNA TECCCTCCACCCCACAGT AGAMA Figure 1 Schematic Diagram of TALEN mediated Homologous Recombination HR Process In this figure a region of the human AAVS1 locus in blue that is targeted by a pair of TALENs is used for inserting an EF1a RFP T2A Puro expression cassette in red present in the HR targeting vector The HR targeting vector also bears homology arms at the 5 and 3 end of the expression cassette that contains 0 8kb of sequence Page 10 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 homology to the genomic DNA surrounding the AAVS1 locus This region of homology is crucial for the success of the homologous recombination reaction as it serves as the guide template for specifically targeting the exogenous cassette into this genomic locus The typical range of sizes for homology arms varies by the application but it should be anywhere from 0 5kb to 1kb for each arm for efficient recombination to occur Please note that the actual regions of recombination Red Xs at the 5 and 3 of the target site can vary widely thus it is difficult to predict the actual sites as this is determined by the cell For Cas9 system the cleavage site is 2 3bp upstream of the protospacer adaptor motif PAM imme
53. s at 25 C for 1 2 hours sticky end ligation or O N at 16 C for blunt end ligation 3 Transform E coli with the ligation product Transform competent cells with a transformation efficiency of at least 1x10 colonies ug pUC19 with the whole ligation reaction 10 ul following the protocol provided with the competent cells Plate the transformed bacteria on 50 ug ml ampicillin agar plates 4 Identify clones with the correct insert a Depending on the ratio of colony numbers for the test sample vs the negative control sample randomly pick 2 or 3 colonies and grow each clone in 100 ul of LB Broth with 100 ug ml ampicillin at 37 C for 2 hours with shaking b Use 1 ul of each bacterial culture for screening homology arm inserts by PCR and continue to grow the culture for another 4 hours Store the culture at 4 C c Prepare a PCR Master Mix with PCR primers flanking the insert 888 266 5066 Toll Free 650 968 2200 outside US Page 47 System Biosciences SBI User Manual PCR primer 2 10 uM 50X dNTP mix 10 mM of each 25 fuf 25 u TOPOR Reaction Buter 79 5 ul 195 ul Nuclease tree water 05 u 5 pl Taq DNA polymerase approx 5 Ulu 24 0 p 240 yl Totalvolume d Mix the master mix very well and aliquot 24 ul into each well of 96 well PCR plate or individual tubes e Add 1 ul of each bacterial culture from step b into each well or tube f Proceed with PCR using the following program 94 C
54. t which aids in translation of the eGFP protein This vector is especially useful for monitoring expression of non coding transcripts e g microRNA lincRNAs that are targeted by TALEN or Cas9 systems for functional studies The 5 homology arm can be cloned into the vector by traditional restriction enzyme cloning or by fusion cloning methods to the 3 end of your gene of your choice using the provided restriction sites directly upstream of the IRES element The 3 homology Page 42 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 arm can be cloned into MCS2 using the same cloning methods Since the IRES controls the expression of the eGFP the gene of interest does not have to be in frame with eGFP and in cases of cDNA inserts the presence of a stop codon in the sequence does not affect eGFP expression The EF1a RFP T2A Puro cassette can be excised by expression of Cre recombinase leaving only the GOI IRES eGFP construct and a single LoxP site B Additional Materials Required a LB Agar and Broth containing 50 pg ml ampicillin b Any high transformation efficiency RecA and EndA E coli competent cells c Dulbecco s Modified Eagle s Medium D MEM high glucose with sodium pyruvate and glutamine Invitrogen Cat 11995073 d Lipofectamine 2000 transfection reagent Invitrogen Cat 11668019 e Qiagen EndoFree Plasmid Maxi Kit Qiagen Cat 12362 f Zyppy Plasmid Mini
55. t up 10 ul ligation reactions for each control and test samples as below 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI User Manual Volume Item 1 0 ul HR Targeting vector 7 0 ul 5 or 3 homology arm PCR product 70 ng or water control 1 0 ul 10X T4 DNA ligase buffer 1 0 ul T4 DNA Ligase 40 U ul 10 0 pl Total Reaction Volume e Incubate reactions at 25 C for 1 2 hours sticky end ligation or O N at 16 C for blunt end ligation Transform E coli with the ligation product Transform competent cells with a transformation efficiency of at least 1x10 colonies ug pUC19 with the whole ligation reaction 10 ul following the protocol provided with the competent cells Plate the transformed bacteria on 50 ug ml of appropriate antibiotic in agar plates Identify clones with the correct insert a Depending on the ratio of colony numbers for the test sample vs the negative control sample randomly pick 2 or 3 colonies and grow each clone in 100 ul of LB Broth with 100 ug ml of appropriate antibiotic at 37 C for 2 hours with shaking b Use 1 ul of each bacterial culture for screening homology arm inserts by PCR and continue to grow the culture for another 4 hours Store the culture at 4 C c Prepare a PCR Master Mix with PCR primers flanking the insert Page 24 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 1 rxn 10 rxn Compos
56. tem Biosciences SBI User Manual nno gt VU HEK293T Plasmid HEK293T w o Plasmid Figure 11 RFP and Puromycin Resistance in HEK293T Cells Transfected with HR110PA 1 Targeting Vector 2 Robustness of Insulators in Preventing Silencing of Expression Cassette To ensure that integration of expression cassette will not be inactivated by epigenetic modifications or influenced by neighboring sequences insulator sequences are implemented in HR vectors Cells with successful HR events show prolonged RFP positivity and persistent puromycin resistant for more than 3 months in culture Fig 12 Page 18 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 Figure 12 HR modified HEK293T Cells using Targeting Vector Remain RFP Positive and Puromycin Resistant for More Than 3 Months 3 Excision of Expression Cassette with Cre LoxP System The HR knock out targeting vectors contain LoxP sites flanking the expression cassette floxed which can be used to easily remove the expression cassette in the presence of Cre recombinase Fig 13 by the well validated LoxP Cre excision reaction This feature of the donor vector allows for conditional expression of the cassette and phenotype screening in the cell line of interest 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual a RW D a 4 UI oh CRE GFP LoxP LoxP CRE GFP Figure 13
57. the order that the homology arms will be cloned into the PBHR vector based on which restriction sites are used 888 266 5066 Toll Free 650 968 2200 outside US Page 59 System Biosciences SBI User Manual 1 12 Page 60 Cut the PBHR vector with the 5 MCS enzyme you chose and with Bsal Run out the reaction on an agarose gel Cut out the band of the correct size and purify Quantitate the DNA Ligate in the 5 HA fragment Use a recombination deficient competent bacterial strain for the transformation Screen colonies for the clone of interest Cut the PBHR vector containing the 5 HA with the enzyme you chose in the 3 MCS and with BspQI Run out the reaction on an agarose gel Cut out the band of the correct size and purify Quantitate the DNA Ligate in the 3 HA fragment Use a recombination deficient competent bacterial strain for the transformation Screen colonies for the clone of interest ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 E Protocol for Gene Editing with 1 TALEN Cas9 system and piggyBac HR vector Notes Depending on the cell type being transfected please choose a transfection protocol which results in maximal transfection efficiencies For adherent cell lines such as HEK293T passive transfection methods using cationic lipid based methods e g Lipofectamine 2000 FuGene HD work very well in transfection of targeting a
58. tion protocol which results in maximal transfection efficiencies For adherent cell lines such as HEK293T passive transfection methods using cationic lipid based methods e g Lipofectamine 2000 FuGene HD work very well in transfection of targeting and TALEN Cas9 plasmids For other types of cells such as primary stem or suspension cells we suggest transfection using electroporation methods NucleoFection or Neon for optimal results Il The plasmids should be mixed well in minimal serum no antibiotic media cationic lipid transfection reagent or electroporation buffer to maximize efficiency of delivery III For selection of target cells we strongly recommend testing different concentrations of puromycin on untransfected cells to determine the optimal concentration of selection agent which is kills 90 100 of cells within 48 72 hours after drug administration 1 Plate 200 000 to 300 000 cells e g 293T cells into a single well of a 6 well plate in 2 ml of appropriate growth medium Include a single well of cells as negative control which can be non relevant plasmid 888 266 5066 Toll Free 650 968 2200 outside US Page 35 System Biosciences SBI User Manual 5 Page 36 DNA Next day or when cells are 50 60 confluent co transfect target cells with either TALEN or Cas9 plasmid s and the HR targeting vector using a suitable transfection reagent following the manufacturer s recommended protocol for 6 well
59. tor T2A GFP pA EF1a RFP T2A Puro MCS The HR130PA 1 vector is designed to direct the T2A peptide GFP linkage to the 3 end of your gene of choice This vector will be used in cases where a GFP fusion will Page 40 ver 16 122914 www systembio com PrecisionX Vectors Cat HRxxxPA 1 PBHR100A 1 affect the function of the endogenous gene of interest The 5 homology arm T2A GFP linkage segment is created using seamless fusion cloning technologies e g SBI s Cold Fusion Kit at the provided EcoRI site The 3 homology arm can be cloned into the MCS using Cold Fusion or by traditional cloning using the provided restriction sites The EF1a RFP T2A Puro cassette can be excised by expression of Cre recombinase leaving only the GOI T2A GFP construct and a single LoxP site 3 GFP Fusion and Luciferase Co Expression Vector EcoRI BamHI Sall GFP T2A Luci PolyA EF RFP T2A Puro PolyA hmcs HR150PA 1 8556bp Replication Note Endogenous protein is tagged with GFP Co expression of luciferase allows quantification of gene expression and in vivo imaging via BLI Therefore gene expression localization and expression levels can be monitored and quantified Figure 20 Schematic Diagram of HR150PA 1 GFP Fusion and Luciferase Co Expression Targeting Vector GFP T2A Luc pA EF1a RFP T2A Puro MCS The HR150PA 1 vector is designed to direct the in frame fusion of GFP T2A Luciferase to the 3 end to your g
60. transfection with the transposase 10 24 hours later switch to media containing 2 10yg ml of ganciclovir to select out cells containing the expression cassette 11 Continue growing cells in ganciclovir media until distinct colonies begin to form 5 10 days depending on cells 12 Remaining colonies should be GFP puro and ganciclovir 13 Isolate genomic DNA from cell lines and use PCR to confirm the absence of the PBHR vector and to amplify the region containing the correction 14 Confirm correction by DNA sequencing VI References 888 266 5066 Toll Free 650 968 2200 outside US Page 63 System Biosciences SBI User Manual Hockemeyer D et al Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc finger nucleases Nat Biotechnol 2009 27 851 857 Boch J et al Breaking the code of DNA binding specificity of TAL type Ill effectors Science 2009 Dec 11 326 5959 1509 12 Bhaya D et al CRISPR Cas systems in bacteria and archaea Versatile small RNAs for adaptive defense and regulation Annu Rev Genet 2011 45 273 97 Jinek M et al A programmable dual RNA guided DNA endonuclease in adaptive bacterial immunity Science 2012 Aug 17 337 6096 816 21 Choulika A et al Induction of homologous recombination in mammalian chromosomes by using the Sce system of Saccharomyces cerevisiae Mol Cell Biol 1995 Apr 15 4 1968 73 Sadelain M et al Safe harbours for the integration of

Download Pdf Manuals

Related Search

Related Contents

    EA 910 owner manual & parts list 05122013  Valueline VLSP40290W150 coaxial cable  piano di sicurezza e coordinamento    Sony VAIO NR21S + Microsoft Office Small Business 2007  開 札 結 果 表  Samsung 냉장고 585 L  Chapter 15 - Forms Engine  

Copyright © All rights reserved. Failed to retrieve file