Home

GeneChip Expression Analysis Technical Manual

Contents

1. IV Display settings when analyzing data Figure 4 1 15 Expression Analysis Settings dialog box Only mask files from the current Probe Information folder will be automatically displayed in this window To edit mask files stored in other locations use the Look in drop down list to locate the folder containing the desired file The Probe Mask Definition dialog box Figure 4 1 16 allows the user to define the probe pairs for exclusion from analysis There are four ways to generate Probe Mask files The first is manual selection of the probe pairs In addition to the manual method there are three utilities for creating Probe Mask files CHAPTER 1 Data Analysis Peer a Mask File neww MSK ma Probe Sets Probe Pairs X Figure 4 1 16 Probe Mask Definition dialog box Defining the Probe Mask File Manually Using Cross Hyb AFFYMETRIX Probe Mask files may be generated manually by selecting the desired probe set from the Probe Sets drop down list then defining the particular probe pairs to be excluded from analysis in the Probe Pairs field format 1 3 7 Once the selection from the current probe set has been completed click within the main field of the dialog box to accept the selection It will then be added to the list in this field The process is repeated for each probe set which will have probe pairs masked until the list in the main field represents the complete list of Probe Sets and Probe Pai
2. AFFYMETRIX 2 Incubate at 94 C for 35 minutes Put on ice following the incubation 3 Save an aliquot for gel analysis At least 1 ug fragmented cRNA is needed if using ethidium bromide for staining the gel Less RNA can be used with SYBR Green II staining See Step 4 Checking Unfragmented Samples by Gel Electrophoresis on page 2 1 22 for information regarding gel electrophoresis The standard fragmentation procedure should produce a distribution of RNA fragment sizes from approximately 35 to 200 bases An example of a gel with cRNA samples before and after fragmentation is shown below a Store undiluted fragmented sample RNA at 20 C until ready to perform the hybridization as described in Section 2 Chapter 3 1636 1018 gt 506 517 200 100 Figure 1 2 Monitoring of target preparation by agarose gel electrophoresis 2 1 23 Eukaryotic 2 1 24 SECTION 2 Eukaryotic Sample and Array Processing 1 Incyte Genomics Inc has asserted that the use of this protocol within the United States infringes U S Patent Nos 5 716 785 and 5 891 636 Affymetrix and Incyte Genomics Inc are currently litigating this and related issues Use of this protocol outside the United States does not infringe these patents To the extent that users of this protocol wish to seek a license of these patents for use in the United States they may contact Incyte Genomics Inc 3160 Porter Drive Palo Alto California 9430
3. Chapter 1 701022 rev 1 GeneChip Expression Analysis Overview 1 1 3 Section I Chapter I 701023 rev 1 E a GeneChip Expression Analysis Overview Introduction and OHJEGUMES 3 32264 48406 o Shae WE Ye 1 1 4 Explanation of GeneChip PrODEATMTAYS sma sus l nA di aS La saba mi 1 1 4 GeneChip Expression Analysis Overviewv 1 1 5 Precautions E RE Neige 1 1 6 TEMNO OE usd rd ara dak A Slo ee dcha eG dob hk GA 1 1 7 interierine Conditions es s ee be War set dis de e et 1 1 7 runim id EA BOS RESO jr Ane jin ew 11 7 References Gan AAA Oe AAA De SS 117 MANO e UD a a ole ir ate je oh Sic ay he ee O de o o ed dk sein 11 7 This Chapter Contains m An overview of GeneChip Expression Analysis m summary of the procedures covered in the remainder of the manual 701023 rev 1 1 1 3 SECTION 1 GeneChip Expression Analysis Overview Introduction and Objectives Welcome to the Affymetrix GeneChip Expression Analysis Technical Manual This manual is a technical guide for using GeneChip expression analysis probe arrays All protocols included in this manual have been used successfully by scientists at Affymetrix or have been recommended by our collaborators during the development of particular products The field of mRNA gene expression monitoring is rapidly evolving and periodic technical updates to this manual will reflect the newest protocols and information for
4. Data Analysis 4 1 12 SECTION 4 Data Analysis If the status bar is not displayed click the Status Log button E in the main toolbar or select View Status Bar from the main menu When the analysis is finished the Expression Analysis window EAW opens and displays the analysis output file chp Figure 4 1 4 If the EAW is already open the results are added to the open window and it may be necessary to use the scroll bars at the bottom and right side of the EAW to see the newly added results Comparison Expression Analysis of the Experiment and Baseline 1 In the data file tree right click the experiment cell intensity file cel and select Analyze from the pop up menu Alternatively 1 select File Analysis from the main menu and choose the desired cel file from the Analyze dialog box that appears or 2 if the image is displayed click the Analyze button EZ or select Run Analysis from the main menu The Save Results As dialog box appears if chosen as a default option It displays the analysis output file chp default name which is the same as the experiment name specified during experiment setup Figure 4 1 7 Save Results As Ea Enter a Chip File Name Timepointo CHP Figure 4 1 7 Save Results As dialog box 2 Enter a new name if an analysis was previously run and you wish to save the current results without overwriting the previous results Click OK The Expression Analysis Settings d
5. a 4444 su us ss 215 S Reagent Preparations ss kaa sma k al a HEBD DY OE ae A Br 3 SONA y ria Raa aa noue oa 2 1 9 E Isolation of RNA Prom Yeasts dans a die eu es da ek ia 219 Isolation of RNA from Arabidopsis 2 1 9 Isolation of RNA from Mammalian Cells or Tissues 2 1 10 Precipitation Di RNA 4 5 os 244 669 a e Dane RES 2 1 10 Quantitationof RNA usina kaa ERD RRA RHE 6 maksame s A 2 111 Synthesis of Double Stranded cDNA From Purified Poly A mRNA 2 1 12 Step 1 First Strand DNA Synthesis 4 lt i 4 dwa ea an l u 2 1 12 Step 2 Second Strand cDNA Synthesis 2 1 13 Synthesis of Double Stranded cDNA from TotalRNA 2 1 14 Step 1 First Strand cDNA Synthesis sa sw ss s auras EEO K vecje a 2 1 14 Step 2 Second Strand cDNA Synthesis 2 422244 42244 aa timia 2 1 16 Cleanup of Double Stranded cDNA 2 1 17 Step 1 Phase Lock Gels PLG Phenol Chloroform Extraction 2 1 17 Step 2 Ethanol Precipitation o e i a Gab a dd a we aes 2 1 17 Synthesis of Biotin LabeledcRNA 2 119 Cleaning Up and Quantifying In Vitro Transcription IVT Products 2 1 20 Step lin Vitro Transcription Clean Up e acia eee 2Q 4i a ea eee wD 2 1 20 Step 2 Ethanol Precipitation s s i LS ne sl a daya yan a eat se e 2 1 21 Step 3 Quantifying the CRN
6. are hybridized to the probe array The hybridized probe array is stained with streptavidin phycoerythrin conjugate and scanned by the GeneArray Scanner at the excitation wavelength of 488 nm The amount of light emitted at 570 nm is proportional to the bound target at each location on the probe array CHAPTER 1 GeneChip Expression Analysis Overview GeneChip Expression Analysis Overview The following major steps outline GeneChip Expression Analysis 1 Target Preparation 2 Target Hybridization 3 Experiment and Fluidics Station Setup 4 Probe Array Washing and Staining 5 Probe Array Scan 6 Data Analysis Due to the differences in the RNA species between eukaryotic and prokaryotic organisms different target labeling protocols have been optimized for eukaryotic and E coli samples Sections 2 and 3 provide detailed protocols for target preparation hybridization array washing and staining for eukaryotic arrays and E coli arrays respectively Please refer to the sections in this manual for detailed protocols appropriate for your arrays Step 1 Target Preparation This manual describes procedures for preparing biotinylated target RNA or cDNA from purified eukaryotic and prokaryotic RNA samples suitable for hybridization to GeneChip expression probe arrays These procedures are recommendations only For more information on these procedures please contact Affymetrix Technical Support at 1 888 DNA CHIP For euka
7. b a K SR An A 3 113 Gel SKI ASSON ab Go ko SOE l SILA AA A 3 1 14 This Chapter Contains a instructions for enriching fragmenting and labeling RNA target from E coli cells After completing the procedures described in this chapter the labeled and fragmented target is hybridized to the GeneChip E coli Genome Array as described in Section 3 Chapter 3 701030 rev1 3 1 3 SECTION 3 Prokaryotic Sample and Array Processing Introduction This chapter describes the assay procedures recommended for use with GeneChip E coli Genome Array These procedures differ from the those described under the previous section primarily because unlike their eukaryotic counterpart the majority of E coli messenger RNAs do not contain poly A tails To enrich for mRNA species a procedure designed to remove 16S and 23S ribosomal RNAs which constitute approximately 90 of the total RNA population is utilized The resulting RNA population is then directly labeled with biotin mRNA Enrichment Procedure The enrichment procedure is a series of enzymatic steps that specifically eliminate the 16S and 23S rRNA species in the total E coli RNA Reverse transcriptase and primers specific to 16S and 23S rRNA are used to synthesize complementary DNAs Then rRNA is removed enzymatically by treatment with RNase H which specifically digests RNA within an RNA DNA hybrid The cDNA molecules are then removed by DNase I digestion and the enri
8. Affymetrix recommends that the RNA used in the fragmentation procedure be sufficiently concentrated to maintain a small volume during the procedure This will minimize the amount of magnesium in the final hybridization cocktail The CRNA must be at a minimum concentration of 0 6 ug uL If it is not it can be precipitated with ethanol using the protocol in this chapter Cleaning Up and Quantifying In Vitro Transcription IVT Products Step 2 Ethanol Precipitation on page 2 1 21 It can then be resuspended in a smaller volume of RNase free water Fragment an appropriate amount of cRNA for hybridization cocktail and gel analysis see Section 2 Chapter 3 Table 2 3 1 1 Add 2 uL of 5X Fragmentation Buffer for every 8 uL of RNA plus H O The fragmentation buffer has been optimized to break down full length cRNA to 35 200 bases fragments by metal induced hydrolysis The final concentration of RNA in the fragmentation mix can range from 0 5 ug uL to 2 ug uL The following table shows an example of a fragmentation mix for a 20 ug cRNA sample at a final concentration of 0 5 ug uL For fragmentation use adjusted cRNA concentration as described in Step 3 Quantifying the cRNA IVT Product on page 2 1 21 Example for 0 5 ug uL final concentration Table 2 1 8 Example of Fragmentation Reaction Component Volume 20 ug CRNA 1 to 32 uL 5X Fragmentation 8 uL Buffer RNase free water to 40 uL CHAPTER 1 Eukaryotic Target Preparation
9. 3 Q Qiashredder QIAGEN P N 79654 R R Phycoerythrin Streptavidin Molecular Probes P N S 866 Ready Lyse Lysozyme Solution Epicentre Technologies P N R1802M Ribonuclease H RNase H E coli Epicentre Technologies P N RO601K RNA DNA Mini Column Kit QIAGEN P N 14123 RNase H E coli Invitrogen Life Technologies P N 18021 021 or Epicentre Technologies P N RO601K RNeasy Mini Kit QIAGEN P N 74104 74106 S Second strand buffer 5X Invitrogen Life Technologies P N 10812 014 Separator Micropure Millipore P N 42512 Sodium Acetate 3 M pH 5 2 Sigma Aldrich P N 7899 Sodium Hypochlorite Sigma Aldrich P N 7681 52 9 SSPE 20X BioWhittaker P N 16 010Y Streptavidin ImmunoPure Pierce Chemical P N 21125 Sucrose Gel Loading Dye 5X Amresco P N E 274 SUPERaseeIn Ambion P N 2696 SuperScript II RT Invitrogen Life Technologies P N 18064 071 SuperScript Choice system Invitrogen Life Technologies P N 18090 019 SYBR Gold Molecular Probes P N S 11494 SYBR Green II FMC Bioproducts P N 50523 or Molecular Probes P N S7586 AFFYMETRIX 6 A 9 Appendixes 6 A 10 SECTION 6 Appendixes T TBE 20X BioWhittaker P N 16 012Y TBE Gel 4 20 1 0 mm 12 well Invitrogen Life Technologies P N EC62252 TE 1X BioWhittaker P N 16 013B Tough Spots Label Dots USA Scientific P N 9185 Tris pH 7 0 1M Ambion P N 9850G Trizma Base Sigma Aldrich P N T 1503 TRIzol Reagent Invit
10. Choose the Selected Probe Sets radio button then browse and select the desired file The selected mask file will appear in the Probe Set Mask file field Probe Information Files Test Data Files AFFYMETRIX cif chip information file Contains grid size and parameters for analysis and scanner settings Do not change any information in this file cdf chip description file msk mask file This is a user defined file which permits the user to select a subset of probes for analysis or a subset of genes for normalization and or scaling To access these files select Tools Defaults from menu bar Select the Probe Information line in the File Locations tab and click the Modify button Map to the appropriate directory to allow Microarray Suite to access the desired files exp experimental information file Information about experiment name sample and probe array are stored in this file The experiment name then becomes the file name for subseguent files generated in the analysis dat data file The image of the scanned probe array is stored in this file cel cell intensity file This file is created by aligning the grid and running the analysis The analysis calculates the average intensities of each cell and assigns it to an x y coordinate position The cel files can be used to re analyze data with different expression algorithm parameters chp analysis output file chip file This outpu
11. Sigma Aldrich P N M5057 m EDTA Disodium Salt 0 5 M solution 100 mL Sigma Aldrich P N E7889 Miscellaneous Reagents m Tough Spots Label Dots USA Scientific P N 9185 optional m Surfact Amps 20 Tween 20 10 Pierce Chemical P N 28320 Miscellaneous Supplies u GeneChip Hybridization Oven 640 Affymetrix P N 800139 m Sterile RNase free microcentrifuge tubes 1 5 mL USA Scientific P N 1415 2600 or equivalent m Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent m Sterile barrier pipette tips and non barrier pipette tips 2 3 5 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Reagent Preparation 12X MES Stock 1 22 M MES 0 89 M Na For 1000 mL 70 4 g MES free acid monohydrate 193 3 g MES Sodium Salt 800 mL of Molecular Biology Grade water Mix and adjust volume to 1000 mL The pH should be between 6 5 and 6 7 Filter through a 0 2 um filter gt IMPORT Do not autoclave Store at 2 8 C and shield from light Discard solution if yellow 2X Hybridization Buffer Final 1X concentration is 100 mM MES 1 M Na 20 mM EDTA 0 01 Tween 20 For 50 mL 8 3 mL of 12X MES Stock 17 7 mL of 5 M NaCl 4 0 mL of 0 5 M EDTA 0 1 mL of 10 Tween 20 19 9 mL of water Store at 2 8 C and shield from light CHAPTER 3 Eukaryotic Target Hybridization Eukaryotic Target Hybridization AFFYMETRIX n Please refer to the table below for the necessary
12. 0 Invitrogen Life Technologies P N 15575 038 Enzo BioArray HighYield RNA Transcript Labeling Kit Affymetrix P N 900182 Ethidium Bromide Sigma Aldrich P N E 8751 Expression Control Clones American Type Culture Collection ATCC pGIKS bioB pGIKS bioC pGIKS bioD pGIKS cre pGIBS lys pGIBS phe AFFYMETRIX n ATCC 87487 ATCC 87488 ATCC 87489 ATCC 87490 ATCC 87482 ATCC 87483 6 A 7 Appendixes 6 A 8 SECTION 6 Appendixes pGIBS thr ATCC 87484 pGIBS trp ATCC 87485 pGIBS dap ATCC 87486 G GeneChip Hybridization Oven 640 Affymetrix P N 800139 GeneChip Eukaryotic Hybridization Control Kit Affymetrix P N 900299 Glycogen Ambion P N 9510 Glycogen 20 mg mL Roche Molecular Biochemical P N 901393 Goat IgG Reagent Grade Sigma Aldrich P N 15256 H HCl 1N solution VWR Scientific Products P N MK638860 Herring Sperm DNA Promega Corporation P N D1811 I ImmunoPure NeutrAvidin Pierce Chemical P N 31000 ImmunoPure Streptavidin Pierce Chemical P N 21125 L 10 bp and 100 bp ladder Invitrogen Life Technologies P N 10821 015 and15628 019 respectively M Magnesium acetate MgOAc Sigma Aldrich P N M2545 MasterPure RNA Purification Kit Epicentre Technologies P N MCR85102 MEGAscript T3 Kit Ambion P N 1338 MEGAscript T7 Kit Ambion P N 1334 MES Free Acid Monohydrate SigmaUltra Sigma Aldrich P N M5287 MES Sodium Salt Sigma Aldrich P N 5057 MMLYV Reverse Transcriptase New
13. 0144 44 0 800 622 935 33 0 1 30 46 39 00 49 0 800 6931 000 Operon Technologies www operon com 800 688 2248 44 0 1914 100 323 see web site for nearest distributor Pierce Chemical www piercenet com 800 874 3723 44 0 1244 382 525 33 0 4 70 03 88 55 49 2241 96850 Promega Corporation www promega com 800 356 9526 44 0 800 378 994 33 0 8 00 48 79 99 49 0 621 85010 QIAGEN www qiagen com 800 426 8157 44 0 1293 422 911 33 0 1 60 92 09 20 49 0 210 3892 230 AFEYMETRIX 6 A 5 Appendixes 6 A 6 SECTION 6 Appendixes Supplier Rainin www rainin com US 800 472 4646 United Kingdom 44 0 1582 456 666 France Germany see web site for nearest distributor Roche Molecular Biochemical biochem roche com 800 262 1640 44 0 1273 480 444 33 0 4 76 76 30 87 49 0 621 75985 68 Sigma Aldrich www sigma aldrich com 800 325 3010 44 0 1202 733 114 33 0 4 74 82 28 88 49 0 896 5131130 USA Scientific www usascientific com 800 522 8477 US 352 237 6288 Vector Laboratories www vectorlabs com 800 227 6666 44 0 1733 237 999 44 86 22 75 49 0 9342 39499 or 0800 253 9472 VWR Scientific Products www vwrsp com 800 932 5000 US 908 757 4045 APPENDIX A Supplier and Reagent Reference List Reagent List A Acetic Acid Glacial Sigma Aldrich
14. Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Appendix A contains a master list of all reagents used in this manual m Expression Control Clones American Type Culture Collection ATCC m Not restriction Endonuclease New England BioLabs P N R0189S m Phase Lock Gel Eppendorf 5 Prime Inc P N pl 188233 m Phenol chloroform isoamyl alcohol Ambion P N 9732 m MEGAscript T3 Kit Ambion P N 1338 pGIBS Iys pGIBS phe pGIBS thr pGIBS trp pGIBS dap ATCC 87482 ATCC 87483 ATCC 87484 ATCC 87485 ATCC 87486 Miscellaneous Reagents 3 M NaAcetate NaOAc m Absolute Ethanol m 80 Ethanol m RNeasy Mini Kit QIAGEN P N 74104 3 2 5 E coli SECTION 3 Prokaryotic Sample and Array Processing Bacterial Plasmid DNA Preparation 1 Grow E coli bacterial cultures containing recombinant plasmids according to established protocols a minimum 50 mL of culture volume is recommended 2 Prepare plasmid DNA from overnight cultures using standard procedures or commercial kits Affymetrix has obtained reliable results using QIAGEN Plasmid Kits for plasmid DNA isolation 3 2 6 CHAPTER 2 Preparation of Control Spike Transcripts for GeneChip E coli Genome Array Linearization of Plasmid DNA Preparation In a 50 uL reaction volume digest 10 ug of plasmid with th
15. England BioLabs P N M0253L MMLV Reverse Transcriptase Buffer 10X New England BioLabs P N M0253L MOPS Sigma Aldrich P N M3183 N NaCl 5 M RNase free DNase free Ambion P N 9760G NaOH IN Solution VWR Scientific Products P N MK469360 Novex XCell SureLock Mini Cell Invitrogen Life Technologies P N EI9001 Nuclease free Water Ambion P N 9930 Nucleotides labeled Biotin 11 CTP and Biotin 16 UTP Enzo P N 42818 CTP and P N 42814 UTP Nucleotides Biotin 11 CTP Sigma Aldrich P N B7048 Nucleotides Biotin 16 UTP Roche Molecular Biochemicals P N 1388908 Nucleotides Biotin 16 UTP Sigma Aldrich P N B6923 APPENDIX A Supplier and Reagent Reference List O Oligo B2 Control Control Oligo for the antisense probe array HPLC purified 5 bio GTCGTCAAGATGCTACCGTTCAGGA 3 Oligotex Direct mRNA Kit QIAGEN P N 72012 72022 or 72041 Oligotex mRNA Kit QIAGEN P N 70022 70042 or 70061 P PBS pH 7 2 Invitrogen Life Technologies P N 20012 027 Pellet Paint Novagen P N 69049 3 PEO Iodoacetyl Biotin 50 mg Pierce Chemical P N 21334ZZ Phase Lock Gel Brinkman Instrument P N 0032007961 for 200 Phenol chloroform isoamyl alcohol Ambion P N 9732 Phycoerythrin Streptavidin Molecular Probes P N S 866 Polynucleotide Kinase T4 New England BioLabs P N 201L Potassium acetate KOAc Sigma Aldrich P N P5708 Primer T7 dT Genset Corp HPLC purified 5 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG T 24
16. Image scan a 2 must be entered into the box for Number of Scans Click the Options button in the Scanner dialog box to check for the correct pixel value and wavelength of the laser beam For Probe Arrays with Probe Cells 24 um or Less Pixel value 3 um m Wavelength 570 nm For a 50 um Probe Array with a Phycoerythrin Stain Pixel value 6 um m Wavelength lt 570 nm Once the experiment has been selected click the Start button A dialog box prompts you to load a sample into the scanner Open the sample door on the scanner and insert the probe array into the holder Do not force the probe array into the holder Close the sample door of the scanner Click OK in the Start Scanner dialog box The scanner begins scanning the probe array and acguiring data When Scan in Progress is selected from the View menu the probe array image appears on the screen as the scan progresses 2 4 15 Eukaryotic 2 4 16 SECTION 2 Eukaryotic Sample and Array Processing Shutting Down the Fluidics Station After removing a probe array from the probe array holder the LCD window displays the message ENGAGE WASHBLOCK Engage the washblock by firmly pushing up on the probe array lever to the ENGAGE position The fluidics station automatically performs a Cleanout procedure The LCD window indicates the progress of the Cleanout procedure When the fluidics station LCD window indicates REMOVE VIAL the Cleanout procedure
17. Tween 20 698 mL of water Filter through a 0 2 um filter 2X Stain Buffer Final 1X concentration 100 mM MES 1 M Nat 0 05 Tween 20 For 250 mL 41 7 mL 12X MES Stock Buffer see Section 2 Chapter 3 for reagent preparation 92 5 mL 5 M NaCl 2 5 mL 10 Tween 20 112 8 mL water Filter through a 0 2 um filter Store at 2 8 C and shield from light 10 mg mL Goat IgG Stock Resuspend 50 mg in 5 mL PBS Store at 4C CHAPTER 4 Eukaryotic Arrays Washing Staining and Scanning Experiment and Fluidics Station Setup Step 1 Defining File Locations Before working with Microarray Suite it is important to define where the program stores and looks for files Launch Microarray Suite from the workstation and select Tools Defaults File Locations from the menu bar The File Locations window displays the locations of the following files m Probe Information library files mask files m Fluidics Protocols fluidics station scripts m Experiment Data exp dat cel and chp files are all saved to location selected here Verify that all three file locations are set correctly and click OK Contact Affymetrix Technical Support if you have any questions regarding this procedure Step 2 Entering Experiment Information To wash stain and scan a probe array an experiment must first be defined in the Microarray Suite AFFYMETRIX Select Run Experiment Info from the menu bar Alternatively click the New Experiment i
18. a baseline of the same probe array type to calculate a set of comparison metrics Some of the metrics are used by a decision matrix to determine a Difference Call for each transcript Increased I Decreased D Marginally Increased MI Marginally Decreased MD or No Change NC A fold change calculation is also computed to indicate the relative change of each transcript represented on the probe array CHAPTER 1 Data Analysis Analyzing Samples AFEYMETRIX Select Tools gt Defaults The Probe Array Call Settings dialog box appears In the Defaults dialog box click the Probe Array Call Settings tab to display probe array setting algorithm options Highlight GeneChip Expression and click the Modify button or double click the algorithm name In the Expression Call Settings dialog box select the Probe Array Type in the drop down list For the probe array chosen verify that the Use As Current Algorithm option box is selected Select desired options in the Scale Normalize Probe Mask Baseline and Parameters tabs By selecting the Prompt for Output Filename option in the Algorithm Parameters section of the dialog box the software automatically ask for a file name to assign to the chp file when an analysis is reguested Selecting the Display Settings When Analyzing Data option automatically opens the Expression Call Settings dialog box for review when an analysis is reguested from an open dat file In
19. above for low cRNA yield Leaking septa Leaking septa are most often created during the array filling with a pipette Be sure to use pipette tips without a beveled end When filling the arrays be careful to push the pipette tip straight through the septum and maintain a constant perpendicular angle during filling and draining the array Software Problems In MAS received the error The default path for the library files in MAS is Set the correct path for the library files message Could not find the incorrect cif file The library files for those specific arrays are not Load the library files for that array making sure to loaded on the computer check the box appropriate for that array during the loading process The probe array type is missing The default path for the library files in MAS is Set the correct path for the library files from the pull down menu when incorrect creating an exp file The library files for those specific arrays are not Load the library files for that array making sure to loaded on the computer check the box appropriate for that array during the loading process The fluidics protocols are The default path for the protocol files in MAS is Check that the location of the fluidics files on the missing from the pull down incorrect hard drive corresponds to the default protocol path menu in the Fluidics control in MAS window The library files are not loaded on the c
20. both of these methods are similar but not identical Therefore to get the best results we suggest only comparing samples prepared using the same type of RNA material Please review precautions and interfering conditions in Section 1 D IMPOR The quality of the RNA is essential to the overall success of the analysis Since the most appropriate protocol for the isolation of RNA can be source dependent we recommend using a protocol that has been established for the tissues or cells being used In the absence of an established protocol we suggest using one of the commercially available kits designed for RNA isolation When using a commercial kit follow the manufacturer s instructions for RNA isolation Isolation of RNA From Yeast Total RNA We have successfully isolated good quality total RNA from yeast cells using a hot phenol protocol described by Schmitt et al 1990 Nucl Acids Res 18 3091 3092 Poly A mRNA Affymetrix recommends first purifying total RNA from yeast cells before isolating poly A mRNA from total RNA Good quality mRNA has been successfully isolated from total RNA using QIAGEN s Oligotex mRNA kit A single round of poly A mRNA selection provides mRNA of sufficient purity and yield to use as a template for cDNA synthesis Two rounds of poly A mRNA selection will result in significantly reduced yields of yeast mRNA and is not generally recommended Isolation of RNA from Arabidopsis Total RNA We have bee
21. evaporation a Place probe array in the hybridization oven set at 45 C 5 Avoid stress to the motor load probe arrays in a balanced configuration around rotisserie axis Rotate at 60 rpm 6 Hybridize for 16 hours During the latter part of the 16 hour hybridization proceed to Section 3 Chapter 4 to prepare reagents required immediately after completion of hybridization AFFYMETRIX AN 3 3 7 E coli Section 3 Chapter 4 701033 rev 1 a GeneChip E coli Genome Array Washing Staining and Scanning Reagents and Materials Required s naase mass ga made mi Reagent Preparations 54 4406 AA RASS Oa Sore a wi Experiment and Fluidics Station Setup k e oe ard ae he E la Step I Defining File Locations LE Lean d n d h Geo Step 2 Entering Experiment Information Step 3 Preparing the Fluidics Stationa Probe Array Wash and Stam sia 2445 054 24 aa Aa we dia 8 Probe Array OBO sas 3 5 di a BH GRRE d A Shutting Down the Fluidics Station Customizing the Protocol ses mass oe ko AA polt we os This Chapter Contains m Instructions for using the GeneChip Fluidics Station to automate the washing and staining of GeneChip E coli Genome Arrays m Instructions for scanning probe arrays using the GeneArray Scanner After completing the procedures described in this chap
22. final primer mix to a concentration of 10 uM Individual stocks and the primer mix are stored at 20 C 25 mM dNTP Mix Add 50 uL of each dNTP stock solution 100 mM each to a sterile microcentrifuge tube Mix thoroughly Store at 20 C RNA Fragmentation and Labeling Reaction 500 mM MOPS pH 7 5 For 100 mL 10 5 g MOPS 80 mL Distilled water Mix and adjust pH to 7 5 with 1 M NaOH Add Distilled water to 100 mL Filter through 0 2 uM filter Store at room temperature Gel shift Assay 2 mg mL NeutrAvidin Resuspend 10 mg NeutrAvidin in 5 mL solution containing 50 mM Tris Cl pH 7 6 200 mM NACI Store at 4 C AFEYMETRIX E coli SECTION 3 Prokaryotic Sample and Array Processing CHAPTER 1 Direct Labeling of Enriched E coli mRNA Total RNA Isolation AFFYMETRIX s Prior to the enrichment process total RNA is isolated For E coli Affymetrix has successfully used the Epicentre MasterPure RNA Purification Kit Typical yields from a 10 mL log phase culture range from 80 400 ug of total RNA After purification the RNA concentration is determined by absorbance at 260 nm on a spectrophotometer 1 absorbance unit 40 ug mL RNA The A A go ratio should be approximately 2 0 with ranges between 1 8 to 2 1 considered acceptable We recommend checking the quality of the RNA by running it on an agarose gel prior to starting the assay The figure below shows 1 ug samples from three acceptable RNA prep
23. it is ready to scan on the GeneArray Scanner Proceed to Probe Array Scan on page 2 4 15 If there are no more samples to hybridize shut down the fluidics station following the procedure outlined in this chapter Shutting Down the Fluidics Station on page 2 4 16 Keep the probe arrays at 4 C and in the dark until ready for scanning 10 ENGAGE wash block Proceed to Probe Array Scan on page 2 4 15 For proper cleaning and maintenance of the fluidics station including the bleach protocol refer to Section 5 Fluidics Station Maintenance Procedures Table 2 4 3 If Bubbles are Present Return the probe array to the probe array holder Latch the probe array holder by gently pushing it up until a light click is heard Engage the washblock by firmly pushing up on the probe array lever to the ENGAGE position The fluidics station will drain the probe array and then fill it with a fresh volume of the last wash buffer used When it is finished if the LCD window displays EJECT CARTRIDGE again remove the probe array and inspect it again for bubbles If no bubbles are present it is ready to scan Proceed to Probe Array Scan on page 2 4 15 If several attempts to fill the probe array without bubbles are unsuccessful the array should be filled with Wash A non stringent buffer manually Excessive washing will result in a loss of signal intensity Contact Affymetrix Technical Support for details on the procedure Remove the probe array and run
24. minimum concentration for purified cRNA is 0 6 ug uL for the following fragmentation reaction in Fragmenting the cRNA for Target Preparation on page 2 1 22 Recommended Methods for In Vitro Transcription Clean Up 1 RNeasy spin columns from QIAGEN preferred method 2 CHROMA SPIN 100 size exclusion spin columns EtOH precipitation IVT Cleanup Protocol Using QIAGEN RNeasy Columns Follow the instructions for RNA cleanup from the QIAGEN handbook included in every kit Depending on recovery ethanol precipitation may be required to concentrate CRNA see Step 2 Ethanol Precipitation on page 2 1 21 Suggestions for Increased Yield 1 Pass the sample over the column two times before the wash and elution steps 2 After adding water to the column for RNA elution wait one minute before centrifuging IVT Cleanup Protocol Using CHROMA SPIN 100s and Ethanol Precipitation Follow the CHROMA SPIN protocol with the following modifications 1 Bring the volume of the IVT reaction to 100 uL with RNase free water 2 Load 50 uL half of sample onto column 3 Wash the column with an additional 50 uL of RNase free H 0 and combine with sample flow through CHAPTER 1 Eukaryotic Target Preparation Step 2 Ethanol Precipitation Reguired for CHROMA SPIN 100 method Optional step after RNeasy method to increase concentration to the minimum requirement of 0 6 ug uL for fragmentation 1 Add 0 5 volumes of 7 5 M NH OAc and 2 5 volumes of a
25. on how to change the registry to correct this 701045 rev 1 List of Controls on GeneChip Probe Arrays Table 6 C 1 Control Genes on GeneChip Microarrays Array Type Origin of Organism Control Gene Name Utility for GeneChip Experiments Associated Affymetrix Products Eukaryotic synthetic B2 Oligo Landing lights Control Oligo B2 P N Arrays 900301 Section 2 Chapter 2 and Chapter 3 E coli bioB Anti sense biotinylated cRNA probes are used as GeneChip Eukaryotic bioC hybridization controls Hybridization Control bioD Kit P N 900299 Section 2 Chapter 3 P1 Bacteriophage cre Anti sense biotinylated cRNA probes are used as hybridization controls B subtilis dap Poly A tailed sense RNA can be produced by IVT N A thr and spiked into isolated RNA samples as controls trp for the labeling and hybridization process The Section 2 Chapter 2 phe spikes can also be used to estimate assay lys sensitivity GeneChip synthetic B2 Oligo Landing lights Control Oligo B2 P N E coliGenome 300391 Array Section 3 Chapter 3 B subtilis dap Sense RNA can be produced by IVT and spiked N A thr into purified sample RNA as control for the trp labeling and hybridization process The spikes can Section 3 Chapter 2 phe also be used to estimate assay sensitivity and Chapter 3 lys 701045 rev 1 Appendixes
26. present proceed to Table 2 4 7 If the probe array has no large bubbles it is ready to scan on the GeneArray Scanner Proceed to Probe Array Scan on page 2 4 15 If there are no more samples to hybridize shut down the fluidics station following the procedure in Shutting Down the Fluidics Station on page 2 4 16 Keep the probe arrays at 49C and in the dark until ready for scanning ENGAGE wash block Proceed to Probe Array Scan on page 2 4 15 For proper cleaning and maintenance of the fluidics station including the bleach protocol refer to Section 5 Fluidics Station Maintenance Procedures Table 2 4 7 If Bubbles are Present Return the probe array to the probe array holder Latch the probe array holder by gently pushing it up until a light click is heard Engage the washblock by firmly pushing up on the probe array lever to the ENGAGE position The fluidics station will drain the probe array and then fill it with a fresh volume of the last wash buffer used When it is finished if the LCD window displays EJECT CARTRIDGE again remove the probe array and inspect it again for bubbles If no bubbles are present it is ready to scan Proceed to Probe Array Scan on page 2 4 15 If several attempts to fill the probe array without bubbles are unsuccessful the array should be filled with Wash A non stringent buffer manually Excessive washing will result in a loss of signal intensity Contact Affymetrix Technical Support for detail
27. right side of the Edit Protocol dialog box Select the item to be changed and input the new parameters as needed keeping parameters within the ranges shown below in Table 3 4 6 Table 3 4 6 Valid Ranges for Wash Stain Parameters Parameter Valid Range Wash Temperature for A1 B A2 or A3 C 15 to 50 Number of Wash Cycles for A1 B A2 or A3 0 to 99 Mixes Wash cycle for A1 B A2 or A3 15 to 50 Stain Time seconds 0 to 86 399 Stain Temperature C 15 to 50 Holding Temperature C 15 to 50 e Wash A1 corresponds to Post Hyb wash 1 in Table 3 4 4 e Wash B corresponds to Post Hyb wash 2 in Table 3 4 4 e Wash A2 corresponds to Post Stain Wash in Table 3 4 4 e AFFYMETRIX Wash A3 corresponds to Final Wash in Table 3 4 4 To return to the default values for the protocol selected click the Defaults button Once all the protocol conditions are modified as desired change the name of the edited protocol in the Protocol Name box If the protocol is saved without entering a new Protocol Name the original protocol parameters will be overwritten Click Save then close the dialog box Enter 0 zero for hybridization time if hybridization step is not reguired Likewise enter 0 zero for the stain time if staining is not reguired Enter 0 zero for the number of wash cycles if a wash solution is not reguired 3 4 15 E coli Section 4 Data Analysis A 701038 rev 1 Con
28. solution at 25 C in SAPE solution at 35 C in SAPE solution at 25 C 15 cycles of 4 mixes cycle with 15 cycles of 4 mixes cycle with 15 cycles of 4 mixes cycle with Final Wash Wash Buffer A at 30 C Wash Buffer A at 35 C Wash Buffer A at 35 C The holding temperature is 25 C The holding temperature is 25 C The holding temperature is 25 C e Wash Buffer A non stringent wash buffer e Wash Bu er B stringent wash buffer Washing and Staining the Probe Array 1 Inthe Fluidics Station dialog box on the workstation select the correct experiment name from the drop down Experiment list The Probe Array Type appears automatically 2 Inthe Protocol drop down list select the appropriate antibody amplification protocol to control the washing and staining of the probe array format being used Three stain protocols require the user to replace stain solutions as directed by the LCD window during staining steps 3 Choose Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions in the LCD window on the fluidics station If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the GeneChip Fluidics Station 400 User s Guide 4 Insert the appropriate probe array into the designated module of the fluidics station while the probe array lever is in the EJECT position When finished verify that the Eukaryotic probe array lever
29. status window also indicates when the analysis is completed If the status bar is not displayed click the Status Log button FE in the main toolbar or select View Status Bar from the main menu When the analysis is finished the Expression Analysis window EAW appears and displays the analysis output file chp Figure 4 1 4 If the EAW is already open the results are added to the open window and it may be necessary to use the scroll bars at the bottom and right side of the EAW to see the newly added results Data Analysis 4 1 10 SECTION 4 Data Analysis i 5 Find Sort Hide a Za Hide Unhide Options HG668 HT 4793 at HG732 HT732 at HG742 HT742_at HG821 HT821_at HG825 HT825_at HG830 HT830_at HG831 HT831_at HGBABHTAAE at HG870 HT870 at HG896 HT 896 at HG307 HT307 at HG308 HT308 at HG909 HT909_at HG313 HT313 at HGS21 HT3995 at HG360 HT360 at HG361 HT361 at HG387 HT387 at J00073 at JODI23 at J00124 at JOD129 at J00287_at J00301_at JOO306 at 102611 at TimepointO Timepointl Timepoint2 Descriptions Pairs Avg Diff Abs Call Pairs Avg Diff Abs Call Pair Ava Diff Abs Call 20 153 A 20 143 A 20 30 A T Cell Factor 1 A B C Alt Splice 1 A 20 539 A 20 354 A 20 202 A Serum Amyloid 41 20 627 A 20 279 A 20 4108 A Latent Membrane Protein Lmp1 20 14212 P 20 14489 P 20 17059 P Ribosomal Protein 513 E 20 504 A 20 330 A 20 127 A Guanine Mucleo
30. the dark at 4 C either foil wrapped or kept in an amber tube Remove SAPE from refrigerator and tap the tube to mix well before preparing stain solution Do not freeze SAPE Always prepare the SAPE stain solution immediately before use Table 3 4 1 Streptavidin Solution Mix Components Volume Final Concentration 2X MES Stain Buffer 300 0 uL 1X 50 mg mL BSA 24 0 uL 2 mg mL 1 mg mL Streptavidin 6 0 UL 10 ug mL DI H 0 270 0 uL Total Volume 600 HL 3 4 9 E coli SECTION 3 Prokaryotic Sample and Array Processing Table 3 4 2 Antibody Solution Mix Components Volume Final Concentration 2X MES Stain Buffer 300 0 uL 1X 50 mg mL BSA 24 0 UL 2 mg mL 10 mg mL Normal Goat IgG 6 0 uL 0 1 mg mL 0 5 mg mL Biotin Anti streptavidin 6 0 uL 5 ug mL DI H 0 264 0 uL Total Volume 600 HL Table 3 4 3 SAPE Solution Mix Components Volume Final Concentration 2X MES Stain Buffer 300 0 uL 1X 50 mg mL BSA 24 0 uL 2 mg mL 1 mg mL Streptavidin Phycoerythrin 6 0 uL 10 ug mL DI H20 270 0 pL Total Volume 600 HL Table 3 4 4 Fluidics Protocols Antibody Amplification for E coli Targets Standard Format ProkGE WS2 Post Hyb 10 cycles of 2 mixes cycle with Wash Buffer A at 25 C Wash 1 Post Hyb 4 cycles of 15 mixes cycle with Wash Buffer B at 45 C Wash 2 Stain Stain the probe array for 10 minutes in Streptavidin Solution Mix at 25 C Post Stain 10 cycles of 4
31. the other information as desired The protocol information at the bottom of the dialog box is exported to the experiment information dialog box after the hybridization and scan are complete a Save the experiment by selecting Save The name of the experiment is used by Microarray Suite to access the probe array type and data for the sample while it is being processed Data files generated for the sample are automatically labeled to correspond to the experiment name Microarray Suite automatically fills in the Protocol section of this dialog box with information on array processing from the fluidics station 5 Close the Experiment Information dialog box AFFYMETRIX KG 3 4 7 E coli 3 4 8 SECTION 3 Prokaryotic Sample and Array Processing Step 3 Preparing the Fluidics Station The GeneChip Fluidics Station 400 is used to wash and stain the probe arrays It is operated using Microarray Suite Setting Up the Fluidics Station 1 Turn on the Fluidics Station using the toggle switch on the lower left side of the machine 2 Select Run gt Fluidics from the menu bar The Fluidics Station dialog box appears with a drop down list for selecting the experiment name for each of the fluidics station modules A second drop down list is accessed for choosing the Protocol for each of the four fluidics station modules Refer to the GeneChip Fluidics Station 400 User s Guide for instructions on connecting and addressing
32. the recommended 2X Image scan a 2 must be entered into the box for Number of Scans Click the Options button in the Scanner dialog box to check for the correct pixel value and wavelength of the laser beam m Pixel value 3 um m Wavelength 570 nm Once the experiment has been selected click the Start button A dialog box prompts you to load a sample into the scanner Open the sample door on the scanner and insert the probe array into the holder Do not force the probe array into the holder Close the sample door of the scanner Click OK in the Start Scanner dialog box The scanner begins scanning the probe array and acguiring data When Scan in Progress is Selected from the View menu the probe array image appears on the screen as the scan progresses 3 4 13 E coli 3 4 14 SECTION 3 Prokaryotic Sample and Array Processing Shutting Down the Fluidics Station After removing a probe array from the probe array holder the LCD window displays the message ENGAGE WASHBLOCK Engage the washblock by firmly pushing up on the probe array lever to the ENGAGE position The fluidics station will automatically perform a Cleanout procedure The LCD window will indicate the progress of the Cleanout procedure When the fluidics station LCD window indicates REMOVE VIAL the Cleanout procedure is complete Remove the sample microcentrifuge tube from the sample holder If no other hybridizations are to be performed p
33. use caution and shield the staining solution from light Prepare a new batch of stain at least once a week 11 After the gel is complete break open cartridge and stain the gel in 1X SYBR Green II or Gold for 10 minutes 12 Place the gel on the UV light box and produce an image following standard procedure Be sure to use the appropriate filter for SYBR Green II or Gold 3 1 15 E coli Section 3 Chapter 2 701031 rev 1 E Li Preparation of Control Spike Transcripts for GeneChip E coli Genome Array Overview bk hae RAR Shae RRS OP REDE a SAS Oe BE Sig sa HE 3 2 4 Reagents and Materials Reguired 3 29 Bacterial Plasmid DNA Preparation 3 2 6 Linearization of Plasmid DNA Preparation 327 Purification of Linearized Plasmid DNA 3 2 7 In Vitro Transcription IVT to Produce Control Sense Transcripts 3 2 8 Preparing the Control Transcript MIX 6 46 4 me diodes mare pie 3 2 8 This Chapter Contains m Detailed steps for producing full length control spike sense RNA After completing the procedures described in this chapter the control sense transcripts can be added to purified E coli RNA samples prior to enrichment and labeling procedure as described in Section 3 Chapter 1 701031 rev 1 3 2 3 3 2 4 SECTION 3 Prokaryotic Sample and Array Processing Overview This chapt
34. using GeneChip probe arrays This manual applies to all GeneChip expression products As an Affymetrix GeneChip user your feedback is welcome Please contact our technical support team with any input on how we can improve this resource Explanation of GeneChip Probe Arrays GeneChip probe arrays are manufactured using technology that combines photolithography and combinatorial chemistry Tens to hundreds of thousands of different oligonucleotide probes are synthesized on each array Each oligonucleotide is located in a specific area on the array called a probe cell Each probe cell contains millions of copies of a given oligonucleotide or probe Probe arrays are manufactured in a series of cycles Initially a glass substrate is coated with linkers containing photolabile protecting groups Then a mask is applied that exposes selected portions of the probe array to ultraviolet light Illumination removes the photolabile protecting groups enabling selective nucleoside phosphoramidite addition only at the previously exposed sites Next a different mask is applied and the cycle of illumination and chemical coupling is performed again By repeating this cycle a specific set of oligonucleotide probes is synthesized with each probe type in a known location The completed probe arrays are packaged into cartridges During the laboratory procedure described in this manual biotin labeled RNA or cDNA fragments referred to as the target
35. 0 Bleach 5 25 Sodium Hypochlorite VWR Scientific P N 21899 504 or equivalent ImmunoPure Streptavidin Pierce Chemical P N 21125 Miscellaneous Supplies Sterile RNase free microcentrifuge tubes 1 5 mL USA Scientific P N 1415 2600 or equivalent Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent Sterile barrier pipette tips and non barrier pipette tips Tygon Tubing 0 04 inner diameter Cole Palmer P N H 06418 04 3 4 5 E coli 3 4 6 SECTION 3 Prokaryotic Sample and Array Processing Reagent Preparation Stringent Wash Buffer 100 mM MES 0 1 M Nar 0 01 Tween 20 For 1000 mL 83 3 mL of 12X MES Stock Buffer see Section 3 Chapter 3 for reagent preparation 5 2 mL of 5 M NaCI 1 0 mL of 10 Tween 20 910 5 mL of water Filter through a 0 2 um filter Store at 2 8 C and shield from light Non Stringent Wash Buffer 6X SSPE 0 01 Tween 20 For 1000 mL 300 mL of 20X SSPE 1 0 mL of 10 Tween 20 698 mL of water Filter through a 0 2 um filter 2X Stain Buffer Final 1X concentration 100 mM MES 1 M Nat 0 05 Tween 20 For 250 mL 41 7 mL 12X MES Stock Buffer see Section 3 Chapter 3 for reagent preparation 92 5 mL 5 M NaCl 2 5 mL 10 Tween 20 112 8 mL water Filter through a 0 2 um filter Store at 2 8 C and shield from light 10 mg mL Goat IgG Stock Resuspend 50 mg in 5 mL PBS Store at 4C 1 mg mL Streptavidin Stock Resuspend 5 mg in 5 mL of PBS Store
36. 0 1183 A 20 392 A 20 53 7 A 400306 class B 20 probes 11 in JOO306cds 40 304 9 in reverseSeguence 1168 2537 Human somato 20 1187 A 20 30 7 A 20 545 A J02611 class A 20 probes 20 in J02611mRNA 208 766 Human apolipoprotein D MANA complete cds z O E mE LR Analysis Info Pivot Figure 4 1 4 Expression Analysis Window EAW Pivot tab Running a Comparison Expression Analysis A comparison expression analysis compares the cell intensity data cel file of an experiment and baseline probe array of the same probe array type The comparison analysis identifies relative changes in the expression level of each transcript represented on the arrays An absolute expression analysis of the baseline must be run prior to running a comparison analysis of the experiment and baseline Absolute Expression Analysis of the Baseline 1 In the data file tree right click the baseline cell intensity file cel and then select Analyze from the pop up menu Alternatively if the image is displayed click the Analyze button fg in the main toolbar or select Run Analysis from the main menu The Save Results As dialog box appears if chosen as a display option see Microarray Suite Default Settings Dialog on page 4 1 15 It displays the analysis output file chp default name which is the same as the experiment name specified during experiment setup Figure 4 1 5 CHAPTER 1 Data Analysis AFFYMETRIX Save Results A
37. 0 ug total RNA 0 5 cDNA reaction 45 0 ug Use adjusted yield in Eukaryotic Target Hybridization on page 2 3 3 Please refer to Table 2 3 1 on page 2 3 7 for the amount of cRNA required for one array hybridization experiment The amount varies depending on the array format Please refer to a specific probe array package insert for information on the array format 2 1 21 Eukaryotic 2 1 22 SECTION 2 Eukaryotic Sample and Array Processing Step 4 Checking Unfragmented Samples by Gel Electrophoresis Gel electrophoresis of the IVT product is done to estimate the yield and size distribution of labeled transcripts Parallel gel runs of unpurified and purified IVT product can help determine the extent of a loss of sample during the clean up process m Analyze 1 of each sample by gel electrophoresis through a 1 agarose gel m Mix RNA samples or markers with loading dye and heat to 65 C for 5 minutes before loading on the gel Ethidium bromide can be used to visualize the RNA in the gel Alternatively gels can be stained with SYBR Green Il at a 1 10 000 dilution in 1X TBE buffer SYBR Green II stains single stranded RNA with greater sensitivity than ethidium bromide but it requires a special photographic filter available from Molecular Probes to photograph stained bands m Asan option run a denaturing gel to obtain a more accurate estimation of the RNA size distribution Fragmenting the cRNA for Target Preparation
38. 0G m MES Free Acid Monohydrate SigmaUltra Sigma Aldrich P N M5287 m MES Sodium Salt Sigma Aldrich P N M5057 m EDTA Disodium Salt 0 5 M solution 100 mL Sigma Aldrich P N E7889 Miscellaneous Reagents m Tough Spots Label Dots USA Scientific P N 9185 optional m Tween 20 10 Pierce Chemical P N 28320 Miscellaneous Supplies u GeneChip Hybridization Oven 640 Affymetrix P N 800139 m Sterile RNase free microcentrifuge tubes 1 5 mL USA Scientific P N 1415 2600 or equivalent m Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent u Sterile barrier pipette tips and non barrier pipette tips 3 3 5 E coli SECTION 3 Prokaryotic Sample and Array Processing Reagent Preparation 12X MES Stock 1 22 M MES 0 89 M Na For 1000 mL 70 4 g MES free acid monohydrate 193 3 g MES Sodium Salt 800 mL of Molecular Biology Grade water Mix and adjust volume to 1000 mL The pH should be between 6 5 and 6 7 Filter through a 0 2 um filter gt IMPORT Do not autoclave store at 2 8 C and shield from light Discard solution if yellow 2X Hybridization Buffer Final 1X concentration is 100 mM MES 1 M Na 20 mM EDTA 0 01 Tween 20 For 50 mL 8 3 mL of 12X MES Stock 17 7 mL of 5 M NaCl 4 0 mL of 0 5 M EDTA 0 1 mL of 10 Tween 20 19 9 mL of water Store at 2 8 C and shield from light CHAPTER 3 E coli Target Hybridization E coli Target Hybridization After deter
39. 30 147 Acetylated Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561 020 R Phycoerythrin Streptavidin Molecular Probes P N S 866 5 M NaCl RNase free DNase free Ambion P N 9760G PBS pH 72 Invitrogen Life Technologies P N 20012 027 20X SSPE 3 M NaCl 0 2 M NaH PO 0 02 M EDTA BioWhittaker P N 16 010Y Goat IgG Reagent Grade Sigma Aldrich P N 5256 Anti streptavidin antibody goat biotinylated Vector Laboratories P N BA 0500 10 surfact Amps20 Tween 20 Pierce Chemical P N 28320 Bleach 5 25 Sodium Hypochlorite VWR Scientific P N 21899 504 or equivalent Miscellaneous Supplies Sterile RNase free microcentrifuge tubes 1 5 mL USA Scientific P N 1415 2600 or equivalent Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent Sterile barrier pipette tips and non barrier pipette tips Tygon Tubing 0 04 inner diameter Cole Palmer P N H 06418 04 2 4 5 Eukaryotic 2 4 6 SECTION 2 Eukaryotic Sample and Array Processing Reagent Preparation Stringent Wash Buffer 100 mM MES 0 1 M Nar 0 01 Tween 20 For 1000 mL 83 3 mL of 12X MES Stock Buffer see Section 2 Chapter 3 for reagent preparation 5 2 mL of 5 M NaCI 1 0 mL of 10 Tween 20 910 5 mL of water Filter through a 0 2 um filter Store at 2 8 C and shield from light Non Stringent Wash Buffer 6X SSPE 0 01 Tween 20 For 1000 mL 300 mL of 20X SSPE 1 0 mL of 10
40. 4 Section 2 Chapter 2 701026 rev 1 E Li Preparation of Controls for Eukaryotic Arrays Reagents and Materials Reguired 2 250 S Hybridization Control Kits da guet deda Ka d das Ak 4U j0 EGE 4 aS 227 a Poly A Spike Controls a kk dde KIRI KIRI KIRI KIR KI RIK KI KI k HO 2 2 7 ul This Chapter Contains m General guidelines for producing controls for eukaryotic arrays After completing the procedures described in this chapter the control transcripts are combined in variable concentrations before adding to the target hybridization mix as explained in Section 2 Chapter 3 701026 rev 1 2 23 CHAPTER 2 Preparation of Controls for Eukaryotic Arrays Reagents and Materials Required The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Appendix A contains a master list of all reagents used in this manual GeneChip Eukaryotic Hybridization Control Kit Complete Kit a Affymetrix P N 900299 Poly A Spike Controls m pGIBS lys ATCC 87482 m pGIBS phe ATCC 87483 m pGIBS thr ATCC 87484 m PGIBS trp
41. 600 or equivalent Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent Sterile barrier RNase free pipette tips Tips must be pointed not rounded for efficient use with the probe arrays Mini agarose gel electrophoresis unit with appropriate buffers Vacuum filter units 1 liter capacity 0 22 um or 0 45 um VWR Scientific Products P N 28199 730 UV spectrophotometer Heatblock Cooling waterbath CHAPTER 1 Eukaryotic Target Preparation Reagent Preparation 5X RNA Fragmentation Buffer 200 mM Tris acetate pH 8 1 500 mM KOAc 150 mM MgOAc The fragmentation buffer is made with RNase free reagents Tris containing solutions should not be treated with DEPC however once H 0 has been DEPC treated and autoclaved it can be used for making the Tris solution 1 Combine the following components to a total volume of 20 mL m 4 0 ml 1 M Tris acetate pH 8 1 Trizma Base pH adjusted with glacial acetic acid m 0 64 g MgOAc m 0 98 g KOAc m DEPC treated H 0 to 20 ML 2 Mix thoroughly and filter through a 0 2 um vacuum filter unit This reagent should be aliguotted and stored at room temperature AFEYMETRIX Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing CHAPTER 1 Eukaryotic Target Preparation Isolation of RNA Protocols are provided for preparing labeled cRNA from either total RNA or purified poly A mRNA We have found that results obtained from samples prepared by
42. A IVT Product 2 1 21 Step 4 Checking Unfragmented Samples by Gel Electrophoresis 2 1 22 Fragmenting the cRNA for Target Preparation 2 1 22 This Chapter Contains m General Guidelines for extracting RNA from eukaryotic cells or tissues using commercially available reagents and kits m Detailed steps for making double stranded cDNA from extracted RNA The prepared cDNA is used for making biotinylated cRNA target Guidelines for producing biotin labeled antisense cRNA target with in vitro transcription reaction IVT using the ENZO BioArray HighYield RNA Transcript Labeling Kit Instructions for fragmenting the labeled cRNA target After completing the procedures described in this chapter the labeled and fragmented cRNA target is hybridized to the probe array in Section 2 Chapter 3 701025 rev 1 2 1 3 SECTION 2 Eukaryotic Sample and Array Processing CHAPTER 1 Eukaryotic Target Preparation Reagents and Materials Reguired AFFYMETRIX The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Append
43. ATCC 87485 m pGIBS dap ATCC 87486 AFFYMETRIX 2 2 5 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing 2 2 6 CHAPTER 2 Preparation of Controls for Eukaryotic Arrays Hybridization Control Kit Each commercially available eukaryotic probe array contains probe sets for several prokaryotic genes BioB bioC and bioD are genes of the biotin synthesis pathway from the bacteria E coli and cre is the recombinase gene from P1 bacteriophage These genes can be labeled and serve as hybridization controls when mixed with labeled eukaryotic CRNA samples Affymetrix provides a kit that contains a 20X reagent with pre mixed hybridization control transcripts bioB bioC bioD and cre in variable concentrations These controls are ready to be added to the hybridization mix as described in Section 2 Chapter 3 A 60X stock of the B2 control oligo is also provided in the kit For instructions on using the GeneChip Eukaryotic Hybridization Control Kit P N 900299 please refer to the package insert and the updated instructions in Section 2 Chapter 3 for more detailed information Poly A Spike Controls Five poly A tailed control clones encoding B subtilis genes dap thr trp phe lys are cloned into pBluescript as an Xho I to Not I insert 5 to 3 respectively XhoI NotI T3 F AAAAA 3 T7 Poly A tailed constructs dap thr trp phe lys These clones can be cut with different restrictio
44. Aldrich P N S 7899 96 to 100 Ethanol RNA DNA Mini Column Kit OIAGEN P N 14123 B Mercaptoethanol Isopropanol 70 Ethanol Glycogen 20 mg mL Roche Molecular Biochemical P N 901393 Gel Shift Assay Novex XCell SureLock Mini Cell Invitrogen P N El9001 4 20 TBE Gel 1 0 mm 12 well Invitrogen P N EC62252 Sucrose Gel Loading Dye 5X Amresco P N E 274 10X TBE Running Buffer SYBR Gold Molecular Probes P N S 11494 10 bp and 100 bp DNA ladder Invitrogen Life Technologies P N 10821 015 and 15628 019 respectively ImmunoPure NeutrAvidin Pierce Chemical P N 31000ZZ 1M Tris pH 70 Ambion P N 9850G Miscellaneous Supplies GeneChip Hybridization Oven 640 Affymetrix P N 800139 Sterile RNase free microcentrifuge tubes 1 5 mL USA Scientific P N 1415 2600 or equivalent Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent Sterile barrier pipette tips and non barrier pipette tips Thermocycler Refrigerated microcentrifuge Spectrophotometer and quartz micro cuvettes Gel imaging system with appropriate filter for SYBR Green or Gold PCR tubes 0 2 um filters for liquid sterilization Tough Spots Label Dots USA Scientific P N 9902 optional CHAPTER 1 Direct Labeling of Enriched E coli mRNA Reagent Preparation mRNA Enrichment Procedure rRNA Removal Primer Stock Individual primers are maintained at a stock concentration of 100 uM Each primer is diluted 10 fold in the
45. FAQs amp Troubleshooting 6 B 3 Appendix C List of Controls on GeneChip Probe Arrays 6 C 3 Y o T o a a lt 701042 rev 1 701043 rev 1 Supplier and Reagent Reference List Afiymetrix Technical Support i amp k s de gui sos ROBA 6 A 4 Supplier Contact Information oo 4 045 me s a s la Ga 4h 8 h Ga si 6 A 5 Kent en S b Se wa e nenn d h w na i JB R K y Wir atone dive ji eae a 6 A 7 701043 rev 1 Appendixes 6 A 3 SECTION 6 Appendixes Affymetrix Technical Support Affymetrix provides technical support via phone or Email To contact Affymetrix Technical Support Affymetrix Inc 3380 Central Expressway Santa Clara CA 95051 USA Tel 888 362 2447 888 DNA CHIP Fax 408 731 5441 Email support affymetrix com Affymetrix UK Ltd Voyager Mercury Park Wycombe Lane Wooburn Green High Wycombe HP10 OHH United Kingdom Tel 44 0 1628 552550 Fax 44 0 1628 552585 Email supporteurope affymetrix com www affymetrix com 6 A 4 APPENDIX A Supplier and Reagent Reference List Supplier Contact Information Supplier US Ambion www ambion com 800 888 8804 United Kingdom 44 0 1993 706 500 France 33 0 1 42 53 14 53 Germany 49 0 692 88082 Amersham Pharmacia Biotech www apbiotech com 800 323 9750 44 0 800 515 313 33 0 1 69 35 67 00 49 0 761 49030 Amresco www
46. GENE EXPRESSION MONITORING GeneChip Expression Analysis Technical Manual For Research Use Only Not for use in diagnostic procedures Affymetrix Confidential AFFYMETRIX 701021 rev 1 n Registration To automatically receive updates to the Expression Analysis Technical Manual please register on our web site at www affymetrix com products expression_registration html Trademarks Affymetrix GeneChip EAST AW PA L HuSNP GenFlex Jaguar MicroDB NetAffx CustomExpress 417 418 427 428 Pin and Ring and Flying Objective are trademarks owned or used by Affymetrix Inc GeneArray is a registered U S trademark of Aglient Technologies Inc Limited License PROBE ARRAYS INSTRUMENTS SOFTWARE AND REAGENTS ARE LICENSED FOR RESEARCH USE ONLY AND NOT FOR USE IN DIAGNOSTIC PROCEDURES NO RIGHT TO MAKE HAVE MADE OFFER TO SELL SELL OR IMPORT OLIGONUCLEOTIDE PROBE ARRAYS OR ANY OTHER PRODUCT IN WHICH AFFYMETRIX HAS PATENT RIGHTS IS CONVEYED BY THE SALE OF PROBE ARRAYS INSTRUMENTS SOFTWARE OR REAGENTS HEREUNDER THIS LIMITED LICENSE PERMITS ONLY THE USE OF THE PARTICULAR PRODUCT S THAT THE USER HAS PURCHASED FROM AFFYMETRIX Patents Products may be covered by one or more of the following patents and or sold under license from Oxford Gene Technology U S Patent Nos 5 445 934 5 744 305 5 700 637 and 5 945 334 and EP 619 321 373 203 and other U S or foreign p
47. LCD window on the fluidics station If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the GeneChip Fluidics Station 400 User s Guide Insert the appropriate probe array into the designated module of the fluidics station while the probe array lever is in the EJECT position When finished verify that the probe array lever is returned to the ENGAGE position Remove any microcentrifuge tube remaining in the sample holder of the fluidics station module s being used Place the microcentrifuge tube containing the SAPE stain solution into the sample holder verifying that the metal sampling needle is in the tube with its tip near the bottom The Fluidics Station dialog box and the LCD window display the status of the washing and staining as they progress When the wash is complete the LCD window displays the message EJECT CARTRIDGE Remove microcentrifuge tube containing stain and replace with an empty microcentrifuge tube Remove the probe arrays from the fluidics station modules by first moving the probe array holder lever to the EJECT position When finished verify that the probe array holder is returned to the ENGAGE position CHAPTER 4 Eukaryotic Arrays Washing Staining and Scanning AFFYMETRIX n 9 Check the probe array window for large bubbles or air pockets If bubbles are present proceed to Table 2 4 3 If the probe array has no large bubbles
48. Microarray Suite Default Settings Dialog AFFYMETRIX n 1 Select Tools Defaults from the main menu to open the Defaults dialog box The Defaults dialog box appears 2 Click the Analysis Settings tab Figure 4 1 12 Defaults x Image Settings File Locations Configuration Analysis Settings Database Algorithm Parameters IV Display settings when analyzing data Cancel Figure 4 1 12 Defaults Analysis Settings tab Prompt for Output File Name Choose this option to display a Save Results As dialog box at the start of an analysis only when Run Analysis main menu commands are used to run the analysis Display settings when analyzing data Choose this option to display the Expression Analysis Settings dialog box at the start of each analysis Figure 4 1 13 4 1 15 Data Analysis SECTION 4 Data Analysis Probe Array Type Hu5800 y Scaling Normalization Probe Mask Baseline Parameters User Defined All Probe Sets Scale Factor C Selected Probe Sets fi Scale Factor Mask File Pra Create Open Probe Set Mask Defaults Figure 4 1 13 Expression Analysis Settings dialog box Probe Array Analysis In the Analysis Settings shortcut bar click a button to view or change user modifiable parameters of the probe array analysis algorithms Analysis Settings EXP Expression Hu SNP Genotyping 4 e Hybridization p53 Mixt
49. NGAGE position 6 Remove any microcentrifuge tube remaining in the sample holder of the fluidics station module s being used 7 Place a microcentrifuge tube containing 600 L L streptavidin solution into the sample holder making sure that the metal sampling needle is in the tube with its tip near the bottom The Fluidics Station dialog box and the LCD window display the status of the washing and staining as they progress 8 When the LCD window indicates replace the microcentrifuge tube containing the streptavidin stain with a microcentrifuge tube containing 600 uL antibody stain solution into the sample holder making sure that the metal sampling needle is in the tube with its tip near the bottom 9 When the LCD window indicates replace the microcentrifuge tube containing antibody solution with the microcentrifuge tube containing the 600 uL of SAPE solution 10 When the protocol is complete the LCD window displays the message EJECT CARTRIDGE 11 Remove microcentrifuge tube containing stain and replace with an empty microcentrifuge tube 12 Remove the probe arrays from the fluidics station modules by first moving the probe array holder lever to the EJECT position When finished verify that the probe array holder is returned to the ENGAGE position 13 Check the probe array window for large bubbles or air pockets If bubbles are present refer to Table 3 4 5 on page 3 4 12 14 If the probe array has no large bubbles i
50. P N A 6283 Acetylated Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561020 Ammonium Acetate 7 5 M Sigma Aldrich P N A 2706 Anti streptavidin antibody goat biotinylated Vector Laboratories P N BA 0500 Antibody goat Anti streptavidin biotinylated 0 5 mg Vector Laboratories P N BA 0500 Antibody IgG Goat Reagent Grade 50 mg Sigma Aldrich P N 15256 y S ATP 20 umoles Roche Molecular Biochemical P N 1162306 B Bleach 5 25 Sodium Hypochlorite VWR Scientific Products P N 21899 504 Bovine Serum Albumin BSA solution 50 mg mL Acetylated Invitrogen Life Technologies P N 15561020 C CHROMA SPIN 100 Columns in Swing Bucket Format CLONTECH P N K1302 1 Control Oligo B2 30 nM Affymetrix P N 900301 D dATP dCTP dGTP dTTP Amersham Pharmacia Biotech P N 27 2035 01 Deoxyribonuclease I DNase I Amersham Pharmacia Biotech P N 27 0514 01 DMSO Hybrid Max Sigma Aldrich P N D2650 DNA Herring Sperm Promega Corporation P N D1811 DNA Ligase E coli Invitrogen Life Technologies P N 18052 019 DNA Polymerase E coli Invitrogen Life Technologies P N 18010 025 DNA Polymerase T4 Invitrogen Life Technologies P N 18005 025 dNTP 10 mM Invitrogen Life Technologies P N 18427 013 DTT 100 mM Epicentre Technologies P N M4410K supplied with MMLV Reverse Transcriptase E EDTA Disodium Salt 0 5 M solution 100 mL Sigma Aldrich P N E7889 EDTA 0 05 M pH 8
51. Remove the buffer solution from the probe array cartridge and fill with appropriate volume Table 2 3 2 on page 2 3 8 of the clarified hybridization cocktail avoiding any insoluble matter in the volume at the bottom of the tube Place probe array in rotisserie box in 45 C oven Avoid stress to rotisserie motor load probe arrays in a balanced configuration around rotisserie axis Rotate at 60 rpm Hybridize for 16 hours During the latter part of the 16 hour hybridization proceed to Section 2 Chapter 4 to prepare reagents required immediately after completion of hybridization Front be array on e 3 4 Chip Probe Array Section 2 Chapter 4 701028 rev 1 E a Eukaryotic Arrays Washing Staining and Scanning E o Reagents and Materials Required 2 5 a sa a awara tadir le l a del 2 4 5 Reagent PDA se Weed ae ee AA e Z og bed a a ae vb oba 2 4 6 a Experiment and Fluidics Station Setup 2 4 7 Step 1 Defining File Locations 4 206 adi a bare bd di as 2 4 7 Step 2 Entering Experiment Information 2 4 7 Step 3 Preparing the Fluidics Station a n a 4 BR ee m 8 4 e 2 4 8 Probe Array Washand Stain soi 4 aus a 4 4 sk jh ge ij we ee ee 2 4 9 Washing and Staining Procedure 1 Single Stain for Eukaryotic Targets 2 4 9 Washing and Staining Procedure 2 Antibody Amplification for Eukaryote Tar
52. VT Total RNA Total RNA 49 Volume of cDNA to use in IVT 5 0 to 8 0 10 pL 8 1 to 16 0 5 uL 16 1 to 24 0 3 3 uL 24 1 to 32 0 2 5 uL 32 1 to 40 0 2 uL assuming 12 uL resuspension volume for DNA as previously described Table 2 1 7 cDNA in IVT Poly A RNA Poly A RNA ug Volume cDNA 0 2 0 5 10 uL 0 6 1 0 8 uL 1 2 5 uL 3 5 2 uL assuming 12 uL resuspension volume for DNA as previously described AFFYMETRIX Eukaryotic 2 1 20 SECTION 2 Eukaryotic Sample and Array Processing Cleaning Up and Ouantifying In Vitro Transcription IVT Products Step 1 n Vitro Transcription Clean Up m lt is essential to remove unincorporated NTPs so that the 260 nm absorbance can determine the guantity of cRNA m DO NOT extract biotin labeled RNA with phenol chloroform The biotin will cause some of the RNA to partition into the organic phase This will result in low yields m Save an aliquot of the unpurified IVT product for analysis by gel electrophoresis We suggest purifying one half of the IVT reaction product and checking yields before purifying the second half for two reasons a If the sample is lost during the purification the second portion can be used b When IVT product yields are high the amount of RNA in the whole reaction may exceed the capacity of the device used for purification Therefore purifying one half of the reaction may result in better overall yields The
53. a 4 ke andes Aw ip ve a 3 3 7 This Chapter Contains m Detailed steps for preparing the hybridization mix containing labeled target m Instructions for hybridizing the target mix to a GeneChip E coli Genome Array After completing the procedures described in this chapter the hybridized probe array is then ready for washing staining and scanning as detailed in Section 3 Chapter 4 3 3 3 SECTION 3 Prokaryotic Sample and Array Processing 3 3 4 CHAPTER 3 E coli Target Hybridization Reagents and Materials Reguired AFFYMETRIX The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Appendix A contains a master list of all reagents used in this manual Water Molecular Biology Grade BioWhittaker P N 16 001Y m Acetylated Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561 020 m Herring Sperm DNA Promega Corporation P N D1811 m Micropure Separator Millipore P N 42512 optional m Control Oligo B2 3 nM Affymetrix P N 900301 can be ordered separately m 5 M NaCl RNase free DNase free Ambion P N 976
54. amount of cRNA for appropriate probe array format These recipes take into account that it is necessary to make extra hybridization cocktail due to a small loss of volume 10 20 uL during each hybridization 1 Mix the following for each target scaling up volumes for hybridization to multiple probe arrays Table 2 3 1 Hybridization Cocktail for Single Probe Array Component Micro Mini Standard Final P Array Array Concentration Fragmented cRNA 5 ug 10 ug 15 ug 0 05 ug pL Control Oligonucleotide B2 1 7 uL 3 3 UL 5 ul 50 pM 3 nM 20X Eukaryotic Hybridization 5 ul 10 uL 15 uL 1 5 5 25 and Controls bioB bioC bioD cre 100 pM respectively Herring Sperm DNA Tul 2uL 3 uL 0 1 mg mL 10 mg mL Acetylated BSA Tul 2 uL 3 uL 0 5 mg mL 50 mg mL 2X Hybridization Buffer 50 uL 100 uL 150 uL 1X H20 to final volume to final volume to final volume of of 100 uL of 200 uL 300 uL Final volume 100 uL 200 uL 300 uL Please refer to specific probe array package insert for information on array format x Please see Section 2 Chapter 1 page 2 1 21 for amount of adjusted fragmented cRNA to use when starting from total RNA It is imperative that frozen stocks of 20X GeneChip Eukaryotic Hybridization Control cocktail be heated to 65 C for 5 minutes to completely resuspend the cRNA before aliquotting 2 Equilibrate probe array to room temperature immediately before use It is important to allow the arrays to normali
55. amresco inc com 800 448 4442 44 0 1582 745 000 33 0 4 70 03 88 55 49 0 551 506860 ATCC www atcc org 800 638 6597 US 703 365 2700 BioWhittaker www brinkman com 800 638 8174 44 0 1189 795 234 Belgium 32 8 732 1611 Brinkman Instrument www coleparmer com 800 421 9988 see web site for nearest distributor Cole Parmer www coleparmer com 800 323 4340 44 0 1815 747 556 33 0 3 88 67 14 14 49 0 785 17069 CLONTECH www clontech com 800 662 CLON 44 0 1256 476 500 33 0 1 34 60 24 24 49 0 622 134170 Epicentre Technologies www epicentre com 800 284 8474 44 0 1223 366 500 33 0 1 30 46 39 00 49 0 515 29020 Eppendorf 5 Prime www 5prime com 800 533 5703 US 303 440 3705 FMC Bioproducts www fmc com US 215 299 6000 GENSET Corp www genset com 800 995 0308 33 0 1 4356 59 00 Invitrogen Life Technologies www invitrogen com 800 955 6288 00 800 5345 5345 Toll free for Europe Millipore Corp www millipore com 800 645 5476 44 0 1923 816 375 33 0 1 30 12 70 00 49 0 619 64940 Molecular Probes www probes com 541 465 8300 44 0 1223 316 855 33 0 4 70 03 88 55 49 0 551 371062 New England Biolabs www neb com 800 632 5227 44 0 800 318 846 33 0 1 34 60 24 24 49 0 800 2465 227 Novagen www novagen com 800 207
56. arations The 23S and 16S rRNA bands should be clear without any obvious smearing patterns Lane 1 1 ug Sample 1 Lane 2 1 ug Sample 2 Lane 3 1 ug Sample 3 Lane 4 RNA Size Markers 23S rRNA 16S rRNA Figure 3 1 1 Typical RNA preparations from E coli E coli SECTION 3 Prokaryotic Sample and Array Processing mRNA Enrichment Procedure The following protocol starts with 100 ug of total RNA Incubations are performed in a thermocycler Each sample is equally split between four 200 uL PCR tubes It takes approximately 5 hours to obtain enriched mRNA Vv Not a The enrichment procedure involves three enzymatic steps and the amount of enzymes used and incubation time are critical to the success of the assay Please exercise precautions and follow standard laboratory procedures when handling RNA samples Step 1 cDNA Synthesis 1 Prepare the following mixture in each of the four PCR tubes Optionally 1 uL of control transcript mix lys phe dap thr and trp from B subtilis can be added to total RNA prior to the enrichment procedure for a final concentration of 10 pM of each control transcript to be applied to the arrays Please refer to Section 3 Chapter 2 for the detailed protocol to prepare control sense RNA The detection limit of the assay is estimated to be around 5 pM Assuming complete recovery of spike transcripts the final hybridization mix contains each transcript at 10 pM concentration
57. ash solution is not required AFFYMETRIX z 2 4 17 Eukaryotic Section 3 Prokaryotic Sample da Array Processing 701029 rev 1 Contents 701029 rev 1 Section 3 Prokaryotic Sample and Array Processing Chapter 1 Direct Labeling of Enriched E coli mRNA Chapter 2 Preparation of Control Spike Transcripts for GeneChip E coli Genome Array Chapter 3 E coli Target Hybridization Chapter 4 GeneChip E coli Genome Array Washing Staining and Scanning 3 1 3 3 2 3 3 3 3 3 4 3 Prokaryotic Section 3 Chapter I 701030 rev1 mo a Direct Labeling of Enriched E coli mRNA Tatro ductos 1 Se Sr n l ok OSS a e e Shee BE Pw 3 1 4 Reagents and Materials Required 2 3 ca sal asl ala RR a km 4 RKG 3 13 Reagent Preparations x y n 4 gayan dd de da bake PUB r ea oo ae 3 1 7 Total RNA SOA OM 6 12 ki Leds b Bee d RE ome e de e to ge ake see 3 1 9 MRNA Enrichment Procedure ss 4c 5 4 4 ik Sod a amp Sw dre 3 1 10 Step L eDNA Synthesis 6 s ss e SBE HE d 3i n bi Se a A 3 1 10 Step 2 TR NA Digestion i ba sal l W dd di dh W Wl yak d n nd 3 1 11 Step S CDNA Digestion si exo sd sas WL 306 HA RA AREA 3 111 RNA Fragmentation and Labeling Reaction 31 12 Step RNA PragmentatiOR a s i kole as 8 ak 3 1 12 Step 2 RNAS Ihiolatlon 4 Bu bath doka obo 3 1 12 Step 9 Bion Addition sai a sa
58. at 4C CHAPTER 4 GeneChip E coli Genome Array Washing Staining and Scanning Experiment and Fluidics Station Setup Step 1 Defining File Locations Before working with Affymetrix Microarray Suite it is important to define where the program stores and looks for files 1 Launch Microarray Suite from the workstation and select Tools Defaults File Locations from the menu bar The File Locations window displays the locations of the following files m Probe Information library files mask files m Fluidics Protocols fluidics station scripts m Experiment Data exp dat cel and chp files are all saved to location selected here 2 Verify that all three file locations are set correctly and click OK Contact Affymetrix Technical Support if you have any questions regarding this procedure Step 2 Entering Experiment Information To wash stain and scan a probe array an experiment must first be defined in the Microarray Suite 1 Select Run Experiment Info from the menu bar Alternatively click the New Experiment icon on the tool bar The Experiment Information dialog box appears allowing the experiment name to be defined along with several other parameters such as probe array type sample description and comments 2 Type in the Experiment Name 3 Inthe Probe Array Type box click the arrow and select Ecoli from the drop down list Experiment name and probe array type are required Complete as much of
59. atabases in the case of custom Expression Analysis arrays available at the time of the array design Infreguently certain probe pairs may be identified which fail to hybridize There may also be cases where excessively large intensity differences are observed or even negative intensity differences i e mismatch probes giving excess hybridization signal over their perfect match counterparts Although the GeneChip Expression Analysis algorithm has been designed to tolerate these events such probe pairs may not add information to the determination of the expression state or quantitative expression level of the target gene Occasionally such aberrant probe pairs may bias certain analysis metrics e g Positive Fraction Log Average Ratio etc adversely affecting sensitivity of detection Many reasons for this unpredictable hybridization behavior are possible in complex biological systems The result will be probe pair s which lacking a target do not show anticipated hybridization signal Once identified the uninformative probe pairs may be removed from subsequent analyses by using a Probe Mask providing a mechanism to customize probe sets for optimum performance in a particular application Creation and Use of Probe Mask Files AFEYMETRIX Users may create Probe Mask files using Affymetrix Microarray Suite software or Affymetrix may supply them for specific applications Once created the Probe Mask file is invoked from the Probe Ma
60. ately centrifuge at gt 12 000 x g in a microcentrifuge at room temperature for 20 minutes Carefully remove supernatent Wash pellet with 0 5 mL of 80 ethanol then centrifuge at gt 12 000 x g at room temperature for 5 minutes Remove the supernatent very carefully and air dry the pellet Resuspend DNA pellet in 15 uL of RNase free water Quantify the DNA by absorbance at 260 nm 50 ug mL of DNA for 1 absorbance unit at 260 nm The quality of DNA template can be monitored by the Az6o Azg9 ratio which should be between 1 8 and 2 0 for pure DNA 3 2 7 E coli 3 2 8 SECTION 3 Prokaryotic Sample and Array Processing In Vitro Transcription IVT to Produce Control Sense Transcripts Use MEGAscript T3 High Yield Transcription Kit for the IVT reaction 1 To make up the reaction mix follow the procedures in the instruction manual provided by Ambion v Note No tracer is involved in this assay 2 Incubate the reaction for 4 hours at 37 C 3 Clean up the reaction product with RNeasy Mini column a Quantify the transcript by absorbance at 260 nm 40 ug mL RNA 1 absorbance unit at 260 nm VA Note It is recommended to examine the quality and integrity of the IVT product on an agarose gel D IMPOR Aliquot and freeze the IVT transcripts at 80 C Avoid repeated freeze thaw cycles Preparing the Control Transcript Mix 1 Prepare stock solutions for each of the five transcripts separately at 2 5
61. atents Software products may be covered by one or more of the following patents U S Patent Nos 5 733 729 5 795 716 5 974 164 6 066 454 6 090 555 6 185 561 and 6 188 783 and other U S or foreign patents Copyright 1999 2000 2001 Affymetrix Inc All rights reserved Contents 701021 rev 1 SECTION 1 Chapter 1 GeneChip Expression Analysis Overview SECTION 2 Eukaryotic Sample and Array Processing 1 1 3 Chapter 1 Zukaryotic Target Preparation 2 1 3 Chapter 2 Preparation of Controls for Eukaryotic Arrays 2 2 3 Chapter 3 Eukaryotic Target Hybridization 2 3 3 Chapter 4 Eukaryotic Arrays Washing Staining and Scanning 2 4 3 SECTION 3 Prokaryotic Sample and Array Processing Chapter 1 Direct Labeling of Enriched E coli mRNA 3 1 3 Chapter 2 Preparation of Control Spike Transcripts for GeneChip E coli Genome Array 3 2 3 Chapter 3 Z coli Target Hybridization 3 3 3 Chapter 4 GeneChip E coli Genome Array Washing Staining and Scanning 3 4 3 SECTION 4 Chapter 1 Data Analysis 4 1 3 iii F S Maintenance Appendixes iv CONTENTS SECTION 5 Chapter 1 Fluidics Station Maintenance Procedures 5 1 3 SECTION 6 Appendixes Appendix A Supplier and Reagent Reference List 6 A 3 Appendix B FAQs amp Troubleshooting 6 B 3 Appendix C List of Controls on GeneChip Probe Arrays 6 C 3 Section I GeneChip Expression PRE Overview 701022 rev 1 Contents Section 1
62. bsequent fragmentation and labeling reaction RNA Fragmentation and Labeling Reaction As in the previous procedure the fragmentation and labeling reactions are done in PCR tubes in a thermocycler A maximum of 20 ug of RNA per tube is used in the fragmentation step Incomplete fragmentation may occur if excess RNA is used Split samples into multiple tubes if the yield of RNA from the enrichment step is greater than 20 ug Following the 5 thiolation and biotin addition reaction the target is purified with ethanol precipitation or RNA DNA Mini Columns The reactions take about 6 hours to complete The reaction of PEO lodoacetyl Biotin is highly pH dependent MOPS is used as the buffer because of its inability to react with the iodoacetyl group under the reaction conditions Other commonly used laboratory buffers containing amino groups such as Tris should not be used because of their reactivity with the iodoacetyl moiety Step 1 RNA Fragmentation 1 Prepare the following mixture Table 3 1 5 RNA Fragmentation Mix Components Volume or Amount Final Concentration 10X NEBuffer for T4 Polynucleotide Kinase 10 0 uL 1 1X enriched MRNA up to 20 0 ug DI H20 up to 88 0 uL total volume Final Volume 88 uL 2 Incubate the reaction at 95 C for 30 minutes 3 Cool to 4 C Step 2 RNA 5 Thiolation 1 Prepare the following mixture Table 3 1 6 RNA Thiolation Mix Components Volume Fina
63. bsolute ethanol stored at 20 C to the sample and vortex 2 Precipitate at 20 C for 1 hour to overnight 3 Centrifuge at gt 12 000 x g at 4 C for 30 minutes 4 Wash pellet twice with 0 5 mL of 80 ethanol stored at 20 C Air dry the pellet and check for dryness before resuspension 5 Resuspend dried pellet in 10 to 20 uL of RNase free water If 1 ug cDNA template was used in the IVT reaction expect 30 to 50 ug cRNA for one half IVT reaction Step 3 Quantifying the cRNA IVT Product AFFYMETRIX Use spectrophotometric analysis to determine the cRNA yield Apply the convention that 1 absorbance unit at 260 nm equals 40 ug mL RNA m Check the absorbance at 260 nm and 280 nm to determine sample concentration and purity m Maintain the A 0 Asgo ratio close to 2 0 for pure RNA ratios between 1 9 and 2 1 are acceptable For quantification of CRNA when using total RNA as starting material an adjusted CRNA yield must be calculated to reflect carryover of unlabeled total RNA Using an estimate of 100 carryover use the formula below to determine adjusted cRNA yield adjusted cRNA yield RNA total RNA y RNA amount of CRNA measured after IVT ug total RNA starting amount of total RNA ug y lt fraction of cDNA reaction used in IVT Example Starting with 10 ug total RNA 50 of the cDNA reaction is added to the IVT giving a yield of 50 ug cRNA Therefore adjusted CRNA yield 50 ug cRNA 1
64. c analysis using the convention that 1 absorbance unit at 260 nm equals 40 ug RNA per mL m The absorbance should be checked at 260 and 280 nm for determination of sample concentration and purity m The Aggo Aggo ratio should be close to 2 0 for pure RNA ratios between 1 9 and 2 1 are acceptable AFFYMETRIX 2 1 11 Eukaryotic 2 1 12 SECTION 2 Eukaryotic Sample and Array Processing Synthesis of Double Stranded cDNA From Purified Poly A mRNA This protocol is a supplement to instructions provided in Invitrogen Life Technologies SuperScript Choice system Please note the following before proceeding Read all information and instructions that come with reagents and kits m Use the T7 dT oligomer described below for priming first strand cDNA synthesis in place of the oligo dT or random primers provided with the SuperScript kit m lt is recommended that each step of this protocol be checked by gel electrophoresis T7 dT primer 5 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG dT 94 3 Affymetrix strongly recommends HPLC purification of the T7 dT primer High quality HPLC purified T7 dT primer is essential not only for double stranded cDNA synthesis but also for the in vitro transcription IVT reaction Insufficiently purified primer may appear to produce double stranded cDNA efficiently since the 5 end of the primer is not critical for the priming step but still result in poor IVT y
65. carrier 1 10 volume of 3 M sodium acetate and 2 5 volume of ethanol to samples followed by twice washing the pellets with 750 uL of 70 ethanol Dissolve the pelleted RNA in 20 to 30 uL of nuclease free water Quantify product by 260 nm absorbance Typical yields for the procedure are 2 to 4 ug of RNA The labeled RNA should be stored at 20 C until ready for gel analysis or hybridization as described in Section 3 Chapter 3 The process may be stopped during ethanol precipitation following the RNA DNA column purification 3 1 13 E coli 3 1 14 SECTION 3 Prokaryotic Sample and Array Processing Gel Shift Assay After purification of the target the efficiency of the labeling procedure can be assessed using the following procedure This guality control protocol prevents hybridizing poorly labeled target onto the probe array The addition of biotin residues is monitored in a gel shift assay where the fragments are incubated with avidin prior to electrophoresis Biotin containing residues are retarded or shifted during the electrophoresis due to avidin binding The nucleic acids are then detected by staining Affymetrix routinely obtains approximately 70 labeling efficiency as shown in the gel photograph Figure 3 1 2 The procedure takes approximately 90 minutes to complete The absence of a shift pattern indicates poor biotin labeling The problem should be addressed before proceeding to the hybridization step Lan
66. ched mRNA is purified on QIAGEN RNeasy columns RNA Fragmentation and Labeling Procedure The direct labeling of RNA consists of the following steps 1 The RNA is fragmented by heat and ion mediated hydrolysis 2 The 5 end RNA termini are enzymatically modified by T4 polynucleotide kinase with y S ATP 3 Biotin is conjugated to 5 ends of the RNA After purification of the product the efficiency of the labeling procedure can be assessed using a gel shift assay described in Gel Shift Assay on page 3 1 14 CHAPTER 1 Direct Labeling of Enriched E coli mRNA Reagents and Materials Required AFFYMETRIX n The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Appendix A contains a master list of all reagents used in this manual Total RNA Isolation m MasterPure RNA Purification Kit Epicentre Technologies P N MCR85102 m Ready Lyse Lysozyme Solution Epicentre Technologies P N R1802M m sopropanol u 75 Ethanol mRNA Enrichment Procedure m MMLV Reverse Transcriptase New England BioLabs P N MO253L m 10X MMLV Reverse Transcriptase Buffer New Englan
67. con on the tool bar The Experiment Information dialog box appears allowing the experiment name to be defined along with several other parameters such as probe array type sample description and comments Type in the Experiment Name In the Probe Array Type box click the arrow and select the probe array type from the drop down list Experiment name and probe array type are required Complete as much of the other information as desired The protocol information at the bottom of the dialog box is exported to the experiment information dialog box after the hybridization and scan are completed Save the experiment by selecting Save The name of the experiment is used by Microarray Suite to access the probe array type and data for the sample while it is being processed Data files generated for the sample are automatically labeled to correspond to the experiment name Microarray Suite automatically fills in the Protocol section of this dialog box with information on array processing from the fluidics station Close the Experiment Information dialog box 24 7 Eukaryotic 2 4 8 SECTION 2 Eukaryotic Sample and Array Processing Step 3 Preparing the Fluidics Station The GeneChip Fluidics Station 400 is used to wash and stain the probe arrays It is operated using Microarray Suite Setting Up the Fluidics Station 1 Turn on the Fluidics Station using the toggle switch on the lower left side of the machine 2 Select Run g
68. cycles of 10 rinses each using bleach solution 9 When the fluidics station LCD window displays Remove Tube from Needle carefully remove tubing from each module needle by pushing the tubing down with one hand while holding the needle with the other Do not pull the tube as this may damage the needle in the process 10 Load empty microcentrifuge tube onto each module The fluidics station will empty the lines and run three cycles with three rinses each In addition the fluidics station will rinse the needle 20 times twice using distilled water then bring the temperature back to 25 C and drain the lines with air 11 The LCD display will read CLEANING DONE CHAPTER 1 Fluidics Station Maintenance Procedures Monthly Fluidics Station Decontamination Protocol To maintain your Fluidics Station in the best possible working condition we recommend that the following decontamination protocol be performed on your fluidics station at least once a month in addition to the weekly cleaning described above The protocol reguires approximately 2 hours to run This protocol ensures that all of the tubing associated with the station is kept thoroughly clean Keeping this tubing as clean as possible ensures that array images will be optimized and high guality results will be obtained 10 AFEYMETRIX Prepare 2 liters of 0 525 sodium hypochlorite solution using distilled water Mix well Place all three wash lines of the f
69. d BioLabs P N MO253L contains DTT and is also supplied with MMLV Reverse Transcriptase m 16S rRNA Primers Name Sequence 1651514 5 CCTAC GGTTA CCTTG TE3 16S889 5 TTAAC CTTGC GGCCG TACTC 3 16S541 5 TCCGA TTAAC GCTTG CACCC 3 m 23s rRNA Primers Name Seguence 2352878 5 CCTCA CGGTT CATTA GT3 23SEco2064 5 CTATA GTAAA GGTTC ACGGG 3 23SEco1595 5 CCTGT GTCGG TTTGG GGT3 23S1022 5 TCCCA CATCG TTTCC CAC 3 23S539 5 CCATT ATACA AAAGG TAC 3 All primers should be purchased in the 1 umole amount and purified by HPLC Oligonucleotides purchased from Operon have been used successfully in the procedure described in this chapter m dATP dCTP dGTP dTTR Amersham Pharmacia Biotech P N 27 2035 01 m SUPERaseeln M Ambion P N 2696 m Ribonuclease H RNase H E coli Epicentre Technologies P N RO601K m Deoxyribonuclease DNase 1 Amersham Pharmacia Biotech P N 27 0514 01 0 5 M EDTA pH 8 0 Invitrogen Life Technologies P N 15575 038 m RNeasy Mini Kit QIAGEN P N 74104 u B Mercaptoethanol m 96 to 100 Ethanol m Nuclease free Water Ambion P N 9930 E coli SECTION 3 Prokaryotic Sample and Array Processing RNA Fragmentation and Labeling Reaction T4 Polynucleotide Kinase and 10X NEBuffer New England BioLabs P N 201L y S ATP 20 umoles Roche Molecular Biochemical P N 1162306 MOPS Sigma Aldrich P N M3183 PEO lodoacetyl Biotin 50 mg Pierce Chemical P N 21334ZZ 3 M Sodium Acetate NaOAc pH 5 2 Sigma
70. e 1 10 bp DNA Ladder Lane 2 Fragmented and labeled enriched E coli RNA Lane 3 Fragmented and labeled enriched E coli RNA with avidin Lane 4 Fragmented and labeled total E coli RNA Lane 5 Fragmented and labeled total E coli RNA with avidin Lane 6 100 bp DNA Ladder i E emir e met Figure 3 1 2 Gel shift assay for monitoring E coli target labeling efficiency 1 Prepare a NeutrAvidin solution of 2 mg mL or higher 50 mM Tris pH 7 0 can be used to dilute the NeutrAvidin solution 2 Place a4 20 TBE gel into the gel holder and load system with 1X TBE Buffer 3 For each sample to be tested remove two 150 to 200 ng aliquots of fragmented and biotinylated sample to fresh tubes a Add 5 uL of 2 mg mL NeutrAvidin to each tube 5 Mix and incubate at room temperature for 5 minutes 6 Add loading dye to all samples to a final concentration of 1X loading dye 7 Prepare 10 bp and 100 bp DNA ladders 1uL ladder 7 uL water 2 uL loading dye for each lane 8 Carefully load samples and two ladders on gel Each gel well can hold a maximum of 20 uL CHAPTER 1 Direct Labeling of Enriched E coli mRNA AFFYMETRIX e Run the gel at 150 volts until the front dye red almost reaches the bottom The electrophoresis takes approximately 1 hour 10 While gel is running prepare at least 100 mL of a 1X solution of SYBR Green II or Gold for staining SYBR Green II and Gold are light sensitive Therefore
71. e restriction enzyme NotI according to the enzyme manufacturer s recommendations Analyze 50 ng of the uncut and linearized plasmid by gel electrophoresis on a 1 agarose gel Complete digestion of the plasmid is required for IVT Repeat restriction enzyme digestion if necessary Purification of Linearized Plasmid DNA Purify the linearized plasmid from restriction enzymes and potential RNase contaminants before proceeding to IVT using a Phase Lock Gel phenol chloroform extraction procedure Phase Lock Gels PLG form an inert sealed barrier between the aqueous and organic phases of phenol chloroform extractions The solid barrier allows more complete recovery of the sample aqueous phase and minimizes interface contamination of the sample PLG s are sold as premeasured aliquots in 1 5 mL tubes to which sample and phenol chloroform are directly added 10 AFEYMETRIX Pellet the Phase Lock Gel 1 5 mL tube with PLG I heavy in a microcentrifuge at gt 12 000 x g for 20 seconds Dilute the linearized plasmid to final volume of 150 uL with TE and add equal volume of 25 24 1 Phenol chlorororm isoamyl alcohol saturated with 10 mM Tris HCl pH8 0 1 mM EDTA Vortex Transfer the mix to the PLG tube and microcentrifuge at gt 12 000 x g for 2 minutes Transfer the top aqueous phase to a new 1 5 mL tube Add 0 1 volumes 15 UL of 3 M NaOAc and 2 5 volumes 375 uL of absolute ethanol to the samples Vortex Immedi
72. eManually 4 1 19 E Using Cross Hyb Hyb and Spike to Generate Probe Mask Files 4 1 19 ki Probe Set Masking soma as eR Eo poems ERED S ES 4 1 20 a Creation and Use of Probe Set MaskFiles 4 1 20 EI IN PES Grad dc od des nn Grau e S eS 4 1 21 Probe Information Files 2054 e a a bd alk dab kd dh eo 4 1 21 Test Data BES 2 j 6454 de DERG W WL bi Sk c wa RE GS 4 1 21 This Chapter Contains a Guidelines for setting up the Absolute Analysis one probe array and the Comparison Analysis two probe arrays using the Affymetrix Microarray Suite After completing the procedures described in this chapter the analyzed probe array data chp file contains the results and the algorithms used by Affymetrix Microarray Suite 701039 rev 1 4 1 3 SECTION 4 Data Analysis Overview This is a brief overview of the capabilities of Affymetrix Microarray Suite MAS and previously GeneChip Analysis Suite software For more detailed descriptions of these features refer to the Affymetrix Microarray Suite User s Guide P N 700293 online help or contact Affymetrix Technical Support After scanning the probe array the resulting image data created is stored on the hard drive of the GeneChip Analysis Suite Microarray Suite workstation as a dat file with the name of the scanned experiment In the first step of the analysis a grid is automaticall
73. ecommended for fluidics station maintenance if the antibody staining procedure is used Choose Bleach for all modules from the drop down list in the Fluidics Station dialog box Click the Run button for all modules and follow LCD instructions This protocol is designed to eliminate any residual SAPE antibody complex that may be present in the fluidics station tubing and needles We recommend running this protocol at least once a week 1 Prepare 1 liter of 0 525 sodium hypochlorite solution using distilled water Shake well Each fluidics station with four modules reguires at least 200 mL of the 0 525 sodium hypochlorite solution 2 Cut at least two feet of plastic tubing for each module of each fluidics station These can be reused for subsequent BLEACH runs 3 Place all three wash lines of each fluidics station in 1 liter of distilled water The BLEACH protocol requires at least 550 mL of distilled water 4 Choose Fluidics from the Run menu Alternatively click the down arrow Protocol list on the toolbar 5 Choose Bleach for the respective modules in the Protocol drop down list 6 Disengage washblock for each module Temperature will ramp up to 50 C 7 Connect one end of the plastic tubing to the needle at the bottom of each module and insert the other end into 0 525 sodium hypochlorite solution at least 200 mL for all four modules 8 ENGAGE washblock The fluidics station will empty the lines and perform three cleaning
74. ed probe sets relative to some target value Different scaling or normalization strategies may be employed from time to time and the optimum strategy will vary depending on the application Probe Set masking allows the scaling or normalization process to be customized for a particular experiment Creation and Use of Probe Set Mask Files A Probe Mask may be created from the Expression Analysis settings dialog box by choosing the appropriate probe array type and then selecting the Scaling Normalization tabs and the Create Open Probe Set Mask button To create a new Probe Set Mask enter the name for the new file in the File Name field in the Probe Set Mask File dialog box To edit a previously created Probe Set Mask file simply select the file from the list in the window Choose Open to create or edit the selected file Only the mask files from the current Probe Information folder will be automatically displayed in this window To edit mask files stored in other locations use the Look in drop down list to locate the folder containing the desired file The Probe Set Mask Definition dialog box allows the user to choose probe sets for inclusion in the mask file Move the appropriate probe sets from the Exclude field to the Include field Click OK to create the mask file CHAPTER 1 Data Analysis File Types Once created the Probe Set Mask file is invoked from the Scaling or Normalization tab of the Expression Analysis Settings dialog box
75. er describes protocols used to generate sense RNA controls from B subtilis genes These control transcripts can be spiked into E coli total RNA used for target preparation at a predetermined concentration to monitor labeling hybridization and staining efficiency To be used as control for assay performance the GeneChip E coli Genome Array contains probe sets with sequences of dap thr phe lys and trp genes from B subtilis These genes have been cloned into Stratagene pBluescript as an Xho I to Not I insert 5 to 3 respectively see Section 2 Chapter 2 Preparation of Controls for Eukaryotic Arrays pGIBS lys ATCC 87482 pGIBS phe ATCC 87483 pGIBS thr ATCC 87484 pGIBS trp ATCC 87485 pGIBS dap ATCC 87486 Xho I Not I T3 5 gt 3 T7 These clones can be digested with the Not I restriction enzyme to produce linear template DNA for the subsequent in vitro transcription IVT to produce sense strand RNA by T3 RNA polymerase as control molecules Bacteria containing these recombinant plasmids can be obtained from the American Type Culture Collection ATCC CHAPTER 2 Preparation of Control Spike Transcripts for GeneChip E coli Genome Array Reagents and Materials Required AFFYMETRIX n The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List
76. for a particular array changes when you change the comparison baseline array What are masks Masks represent a feature in MAS that is rarely used There are three types of mask files Image mask files You may want to use an image mask if there is a large visible aberration on an image You define the image mask based on the physical location on the image Probe pairs included in the mask are excluded from the analysis Image masks are associated with a given dat cel file and cannot be used on other images Probe mask files Probe masks are defined by the probe set and probe pair number Probe pairs included in this type of probe mask are excluded from the analysis when the probe mask is used Probe masks can be applied across a data set Please refer to Section 4 Data Analysis for more detailed description A second type of probe mask defines a select group of probe sets that can be used in normalization or scaling Please refer to Affymetrix Microarray Suite User s Guide where this type of probe set mask file is described If I realign the grid how do I create a new cel file If manual adjustment of the grid is necessary the corresponding cel file present at the time of adjustment will no longer be a valid representation of the realigned image data Microarray Suite will automatically detect this situation either on initial reopening of the readjusted dat file or during the analysis process The user does not need to carry out an
77. gets es mu Pierna da kl al So ea Nes 2 4 12 Probe Antay Salis 24 4 44 454444 6 PG A bee bee bee eee ES 2 4 15 Shutting Down the Fluidics Station 2 4 16 Customizing the Protocol ea Ged pa sala w Ade ORS aR 4 40 aS 2 4 17 This Chapter Contains m Instructions for using the GeneChip Fluidics Station to automate the washing and staining of eukaryotic GeneChip expression probe arrays m Instructions for scanning probe arrays using the GeneArray scanner After completing the procedures described in this chapter the scanned probe array image dat file is ready for analysis as explained in Section 4 701028 rev 1 2 4 3 SECTION 2 Eukaryotic Sample and Array Processing 2 44 CHAPTER 4 Eukaryotic Arrays Washing Staining and Scanning Reagents and Materials Required AFFYMETRIX The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Appendix A contains a master list of all reagents used in this manual Water Molecular Biology Grade BioWhittaker P N 16 001Y Distilled water Invitrogen Life Technologies P N 152
78. hly basis the full fluidics bleaching protocol should be performed and the peristaltic pump tubing replaced Please refer to Section 5 Fluidics Station Maintenance Procedures for more detail What fluidics seript do I use The appropriate fluidics script is specific to the array format standard midi mini or micro and the organisms eukaryotic or E coli Information on the array format and appropriate script is contained in the package insert that comes with each array package Please refer to the hybridization protocols in the respective sections of this manual for more detail I have a bubble in the array How do I get rid of it After the final wash on the fluidics station if the door is still open replace the array and close the door The fluidics module will automatically run a drain and fill protocol with buffer A If one cycle does not remove the bubble repeat the process and try again If this doesn t work or the door has already been closed manually drain the array and refill with buffer A What are the safe stopping points in the assay It is safe to stop work after each of the major steps in the sample preparation process 1 strand cDNA synthesis 2 strand synthesis IVT fragmentation or after mixing the hybridization mix cocktail If possible work with extracted RNA samples immediately rather than freezing them Although it is common practice to use stored frozen RNA samples in the process and such samples prope
79. hrin SAPE 6 0 uL 10 pg mL DI H 0 270 0 uL Total 600 pL AFFYMETRIX 2 4 9 Eukaryotic 2 4 10 SECTION 2 Eukaryotic Sample and Array Processing Table 2 4 2 Fluidics Protocols Single Stain for Eukaryotic Targets Standard Format Mini Format EukGE WS1 Mini euk1 Post Hyb 10 cycles of 2 mixes cycle with 10 cycles of 2 mixes cycle with Wash 1 Wash Buffer A at 25 C Wash Buffer A at 25 C Post Hyb 4 cycles of 15 mixes cycle with 8 cycles of 15 mixes cycle with Wash 2 Wash Buffer B at 50 C Wash Buffer B at 50 C Stain Stain the probe array for 30 minutes in Stain the probe array for 10 minutes in SAPE solution at 25 C SAPE solution at 25 C 10 cycles of 4 mixes cycle with 10 cycles of 4 mixes cycle with Final Wash Wash Buffer A at 25 C The holding Wash Buffer A at 30 C The holding temperature is 25 C temperature is 25 C Wash Buffer A non stringent wash buffer e Wash Buffer B stringent wash buffer Washing and Staining the Probe Array In the Fluidics Station dialog box on the workstation select the correct experiment name in the drop down Experiment list The probe array type will appear automatically In the Protocol drop down list select the specific single stain protocol to control the washing and staining of the probe array format being used Table 2 4 2 Choose Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions on the
80. ialog box appears Figure 4 1 8 if chosen as a default option The Save Results As and Expression Analysis Settings dialog boxes are only displayed when chosen as default options and when the Analyze button EB or Run Analysis main menu commands are used to run an analysis 3 Click the Baseline tab of the Expression Analysis Settings dialog box and select the Use Baseline Comparison File option Figure 4 1 8 CHAPTER 1 Data Analysis AFFYMETRIX Expression Call Settings Hu6800sub M Figure 4 1 8 Expression Analysis Settings Baseline tab 4 Click Browse gt The Baseline Comparison File dialog box appears disk files mode or the Open dialog box appears LIMS mode Figure 4 1 9 5 Select the baseline file and click Open or OK or double click the file name Baseline Comparison File 2 1204 5248 CHP 11084 05aCHP lt 1204 524B CHP k NOD4as chp x 1204 5224 CHP JA 6 chp Z NOOB chp 1204 522B CHP A_S chp NODBas chp 1204 5234 CHP O JA wtCHP TO00 chp 1204 5238 CHP NOO2 chp e T000as chp Cell Cycle Cell Cycle Cell Cycle Cell Cycle Cell Cycle Cell Cycle poo oe enero TET jer fra Chip Files CHP l Figure 4 1 9 Baseline Comparison File dialog box file mode left and Open dialog box LIMS mode right gt The Expression Analysis Settings dialog box displays the selected baseline file Figu
81. ields if the primer is contaminated with shorter sequences missing the 5 end which contains the promoter region for the IVT reaction PAGE purified primers do not generally work well in this protocol Step 1 First Strand cDNA Synthesis Starting material High quality poly A mRNA 0 2 ug to 5 ug Before starting cDNA synthesis the correct volumes of DEPC treated H O and Reverse Transcriptase RT must be determined These volumes will depend on both the concentration and total volume of mRNA that is being added to the reaction For every ug of mRNA you will need to add 1 uL of SuperScript II RT 200 U uL For mRNA quantity lt 1 ug use 1 uL of SuperScript II RT Synthesis reactions should be done in a polypropylene tube RNase free Use Table 2 1 1 for variable component calculations Determine volumes of mRNA and SuperScript II RT required and then calculate the amount of DEPC treated H O needed in the Primer Hybridization Mix step to bring the final First Strand Synthesis reaction volume to 20 UL CHAPTER 1 Eukaryotic Target Preparation Table 2 1 1 First Strand cDNA Synthesis Components Final Concentration Reagents in Reaction Volume or Amount in Reaction 1 Primer Hybridization DEPC H20 variable for final reaction volume of 20 uL Incubate at 70 C for 10 minutes T7 dT 24 primer 100 pmol uL Tul 100 pmol Quick spin and put on ice mRNA variable 0 2 to 5 ug 0 2 to 5 ug 2 Temperature Adjustment 5X Fir
82. ignificantly less CRNA will result in reduced sensitivity particularly for low copy number messages How long can I store my eukaryotic cRNA target after its first hybridization Assuming that there is no RNase contamination cRNA targets can be stored for at least one year at 80 C without significant loss of signal intensity The fact that the cRNA has been fragmented prior to the first hybridization reduces any effects of subsequent degradation Hybridization washing and staining 701044 rev 1 How long can I keep my arrays in low stringency wash buffer before scanning The arrays may be stored in the dark for up to 8 hours at 4 C prior to scanning with no noticeable loss of signal intensity To avoid condensation while scanning warm the arrays to room temperature prior to the scan How many times can I scan an array before the data is affected It is always best to capture the data on the initial scan The laser light used in scanning can bleach the fluorophore and will result in reduction in signal intensity of 10 20 with each scan Therefore subsequent scans will not give signals as robust as the initial scan 6 B 3 a o 3 2 2 lt 6 B 4 SECTION 6 Appendixes Data analysis How often do I need to do maintenance on the fluidics station With normal use e g 20 arrays module week we recommend the following schedule Every week the needle bleaching protocol should be performed on a mont
83. inal M In a comparison expression analysis Microarray Suite examines the hybridization intensity data from two probe arrays an experiment and a baseline of the same probe array type to calculate a set of comparison metrics Some of the metrics are used by a decision matrix to determine a Difference Call for each transcript Increased I Decreased D Marginally Increased MI Marginally Decreased MD or No Change NC A Fold Change calculation is also computed to indicate the relative change of each transcript represented on the probe array Expression Analysis Settings AFFYMETRIX Prior to an absolute or comparison analysis confirm or specify new values for the expression analysis settings These settings include scaling and normalization factors probe mask definition baseline file selection and values for the user modifiable parameters of the expression analysis algorithm The algorithm relies on the expression analysis settings to derive biologically meaningful results from the hybridization intensity data Viewing the Expression Analysis Settings 1 Click Analysis Settings in the shortcut bar then click the Expression Analysis button amp Figure 4 1 14 The Expression Analysis Settings dialog box appears Figure 4 1 1 2 Click a tab to view each type of setting The expression analysis settings are saved on a per user basis Changes made by one user as identified by the logon name do not affect the sett
84. ings of other users Refer to the Microarray Suite User s Guide for further information on how to change the settings 4 1 7 Data Analysis SECTION 4 Data Analysis Expression Analysis Settings x Probe Array Type Huseoo z Scaling Normalization Probe Mask Baseline Parameters C User Defined 4 Target Intensity Selected Probe Sets 2500 Browse Scale Factor Mask File Create Open Probe Set Mask Defaults Cancel Figure 4 1 1 Expression Analysis Settings dialog box Scaling tab Running an Absolute Expression Analysis An absolute expression analysis examines the cell intensity file cel from one experiment probe array and determines whether the transcripts represented on the probe array are present absent or marginal in the target sample 1 Right click the desired cel or dat file in the data file tree then select Analyze from the shortcut menu Alternatively if the image is displayed click the Analyze button BE in the main toolbar or select Run Analysis from the main menu The Save Results As dialog box appears if chosen as a default option see Microarray Suite Default Settings Dialog on page 4 1 15 It displays the analysis output file chp default name which is the same as the experiment name specified during experiment setup Figure 4 1 2 Save Results As Ea Enter a Chip File Name Timepoint0 CHP Figure 4 1 2 Save Results As dialog box 2 E
85. is complete Remove the sample microcentrifuge tube from the sample holder If no other hybridizations are to be performed place wash lines into a bottle filled with deionized water Choose Shutdown for all modules from the drop down Protocol list in the Fluidics Station dialog box Click the Run button for all modules The Shutdown protocol is critical to instrument reliability Refer to the Affymetrix GeneChip Fluidics Station 400 User s Guide for more information After Shutdown protocol is complete flip the ON OFF switch of the fluidics station to the OFF position To maintain the cleanliness of the fluidics station and obtain the highest quality image and data possible a weekly bleach protocol and a monthly decontamination protocol are highly recommended Please refer to Section 5 Fluidics Station Maintenance Procedures for further detail CHAPTER 4 Eukaryotic Arrays Washing Staining and Scanning Customizing the Protocol There may be times when the fluidics protocols need to be modified Modification of protocols must be done before downloading the protocol to the fluidics station Protocol changes will not affect runs in progress For more specific instructions refer to the Microarray Suite online help 1 Select Tools Edit Protocol from the menu bar gt The Edit Protocol dialog box appears 2 Select the protocol to be changed from the Protocol Name drop down list The name of the protocol is disp
86. is returned to the ENGAGE position 5 Remove any microcentrifuge tube remaining in the sample holder of the fluidics station module s being used 6 Place a microcentrifuge tube containing 600 uL SAPE solution into the sample holder making sure that the metal sampling needle is in the tube with its tip near the bottom The Fluidics Station dialog box and the LCD window display the status of the washing and staining as they progress AFFYMETRIX AN 2 4 13 2 4 14 SECTION 2 Eukaryotic Sample and Array Processing 7 10 When the LCD window indicates replace the microcentrifuge tube containing the SAPE stain with a microcentrifuge tube containing 600 uL antibody stain solution into the sample holder making sure that the metal sampling needle is in the tube with its tip near the bottom When the LCD window indicates replace the microcentrifuge tube containing antibody solution with the microcentrifuge tube containing the second 600 uL SAPE solution When the protocol is complete the LCD window displays the message EJECT CARTRIDGE Remove microcentrifuge tube containing stain and replace with an empty microcentrifuge tube Remove the probe arrays from the fluidics station modules by first moving the probe array holder lever to the EJECT position When finished verify that the probe array holder is returned to the ENGAGE position Check the probe array window for large bubbles or air pockets If bubbles are
87. ix A contains a master list of all reagents used in this manual Do not store enzymes in a frost free freezer Total RNA Isolation m TRIzol Reagent Invitrogen Life Technologies P N 15596 018 u RNeasy Mini Kit QIAGEN P N 74104 Poly A mRNA Isolation Oligotex Direct MRNA Kit isolation of mRNA from whole cells QIAGEN P N 72012 72022 or 72041 m Oligotex mRNA Kit isolation of mRNA from total RNA QIAGEN P N 70022 70042 or 70061 m Oiashredder OIAGEN P N 79654 Required only for use with QIAGEN Oligotex Direct Kit u DEPC Treated Water Ambion P N 9920 cDNA Synthesis m SuperScript Il Invitrogen Life Technologies P N 18064 014 or SuperScript Choice System for cDNA Synthesis Invitrogen Life Technologies P N 18090 019 SuperScript Choice System contains in addition to SuperScript Il Reverse Transcriptase other reagents for cDNA synthesis However not all components provided in the Choice System are used in the GeneChip cDNA synthesis protocol m T7 dT 24 Primer Genset Corp or Operon HPLC purified DNA 5 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG dT 94 37 100 pmol uL m E coli DNA Ligase Invitrogen Life Technologies P N 18052 019 m E coli DNA Polymerase Invitrogen Life Technologies P N 18010 025 m E coli RNaseH Invitrogen Life Technologies P N 18021 071 m T4 DNA Polymerase Invitrogen Life Technologies P N 18005 025 m 5X Second strand buffer Invitrogen Life Technologies P N 10812 014 m 10
88. kely Cause Solution High 3 B ratio Most often caused by degradation of the RNA during the isolation process Start with a fresh sample and minimize the possibility of RNase activity Recovered RNA should demonstrate the ribosomal bands on a non denaturing agarose gel Low cRNA yield Low RNA quality which interferes with reverse transcription and subsequent labeling It sometimes helps to do a Trizol based isolation followed by clean up with an RNeasy column For samples with a high lipid content such as brain use procedures to reduce the lipid content prior to the reverse transcription reaction Image Array Quality Dim Corners In need of fluidics maintenance Bleach the fluidics as recommended and change the peristaltic pump tubing If the problem persists call Affymetrix Technical Support Dim Arrays Hybridization problems Check the signal from control Oligo B2 to see if the signals are also weak If it appears to be a hybridization issue check all hybridization reagents and equipment setting before running another assay Test arrays can be useful for troubleshooting this issue Sample preparation problems Re check each of the quality control procedures recommended in the manual such as absorbance measurement and running an aliquot on gel to ensure that there is no significant loss of sample during target preparation due to manipulation of the sample or RNase contamination Also see
89. l Concentration Fragmented RNA from Step 1 88 0 uL 5 mM y S ATP 2 0 uL 0 1 mM 10 U uL T4 Polynucleotide Kinase 10 0 uL 1 U uL Final Volume 100 0 uL CHAPTER 1 Direct Labeling of Enriched E coli mRNA Incubate the reaction at 37 C for 50 minutes Inactivate the reaction by heating at 65 C for 10 minutes and then cool to 4 C Remove excess y S ATP by ethanol precipitation If you have started with multiple tubes combine all samples in one sterile microcentrifuge tube Add 1 10 volume of 3 M sodium acetate pH 5 2 and 2 5 volumes of ethanol Leave on ice for 15 minutes Spin at 14 000 rpm at 4 C for 30 minutes to pellet the RNA Resuspend the RNA pellet in 90 uL of DI H30 Step 3 Biotin Addition AFFYMETRIX 1 Prepare the following mixture Table 3 1 7 RNA Labeling Mix Components Volume Final Concentration 500 mM MOPS pH 75 6 0 uL 30 mM Fragmented thiolated RNA from Step 2 90 0 uL 50 mM PEO lodoacetyl Biotin 4 0 uL 2mM Final Volume 100 0 uL 2 Incubate the reaction at 37 C for one hour 3 Cool to 4 C 4 Remove unincorporated biotin label using the QIAGEN RNA DNA Mini Columns For increased RNA recovery use one RNA DNA column and 5 4 mL Buffer ORV2 for every 10 0 ug RNA It is recommended to add 50 ug of glycogen as carrier during the precipitation step Alternatively clean up the labeling product by ethanol precipitation instead of Qiagen columns add 50 ug of glycogen as
90. lace wash lines into a bottle filled with deionized water Select Shutdown for all modules from the drop down Protocol list in the Fluidics Station dialog box Click the Run button for all modules The Shutdown protocol is critical to instrument reliability Refer to the Affymetrix GeneChip Fluidics Station 400 User s Guide for more information After Shutdown protocol is complete flip the ON OFF switch of the fluidics station to the OFF position To maintain the cleanliness of the fluidics station and obtain the highest quality image and data possible a weekly bleach protocol and a monthly decontamination protocol are highly recommended Please refer to Section 5 Fluidics Station Maintenance Procedures for further detail CHAPTER 4 GeneChip E coli Genome Array Washing Staining and Scanning Customizing the Protocol T here may be times when the fluidics protocols need to be modified Modification of protocols must be done before downloading the protocol to the fluidics station Protocol changes will not affect runs in progress For more specific instructions refer to the Microarray Suite online help 1 Select Tools Edit Protocol from the menu bar 2 In the Edit Protocol dialog box under Protocol Name click the arrow to open a list of protocols Click the protocol to be changed The name of the protocol is displayed in the Protocol Name text box The conditions for that protocol are displayed on the
91. layed in the Protocol Name box The conditions for that protocol are displayed on the right side of the Edit Protocol dialog box 3 Select the item to be changed and input the new parameters as needed keeping the parameters within the ranges shown below in Table 2 4 8 Table 2 4 8 Valid Ranges for Wash Stain Parameters Wash Temperature for A1 B A2 or A3 C 15 to 50 Number of Wash Cycles for A1 B A2 or A3 0 to 99 Mixes Wash cycle for A1 B A2 or A3 15 to 50 Stain Time seconds 0 to 86399 Stain Temperature C 15 to 50 Holding Temperature C 15 to 50 e Wash A1 corresponds to Post Hyb wash 1 in Tables 2 4 2 and 2 4 6 e Wash B corresponds to Post Hyb wash 2 in Tables 2 4 2 and 2 4 6 e Wash A2 corresponds to Post Stain Wash in Tables 2 4 2 and 2 4 6 Wash A3 corresponds to Final Wash in Tables 2 4 2 and 2 4 6 a To return to the default values for the protocol selected click the Defaults button 5 After all the protocol conditions are modified as desired change the name of the edited protocol in the Protocol Name box j CAUTI If the protocol is saved without entering a new Protocol Name the original protocol parameters will be overwritten 6 Click Save then close the dialog box Enter 0 zero for hybridization time if hybridization step is not required Likewise enter 0 zero for the stain time if staining is not required Enter 0 zero for the number of wash cycles if a w
92. ld be calibrated and carefully maintained to ensure accuracy as incorrect measurement of reagents may affect the outcome of the procedure Instruments The Affymetrix GeneChip Expression Analysis Technical Manual is designed for use in a system consisting of a GeneChip Fluidics Station 400 a GeneChip Hybridization Oven and a GeneArray Scanner References 1 Sambrook J Fritsch E F Maniatis T 1989 Molecular Cloning A Laboratory Manual v 1 Cold Spring Harbor NY Cold Spring Harbor Laboratory Press p 21 52 2 See www affymetrix com for current GeneChip technology references Limitations The results of the assay kit are dependent upon the quality of the input RNA subsequent proper handling of nucleic acids and other reagents m The results should be evaluated by a qualified individual D IMPOR Do not store enzymes in a frost free freezer AFFYMETRIX Overview Section 2 Eukaryotic Sample guarros Processing 701024 rev 1 E m Contents o Section 2 Eukaryotic Sample and Array Processing q gt Ul Chapter 1 Eukaryotic Target Preparation 2 1 3 Chapter 2 Preparation of Controls for Eukaryotic Arrays 2 2 3 Chapter 3 Eukaryotic Target Hybridization 2 3 3 Chapter 4 Eukaryotic Arrays Washing Staining and Scanning 2 4 3 701024 rev 1 Section 2 Chapter I 701025 rev 1 mo Li Eukaryotic Target Preparation Reagents and Materials Required ssu s aa
93. le already generated Re N From the menubar select Tools Defaults Probe Array Call Settings Highlight GeneChip Expression and click the Modify button Select the correct probe array type from the drop down list then click the Baseline tab Select the Use Baseline Comparison File option box then click the Browse button A dialog box appears displaying the chp files in the Experimental Data folder Select the chp file to be used as a baseline file in your comparison then click Open or double click the chp file name then click OK Open the dat or cel file of the experiment to be analyzed Select Run Analysis It is possible to select the columns of data output shown in a chp file With a chp file open in the Expression Analysis window choose Options from the Analysis menu and select the Table Data tab Select or clear the data output columns by double clicking the column names CHAPTER 1 Data Analysis Affymetrix Microarray Suite Affymetrix Microarray Suite analyzes the hybridization intensity data from GeneChip expression probe arrays and calculates a set of metrics that describe probe set performance In an absolute expression analysis Microarray Suite examines the hybridization intensity data from one experiment probe array to calculate a set of absolute metrics Some of the metrics are used by a decision matrix to determine an Absolute Call for each transcript Present P Absent A or Marg
94. le in the in vitro transcription reaction Please see Tables 2 1 6 and 2 1 7 for recommendations Also we do not recommend RNase treatment of the cDNA prior to the in vitro transcription and labeling reaction the carry over ribosomal RNA does not seem to inhibit the reaction An aliquot of the cDNA prepared from isolated poly A can be analyzed for size distribution and yield on a 1 agarose gel One uL of double stranded cDNA should be sufficient to detect on an agarose gel stained with ethidium bromide A representative gel is shown in Figure 1 2 on page 2 1 23 We do not recommend gel analysis for cDNA prepared from total RNA Quantifying the amount of double stranded cDNA by the absorbance at 260 nm is not recommended The primer can contribute significantly to the absorbance Subtracting the theoretical contribution of the primer based on the amount added to the reaction is not practical because it is not likely to precipitate as reproducibly and efficiently as the longer double stranded cDNAs After clean up please proceed to Synthesis of Biotin Labeled cRNA on page 2 1 19 CHAPTER 1 Eukaryotic Target Preparation Synthesis of Biotin Labeled cRNA Enzo For instructions regarding the labeling of RNA transcripts please refer to the BioArray HighYield RNA Transcript BioArray apeling Kit Affymetrix P N 900182 HighYield Vv Not a Overnight incubation may produce shorter products Table 2 1 6 cDNA in I
95. luidics station in 1 liter of 0 525 sodium hypochlorite solution Run the Prime protocol page 2 4 8 on all four modules with wash lines in 0 525 sodium hypochlorite solution instead of wash buffers A and B Run the Shutdown protocol page 2 4 16 on all four modules with wash lines in 0 525 sodium hypochlorite solution instead of distilled water Follow Bleach Protocol as described on page 5 1 4 with the following change in Step 3 place the three wash lines of the fluidics station in 1 liter of 0 525 sodium hypochlorite solution instead of distilled water Change intake tubing and peristaltic tubing if required as described in the Affymetrix GeneChip Fluidics Station 400 User s Guide Run the Bleach protocol with three wash lines of the fluidics station in distilled water Run the Prime protocol with wash lines in distilled water instead of wash buffers A and B Run the Shutdown protocol with wash lines in distilled water Run the Prime protocol with wash lines in distilled water instead of wash buffers A and B Run the Shutdown protocol with distilled water At the end of each step the fluidics station will indicate a ready status The fluidics station should not be used until this entire procedure steps 1 11 is complete ES Maintenance Section 6 Appendixes A 701042 rev 1 Contents Section 6 Appendixes Appendix A Supplier and Reagent Reference List 6 A 3 Appendix B
96. mM dNTP Invitrogen Life Technologies P N 18427 013 Phase Lock Gel Brinkman Instrument P N 0032007961 for 200 m Phenol chloroform isoamyl alcohol Ambion P N 9732 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Synthesis of Biotin Labeled cRNA Enzo RNA Transcript Labeling Kit Affymetrix P N 900182 BioArray High Yield IVT cRNA Cleanup and Quantitation RNeasy Mini Kit used in IVT cleanup OIAGEN P N 74103 74104 74106 or CHROMA SPIN 100 Columns in Swing Bucket Format CLONTECH P N K1302 1 optional DEPC Treated water Ambion P N 9920 10X TBE BioWhittaker P N 16 012Y cRNA Fragmentation Trizma Base Sigma Aldrich P N T1503 Magnesium acetate MgOAc Sigma Aldrich P N M2545 Potassium acetate KOAc Sigma Aldrich P N P5708 Glacial Acetic Acid Sigma Aldrich P N A628 Miscellaneous Reagents 7 5 M Ammonium Acetate NH OAc Sigma Aldrich P N A2706 Absolute ethanol stored at 20 C 80 ethanol stored at 20 C SYBR Green II FMC Bioproducts P N 50523 or Molecular Probes P N S7586 optional Water Molecular Biology Grade BioWhittaker P N 16 001Y Pellet Paint Novagen P N 69049 3 optional Glycogen Ambion P N 9510 optional 3 M Sodium Acetate NaOAc Sigma Aldrich P N S7899 Ethidium Bromide Sigma Aldrich P N E8751 NaOH 1 N HCI 1 N 50 mM MgCl 0 5 M EDTA Miscellaneous Supplies Sterile RNase free microcentrifuge tubes 1 5 mL USA Scientific P N 1415 2
97. meter one absorbance unit 40 ug mL RNA The A 0 Ago ratio should be approximately 2 0 with ranges between 1 8 to 2 1 considered acceptable We recommend checking the guality of the RNA by running it on an agarose gel prior to starting the assay The rRNA bands should be clear without any obvious smearing patterns Before starting cDNA synthesis the correct volumes of DEPC treated H O and Reverse Transcriptase RT must be determined These volumes will depend on both the concentration and total volume of RNA that is being added to the reaction Use Table 2 1 3 and Table 2 1 4 for variable component calculations Determine the volumes of RNA and SuperScript II RT required in Table 2 1 3 then calculate the amount of DEPC treated H O needed in Step 1 Table 2 1 4 to bring the final volume in Step 3 Table 2 1 4 to 20 uL CHAPTER 1 Eukaryotic Target Preparation Table 2 1 3 Reverse Transcriptase Volumes for First Strand cDNA Synthesis Reaction Total RNA ug SuperScript II RT UL 200U uL 5 0 to 8 0 1 0 8 1 to 16 0 2 0 16 1 to 24 0 3 0 24 1 to 32 0 4 0 32 1 to 40 0 5 0 The combined volume of RNA and SuperScript II RT should not exceed 12 ul as indicated in Table 2 1 4 Synthesis reactions should be done in a 1 5 mL polypropylene tube RNase free Table 2 1 4 First Strand cDNA Synthesis Components Final concentration Reagents in reaction Volume 2 or amount in reaction 1 Primer Hybridiza
98. mg mL 0 5 mg mL biotinylated antibody 3 6 uL 3 ug mL DI H20 266 4 uL Total 600 uL CHAPTER 4 Eukaryotic Arrays Washing Staining and Scanning Table 2 4 6 Fluidics Protocols Antibody Amplification for Eukaryotic Targets Standard Format EukGE WS2 Midi Format Midi_euk2 Micro Mini Format Micro 1v1 Mini_euk2 Post Hyb 10 cycles of 2 mixes cycle with 10 cycles of 2 mixes cycle with 10 cycles of 2 mixes cycle with Wash Buffer A at 25 C Wash Buffer A at 30 C Wash Buffer A at 25 C Wash 1 Post Hyb 4 cycles of 15 mixes cycle with 6 cycles of 15 mixes cycle with 8 cycles of 15 mixes cycle with Wash Buffer B at 50 C Wash Buffer B at 50 C Wash Buffer B at 50 C Wash 2 Stain Stain the probe array for 10 minutes Stain the probe array for 5 minutes Stain the probe array for 10 minutes in SAPE solution at 25 C in SAPE solution at 35 C in SAPE solution at 25 C Post Stain 10 cycles of 4 mixes cycle with 10 cycles of 4 mixes cycle with 10 cycles of 4 mixes cycle with Wash Wash Buffer A at 25 C Wash Buffer A at 30 C Wash Buffer A at 30 C 2nd Stain Stain the probe array for 10 minutes Stain the probe array for 5 minutes Stain the probe array for 10 minutes in antibody solution at 25 C in antibody solution at 35 C in antibody solution at 25 C 3rd Stain Stain the probe array for 10 minutes Stain the probe array for 5 minutes Stain the probe array for 10 minutes in SAPE
99. mining that the fragmented RNA is labeled with biotin prepare the hybridization solution mix The recommended amount of RNA per assay is 1 5 to 4 0 ug The solution is stable for approximately 6 to 8 hours at 4 C The following protocol can be used for freshly prepared or frozen hybridization cocktail Re use of prokaryotic sample is not recommended since the samples are end labeled rather than internally labeled 1 Prepare the following hybridization solution mix Table 3 3 1 Hybridization Solution Mix Components Volume Final Concentration 2X MES Hybridization Buffer 100 0 uL 1X 3 nM Control Oligo B2 3 3 uL 50 pM 10 mg mL Herring Sperm DNA 2 0 uL 0 1 mg mL 50 mg mL BSA 2 0 uL 0 5 mg mL Fragmented Labeled RNA 1 5 to 4 0 ug Molecular Biology Grade Water to a final volume of 200 uL Final Volume 200 uL 2 Equilibrate probe array to room temperature immediately before use Y Note It is important to allow the arrays to normalize to room temperature completely Specifically if the rubber septa are not equilibrated to room temperature they may be prone to cracking which can lead to leaks 3 Add the hybridization solution mix to the probe array It is necessary to use two pipette tips when filling the probe array cartridge one for filling and the second to allow venting of air from the hybridization chamber After the addition of hybridization cocktail the septa may be covered with Tough Spots to prevent
100. mixes cycle with Wash Buffer A at 30 C Wash 2nd Stain Stain the probe array for 10 minutes in antibody solution Mix at 25 C 3rd Stain Stain the probe array for 10 minutes in SAPE Solution at 25 C Final Wash 15 cycles of 4 mixes cycle with Wash Buffer A at 30 C The holding temperature is 25 C e Wash Buffer A non stringent wash buffer e Wash Buffer B stringent wash buffer 3 4 10 CHAPTER 4 GeneChip E coli Genome Array Washing Staining and Scanning 2 In the Fluidics Station dialog box on the workstation select the correct experiment name from the drop down Experiment list The probe array type will appear automatically 3 In the Protocol drop down list select the ProkGE WS2 protocol to control the washing and staining of the probe array format being used v Note Three stain protocols reguire the user to replace stain solutions as directed by the LCD window during staining steps 4 Choose Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions in the LCD window on the fluidics station If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the GeneChip Fluidics Station 400 User s Guide 5 Insert the appropriate probe array into the designated module of the fluidics station while the probe array lever is in the EJECT position When finished verify that the probe array lever is returned to the E
101. mplification Washing and Staining Protocol for all arrays with probe cells of 24 um or smaller 1 After 16 hours of hybridization remove the hybridization cocktail from the probe array and set it aside in a microcentrifuge tube Store on ice during the procedure or at 80 C for long term storage 2 Fill the probe array completely with the appropriate volume of Non Stringent Wash Buffer as given in Table 2 3 2 on page 2 3 8 v Note If necessary at this point the probe array can be stored at 4 C for up to 3 hours before proceeding with washing and staining Eguilibrate the probe array to room temperature before washing and staining Washing and Staining Procedure 1 Single Stain for Eukaryotic Targets v Note Volumes needed will be the same for all fluidics protocols This procedure takes approximately 75 minutes to complete Preparing the SAPE Stain Solution Streptavidin Phycoerythrin SAPE should be stored in the dark at 4 C either foil wrapped or kept in an amber tube Remove SAPE from refrigerator and tap the tube to mix well before preparing stain solution Do not freeze SAPE Always prepare the SAPE stain solution immediately before use For each probe array to be stained combine the following components in a microcentrifuge tube Table 2 4 1 SAPE Solution Mix Components Volume Final Concentration 2X MES Stain Buffer 300 0 uL 1X 50 mg mL acetylated BSA 24 0 uL 2 mg mL 1 mg mL Streptavidin Phycoeryt
102. multiple fluidics stations Priming the Fluidics Station Priming ensures that the lines of the fluidics station are filled with the appropriate buffers and the fluidics station is ready for running fluidics station protocols Priming should be done m When the fluidics station is first started When wash solutions are changed m Before washing if a shutdown has been performed m f the LCD window instructs the user to prime 1 To prime the fluidics station select Protocol in the Fluidics Station dialog box 2 Choose Prime for the respective modules in the Protocol drop down list 3 Change the intake buffer reservoir A to Non stringent Wash Buffer and intake buffer reservoir B to Stringent Wash Buffer 4 Click Run for each module to begin priming CHAPTER 4 GeneChip E coli Genome Array Washing Staining and Scanning Probe Array Wash and Stain AFFYMETRIX Following hybridization the wash and stain procedures are carried out by the fluidics station using the ProkGE WS2 fluidics script The procedure takes approximately 75 minutes to complete The use of streptavidin in the first part of the stain procedure enhances the overall signal Preparing the Staining Reagents 1 Prepare the following stain and wash solutions the day of the procedure The solutions are stable for approximately 6 to 8 hours at 4 C Volumes given are sufficient for one probe array Streptavidin Phycoerythrin SAPE should be stored in
103. n enzymes to produce template DNA for either sense strand RNA synthesis or antisense RNA synthesis The antisense control RNA for each B subtilis gene is synthesized from linearized plasmid using T7 RNA polymerase with biotinylated nucleotides The sense RNA for each B subtilis gene is synthesized from linearized plasmid using T3 RNA polymerase with unlabeled nucleotides For detailed preparation of sense RNA controls please refer to Section 3 Chapter 2 The antisense strand B subtilis RNA controls are used as described above for bioB bioC and bioD genes The sense strand RNA controls can be spiked into samples during mRNA preparation to monitor the efficiency of target preparation hybridization wash and stain Bacteria containing these recombinant plasmids can be obtained from the American Type Culture Collection ATCC See Reagents and Materials Required on page 2 2 5 for details AFFYMETRIX ai 2 2 7 Eukaryotic Section 2 Chapter 3 701027 rev 1 E a Eukaryotic Target Hybridization Reagents and Materials Reguired 2 359 S Reagent Preparation ko sus a ds sua dons Has EERE DY ORY a 2 3 6 a B karyaue Target Hybridization 4 nd de an a e ab E na eue Pe E m This Chapter Contains m Detailed steps for preparing the eukaryotic hybridization mix containing labeled target and control cRNA m Instructions for hybridizing the target mix to a eukaryotic GeneChip
104. n using TRIzol Reagent from Invitrogen Life Technologies to isolate total RNA from Arabidopsis Please follow the instructions provided by the supplier and when necessary use the steps outlined specifically for samples with high starch and or high lipid content Poly A mRNA We have successfully isolated Arabidopsis poly A RNA using QIAGEN Oligotex product However other standard isolation products are likely to be adequate AFFYMETRIX Eukaryotic 2 1 10 SECTION 2 Eukaryotic Sample and Array Processing Isolation of RNA from Mammalian Cells or Tissues Total RNA We have successfully isolated good quality total RNA from mammalian cells such as cultured cells and lymphocytes using QIAGEN s RNeasy Total RNA Isolation kit If mammalian tissue is used as the source of RNA we recommend isolating total RNA with a commercial reagent such as TRIzol If going directly from TRIzol isolated total RNA to cDNA synthesis it may be beneficial to perform a second cleanup on the total RNA before starting After the ethanol precipitation step in the TRIzol extraction procedure perform a cleanup using QIAGEN RNeasy Total RNA isolation kit Much better yields of labeled cRNA are obtained from the in vitro transcription labeling reaction when this second cleanup is performed Poly A mRNA Good quality mRNA has been successfully isolated from mammalian cells such as cultured cells and lymphocytes using QIAGEN s Oligotex Di
105. nM for each transcript Use the following table to calculate the amount of transcript needed to prepare 2 5 nM stock Table 3 2 1 Conversions for Preparing 2 5 nM Control Transcript Mix Control RNA Size kb Molecular Weight pMoles ug Lys 1 330 000 3 03 Phe 1 32 435 600 2 30 Dap 1 82 607200 1 65 Thr 1 98 653 400 1 53 Trp 2 5 kb 825 000 1 21 2 Mix egual volume of all five transcripts so that final concentration for each is 500 pM 3 Apply 4 uL of the transcript mix with each 100 ug of total RNA prior to the enrichment procedure as described in Chapter 1 of this section Final concentration applied on the array for the control transcripts would be 10 pM assuming 100 recovery Y Note Since the hybridization mix has a volume of 200 uL 10 pM would be the final concentration for the transcripts assuming 100 recovery throughout the enrichment and labelling procedure Alternatively different concentrations of transcript stock can be prepared to generate variable concentrations for different transcripts to monitor the dynamic range of the assay 2 IMPOR Aliquot and freeze the IVT transcripts at 80 C Avoid repeated freeze thaw cycles Section 3 Chapter 3 701032 rev 1 a E coli Target Hybridization Reagents and Materials Reguired 3139 Reagent Preparation aus sa ema des SLA di k 20 GR DY A a GA 3 3 0 E coli Tat set HD IZA LO 4 564 das ej pa di v kan
106. nalysis window EAW opens and displays the comparison analysis output file chp Figure 4 1 11 If the EAW is already open the results are added to the open window and it may be necessary to use the scroll bars at the bottom and right sides of the EAW to see the newly added results CHAPTER 1 Data Analysis o E Mod amp 9 Clear Scatter Series Intensity Image Lasso a 2 SS Find Sort Hide Hide hide Options Analysis Name Probe Set Mame Diff Call Avg Diff Change Fold Change Sort Score 1 CancerChip 34 AFFx MuriL2 at D 380 3 0 9 0 90 12 CancerChip 34 AFFX MurlL10_at NC 267 3 0 3 0 33 13 CancerChip 34 AFFX MurL4 at NC 21 4 0 0 0 01 4 CancerChip 34 AFFX MurFAS_at NC 201 9 0 4 0 40 5 CancerChip 34 AFFX BioB 5 at l 1029 9 se 6 05 6 CancerChip 34 AFFX BioB M_at l 1056 4 s 5 31 17 CancerChip 34 AFFX BioB 3 at l 784 0 s 4 88 lg CancerChip 34 AFFX BioC 5 at 642 8 s 305 lg CancerChip 34 AFFX BioC 3 at 695 2 By 2 07 10 CancerChip 34 AFF lt BioDn 5_at 437 2 ai 0 64 11 CancerChip 34 AFFX BioDn 3_at NC 545 3 1 4 1 36 12 CancerChip 34 AFFX CreX 5_at NC 1513 0 17 13 CancerChip 34 AFFX Crex 3_at NC 217 9 e 0 58 14 CancerChip 34 AFFX BioB 5_st NC 2132 0 3 0 25 15 CancerChip 34 AFFX BioB M_st NC 70 3 0 1 0 06 a2 bin LA DD a g KIT Fi 2 nn ANA IN Analysis ino metrics RE La Figure 4 1 11 EAW metrics tab comparison analysis output file chp
107. nd Array Processing Synthesis of Double Stranded cDNA from Total RNA This protocol is a supplement to instructions provided in Invitrogen Life Technologies SuperScript Choice system Please note the following before proceeding Read all information and instructions that come with reagents and kits m Use the T7 dT oligomer described below for priming first strand cDNA synthesis in place of the oligo dT or random primers provided with the SuperScript kit m lt is recommended that each step of this protocol be checked by gel electrophoresis T7 dT 24 primer 5 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG dT 94 3 Affymetrix strongly recommends HPLC purification of the T7 dT primer High quality HPLC purified T7 dT primer is essential not only for double stranded cDNA synthesis but also for the in vitro transcription IVT reaction Insufficiently purified primer may appear to produce double stranded cDNA efficiently since the 5 end of the primer is not critical for the priming step but still result in poor IVT yields if the primer is contaminated with shorter sequences missing the 5 end which contains the promoter region for the IVT reaction PAGE purified primers do not generally work well in this protocol Step 1 First Strand cDNA Synthesis Starting material High quality total RNA 5 0 ug 40 0 ug After purification the RNA concentration is determined by absorbance at 260 nm on a spectrophoto
108. nteranew name if an analysis was previously run and you wish to save the current results without overwriting the previous results Click OK The Expression Analysis Settings dialog box appears Figure 4 1 3 if set as a default option see Microarray Suite Default Settings Dialog on page 4 1 15 CHAPTER 1 Data Analysis AFFYMETRIX The Save Results As and Expression Analysis Settings dialog boxes are only displayed when chosen as default options and when the Run Analysis main menu commands are used to run an analysis 3 Click the Baseline tab of the Expression Analysis Settings dialog box and verify that the Use Baseline Comparison File option is cleared Figure 4 1 3 Expression Analysis Settings x Probe Array Type Hu6800 led Scaling Normalization Probe Mask Baseline Parameters F Use Baseline Comparison File Defaults Cancel Figure 4 1 3 Expression Analysis Settings Baseline tab a To compare the analysis output files chp of several experiments scale the experiments to the same target intensity using the All Probe Sets or Selected Probe Sets option found on the Scaling tab 5 Confirm or change the other Expression Analysis Settings as desired 6 Click OK to close the Expression Analysis Settings dialog box and run the absolute analysis During the analysis the status window displays the name of the analysis output file chp being generated and where it will be stored The
109. o mix Then briefly spin in a microcentrifuge to remove condensation and incubate at 16 C for 2 hours in a cooling waterbath Add 2 uL 10 U T4 DNA Polymerase Return to 16 C for 5 minutes Add 10 uL 0 5 M EDTA Proceed to clean up procedure for cDNA Cleanup of Double Stranded cDNA on page 2 1 17 or store at 20 C for later use CHAPTER 1 Eukaryotic Target Preparation Cleanup of Double Stranded CDNA Step 1 Phase Lock Gels PLG Phenol Chloroform Extraction Phase Lock Gels PLG form an inert sealed barrier between the agueous and organic phases of phenol chloroform extractions The solid barrier allows more complete recovery of the sample agueous phase and minimizes interface contamination of the sample PLG s are sold as premeasured aliguots in 1 5 mL tubes to which sample and phenol chloroform are directly added v Note A standard phenol chloroform extraction can be performed as an alternative to the PLG procedure 1 Pellet the Phase Lock Gel 1 5 mL tube with PLG I heavy in a microcentrifuge at gt 12 000 x g for 20 to 30 seconds 2 Add 162 uL equal volume of 25 24 1 Phenol chloroform isoamyl alcohol saturated with 10 mM Tris HCl pH 8 0 1 mM EDTA to the final cDNA synthesis preparation 162 uL to a final volume of 324 uL Vortex briefly See Reagents and Materials Required on page 2 1 5 for ordering information for phenol chloroform isoamyl alcohol Y Note Store phenol chloroform isoamyl alcoh
110. of the number of probes representing a sequence on GeneChip arrays negates any significant impact this may have on the final interpretation of the data 6 B 5 Appendixes 6 B 6 SECTION 6 Appendixes There are too many files showing in the file window in Microarray Suite What can I do By placing files for projects in their own directories and changing the default settings for data in Affymetrix Microarray Suite appropriately you can manage large numbers of files In addition with the Windows NT operating system users can specify their own directory defaults in Microarray Suite while logging on and create their own directories containing their data To do so each user should have their own logon name and organize files in subdirectories for example by project user date or lab Each user can then set the data default to their subdirectory of choice Experimental design Which is greater sample or assay variability Sample variability that arises mainly from biological heterogeneity is certainly higher than assay variability and has been estimated to be at least 10 fold greater than assay variability We recommend that researchers run multiple samples per data point to account for sample to sample variability In addition take care in experimental design to minimize potential variables associated with sample variables APPENDIX B FAQs amp Troubleshooting Troubleshooting Problem Sample Quality Li
111. ol at 4 C Dispose of solution when it turns pink 3 Transfer the entire cDNA phenol chloroform mixture to the PLG tube 4 DONOT VORTEX PLG will now become part of the suspension Microcentrifuge at full speed gt 12 000 x g for 2 minutes 5 Transfer the agueous upper phase to a fresh 1 5 mL tube Step 2 Ethanol Precipitation Please refer to Precipitation of RNA on page 2 1 10 for information on the use of carriers during ethanol precipitation 1 Add 0 5 volumes of 7 5 M NH OAc and 2 5 volumes of absolute ethanol stored at 20 C to the sample and vortex 2 Immediately centrifuge at gt 12 000 x g in a microcentrifuge at room temperature for 20 minutes 3 Remove supernatant Wash pellet with 0 5 mL of 80 ethanol stored at 20 C a Centrifuge at gt 12 000 x g at room temperature for 5 minutes 5 Remove the 80 ethanol very carefully the pellet may be loose Repeat the 80 ethanol wash one additional time 6 Air dry the pellet Check pellet for dryness before proceeding 7 Resuspend dried pellet in a small volume of RNase free water We recommend resuspending in 12 uL AFFYMETRIX AY 2 1 17 Eukaryotic 2 1 18 SECTION 2 Eukaryotic Sample and Array Processing The appropriate volume for resuspension depends on expected yield In the next step of sample preparation Synthesis of Biotin Labeled cRNA it is recommended to start with approximately 1 ug of cDNA up to 22 uL of volume is availab
112. olume 3 M NaOAc pH 5 2 and 2 5 volumes ethanol 2 Mix and incubate at 20 C for at least 1 hour 3 Centrifuge at gt 12 000 x g in a microcentrifuge for 20 minutes at 4 C CHAPTER 1 Eukaryotic Target Preparation a Wash pellet twice with 80 ethanol 5 Air dry pellet Check for dryness before proceeding 6 Resuspend pellet in DEPC treated H O The appropriate volume for resuspension depends on the expected yield and the amount of RNA required for the cDNA synthesis Please read ahead to the cDNA synthesis protocol in order to determine the appropriate resuspension volume at this step A ddition of Carrier to Ethanol Precipitations Adding carrier material has been shown to improve the RNA yield of precipitation reactions u Pellet Paint Affymetrix has found that adding 0 5 uL of Pellet Paint per tube to nucleic acid precipitations makes the nucleic acid pellet easier to visualize and helps reduce the chance of losing the pellet during washing steps The pellet paint does not appear to affect the outcome of subsequent steps in this protocol however it can contribute to the absorbance at 260 nm when quantifying the mRNA m Glycogen Addition of 0 5 to 1 uL of glycogen 5 mg mL to nucleic acid precipitations aids in visualization of the pellet and may increase recovery The glycogen does not appear to affect the outcome of subsequent steps in this protocol Quantitation of RNA Quantify RNA yield by spectrophotometri
113. omputer Load the library files making sure the protocols are in the same directory as the default path set in MAS AFEYMETRIX Appendixes 6 B 8 SECTION 6 Appendixes Problem Likely Cause Software Problems continued Solution Descriptions do not appear in When networking computers the name of the the analysis window following computer is often changed to correspond to an networking of the computer and organization s standard conventions This there is also a SOL error results in the breaking of the connection message appearing between MAS and the Microsoft Data Engine that also requires the computer name to operate After the computer is renamed uninstall MAS and MSDE and reinstall MAS GeneChip Analysis Suite is on the C drive and its filling up The library and protocol files can be moved to another larger drive The folders can simply be dragged and placed in a directory on another drive Remember to change the default path for the library and protocol files in MAS and remember that this path will need to be modified for each log in name In addition GeneChip data should always be stored locally on the largest available drive on the workstation The gene descriptions show up This is a result of different security settings for some users and not for between users and administrators of the others workstation Call Affymetrix Technical Support for information
114. on the procedure Remove the probe array and run the CLEAN procedure on the particular module before starting a new hybridization 3 4 12 CHAPTER 4 GeneChip E coli Genome Array Washing Staining and Scanning Probe Array Scan AFFYMETRIX The scanner is also controlled by Affymetrix Microarray Suite The probe array is scanned after the wash protocols are complete Make sure laser is warmed up prior to scanning by turning the laser on at least 15 minutes before use If probe array was stored at 4 C warm to room temperature before scanning Refer to the Microarray Suite online help and the appropriate scanner user s manual for more information on scanning If necessary clean the glass surface of probe array with a non abrasive towel or tissue before scanning Do not use alcohol to clean glass The scanner uses an argon ion laser and is equipped with a safety interlock system Defeating the interlock system may result in exposure to hazardous laser light Select Run Scanner from the menu bar Alternatively click the Start Scan icon in the tool bar The Scanner dialog box appears with a drop down list of experiments that have not been run A scrollable window is also displayed showing previous scans Select the experiment name that corresponds to the probe array to be scanned A previously run experiment can also be chosen from the Previous Experiments list by double clicking the name desired To perform
115. probe array After completing the procedures described in this chapter the hybridized probe array is ready for washing staining and scanning as detailed in Section 2 Chapter 4 701027 rev 1 2 3 3 SECTION 2 Eukaryotic Sample and Array Processing 2 3 4 CHAPTER 3 Eukaryotic Target Hybridization Reagents and Materials Reguired AFFYMETRIX The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Appendix A contains a master list of all reagents used in this manual Water Molecular Biology Grade BioWhittaker P N 16 001Y m Acetylated Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561 020 m Herring Sperm DNA Promega Corporation P N D1811 m Micropure Separator Millipore P N 42512 optional m GeneChip Eukaryotic Hybridization Control Kit Affymetrix P N 900299 contains Control cRNA and Control Oligo B2 m Control Oligo B2 3 nM Affymetrix P N 900301 can be ordered separately m 5 M NaCl RNase free DNase free Ambion P N 9760G m MES Free Acid Monohydrate SigmaUltra Sigma Aldrich P N M5287 m MES Sodium Salt
116. re 4 1 10 4 1 13 Data Analysis SECTION 4 Data Analysis 4 1 14 Expression Analysis Settings x Probe Array Type Huseoo z Scaling Normalization Probe Mask Baseline Parameters IV Use Baseline Comparison File N002 CHP Defaults OK Cancel Figure 4 1 10 Expression Analysis Settings Baseline tab displays the baseline file for the expression comparison analysis e Click the Normalization tab and specify the normalization option for the experimental data The scaling option may be used instead of normalization however baseline should already be scaled if using the scaling option refer to Affymetrix Microarray Suite User s Guide for a discussion of normalization and scaling You need only specify a normalization option for the experiment not the baseline When using scaling instead of normalization scale both the experiment and the baseline 7 Confirm or specify other probe array analysis parameters as desired 8 Click OK to close the Expression Analysis Settings dialog box and run the comparison analysis During the analysis the status window displays the name of the analysis output file chp being generated and where it will be stored The status window also indicates when the analysis is completed If the status bar is not displayed click the Status Log button E in the main toolbar or select View Status Bar from the main menu When the analysis is finished the Expression A
117. rect mRNA kit and from total RNA using the Oligotex mRNA kit If mammalian tissue is used as the source of mRNA total RNA should be first purified using a commercial reagent such as TRIzol and then using a poly A mRNA isolation procedure or a commercial kit Precipitation of RNA Total RNA It is not necessary to precipitate total RNA following isolation or cleanup with RNeasy Total RNA Isolation kit Please adjust elution volumes from the RNeasy column to prepare for cDNA synthesis based upon expected RNA yields from your experiment Affymetrix recommends starting the cDNA synthesis protocol with a minimum of 0 2 ug poly A mRNA at a minimum concentration of 0 02 ug uL or 5 ug of total RNA at a minimum concentration of 0 5 ug uL in order to obtain sufficient quantity of labeled cRNA for target assessment and hybridization to GeneChip expression probe arrays There are two major advantages to starting with at least the recommended amount of material 1 Enough material to check sample yield and quality at the various steps of this protocol 2 Production of enough cRNA for hybridization of the target to multiple probe arrays Ethanol precipitation is required following TRIzol isolation and hot phenol extraction methods see methods below Poly A mRNA Most poly A mRNA isolation procedures will result in dilute solutions of RNA It is necessary to concentrate mRNA prior to the cDNA synthesis Precipitation Procedure 1 Add 1 10 v
118. rly stored routinely give good results eliminating a freeze thaw can be of benefit since it will most likely yield higher quality RNA GeneChip Microarray Suite is on the C drive and its filling up How can I create more room on the hard drive The library and data files can be moved to another drive then deleted from the C drive After moving the files remember to change your library file default settings in MAS to the appropriate directory by clicking on the Tools tab and then select Defaults in the drop down menu then File locations tab in the Defaults window What is the difference between scaling and normalization when I scale or normalize my data to all genes on the array With scaling you create an arbitrary target average intensity and scale the average intensity of all genes on each array within a data set to that number This enables you to compare multiple arrays within a data set The scaling factor remains the same for a particular array as long as you use the same arbitrary target intensity for scaling Scaling can be performed independent of the comparison analysis On the other hand normalization can only be done when doing the comparison analysis It compares an experimental array with a baseline array and normalizes the average intensity of the experimental array to the average intensity of the baseline array when running a APPENDIX B FAQs amp Troubleshooting comparison analysis in MAS The normalization factor
119. rogen Life Technologies P N 15596 018 Tubes Sterile RNase free microcentrifuge 1 5 mL USA Scientific P N 1415 2600 Tubing Tygon 0 04 inner diameter Cole Palmer P N H 06418 04 Tween 20 10 Pierce Chemical P N 28320 V Vacuum filter units 1 liter capacity 0 20 um or 0 45 um Corning P N 25988 1L W Water DEPC Treated Ambion P N 9902 Water Distilled Invitrogen Life Technologies P N 15230 147 Water Molecular Biology Grade BioWhittaker P N 16 001Y 701044 rev 1 FAQs amp Troubleshooting FAQs This section contains frequently asked questions related to GeneChip Expression Analysis Sample Preparation What is the minimum amount of total RNA I can use for each microarray experiment We currently recommend 5 ug of total RNA for our eukaryotic expression arrays There are protocols in the literature which describe the use of less starting material for hybridization onto Affymetrix GeneChip arrays but we have not fully validated the performance of these various labeling strategies compared with our standard protocol What is the least amount of labeled eukaryotic cRNA target I can put on an array You should always use the recommended quantity of cRNA as described in this manual Please refer to Table 2 3 1 for the detailed instruction on the amount of cRNA needed for different array formats Though there is a tolerance for some variation in this quantity we have found that hybridization of s
120. rs to be masked Select OK to end selection and save the Probe Mask file Hyb and Spike to Generate Probe Mask Files There are also three probe mask creation utilities Cross Hyb Hyb and Spike Each of these utilities allows the user to automatically create Probe Mask files based on user defined probe pair hybridization characteristics in control experiments Cross Hyb The cross hybridization probe mask generator allows the user to conduct control experiments in order to detect cross hybridization occurring in the presence of specific transcripts Probe pairs observed to exhibit cross hybridization with the control sample based on these experiments are automatically added to a Probe Mask file For example we may wish to determine whether certain control transcripts cross hybridize with other probes on an array The Cross Hyb function adds any such probe pairs to the Probe Mask file based on a user defined Upper Intensity Limit This is an advanced feature to assist in mask creation Contact Affymetrix Technical Support for assistance with this utility 4 1 19 Data Analysis 4 1 20 SECTION 4 Data Analysis Hyb The hybridization probe mask generator allows the user to generate Probe Mask files that include only those probe pairs which meet hybridization characteristics based on the Difference Threshold and Ratio Threshold values that are user defined Subseguent analyses using hybridization masks will be ba
121. ryotic samples using protocols in this manual Section 2 double stranded cDNA is synthesized from total RNA or purified poly A messenger RNA isolated from tissue or cells An in vitro transcription IVT reaction is then done to produce biotin labeled cRNA from the cDNA The cRNA is fragmented before hybridization For E coli samples Section 3 describes a detailed protocol to isolate total RNA followed by enrichment of messenger RNA After fragmentation the RNA is end modified and conjugated with biotin Step 2 Target Hybridization A hybridization cocktail is prepared including the fragmented target probe array controls BSA and herring sperm DNA It is then hybridized to the probe array during a 16 hour incubation The hybridization process is described in the respective sections for the different probe array types AFFYMETRIX AN 1 1 5 Overview SECTION 1 GeneChip Expression Analysis Overview Step 3 Experiment and Fluidics Station Setup Specific experimental information is defined using Affymetrix Microarray Suite on a PC compatible workstation with a Windows NT operating system The probe array type sample description and comments are entered in Microarray Suite and saved with a unigue experiment name The fluidics station is then prepared for use by priming with the appropriate buffers For more information on the fluidics station refer to the GeneChip Fluidics Station 400 User s Guide Step 4 Probe Arra
122. s x Enter a Chip File Name Timepoint0 CHP Figure 4 1 5 Save Results As dialog box Enter a new name if an analysis was previously run and you wish to save the current results without overwriting the previous results Click OK The Expression Analysis Settings dialog box appears Figure 4 1 6 if chosen as a default option see Microarray Suite Default Settings Dialog on page 4 1 15 The Save Results As and Expression Analysis Settings dialog boxes are only displayed when chosen as default options and when the Analyze button or Run Analysis main menu commands are used to run an analysis 2 Click the Baseline tab and verify that the Use Baseline Comparison File option is cleared Figure 4 1 6 Expression Analysis Settings x Probe Array Type Huggoo Sealing Normalization Probe Mask Baseline Parameters C Use Baseline Comparison File Defaults Cancel Figure 4 1 6 Expression Analysis Settings Baseline tab 3 Confirm or change the other Expression Analysis settings as desired a If the baseline was not scaled specify a normalization option for the experiment 5 Click OK to close the Expression Analysis Settings dialog box and run the absolute analysis of the baseline During the analysis the status window displays the name of the analysis output file chp being generated and where it will be stored The status window also indicates when the analysis is completed 4 1 11
123. s in accordance with federal state and local regulations This includes adherence to the OSHA Bloodborne Pathogens Standard 29 CFR 1910 1030 for blood derived and other samples governed by this act Never pipet by mouth Avoid specimen contact with skin and mucous membranes 3 Exercise standard precautions when obtaining handling and disposing of potentially carcinogenic reagents 4 Exercise care to avoid cross contamination of samples during all steps of this procedure as this may lead to erroneous results 5 Use powder free gloves whenever possible to minimize introduction of powder particles into sample or probe array cartridges CHAPTER 1 GeneChip Expression Analysis Overview Terminology Probes The oligonucleotides on the surface of the probe arrays are called probes because they probe or interrogate the sample Target The target is the labeled nucleic acid that is being interrogated It is hybridized to the probes on the array Probe Cell Specific areas on the probe array that contain oligonucleotides of a specific sequence Interfering Conditions C AUTI Wear powder free gloves throughout procedure Take steps to minimize the a introduction of exogenous nucleases Water used in the protocols below is molecular biology grade nuclease free Proper storage and handling of reagents and samples is essential for robust performance ALI laboratory equipment used to prepare the target during this procedure shou
124. s on the procedure Remove the probe array and run the CLEAN procedure on the particular module before starting a new hybridization CHAPTER 4 Eukaryotic Arrays Washing Staining and Scanning Probe Array Scan The scanner is also controlled by Affymetrix Microarray Suite The probe array is scanned after the wash protocols are complete Make sure laser is warmed up prior to scanning by turning the laser on at least 15 minutes before use If probe array was stored at 4 C warm to room temperature before scanning Refer to the Microarray Suite online help and the appropriate scanner user s manual for more information on scanning If necessary clean the glass surface of probe array with a non abrasive towel or tissue before scanning Do not use alcohol to clean glass AFFYMETRIX The scanner uses an argon ion laser and is equipped with a safety interlock system Defeating the interlock system may result in exposure to hazardous laser light Click Run Scanner from the menu bar Alternatively click the Start Scan icon in the tool bar The Scanner dialog box appears with a drop down list of experiments that have not been run A scrollable window is also displayed showing previous scans Select the experiment name that corresponds to the probe array to be scanned A previously run experiment can also be selected from the Previous Experiments list by double clicking the desired name To perform the recommended 2X
125. sed solely on the probe pairs which were identified as performing to a specified level All other probe pairs are masked This is an advanced feature to assist in mask creation Contact Affymetrix Technical Support for assistance with this utility Spike The Spike probe mask generator allows the user to generate Probe Mask files that exclude probe pairs from analysis based on differential hybridization characteristics between a sample with and without a specific transcript spike The hybridization characteristics are based on Difference Threshold and Ratio Threshold values that are user defined This is an advanced feature to assist in mask creation Contact Affymetrix Technical Support for assistance with this utility Probe Set Masking Purpose Probe Set masking is used to select particular probe sets for use in comparison analysis during data scaling or normalization Why is Probe Set Masking Helpful Signal intensity may vary between experiments due to many factors such as sample and or stain concentration variance Scaling or normalization is a process through which a factor is calculated that when applied to all intensity values on an array will allow experiments to be accurately compared Using Probe Set masks the user defines which probe sets on an array will be used for the scaling or normalization calculation Scaling or normalization factor computation is based on an average of the Average Difference values of the select
126. sk tab of the Expression Analysis Settings dialog box Check Use Probe Mask File and then browse and select the desired file from the list The selected mask file will appear in the Probe Mask file field and the probe pairs which had been specified for masking will not be used in the analysis This will be reflected in the Pairs Used column of the analysis results For example if there are 20 total probe pairs Pairs in a probe set and two pairs are masked with a Probe Mask then the Pairs Used will be 18 for that probe set Probe Mask use is recorded under View parameters 4 1 17 Data Analysis 4 1 18 SECTION 4 Data Analysis Procedure to Create a Custom Probe Mask A Probe Mask may be created from the Expression Analysis Settings dialog box by choosing the appropriate probe array type and then selecting the Probe Mask tab and the Create Open Probe Mask button To create a new Probe Mask enter the name for the new mask file in the File Name field of the Probe Mask File dialog box In order to edit a previously created Probe Mask file simply select the file from the list in the window Choose Open to create or edit the selected file Figure 4 1 15 Expression Call Settings FI r Probe Array Parameters Defaults IV Use As Current Algorithm Scaling Normalization Probe Mask Baseline Parameters T Use Probe Mask File Create Open Probe Mask r Algorithm Parameters IV Prompt for output filename
127. st strand cDNA buffer 4uL 1X Add to the above tube and mix well 0 1 M DTT i 2 uL 10 mM Incubate at 37 C for 2 minutes 10 mM dNTP mix Tul 500 uM each 3 First Strand Synthesis SuperScript II RT 1 pL per ug MRNA 200 U to 1000 U Add to the above tube and mix well variable 200 U uL Incubate at 37 C for 1hour Total Volume 20 HL Step 2 Second Strand cDNA Synthesis 1 Place First Strand reactions on ice Centrifuge briefly to bring down condensation on sides of tube 2 Addtothe First Strand synthesis tube the reagents listed in the following Second Strand Final Reaction Composition Table Table 2 1 2 Table 2 1 2 Second Strand Final Reaction Composition Final Concentration or Component Amount in Reaction DEPC treated water 91 uL 5X Second Strand Reaction Buffer 30 uL 1X 10 mM dNTP mix 3 uL 200 uM each 10 U uL E coli DNA Ligase 1 uL 10 U 10 U uL E coli DNA Polymerase 4 uL 40 U 2 U uL E coli RNase H 1 uL 2U Final Volume 150 uL 3 Gently tap tube to mix Then briefly spin in a microcentrifuge to remove condensation and incubate at 16 C for 2 hours in a cooling waterbath a Add 2 uL 10 U T4 DNA Polymerase 5 Return to 16 C for 5 minutes 6 Add 10 uL 0 5 M EDTA 7 Proceed to clean up procedure for cDNA Cleanup of Double Stranded cDNA on page 2 1 17 or store at 20 C for later use AFFYMETRIX AN 2 1 13 Eukaryotic 2 1 14 SECTION 2 Eukaryotic Sample a
128. t Fluidics from the menu bar The Fluidics Station dialog box appears with a drop down list for selecting the experiment name for each of the fluidics station modules A second drop down list is accessed for choosing the Protocol for each of the four fluidics station modules Refer to the GeneChip Fluidics Station 400 User s Guide for instructions on connecting and addressing multiple fluidics stations Priming the Fluidics Station Priming ensures that the lines of the fluidics station are filled with the appropriate buffers and the fluidics station is ready for running fluidics station protocols Priming should be done m When the fluidics station is first started When wash solutions are changed m Before washing if a shutdown has been performed m f the LCD window instructs the user to prime 1 To prime the fluidics station select Protocol in the Fluidics Station dialog box 2 Choose Prime for the respective modules in the Protocol drop down list 3 Change the intake buffer reservoir A to Non stringent Wash Buffer and intake buffer reservoir B to Stringent Wash Buffer 4 Click Run for each module to begin priming CHAPTER 4 Eukaryotic Arrays Washing Staining and Scanning Probe Array Wash and Stain Affymetrix offers two staining protocols 1 the single stain protocol for eukaryotic targets page 2 4 9 and 2 a signal amplification protocol for eukaryotic targets page 2 4 12 Please use the Antibody A
129. t is generated by the analysis of a dat or cel file The chp file contains the absolute analysis and may contain the comparison analysis The absolute analysis determines which transcripts are present or absent in a sample and the comparison analysis determines which transcripts are increased or decreased between samples To access these files select Tools Defaults from menu bar Select the Experiment Data line in the File Locations tab and click the Modify button Map to the appropriate directory to allow Microarray Suite to access the desired files 4 1 21 Data Analysis Section 3 Fluidics Station Maintenance Procedures 701040 rev 1 Contents 701040 rev 1 Section 5 Chapter 1 Fluidics Station Maintenance Procedures 5 1 3 o o 3 3 c o 3 3 vw u Section 5 Chapter 1 701041 rev 1 n m Fluidics Station Maintenance Procedures Weekly Fluidics Station Cleanout 524 404054 2 84 oo bP G5 e EN 5 1 4 Bleach Protocol 44 22 R k Ah ADA STE l0 QUR DOSES Ed BX 5 1 4 Monthly Fluidics Station Decontamination Protocol S15 This Section Contains u Aweekly fluidics station bleach protocol m A monthly fluidics station decontamination protocol o o 3 3 c o 3 3 vw u 701041 rev 1 SECTION 5 ZTuidics Station Maintenance Procedures Weekly Fluidics Station Cleanout Bleach Protocol ETT A cleaning protocol is r
130. t is ready to scan on the GeneArray Scanner Scan according to Probe Array Scan on page 3 4 13 If there are no more samples to hybridize shut down the fluidics station following the procedure in Shutting Down the Fluidics Station on page 3 4 14 15 Keep the probe arrays at 4 C and in the dark until ready for scanning AFFYMETRIX AN 34 11 E coli SECTION 3 Prokaryotic Sample and Array Processing 16 ENGAGE wash block v Note For proper cleaning and maintenance of the fluidics station including the bleach protocol refer to Section 5 Fluidics Station Maintenance Procedures Table 3 4 5 If bubbles are present Return the probe array to the probe array holder Latch the probe array holder by gently pushing it up until a light click is heard Engage the washblock by firmly pushing up on the probe array lever to the ENGAGE position The fluidics station will drain the probe array and then fill it with a fresh volume of the last wash buffer used When it is finished if the LCD window displays EJECT CARTRIDGE again remove the probe array and inspect it again for bubbles If no bubbles are present it is ready to scan Proceed to Probe Array Scan on page 3 4 13 If several attempts to fill the probe array without bubbles are unsuccessful the array should be filled with Wash A non stringent buffer manually Excessive washing will result in a loss of signal intensity Contact Affymetrix Technical Support for details
131. tents Section 4 Chapter 1 Data Analysis 701038 rev 1 4 1 3 Data Analysis Ka a gt lt g lt y lt a Section 4 Chapter 1 701039 rev 1 F Data Analysis OVEIIEW y rias oe SEE EES CESS di a ak bn OSH h OA 4 1 4 GeneChip Analysis Suite 4 1 4 Analyzing Samples s a eorne sap we Ree Adam ele A di JA e A der D 4 1 5 Comparison Analysises a Jung 4 4 das D Oe et ee oe de A cee Ao KC 4 1 6 Affymetrix Microarray UME 2 sal Moke Wt dae AOR al l v n 4 1 7 Expression Analysis Settings o es 665 e aust ala ed me nk OE 4 OE HDS 4 1 7 Viewing the Expression Analysis Settings 4 1 7 Running an Absolute Expression Analysis 4 1 8 Running a Comparison Expression Analysis 4 1 10 Absolute Expression Analysis of the Baseline 4 1 10 Comparison Expression Analysis of the Experiment and Baseline 4 1 12 Microarray Suite Default Settings Dialog 4 1 15 Probe Array Analysis lt 404 os OG Dae HRSG OE BGG kes 4 1 16 Probe Pair and Probe Set Masking in GeneChip Expression Analysis 4 1 17 Probe MASKO sa r a y a tn ai ob og de rte de c re goon ce 4 1 17 Creation and Use of Probe MaskFiles 4 1 17 2 Procedure to Create a Custom Probe Mask 4 1 18 ES Defining the Probe MaskFil
132. ter the scanned probe array image dat file is ready for analysis as explained in Section 4 701033 rev 1 3 4 3 SECTION 3 Prokaryotic Sample and Array Processing 3 44 CHAPTER 4 GeneChip E coli Genome Array Washing Staining and Scanning Reagents and Materials Reguired AFFYMETRIX The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Appendix A contains a master list of all reagents used in this manual Water Molecular Biology Grade BioWhittaker P N 16 001Y Distilled water Invitrogen Life Technologies P N 15230 147 Acetylated Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561 020 R Phycoerythrin Streptavidin Molecular Probes P N S 866 5 M NaCl RNase free DNase free Ambion P N 9760G PBS pH 72 Invitrogen Life Technologies P N 20012 027 20X SSPE 3 M NaCl 0 2 M NaH PO 0 02 M EDTA BioWhittaker P N 16 010Y Goat IgG Reagent Grade Sigma Aldrich P N 5256 Anti streptavidin antibody goat biotinylated Vector Laboratories P N BA 0500 10 surfact Amps20 Tween 20 Pierce Chemical P N 2832
133. that is slightly above detection limit Detection of these controls on the E coli Genome Array serves as indicators of the labeling efficiency Alternatively various control transcripts can also be spiked in at variable concentrations to demonstrate the dynamic range of the assay Table 3 1 1 Primer Mixture for mRNA Enrichment Components Volume or Amount Final Concentration Total RNA 25 0 ug 0 83 ug pL 10 uM rRNA Removal Primer Stock 7 UL 1 75 uM 500 pM Control Transcript optional 1 uL Nuclease free DI H2O Up to 40 0 uL Total Volume Added 40 uL 2 Heat RNA and primer mixture to 70 C for 5 minutes and then cool to 4 C 3 Add the following components to each of the four tubes Table 3 1 2 Reverse Transcription Components Components Volume Final Concentration 10X MMLV RT Buffer 10 0 uL 1X 25 0 mM dNTP Mix 2 0 uL 0 5 mM 20 U uL SUPERaseeln 3 0 uL 0 6 U uL 200 U uL MMLV RT 2 5 uL 5 U uL Nuclease free H20 42 5 uL Total Volume Added 60 uL 3 1 10 CHAPTER 1 Direct Labeling of Enriched E coli mRNA 4 Incubate the reaction at 42 C for 25 minutes then at 45 C for 20 minutes Cool to 4 C 5 Inactivate the enzyme at 65 for 5 minutes then hold at 4 C Proceed immediately to Step 2 rRNA Digestion below step 2 rRNA Digestion 1 Add the following to each of the four tubes Table 3 1 3 RNase Digestion of rRNAs Components Volume Final Concen
134. the CLEAN procedure on the particular module before starting a new hybridization 2 4 11 Eukaryotic 2 4 12 SECTION 2 Eukaryotic Sample and Array Processing Washing and Staining Procedure 2 Antibody Amplification for Eukaryotic Targets This protocol is recommended for use with probe arrays with probe cells of 24 um or smaller This procedure takes approximately 75 minutes to complete Preparing the Staining Reagents Prepare the following reagents Volumes given are sufficient for one probe array SAPE Stain Solution Streptavidin Phycoerythrin SAPE should be stored in the dark at 4 C either foil wrapped or kept in an amber tube Remove SAPE from refrigerator and tap the tube to mix well before preparing stain solution Do not freeze concentrated SAPE or diluted SAPE stain solution Always prepare the SAPE stain solution immediately before use Table 2 4 4 SAPE Solution Mix Components Volume Final Concentration 2X MES Stain Buffer 600 0 uL 1X 50 mg mL acetylated BSA 48 0 uL 2 mg mL 1 mg mL Streptavidin Phycoerythrin SAPE 12 0 uL 10 ug mL DIH 0 540 0 uL Total 1200 pL Mix well and divide into two aliquots of 600 uL each to be used for stains 1 and 3 respectively Antibody Solution Table 2 4 5 Antibody Solution Mix Components Volume Final Concentration 2X MES Stain Buffer 300 0 uL 1X 50 mg mL acetylated BSA 24 0 uL 2 mg mL 10 mg mL Normal Goat IgG 6 0 uL 0 1
135. the Expression Call Settings dialog box click the OK button to apply your choices regarding parameters set by all of the tab dialog boxes in the window Next select OK in the Defaults dialog box Select Run gt Analysis or click the Analyze button EE on the main tool bar The software calculates the average intensity of each probe cell using the intensities of the pixels contained in the cell Pixels on the edges of each cell are not included which prevents neighboring cell data from affecting a cell s calculated average intensity The calculated average intensity is assigned an X Y coordinate position which corresponds to the cell s position on the array This data is stored as a cel file using the same name as the exp and dat files The cel file is an intermediate data file The software then applies the selected probe array algorithm to determine expression levels for each gene This is done with reference to the information contained in the cdf file the second library file for the probe array The resulting analysis is automatically displayed as a chp file in the Expression Analysis window of GeneChip Analysis Suite software See File Types on page 4 1 21 for definitions of these files Data Analysis SECTION 4 Data Analysis Comparison Analysis In a comparison analysis one experiment is defined as a baseline and is then used in comparison to a second experiment The experiment to be used as a baseline must have a chp fi
136. tide Binding Protein Alpha 12 20 688 A 20 339 A 20 47 0 A Potassium Channel Gb L02750 20 7 0 A 20 632 A 20 10 A Potassium Channel Gb L02752 20 25 4 A 20 117 A 20 110 A Cyelophilin Related Protein 20 218 A 20 1269 A 20 30 A Golgin 165 Kda Polypeptide 20 76 A 20 321 A 20 85 A Thrombospondin 2 Gb L07803 20 589 A 20 639 A 20 657 A Ma44 20 1115 A 20 1459 P 20 682 P Mg51 Protein Gb L08239 20 117 A 20 82 A 20 380 A Mg81 20 d43 A 20 331 A 20 437 A Dna Polymerase Epsilon Catalytic Subunit 20 236 A 20 02 A 20 02 A Serine Threonine Kinase Receptor 2 2 Alt Splice 3 20 1004 P 20 730 A 20 378 A Guanine Nucleotide Exchange Factor 1 20 40 A 20 400 A 20 78 A Guanine Nucleotide Exchange Factor 2 20 6069 P 20 738 7 P 20 6270 P Mac25 20 72 3 A 20 1504 A 20 107 0 A J00073 class A 20 probes 18 in J00073exont2 132 255 2 not in GB record Human alpha cardiac actir 20 51 4 A 20 366 A 20 333 A J00123 class C 20 probes 20 in all 100123 539 1020 Human enkephalin gene 20 327 A 20 29 3 A 20 3 3 A 100124 class A 20 probes 17 in J00124exon 8 14 227 3 not in GB record Homo sapiens 50 kDa type 20 21 1 A 20 161 A 20 66 A J00123 class A 20 probes 16 in J00123mRNA 1 1282 1552 4 not in GB record Human fibrinogen bet 20 735 A 20 763 A 20 199 A J00287 class B 20 probes 14 in JO0287exon 1 8 248 6 not in GB record Human pepsinogen gene 20 07 A 20 38 A 20 104 A J00301 class C 20 probes 20 in all JOO301 342 715 Human parathyroid pth gene 3 end 2
137. tion DEPC H20 variable for final reaction volume of 20 uL Incubate at 70 C for 10 minutes T7 dT 24 primer 100 pmol uL 1 uL 100 pmol Quick spin and put on ice RNA variable 5 0 to 40 ug 5 0 to 40 ug 2 Temperature Adjustment 5X First strand cDNA buffer 4 uL 1X Add to the above tube and mix well 0 1 M DTT 2uL 10 mM DTT Incubate at 42 C for 2 minutes 10 mM dNTP mix 1 uL 500 uM each 3 First Strand Synthesis SuperScript II RT variable See Table 2 1 3 200 U to 1000 U Add to the above tube and mix well 200 U uL Incubate at 42 C for 1 hour Total Volume 20 uL Y Not n The above incubations have been changed from the SuperScript protocols and are done at 42 C AFFYMETRIX AN 2 1 15 Eukaryotic 2 1 16 SECTION 2 Eukaryotic Sample and Array Processing Step 2 Second Strand cDNA Synthesis 1 Place First Strand reactions on ice Centrifuge briefly to bring down condensation on sides of tube 2 Add to the First Strand synthesis tube the reagents listed in the following Second Strand Final Reaction Composition Table Table 2 1 5 Table 2 1 5 Second Strand Final Reaction Composition Final Concentration or Component Amount in Reaction DEPC treated water 91 uL 5X Second Strand Reaction Buffer 30 uL 1X 10 mM dNTP mix 3 uL 200 uM each 10 U uL E coli DNA Ligase Tul 10U 10 U uL E coli DNA Polymerase 4uL 40 U 2 U pL E coli RNase H 1 uL 2U Final Volume 150 uL 3 Gently tap tube t
138. tration 10 0 U uL RNase H 4 0 uL 0 4 U uL 20 U uL SUPERaseeln 3 0 uL 0 6 U uL Total Volume Added Tul 2 Incubatethe reaction at 37 C for 25 minutes then hold at 4 C Proceed immediately to Step 3 cDNA Digestion below step 3 cDNA Digestion AFFYMETRIX 1 Add the following to each of the four tubes Table 3 1 4 Digestion of cDNA Components Volume Final Concentration 5 0 U uL DNase I 4 0 uL 0 2 U uL 24 5 U uL RNAguard 1 0 uL 0 225 U UL Total Volume Added 5 uL Dilute 10 U uL DNase to 5 U uL with nuclease free HO The concentration of DNase is critical Excessive digestion may cause degradation of mRNA Lot to lot variation of enzyme activity may occur Therefore titrate DNase concentrations when necessary 2 Incubate the reaction at 37 C for 20 minutes 3 Inactivate the enzyme by adding 3 UL of 500 mM EDTA to each tube for a final concentration of 10 0 mM The concentration and incubation time for DNase are critical Under digestion is preferable to over digestion 4 Pool reaction product from all four tubes and clean up the enriched mRNA with QIAGEN RNeasy Mini column 5 Quantify the enriched mRNA preparation by 260 nm absorbance Typical yields for the procedure are 20 to 40 ug of RNA 1 0 A unit 40 g mL single strand RNA 3 1 11 E coli 3 1 12 SECTION 3 Prokaryotic Sample and Array Processing The enriched mRNA is stored at 20 C until ready for use in the su
139. ure Detection HIV Rules Figure 4 1 14 Analysis Settings shortcut bar 4 1 16 CHAPTER 1 Data Analysis Probe Pair and Probe Set Masking in GeneChip Expression Analysis Probe Masking Affymetrix Microarray Suite allows the user to define files called mask files which may be useful during array analysis Two types of mask files can be employed Probe Mask files and Probe Set Mask files Probe Mask files designate specific probe pairs which are to be excluded from analysis while Probe Set Mask files define specific probe sets for use during data scaling and normalization These two types of mask files quite distinct from one another in their functions can be useful tools to enhance GeneChip Expression Analysis at both the absolute intra array and the comparison inter array level Both Probe Mask and Probe Set Mask files format msk are written to the Probe Information file directory which by default is C GeneChip Library It is important to note that although the two types of mask files share the same filename format and location they are not interchangeable Purpose Probe masking is a feature that allows the user to exclude groups of probe pairs from the analysis of a specific probe array type Why is Probe Masking helpful The probe pairs synthesized on GeneChip Expression Analysis arrays are all a priori selected based on sequence information derived from public sequence databases or proprietary d
140. y overt steps to accomplish this How do I add additional probe sets in the rpt file Use the Report Settings dialog on the short cut menu in Microarray Suite to open the Expression Report You may add any probe sets desired by simply typing in the probe set name s you wish to add this can also be accomplished by cutting and pasting from a text file Keep in mind that the probe set name must be entered exactly as it appears in the analysis file including the suffixes such as 12345 s at Why can t I analyze data files stored on a CD Files in CD ROM format are stored in read only mode MAS requires that this attribute be removed To do this open NT Explorer and select the file s you copied from the CD Click the right mouse button and select Properties Clear the Read only check box near the bottom of the Properties screen and click OK How can the mismatch probe cell have a higher intensity than its complementary perfect match probe cell There could be a number of reasons for this It is possible that this probe sequence could have high homology with another unknown sequence resulting in a high mismatch to perfect match ratio Another possibility is that the probe sequence on the array is correct for the majority of the cases however the sample may have a sequence variation which causes low specific binding to the perfect match and high specific binding to the mismatch Regardless of the cause of such phenomenon the redundancy
141. y Washing and Staining Immediately following hybridization the probe array undergoes an automated washing and staining protocol on the fluidics station Step 5 Probe Array Scan Once the probe array has been hybridized washed and stained it is scanned Each workstation running Affymetrix Microarray Suite can control one scanner Each probe array is scanned twice taking up to ten minutes depending on the array format The software calculates an average of the two images defines the probe cells and computes an intensity for each cell The double scan improves assay sensitivity and reduces background noise Each complete probe array image is stored in a separate data file identified by the experiment name and is saved with a data image file dat extension Review the scanner user s manual for safety precautions and for more information on using the scanner Step 6 Data Analysis Precautions Data is analyzed using Microarray Suite Expression Analysis window The dat image is analyzed for probe intensities results are reported in tabular and graphical formats Information on data analysis is given in Section 4 A WARK 1 FOR RESEARCH USE ONLY NOT FOR USE IN DIAGNOSTIC PROCEDURES 2 Avoid microbial contamination which may cause erroneous results All biological specimens and materials with which they come into contact should be handled as if capable of transmitting infection and disposed of with proper precaution
142. y placed over the dat file demarcating each probe cell One of the probe array library files the cif file is used by Microarray Suite to determine the appropriate grid size used Confirm the alignment of the grid by zooming in on each of the four corners and on the center of the image If the grid is not aligned correctly adjust the alignment by placing the cursor on an outside edge or corner of the grid The cursor image will change to a small double headed arrow The grid can then be adjusted using the arrow keys on the keyboard or by clicking and dragging the borders with the mouse The procedures for GeneChip expression analysis differ slightly whether you are running GeneChip Analysis Suite software or Affymetrix Microarray Suite The procedures for each are described below GeneChip Analysis Suite GeneChip Analysis Suite analyzes the hybridization intensity data from GeneChip expression probe arrays and calculates a set of metrics that describe probe set performance In an absolute expression analysis GeneChip Analysis Suite examines the hybridization intensity data from one experiment probe array to calculate a set of absolute metrics Some of the metrics are used by a decision matrix to determine an Absolute Call for each transcript Present P Absent A or Marginal M In a comparison expression analysis GeneChip Analysis Suite examines the hybridization intensity data from two probe arrays an experiment and
143. ze to room temperature completely Specifically if the rubber septa are not equilibrated to room temperature they may be prone to cracking which can lead to leaks 3 Heat the hybridization cocktail to 99 C for 5 minutes in a heat block 4 Meanwhile wet the array by filling it through one of the septa see Figure 3 4 for location of the probe array septa with appropriate volume 1X Hybridization Buffer using a micropipettor and appropriate tips Table 2 3 2 It is necessary to use two pipette tips when filling the probe array cartridge one for filling and the second to allow venting of air from the hybridization chamber After the addition of hybridization cocktails to the array the septa may be covered with Tough Spots to prevent evaporation 2 3 7 Eukaryotic 2 3 8 SECTION 2 Eukaryotic Sample and Array Processing 5 Incubate the probe array filled with 1X Hybridization Buffer at 45 C for 10 minutes with rotation Table 2 3 2 Probe Array Cartridge Volumes Hybridization Volume Total Fill Volume Standard 200 uL 250 uL Midi 130 uL 160 uL Mini 80 uL 100 uL Micro 80 uL 100 uL 6 Transfer the hybridization cocktail that has been heated at 99 C in step 3 to a 45 C Plastic cartridge Pro glass substrate Figur Gene heat block for 5 minutes Spin hybridization cocktail s at maximum speed in a microcentrifuge for 5 minutes to remove any insoluble material from the hybridization mixture

Download Pdf Manuals

Related Search

Related Contents

PDP 3000 HV  PM-624 ALGIBLACK  Sony XBA-1 User's Manual  A2F-Linux Evaluation Kit  Samsung SM-G355HN Benutzerhandbuch  Project Manual 2  

Copyright © All rights reserved. Failed to retrieve file