Home

DNA Sequencing Analysis User`s Manual 3.2

1. E 3 sample Scripts e sh EE CHEER UR RAE PR ees E 5 License and 1 Software License and Limited Product Warranty F 1 Glossary Index vii Search Find Again About This User s Manual Introduction In This Chapter This chapter provides a general introduction to the ABI PRISM DNA Sequencing Analysis Software It provides information about the organization of this manual and instructions on how to get help from PE Applied Biosystems This chapter includes the following topics Topic See Page Manual Contents 1 2 New Features in Sequencing Analysis Since Version 3 0 1 4 Sequencing Analysis Software Applies to Three Instruments 1 8 What Does Sequencing Analysis Software Do 1 9 Other ABI PRISM Software 1 14 Technical Support 1 16 Note If you are already familiar with previous versions of Sequencing Analysis software and want to know what is new and different in this version turn to New Features in Sequencing Analysis Since Version 3 0 on page 1 4 About This User s Manual 1 1 Search Find Again Manual Contents Overview of The following table describes the contents of this manual Contents Chapter contents Chapter Content 1 About This User s Manual gives an overview of Sequencing Analysis and related software and tells how to obtain technical
2. 4 20 The Processing Parameters 5 10 OVEIVIEW sci Sek LETT 5 1 Parameters in the Sample Manager Window 5 2 The Sample File Name Parameter 5 3 The Sample Name 5 4 Whe Av Parameter p C eb n ewe 5 5 The F Parameter oro eR ERRARE Hr Re URL eae ad 5 6 The P Parameter zl cbex e RU ER VER 5 7 The Basecaller Parameter 5 8 The Spacing Parameter 0 0 2 eee cee ee 5 9 The Basecaller Settings 5 10 The Peak 1 Location Parameter 5 11 The Start Point 5 16 The Stop Point 5 17 The DyeSet Primer File 5 18 The Instrument File 5 20 Parameters in the Preferences Dialog 5 21 Changing Parameter Values in the Preferences Dialog Box 5 22 Gel Preferences 2 Ar Pi Saas eis REEF CRUS T gus 5 23 Basecaller Settings 0 0 ee eee eee 5 28 Search Find Again Sample Manager Defaults 0 0 0 0 5 32 Printing Preferences dul kn eo ROLE Pre wes pense YER 5 34 Se
3. for the file Example Sample Feature key Rangets Description HBI Vector 1 75 This range of bases indicates the vector E 5 ABIAmbi gui ty 829 1024 This range of bases indicates ambiguity RBBI Limits 1 950 This is the confidence range RBI Multibase 707 0 6 R RBI Multibase 747 0 915 RBI Multibase 831 0 73 S RBI Multibase 848 0 73 V RBI Multibase 858 0 845 RBI Multibase 888 0 66 ABI Mul t ibase 889 0 71M ABI Mul t ibase 900 0 84 W AB I Mul t ibase 903 0 64 S AB I Mul t ibase 953 0 94 AB I Mul t ibase 961 0 72 H AB I Mul t ibase 963 0 64 M ABIMul t ibase 964 0 56 S AB I Mul t ibase 978 0 52 K AB I Mul t ibase 980 0 69 H ABI Mul t ibase 0 64 AB I Mul t ibase 0 84 M M ibase 082 M In Feature view you can Feature information View the window contents for an explanation of the information displayed in this view see the AB Prism Factura Feature Identification Software User s Manual Print the window contents for details see Printing the Sample Window Views on page 6 31 Viewing and Editing Sample Files 6 11 Search Find Again Electropherogram View Displaying To display Electropherogram view Command Y or Click the button shown below m Note If the raw data has not been analyzed Electropherogram view is not available About Electropherogram view shows a four color picture of the analyzed Electropherogram sam
4. 2 3 Installing Sequencing Analysis 0 0 0 eee eee eee 2 6 Setting Up the Sequencing Analysis 2 10 Selecting Processing Preferences 2 16 Working with the Gel File 3 1 o P rm 3 1 Displaying the Gel File in the Gel File Window 3 5 About the Gel File 8 3 6 Checking the Gel File 2 2 ee 3 11 Adjusting the 1 3 17 Adjusting Lane Markers and Tracker Lines 3 23 Tracking Lanes in the Gel File and Extracting the Data 3 37 Search Find Again saving Gel Files 2 eos AK bee URP SERI OPE es 3 45 Printing the Gel Image Loss erp RR REER CE ERE ERE RE 3 47 4 Processing Sample Files 4 1 OVeEVIe WO Lois ib aevi e he pats aie Eee dte P Ded ud eect 4 1 About the Sample Manager Window 4 3 Adding Sample Files to the Sample Manager Window 4 8 Moving and Removing Sample Files from the Sample Manager Window 4 12 Changing the Processing Parameter Values 4 14 Navigating the Sample Manager Window 4 16 Processing the Sample 4 18 Checking for Processing
5. S841 4509 177 m T va s ACET When you first select Raw Data view the Sequencing Analysis software displays the data in full view with all the data compressed into one normal sized window 6 16 Viewing and Editing Sample Files Search The Importance of the Raw Data View View Edit and Print Find Again The four colored trace lines represent the fluorescence data from the four fluorescent dyes The base represented by each color depends on the chemistry and filter set used For more details see Summary of the Instruments and Chemistries on page D 2 The Raw Data enables you to perform a number of important checks and troubleshooting tasks You can use the Raw Data view to Verify the point used by the Sequencing Analysis software to start and stop base calling Measure true peak intensities and view peak resolution before the smoothing applied by the Sequencing Analysis software Look for problems or noise in the baseline for example electronic spikes in the data or unusual baseline levels that could result in poor base calling or could indicate instrument problems For data from ABI 373 or ABI PRISM 377 instruments find areas with lower signal that could indicate bad tracking of the gel file Determine the scan number that corresponds to a given location in the data for details see Determining the Value for a Data Point on page 6 21
6. AppleScripting 1 Search Find Again AppleScript and Sequencing Analysis Introduction Sequencing Analysis v 3 2 is Apple scriptable and recordable It supports the Standard and Required Suite In addition an ABD defined ABI PRISM Suite is supported It is through the ABD defined ABI PRISM Suite that Sequencing Analysis performs application specific functions Limited Scriptability is complete but recordability is limited to basic functions Recordability such as opening a file and other menu commands E 2 AppleScripting Search Find Again Commands Objects and Events AppleScript The Sequencing Analysis software supports the following AppleScript Commands and Objects Supported Apple Events commands and objects General Commands open add print start get quit run set close pause remove process resume track cancel extract General Objects application sample file window processor gel Using the commands and objects above you can create the following apple events Open a sample file Open a gel file Track a gel Start analysis Cancel analysis Pause analysis Close a window Resume analysis Print 9 9 9 9 9 9 9 9 9 94 9 9 Add a sample file to the Sample Manager Remove a file from the Sample Manager Extract a gel into sample files Process track and extract a gel AppleScripting E 3 Quit the
7. Jfar mtx 10101 P 10 Dj t0e20u 10 2001 10 600 Isopropanol BDT E set anyprifp mtx 10101 JE ET P 11 tte200 11 201 11 6001 1 set mtx 10101 gt 12 12020u1Spincotur 20u1 SpinCotumnn Sx volume after sp BDT E set anyprifh mtx 10101 Ed 13 Dj 1 1 10ul 1 BDT E set anyprit Pyar mtx 10101 P LT 14 amp ise1ou2 1012 EDT E set anyprifh Jfar mtx iot01 Ed ET 15 150104 3 10u1 3 BDT E set anyprif gt dR mtx 10101 P 16 D 16e10u14 10u1 4 IBDT E set anyprify de mtx 10101 gt B LT g 17 D ivetous 1041 5 IBDT E set anypriqy mtx 10101 gt J Bd gt 18 amp iserours 10u1 6 EDT E set anypri P JAR mtx 10101 c 19 R 1301017 100 7 BDT E set anypri P mtx 10101 20 amp 200101 8 10u1 8 BDT E set anypri P JAR mtx 10101 21 R zieus 1041 9 EDT E set anypri P 4R mtx 10101 c O 22 amp 22010110 10010 EDT E set anypri P 4R mtx 10101 c 125 R 23010 11 1091 11 EDT E set anypri P 4R mtx 101010 3 O 24 R 24010112 100112 EDT E set anypri P 4R mtx 10101 125 25e5ul 1 5ul 1 IBDT E set JER mtx 0701 Bo E HE Working with the Gel File 3 13 Search 3 14 Working with the Gel File Find Again Components of the Sample Sheet
8. 6 28 Viewing and Editing Sample Files Search Find Again To add a base in Electropherogram view continued Step Action 2 To move the insertion point closer to one of the flanking bases hold down the Option key while you press the Left or Right Arrow key Each time you press the Arrow key while you hold down the Option key the cursor moves one scan point one sample point closer to the next base position When the insertion point is at the correct location release the Option key then type the new base character The program allows you to add any base identification character that is recognized by the program including IUPAC IUB codes Note If you edit data in Electropherogram view the Sequence view is immediately updated to match the changed Electropherogram view data Viewing and Editing Sample Files 6 29 Search Find Again Showing Original Data in Electropherogram View Introduction n Electropherogram view you can display the original sequence data in addition to the editable copy so you can compare them This is particularly helpful if you are editing bases in Electropherogram view Showing the To show the original data in Electropherogram view Original Data Step Action 1 Make sure you are in Electropherogram view in the Sample window Choose Show Original from the Sample menu A second line of bases characters appears at the top of the w
9. The ABI PRISM AutoAssembler DNA Sequence Assembly Software User s Manual About This User s Manual 1 3 Search Find Again New Features in Sequencing Analysis Since Version 3 0 Introduction Basecaller Consolidation ABI CE2 Basecaller for 310 1 4 Analysis About This User s Manual The major new features in Sequencing Analysis since version 3 0 are Basecaller consolidation New Basecaller algorithm for analysis of data from the ABI PRISM 310 Genetic Analyzer New improved Neural Net Tracker New improved manual tracking user interface Ninety six lane gel capability Support for a fifth dye in gel display and extraction Basecaller threshold removed Maximum number of analyzed scans is increased Selectable area around electropherogram base letters increased 9 9 9 9 9 New weighted channel averaging See Use Weighted Averaging on page 5 25 The DyeSet Primer and Instrument file columns in the Sample Sheet can be edited In Sequencing Analysis v 3 0 each of the Basecallers existed as a separate application contained in the Basecallers folder In Sequencing Analysis v 3 1 base calling speed was slightly improved by consolidating the Basecallers into a single base calling application The same base calling algorithms are available in the consolidated Basecaller and are selected in the Sample Manager window as in previous versions New in Sequencing Analysis v 3 1 is the ABI
10. Troubleshooting C 5 Search Find Again Table of Common Error Messages continued Error Message Observed Symptoms Recommended Action TDOpen Mobility file error File not found Analysis fails No effect on gel file or sample file Select the file for analysis again Update the DyeSet Primer file in the Sample Manager window Reanalyze the file The DyeSet Primer file must be located in the ABI Folder in the System Folder of the computer where analysis is performed Any Limit Check PostScript error Printing fails Reduce number of pages printed or number of data points per page Perhaps add memory to printer Sample file input error File not found Some Sample Manager window menu commands become unavailable Program produces erratic results or crashes Either find the missing instrument file and put in the ABI folder or pick a different instrument file in the Sample Manager from the pop up menu C 6 Troubleshooting Search Find Again Troubleshooting Other Types of Sequencing Analysis Software Problems Introduction This section describes various problems that can occur and how to Table Troubleshooting Table resolve each type of problem Observation Possible Cause Recommended Action Tracking fails The gel is not multicomponented Check that the gel is multicomponented with the correct instrument matrix file See ste
11. Note The settings on the page have no effect on the appearance of base letters on screen Descriptions of The Base Letter Style parameters are described in the following table Base Letter Parameters Item Description Base Letters Select this if you want to change the appearance of the four base letters C A G and T on printed electropherograms Ns Select this if you want to change the appearance of the letter N on printed electropherograms Font The font used for the base letters and Ns on printed electropherograms The options are Monaco and Courier The default is Monaco Size The size of the base letters and Ns on printed electropherograms The options are 9 10 12 14 18 and 24 points The Processing Parameters 5 41 Search Find Again Item Description Style The style of the base letters and Ns on printed electropherograms The options are plain and bold Color The color of the Ns on printed electropherograms Selecting a Color To set the color for the Ns in electropherogram prints follow these steps Step Action 1 Click the Ns radio button 2 Click on the colored rectangle to open the ColorPicker dialog box 3 In the dialog box either enter values in the numeric fields or click on the color wheel to select the color you want 4 Click OK to save your choice and close the ColorPicker dialog box 5 42 The Processi
12. Search Find Again What Does Sequencing Analysis Software Do Introduction For 373 and 377 Instrument Data 34d 373 377 For 310 Instrument Data 310 37d The Sequencing Analysis software can carry out several analysis steps on the data from genetic analysis instruments These steps can be done manually in the Sample File Manager or they can be done as part of a fully automated operation The automated analysis begins with the start of data collection and ends when the data has been analyzed by the Sequencing Analysis software Additional automatic processing can be carried out using the Factura Feature Identification software Also as part of the automatic operation results can be printed For samples run on ABI 373 and ABI PRISM 377 instruments the Sequencing Analysis program tracks the gel file Finds the starting position of each lane in the gel file Creates a sample file for each lane marked as used then transfers the basic sample information name run date etc from the sample sheet in the gel file to the sample files Tracks the lanes and transfers the raw data for each lane to the appropriate sample file IMPORTANT Do not use Sequencing Analysis v 3 2 to track a gel file during instrument data collection Wait until data collection is finished before tracking any gel Alternatively load and run Sequencing Analysis v 3 2 on a separate computer that does not ru
13. Comb Type Shark Tooth Q Square Tooth There seven Gel Preferences parameters Multicomponent Gel Image checkbox Estimated Maximum Peak Height text box Use Channel Averaging text box Use Weighted Averaging checkbox Stop extraction threshold checkbox Confidence Threshold textbox 9 9 9 9 Comb Type radio button These are described in detail below Select the Multicomponent Gel Image if you want the Sequencing Analysis software to adjust for spectral overlap of the dyes when generating the gel image This process affects only the gel image not the raw data Note Gels must be multicomponented in order to be auto tracked by the Tracker application The Processing Parameters 5 23 Search Estimated Maximum Peak Height Use Channel Averaging 5 24 The Processing Parameters Find Again In this text box enter the maximum signal level you expect from samples in the run This can be an approximate number based on your typical run conditions and samples The Estimated Maximum Peak Height value affects the brightness of the colored bands that represent the base peaks All bands with a data value at or above the Estimated Maximum Peak Height value are assigned the brightest dye color The dye colors for bands with values below that level are dimmed proportionally In general the lower you set this value the brighter the bands appear in the Gel File window A value of
14. Item Description The lane number for the sample The Sequencing Analysis software assigns lane numbers to the gel file lanes based on the numbers in this column If a lane in the gel is empty there must be a corresponding empty row in the Sample Sheet Used When this checkbox is selected the corresponding lane in the gel image is marked Used When the Sequencing Analysis software extracts the sample data from the gel file it creates sample data only from lanes marked Used If you change the setting for this checkbox the corresponding lane marker in the gel file is automatically changed File Name The name of the sample file to be created for the data in this lane Sample Name The name of the sample in this lane Comments Comments about the sample DyeSet Primer The dye set and primer file to be used during analysis The information in this file is used to designate the type of chemistry dye base relationships and mobility correction to be applied to this sample Inst File The instrument file to be used during analysis The Sequencing Analysis software uses the matrix information in the instrument file to adjust for spectral overlap in the dyes When this checkbox is selected the Sequencing Analysis software automatically creates and analyzes the sample data after data collection is finished When this checkbox is selected the Sequencing Analysis software automatic
15. Note To cancel the Extract Lanes process at any time press Command period and choose Cancel in the alert box that appears Working with the Gel File 3 43 Search Find Again Naming Sample following table shows the process the Sequencing Analysis Files software follows when naming generated sample files 3 44 Working with the Gel File If the generated sample file Then the software names the file has an associated filename in the Sample Sheet Used File Name Sample Name 1 DJ Sample 45 the filename in the Sample Sheet For example MySampleFile does not have an associated file name the lane number of the sample is placed after the name Sample File For example Sample File 1 Sample File 2 has the same name as a previous sample file in the run sheet x Used File Name Sample Name 1 Dj Test1 2 testi 3 Dj Testi the lane number of the sample in parentheses concatenated to the filename For example Test1 02 Test1 03 Test1 has the same name as a previously generated sample file in the sample file folder the original filename with a dot anda number appended to it For example if lane 2 in the example above were re extracted a second and third time without over writing 02 Test1 1 02 Test1 2 Search Saving Gel Files Saving the Gel File After Adjusting Tracking Savi
16. Page Basecaller Settings Y Basecaller Settings Default Settings Cancel The default setting is to have no endpoint This means that the basecaller tries to basecall to the end of the sample file This is the recommended setting except for sequencing short PCR fragments when an earlier end point should be set using the procedure described on page 5 29 To select a predefined set of Basecaller settings use the Basecaller Settings pop up menu See step 2 on page 5 30 for a description of the settings Note Predefined settings are stored in the Seq Analysis v3 2 Prefs file in the Preferences folder which is inside the System Folder If this Prefs file is deleted the predefined settings along with all other preferences are lost Search Find Again Creating a Set of Basecaller Settings 5 To create and save a new set of Basecaller settings Step Action 1 Choose the Create a set button The button name changes to Save this set as The checkboxes can now be edited Preferences Page Basecaller Settings Basecaller Settings untitled X Set endpoint at PCR stop Set endpoint after s w in io bases Elset endpoint after 20 Eset endpoint after _ bases Default Settings Remove this set Save this set as The Processing Parameters 5 29 Search Find Again To create and save a new set of Basecaller settings continue
17. Project Name Editor Edit Project Names D A Add Row Delete Row You can take the following action If you want to Then add a name click Add Row and enter a project name project comment and project owner edit a row select a row and make the necessary changes delete a row select a row and click Delete Row Search Find Again Adjusting the Gel Image Introduction Displaying and Hiding Selected Dye Colors Adjusting the Contrast Although the data shown in the gel image is not analyzed the displayed information allows you to evaluate the quality of the run You can adjust the content and appearance of the gel image in the following ways Display or hide selected dye colors in the gel image Adjust the color contrast in the gel image Regenerate the gel image using a different data range maximum peak height and multicomponenting option Install new matrix information in the gel file and use the new information to regenerate the gel image Note None of these options change the raw fluorescence data contained in the gel file nor the way data is extracted from the gel file You can control the display of the four colors in the gel image For example if you want to display only the blue bands you can suppress the display of all green yellow or red bands Step Action 1 Click the colored boxes near the top left corner of the Gel
18. The fast way to correct this is a Selectall the markers of the extra lanes in the gel shift click to select multiple markers b Select Force Selected Lanes to Right from the Gel menu Gel Sequence Manager Window Unmark Lane For Extraction Mark Lane Unused Mark All Lanes For Extraction Unmark All Lanes For Extraction Mark All Lanes Used Mark All Lanes Unused Straighten Selected Lanes Force Selected Lanes to Right The selected lanes are straightened and moved to the far right of the gel and the lane markers renumbered The markers forced right are stacked on top of each other to view them individually move them left one at a time Marking Lanes as The Sequencing Analysis software only extracts sample data if the lane is marked Used in the data collection Sample Sheet Used 3 26 Working with the Gel File IMPORTANT By marking lanes as Used or Unused you specify which lanes should be used to generate sample data This allows the Sequencing Analysis software to correctly number the used lanes and put the extracted sample data from each lane into the correct sample file It also ensures that sample data is generated from only the intended lanes and not from empty lanes When a lane is marked Used its lane marker 4 is colored blue white or yellow Unused lanes have gray lane markers There are three ways to mark a lane as used or unused Click the lane marker then choose Mark
19. 8245 5890p 4715p 3535 2360p When you have finished click the Interpolation Mode button to exit from the interpolation mode Or click a different tick mark to choose a different guide lane and further adjust tracker line positions Individual tracker lines can be further adjusted as described in Reshaping Tracker Lines Using Control Points on page 3 30 above Note An alternative way to use interpolation mode is to adjust the tracker lines of the guide lanes before entering interpolation mode When the Interpolation button is selected the tracker lines are immediately interpolated between the already adjusted guide lanes Search Find Again Tracking Lanes in the Gel File and Extracting the Data Introduction Tracking the Gel File The Sequencing Analysis software provides three options for tracking and extracting the data in the gel file To have the Sequencing Analysis software track the gel without extracting sample data use the Track Lanes command below Tohave the Sequencing Analysis software both track the lanes and extract the data into sample files use the Track amp Extract Lanes command page 3 38 Tohave the Sequencing Analysis software extract sample data without changing the current lane tracking use the Extract Lanes command page 3 42 When you choose the Track Lanes command the Neural Net Tracker application calculates the tracking
20. The exact contents of this dialog box depend on your printer To ensure base letters on the electropherogram print in color Step Action 1 Click the Print Options button to open the Print dialog box 2 Click the Options button of the Print dialog box to open the Print Options dialog box Print Options Cover None Before After Document Print _Color Grayscale v Postscript Errors No Special Reporting v Print Quality Printer s Current Setting v Paper Type _Printer s Current Setting v Print in Grayscale Printer s Current Setting Ra 3 Select Color Grayscale for the Print option then click OK to close the Print Options dialog box 4 Click Print to close the Print dialog box IMPORTANT If you don t choose Print to close the box the settings are not saved The Processing Parameters 5 37 Search Find Again Sequence File Formats About the The Sequence File Formats page allows you to specify which file format Sequence File to use when saving sequence Seq files The Seq file is a text file that Formats Page includes only the base sequence for the corresponding sample file Preferences Page Sequence File Formats Y Sequence File Format Intelligenetics Q Staden Q Wisconsin To use other ABI software that reads files in ABI text format choose ABI If you want to import the text sequence
21. To adjust contrast for the gel image continued Step Action 3 Put the cursor on the triangle for the color you want to adjust then hold down the mouse button and drag the triangle up or down to a new position Toincrease the intensity of a color pull the top triangle for that color down For example blue is sometimes hard to see on a gel To correct this pull the top blue triangle down until it is somewhat above the tallest blue peaks in the displayed slice view Tosuppress background noise of a particular color pull the bottom triangle for that color up For example there is sometimes a red background haze because of signal noise or because the signal baseline is not flat To correct this pull the bottom red triangle up until it is just above the baseline and noise in the displayed Slice view It is best to adjust one color apply the change and view the effect in the gel image before you adjust another color 4 Changes take place immediately Choose OK to close the dialog box 5 After the Gel File window is redrawn note both the change in contrast in the gel image and the corresponding change in the peak heights in the Slice view Note If you do not like the contrast adjustment immediately choose Undo Adjust Contrast from the Edit menu to remove the change Working with the Gel File 3 19 Search Regenerating the Gel Image with Different Option Values 3 20 Working with the
22. View the information in the window but not edit it Print the contents of the window for details see Printing the Sample Window Views on page 6 31 6 8 Viewing and Editing Sample Files Search Sequence View Displaying About Sequence View Find Again To display Sequence view Command R or Click the button shown below Sequence view shows the nucleotide sequence called for the data The wide center column contains the sequence data The left and right columns show the base positions at the beginning and end of each row r When you select a base or range of bases its position in the sequence is indicated in the Summary Line at the top of the window RTTCGTRRTC RCRRTTCCRC TGCCTRRTGR CTTTCCRGTC CGCGCGGGGR TCRCCRGTGR GRGRGTTGCR CTGTTTGRTG RTRGCCCGRG TRTTRRRGRR GGCGATGGCC GAGGTGCCGT GAGCTTGACG GCGRRRRGRR GNTRRCCRCC RTGGGTGCCT 1001 AAAMANCHCT EA ps fff R RCRRCRTRCG GTGRGCTRRC GGGRRRCCTG GAGGCGGTTT GRCGGGCRRC GCRRGCGGTC GTGGTTCCGA RTRGGGTTGR CGTGGRCTCC CRCTRCGTGR RRRGCRCTRR GGGRRRGCCG GCGGGCGCTA ANACCCGCCG TTACGAGCAC TGC Example Sample 3TTTCCTG RGCCGGRRGC TCRCRTTRRT TCGTGCCRGC GCGTRTTGGG RGCTGRTTGC CRCGCTGGTT RRTCGGCRRR GTGTTGTTCC RRCGTCRRRG RCCRTCRCCC RTCGGRRCCC GCGRRCGTGG RGGGCGCTGG CGCTTRRTGC TGTGRRRTTG RTRRRGTGTR TGCGTTGCGC TGCRTTRRTG CGCCRGGGTG CCTTCRCCGC TGCCCCRGCR RTCCCTTRTR RG
23. Creating Instrument Files explains how to make and change D instrument files Appendix AppleScripting lists the AppleScripte commands available in E the Sequencing Analysis program and lists the sample scripts included with the software Appendix License and Warranty explains your rights and F responsibilities regarding this software Glossary The Glossary explains many terms used in this manual Index The index enables you to easily find information in this manual Related Manuals Sequencing Analysis software is part of a suite of PE Applied Biosystems hardware and software products that provides a complete sequencing solution If the information you seek is not in this manual it may be in one of the other manuals listed in the table below For more information about See Your genetic analysis instrument including data collection software The user s manual for your instrument Specific sequencing chemistry protocols designing experiments and preparing samples The ABI PRISM Automated DNA Sequencing Chemistry Guide P N 4305080 or the protocols that accompany your PE Applied Biosystems sequencing reagent kit Using Factura software to identify and edit out vector and ambiguous regions of sequences The ABI PRISM Factura Feature Identification Software User s Manual Using AutoAssembler software to assemble sequence fragments into contiguous sequence data
24. The blue peak C is usually the highest With the mouse cursor point to the beginning of the peak and hold the mouse button down to display locator lines Note the cursor position on the x axis this is the scan point number at the top of the vertical locator line This number is the Peak 1 Location value to use for analysis The Processing Parameters 5 13 Search 5 14 The Processing Parameters Find Again For dye terminator chemistry To find the Peak 1 Location value Step Action 1 Open the sample file 2 Click the Raw Data view button Im Peaks are normally present in four colors on the display They extend throughout the width of the window If the colored lines representing the bases do not appear use the following steps to display them a Choose Display Options from the Window menu b Click to select the check boxes for all four bases c Choose OK Use the scroll bar at the bottom of the Raw Data view window to scroll along the sequence and find the first true base peak near the beginning of the data Use the Zoom In Command and Zoom Out Command commands in the Window menu for better views of the data If you get lost in a zoomed in view choose Full View from the Window menu to see all the data Search Find Again For dye terminator chemistry To find the Peak 1 Location Step Action 4 Find the beginning of the first b
25. Using the Zoom Commands Introduction The Window menu contains four zooming commands that change the amount of data visible in any of the graphic views The effects of the four zoom commands are illustrated in the figure on page 6 40 Zooming the View To zoom a view Step Action 1 Click in the data region that you want to view 2 To see successively larger scale views of a part of the data choose Zoom In from the Window menu 3 To see successively smaller scale views of the data choose Zoom Out from the Window menu 4 To scale the data so that the entire length fits within the standard size view window choose Full View from the Window menu 5 To return the view to its original size one scan one screen pixel after using Zoom In Zoom Out or Full View command choose Actual Size from the Window menu Viewing and Editing Sample Files 6 39 Search Find Again Zoom Commands This example of zoom commands uses the Electropherogram view The Illustrated commands also work in Raw Data view and EPT view LRO 125 2800 2840 2880 2920 2960 m GCCCR GEA BA AA 1328 996 664 1 A 332 JU AA d M LULA i B UN uS Zoom in LAO 125 ar Wile a E aa ae 0 380 A A
26. Weak 2 H bonds W S Cytidine Guanosine or Thymidine B V Adenosine Guanosine or Thymidine D H Adenosine Cytidine or Thymidine H D Adenosine Cytidine or Guanosine V B Adenosine Cytidine Guanosine or Thymidine N N aNy base IUPAC International Union of Pure and Applied Chemistry This acronym is also used to refer to IUB codes because IUPAC adopted the codes as a standard length The length of a sequence is the number of characters it contains including gap characters For example GAATTC has a length of 6 while GAA TTC has a length of 7 matrixfile See instrument file mobility file See DyeSet Primer file module file that provides instructions about conditions of operation to the ABI PRISM instrument You might use three different modules during a typical run to specify conditions for plate check pre run and the run itself For more details see the ABI PRISM instrument user s manual Neural Net Tracker A neural network is a computational structure inspired by the study of biological neural processing Neural networks learn by example The Tracker application uses a neural network to learn which features in a gel correspond to the center of a lane and which features to ignore The Tracker application has been shown hundreds of hand tracked gels as examples of how to accurately track It has been shown very noisy gels and told to ignore various types of noise including red rain primer peaks blobs etc original
27. about field 5 16 changing 5 16 recalculate 5 11 5 16 Status field 4 5 Stop Extraction When Below Confidence Threshold checkbox 5 26 Stop field 3 21 Stop Point 4 6 about field 5 17 changing 5 17 recalculate 5 11 unusable raw data 5 17 Straighten Selected Lanes command 5 summary graphic in Sample window 6 5 Glossary 5 System Folder Sequencing Analysis files in B 2 System Font changing for DataUtility appearance D 19 T TDOpen C 6 technical support 1 16 See Also help temperature during run 6 18 text colors in Sample Manager window 4 7 4 20 text field in bold 5 9 outlined in blue 5 9 text files formats 1 13 tick marks in interpolation mode 3 10 3 35 scaling sample file view 6 41 Tile Windows command 8 Track amp Extract Lanes command 4 Track amp Extract Lanes dialog box 3 40 Track and Extract Gel command 3 40 Track Lanes command 3 37 dialog box 3 37 typical times for 1 5 Track Lanes command 4 Tracker about program 1 5 1 14 fails troubleshooting C 7 Index 12 missing C 4 program file location B 4 program missing C 7 red data requirement D 10 Tracker Extensions files 5 Tracker extensions files missing C 4 tracker lines 3 7 about 3 9 adjusting 3 23 3 36 defined Glossary 5 interpolating 3 34 3 36 missing C 5 move entire line 3 34 optimize locations 3 29 reshape 3 30 3 36 review and edit placement 3 32 show and hide 3 29 Tracker Settings files 5 Tracker settings files missing C
28. channel 10 see diagram below and 2 channel averaging is set len o 0 8 lon 10 Clen 11 x 0 2 channel average 5 The Processing Parameters 5 25 Search Stop Extraction When Below Confidence Threshold Confidence Threshold 5 26 The Processing Parameters Find Again r Tracker line 2 gt O c 9 10 11 Channel Number If you use weighted averaging the annotation view of the sample file indicates this by specifying Weighted in the Channels Ave field If the Stop Extraction When Below Confidence Threshold box is checked when the lane assignment confidence level is below that specified in the Confidence Threshold the lane extraction will not be carried out and a warning dialog box appears The dialog box gives you the option to cancel or continue the gel file extraction and analysis Lane extraction is not to be carried out after tracking if The Stop Extraction When Below Confidence Threshold box is checked and The lane assignment confidence value is less than this confidence threshold The default value for the Confidence Threshold is 70 You can enter any number between 0 and 100 for the Confidence Threshold Lane Assignment Confidence Value After a gel is auto tracked a lane assignment confidence value is written to the Error Log This value indicates the Tracker s confidence in how well the assigned lanes match the sample sheet This value is no indicati
29. objects AppleScript E 3 Offset search by base position 6 26 old dye primers 0 2 old dye terminators D 2 open gel file 3 5 sample file 6 3 6 4 Open Files button 4 4 Open Files command A 7 Open Gel command 2 Open Sample command A 2 Operating System requirement 2 4 orange bordered lane marker 3 9 original sequence data about 4 18 defined Glossary 3 showing hiding 6 30 viewing 6 27 Out of Memory dialog box C 10 outlined text 6 19 overview of 310 sequencing 1 11 of 373 377 sequencing 1 12 of manual 1 2 sample file processing 4 2 Over Write Original Sample Files 3 41 3 43 P P checkbox 4 6 4 12 about 5 7 box colors 4 20 in Sample Sheet 3 14 review 6 19 selected 5 33 Page Setup command 6 31 A 2 Page Setup dialog box 2 11 2 12 about 5 36 for sample file 6 31 Page Setup Options button 5 36 Panels per Page text box 5 35 parameter values change in Preference dialog box 4 15 change in Sample Manager window 4 14 4 15 Index 8 changes in Preferences dialog box 5 22 in Preferences dialog box 5 21 5 42 in Sample Manager window 5 2 5 20 Paste command A 3 patterns find in sequence 6 23 pause sample file processing 4 18 Pause button 4 4 Pause command A 7 PE Applied Biosystems web site 1 15 Peak 1 Location 4 6 about field 5 11 dye primer chemistry 5 13 finding 5 11 5 15 mobility correction 5 11 recalculate 5 11 Peak height normalization 5 43 peaks poorly resolved 6 19 well resolved 6 19 Points pe
30. products The chemistries and kits supplied by PE Applied Biosystems for performing such reactions are described in the AB PRISM DNA Sequencing Chemistry Guide settings Values that you can select and which are then used by the program during program operations Settings can be relatively permanent see preferences earlier in this glossary or temporary as when you decide to print six copies of a sample file for a meeting shark tooth comb A piece of flexible plastic material inserted into a gel that is used for a sequencing run During gel polymerization the comb is inserted with the flat edge down to form a single well or a separate casting comb can be used Later the toothed edge is inserted to form wells into which samples are loaded It is called a shark tooth comb because it has pointed teeth along one side signal strength number that indicates the intensity of the fluorescence from one of the dyes used to identify bases during a data run Signal strength numbers are shown in Annotation view of the Sample File widow and in the header of the printed electropherogram spacing See base spacing square tooth comb piece of flexible plastic material inserted into a gel that is used for a GeneScan or sequencing run During gel polymerization the comb is inserted into the gel Later it is removed and sample is loaded into the square holes formed by the comb It is called a square tooth comb because it has square teeth along on
31. running Carry out the following steps in the order listed a Checkthat the correct type of Basecaller is selected in the Sample Manager window b Checkthat the Basecaller application is installed in the same folder as the Sequencing Analysis application c Rebuild the desktop hold down the Command and Option keys while you restart the computer to update the desktop database so the Sequencing Analysis software will be able to recognize and start the correct Basecaller program d If there is an extensions conflict hold down the Shift key while you restart the computer to turn off all extensions Then start the Sequencing Analysis program add the files to the Sample Manager and start analysis Wrong Basecaller is running The desktop database is not correct The desktop database is what gets rebuilt when you rebuild the desktop step c above See No base calling occurred when you chose Start to begin analysis above Only the first portion of the sequence is called The endpoint defined in the Basecaller Preferences page is Set endpoint after __ Ns in __ bases and there is noisy data at the start of the run Carry out the following steps Uncheck the Set endpoint box in the Basecaller Preferences page page 5 28 Or change the Start Point to skip the noisy false start data page 4 6 Reanalyze the sample file Note This false start behavior is seen more often with
32. the Edit menu commands are not available Electropherogram You can edit only one base character at a time VIEW In this view the spacing of the characters is much more precise and approximately ten base positions are available between the displayed bases If you place the insertion point between two characters and click the software selects one of the available positions move from one displayed base to the next use the Left Arrow and Right Arrow keys move from base position to the next position often pixel by pixel hold down the Option key while you use the Left and Right Arrow keys To select a base in Electropherogram view Step Action 1 Place the insertion point cursor to the left or the right of the character you want to select then click the mouse button 2 Use the Right Arrow key or Left Arrow key to position the highlight directly on the correct base character When you use the Arrow key the cursor always moves to the next base character in the sequence This procedure ensures that you have selected the base not a position only one pixel away from it Once you have selected the base you can delete it using the Delete key or replace it by typing a new character To add a base in Electropherogram view Step Action 1 Place the insertion point between the displayed base characters where you want to insert the base character then click the mouse button
33. 1000 is satisfactory for most gel files If the gel image is very dim try 500 if it is too bright try 2000 This value also determines the scale of the peaks in the Slice view of the Gel File window For the highest quality gel image the highest sample peaks notthe primer peak should just reach the top of the scale in the Slice view If you find that many of the peaks are cut off you may want to readjust the Estimated Peak Height value to a higher number Note This option affects only the appearance of the gel image not the raw data when the image is generated the first time the gel file is opened To change the image appearance for any other gel file use the Regenerate Gel Image command To regenerate the gel image on page 3 20 The number of channels to be averaged for each lane when extracting data from the gel file is normally set to 3 Averaging reduces the amount of noise in the sample file Further data smoothing may be achieved by using the Weighted Average page 5 25 below Each tracker line in the Gel File window marks the channel where the Sequencing Analysis software located the strongest fluorescent signal for that lane If you use the default three channel average the raw data in each sample file is an average of the data in the channel marked by the tracker line and one channel on either side of it Altering the Channel Averaging If you choose two channel averaging data is taken from the tracked channel and
34. 6 16 6 6 Viewing and Editing Sample Files Search Find Again Summary of Sample Window Views continued Button View Short cut Description EPT Command l A plot of run voltage temperature current and power values See page 6 18 Viewing and Editing Sample Files 6 7 Search Find Again Annotation View Displaying To display Annotation view Command E or Click the button shown below About Annotation Annotation view shows the sample information you entered in the data View collection program additional information entered by the data collection and analysis programs for example the start time and stop times and changes that you made to the original information Em Sample 02 Data Collection File Sample 02 Sample test2 Comment com2 Lane Number Channel Number 2 Humber of Scans Run started at 21 3 1994 15 37 Run stopped at 21 3 1994 15 37 Gel Gel File 2M Dyeset Primer DyePr imer 2 1m 13 Comb 24 well sharks tooth Instrument Name machine 128 5 19 90 Collect Vers Not Found Data Analysis Base Call Start o Base Call End 12000 Primer Peak Loc 0 Matrix Name machine 128 5 19 90 Channels Ave 3 Note information displayed in Annotation view depends in part on the instrument used to generate the data View and Print n Annotation view you can
35. ABI 373 Instrument Configurations D 6 The Instrument File D 8 Running Standards and Viewing Raw Sample Files D 10 Making a New Instrument File D 12 A Worksheet for Instrument File Matrices D 16 Verifying the Instrument File D 19 Making an Instrument File from a Sample File D 22 Storing and Backing Up the Instrument File D 24 Adding or Replacing a Matrix in an Existing Instrument File D 25 Correcting Errors in Matrix Creation D 28 Viewing and Copying Matrices D 30 Creating Instrument Files D 1 Search Find Again Summary of the Instruments and Chemistries The Sequencing Five cycle sequencing chemistries are currently available to prepare Chemistries DNA samples for ABI PRISM genetic analysis instruments Chemistry Applicable to Old Dye Primers 373 with filter set A 310 and 377 Old Dye Terminators 373 with filter set A 310 377 dRhodamine Terminators 373 with BigDye filter wheel and 310 and 377 with virtual filter set E BigDye Terminators 373 with BigDye filter wheel and 310 and 377 with virtual filter set E BigDye Primers 373 with BigDye filter wheel and 310 and 377 with virtual filter set E Dye Labels Each chemistry has a specified set of dye labels that emit fluorescence Specific to each when excited by a laser Each dye label in the set emits fluorescence at Chemistry 4 different wavelength and these emissions are detected during data collection On the ABI PRISM 377 and t
36. ABI PRISM 377 folder Sample Sample Scripts Can be used to develop AppleScript routines that are AppleScript folder inside the tailored to your site scripts Sequencing Analysis 3 2 folder Tracker program SAGelTracker Neural Net Tracker application launched by the file folder inside the Sequencing Analysis v 3 2 software to track gel files Sequencing Analysis 3 2 folder B 4 Input and Output Files Search Find Again Necessary Input Files That Are External to the System Folder continued File Type Folder Location Description Tracker Settings Files SAGelTrackera folder inside the Sequencing Analysis 3 2 folder Tracker settings files SA194Tracker34SHK mat for 194 channels and 32 36 lane shark tooth gels SA388Tracker48SHK mat for 388 channels and 48 lane shark tooth gels SA388Tracker64SHK mat for 388 channels and 64 lane shark tooth gels SA480Tracker96SHK mat for 480 channels and 96 lane shark tooth gels IMPORTANT Do not move or rename these files Tracker Extensions SAGelTracker folder inside the Sequencing Analysis 3 2 folder These three extensions are required for the Tracker application to run libmatlb libmcc libtbx IMPORTANT Do not rename or move these files a Do not move or change the name of this folder Input and Output Files B 5 Search Find Again Output Files Not Located in the System Folder I
37. Again Data Formats The data that results from the Sequencing Analysis process are in formats that you can use with commercially available or user generated programs on the Macintosh computer or on other compatible computers Data can be output from the program in two formats Sample files These files are written in an PE Applied Biosystems proprietary format They contain complete information about the sequence raw sequence data basecalls peak locations sample information etc Text files Each time a sample file is created or modified a text file is created automatically in the same folder as the sample file By default text file names have the extension Seq In the Preferences panel page 5 38 you can specify the format of the text file ABI Intelligenetics Staden Wisconsin Regardless of the format chosen text files are given the default extension Seq A Seq text file is created automatically when a sample file is created or updated About This User s Manual 1 13 Search Find Again Other ABI PRISM Software Introduction Other Programs in the Sequencing Analysis Package Other Programs for Analysis of Sequence Data 1 14 About This User s Manual This section describes other programs you should know about Utility programs included with the Sequencing Analysis software Programs for further processing of sequence data Programs for DNA fragment analy
38. Again editable data copy of the original ABI PRISM instrument produced data that is stored in the sample file All changes saved to sequence files are stored in the editable data copy so the original data is maintained in its unmodified original condition The data displayed in the Sample window is the editable copy unless you choose to display both the editable data and original data See also sample files original data electropherogram A multi color picture of a sequence showing peaks that represent the bases The term is used interchangeably with chromatogram in this manual feature A defined region in a sequence Features are created and used by software programs that perform further analysis of sample files for instance the Factura and AutoAssembler programs The Sample window includes a Feature view that displays feature information if any is present in the file genetic analysis instrument Used to refer generally to the instruments that provide data for analysis by the Sequencing Analysis software the ABI PRISM 310 Genetic Analyzer the ABI 373 DNA Sequencer and the ABI PRISM 377 DNA Sequencer heterozygote a diploid or polyploid individual that has inherited different alleles at one or more loci and therefore does not breed true King R C Stansfield W D A Dictionary of Genetics Oxford University New York 1990 p 147 In this manual the term describes a position at which the electropherogram display
39. C dR110 dROX dR6G A dR6G dR6G dTAMRA G dTAMRA dR110 dROX dROX dTAMRA dR110 The DataUtility program has two main functions for users to make instrument files and to copy matrices from one instrument file to another The Measure Noise function of the program is used by PE Applied Biosystems Service personnel and is not discussed here To make the instrument file Step Action 1 Open the DataUtility program This program is located in the Utilities folder inside the Sequencing Analysis folder The program icon looks like this Creating Instrument Files 13 Search D 14 Creating Instrument Files Find Again To make the instrument file continued Step Action 2 Choose Make Matrix from the Utilities menu The Make Matrix dialog box appears Make Matrix Name of file containing C data Start at Name of file containing A data Start at 5 Name of file containing 6 data Start at Name of file containing T data Start at Points Name of new matrix file Update File Instrument Comment Dye Primer Matrix Terminator Matrix QT Terminator Matrix Note files you select for the four nucleotides are the sample files you named on the Sample Sheet when you electrophoresed the matrix standards Note You need to make duplicate copies of each set of four files one copy for the Tag Primer one for the Taq T
40. CE2 Basecaller for analysis of sequencing data collected on the ABI PRISM 310 Genetic Analyzer Use this Basecaller to analyze sample data obtained using Old Dye rhodamine Terminator chemistries and the POP 6 polymer For more information about when to use the ABI CE2 basecaller see Choosing a Basecaller on page 5 44 and The ABI Basecallers on page 5 44 Note Many ABI PRISM 310 Genetic Analyzer users have already received the ABI CE2 basecaller separately from the Sequencing Analysis application Search Find Again The New Neural This is the most significant improvement in the v 3 2 release of Net Tracker Sequencing Analysis new Neural Net Tracker application uses a neural net based algorithm to automatically track gel lanes The Neural Net Tracker has been taught how to recognize bands and how to track curved lanes The new Neural Net Tracker application exists as a separate application within the Sequencing Analysis software folder Also associated with the Neural Net Tracker application are a set of Tracker settings files that have been optimized for number of lanes and comb types The Neural Net Tracker application is headless This means that although it stands as a separate application file it does not have a user interface The Tracker application is opened automatically from within the Sequencing Analysis program IMPORTANT The gel file must be multicomponented using the correct instrument fi
41. Data view window to scroll along the sequence and find the large Primer peak near the beginning of the data Use the Zoom In Command and Zoom Out Command commands in the Window menu for better views of the data If you get lost in a zoomed in view choose Full View from the Window menu to see all the data Search Find Again For dye primer chemistry to find the Peak 1 Location value continued Step Action 4 Find the beginning of the first base peak the Peak 1 Location value The general appearance of this peak depends on whether you used dye primer or dye terminator chemistry If you used dye terminator chemistry follow the table on page 5 14 Note scan number at which the first base peak occurs varies with the instrument gel electrophoresis conditions and separation distance used to generate the data If you used dye primer chemistry to prepare your samples the initial peaks in the data are small and a much taller primer peak appears at the beginning of the sequencing run The beginning of the first base peak is on the downslope of this tall primer peak The following figure shows the correct Peak 1 Location value at scan 1109 for a sample prepared with dye primer chemistry and run on a 48 cm gel Sample 09 Ipse 148 la Find the location on the downward slope of the primer peak where the first base peak begins
42. Estimate base spacing by measuring the scan points which define a peak In Raw Data view you can Zoom in or out to see the data at different magnifications see Using the Zoom Commands on page 6 39 Change the colors of the trace lines that represent the fluorescent dyes or hide one or more trace lines see Changing the Displayed Lines and Scales on page 6 41 Hold down the mouse button while the cursor is in the data area of the window to display cross hairs and the coordinates for the current cursor location Print the window contents for details see Printing the Sample Window Views on page 6 31 Viewing and Editing Sample Files 6 17 Search Find Again EPT View Displaying To display view Command or Click the button shown below ET About View view shows values for run voltage temperature power and current The colors indicated in the figure below are the default colors zi Sample 08 Volts 10 blue Degrees C red Watts black mAmps green View and Print In view you can Hold down the mouse button while the cursor is in the data area of the window to display cross hairs and the data values at the current cursor location Choose Display Options from the Window menu to open a dialog box and determine the type of information represented by a parti
43. Find Again Copying Matrices Between Files To copy a matrix from one file to another file Step Action 1 Start the DataUtility program if it is not already running The DataUtility program resides in the Utilities folder inside the Sequencing Analysis folder The program icon looks like this Choose Copy Matrix from the Utility menu From the Source pop up menu choose the type of file that contains the matrix or matrices you want to copy Copy Matrix Sample File Instrument File Instrument Gel File Vectra DAT File Vectra MAT File Destination No Destination File Instrument Comment Comment Primer Matris O tepy fag Term Matris Ospu 1 Term Matriz In the directory dialog box that appears locate and select the file that contains the matrix information you want to copy Then choose Open After the dialog box closes the Copy Matrix fields at the bottom of the Copy Matrix dialog box display the matrix information in the source file Creating Instrument Files D 31 D 32 Search Creating Instrument Files Find Again To copy a matrix from one file to another file continued Step Action 5 Select the Copy Matrix checkbox for each matrix you want to copy to the destination file Be sure to de select the checkbox for any matrix that you do not want to copy IMPORTANT When you copy a new matrix
44. Gel File Find Again Use Sequencing Analysis software to Change the range of data included in the gel image e g if there is unusable data near the end of the run Seta different maximum peak height Change the Multicomponent Gel Image setting Note When it regenerates the image the Sequencing Analysis software saves any tracker line changes you made in the original image To regenerate the gel image Step Action 1 Choose Regenerate Gel Image from the Gel menu The Regenerate Gel Image dialog box appears and displays the values that were used to create the current gel image Regenerate Gel Image Scan Range 10624 Max 10624 Multicomponent Gel Image Estimated Maximum Peak Height 1000 Cum Search Find Again To regenerate the gel image continued Step Action 2 Make any required changes in the dialog box values as described below Item Description Stop The last scan value to be included in the gel image and when extracting sample data Start The first scan value to be included in the gel image is always zero Multi Causes the Sequencing Analysis software to component apply the matrix information in the attached Gel Image instrument file to the raw data to adjust for spectral overlap of the dyes before creating the gel image It is usual to view the gel image multi
45. IUB codes are listed in the Glossary Edited Bases Bases that have been edited since the last basecall are underlined Sequence View and Electopherogram View If you click on the sequence in Sequence view then switch to Electropherogram view the electropherogram shows the area of the sequence around the point where you clicked If you highlight a range of bases in Sequence view that range of bases is also highlighted in Electropherogram view Viewing and Editing Sample Files 6 13 Search Find Again Raw Data View and Electopherogram View The scan numbers of the Electropherogram view do not map directly to scan numbers of the Raw Data view due to the application of the basecaller algorithm which alters the scan number to data point relation 6 14 Viewing and Editing Sample Files Search Find Again View Edit and n Electropherogram view you can Print Zoom in or out to see the data at different magnifications see Using the Zoom Commands on page 6 39 Use the right arrow keys to move to the next base or the left arrow key to move the previous base Use the Tab key to find the next occurrence of an N or Shift Tab to find the previous occurrence Edit the bases one at a time see Editing Bases in Electropherogram View on page 6 28 Display the original unedited base calls while you edit the bases see Showing Original Data in Electropherogram View on page 6 30 Change the horizont
46. LIMITED PRODUCT WARRANTY PURCHASER CAREFULLY READ THE FOLLOWING TERMS AND CONDITIONS THE AGREE MENT WHICH APPLY TO THE SOFTWARE ENCLOSED THE SOFTWARE YOUR OPENING OF THIS PACKAGE INDICATES YOUR ACCEPTANCE OF THEM IF YOU DO NOT ACCEPT THEM PROMPTLY RETURN THE COMPLETE PACKAGE AND YOUR MONEY WILL BE RETURNED THE LAW PROVIDES FOR CIVIL AND CRIMINAL PENALTIES FOR ANYONE IN VIOLATION OF THE LAWS OF COPYRIGHT COPYRIGHT The SOFTWARE including its structure organization code user interface and associated documen tation is a proprietary product of Perkin Elmer and is protected by international laws of copyright Title to the SOFTWARE and to any and all portion s of the SOFTWARE shall at all times remain with Per kin Elmer LICENSE 1 You may use the SOFTWARE on a single computer or in a single network if your SOFTWARE is designated as a network version You may transfer the SOFTWARE to another single computer or network if a network version so long as you first delete the SOFTWARE from the previous computer or network You may not have operational SOFTWARE on more than one computer or more than one network if a network version per original copy of the software at any time 2 You may make one copy of the SOFTWARE for backup purposes 3 You may transfer the SOFTWARE to another party but only if the other party agrees in writing with Perkin Elmer to accept the terms and conditions of this Agreement If you transfer
47. Lane Used Unused from the Gel menu Hold down the Command key while you click the lane marker Search Marking Unmarking Lanes for Extraction Find Again Click the button to open the Sample Sheet that is attached to the gel file then select or deselect the Used checkbox for the lane Note When you use mark a lane Used or Unused the Sequencing Analysis software changes the setting in both the gel image and the Sample Sheet During the extraction process the Sequencing Analysis software only extracts data from gel lanes that are marked for extraction This allows you to control which lanes to extract when using the Extract Lanes command Lane Marker Rules The Sequencing Analysis software uses the following rules to mark lanes Lanes identified with sample names in the Sample Sheet of the data collection software are automatically marked Used blue or white or yellow marker All unidentified lanes are marked Unused gray marker When opening a gel file the first time all Used lanes are marked for extraction white marker After the data is extracted from a lane the lane is unmarked for extraction blue marker Ifyou adjust the position of a lane marker or tracker line the lane is automatically marked for extraction white marker f you modify a tracker line and then extract sample data from the lane before you save the gel image the lane marker becomes yellow This serves as a warning
48. Points Stop Point Start Point Every number in this column must be the same Creating Instrument Files 17 Search Find Again Example Below is an example of how a worksheet might be filled in if you were making an instrument file using dRhodamine standards for dRhodamine and BigDye chemistries If you are using other dye matrix standards refer to your instrument User s Manual For the dRhodamine standards instrument file the same four standard sample files are used for each of the three matrices but the order that they are used is different for each matrix Data for Dye Primer Matrix Sample File Number of Name Start Point Points Stop Point C matrix dR110 1500 1500 3000 A matrix dR6G 2000 1500 3500 G matrix dTAMRA 1450 1500 2950 T matrix dROX 2000 1500 3500 a Number Points Stop Point Start Point Every number in this column must be the same Data for Taq Terminator Matrix Sample File Number of Name Start Point Points Stop Point C matrix dROX 2000 1500 3500 A matrix dR6G 2000 1500 3500 G matrix dR110 1500 1500 3000 T matrix dTAMRA 1450 1500 2950 Data for T7 Terminator Matrix Sample File Number of Name Start Point Points Stop Point C matrix dR6G 2000 1500 3500 A matrix dTAMRA 1450 1500 2950 G matrix dROX 2000 1500 3500 T matrix dR110 1500 1500 3000 D 18 Creatin
49. Sample Manager window During base calling the Basecaller considers both the endpoint set in the Basecaller Settings preferences and any Stop Point value in the Sample Manager window the Basecaller stops analysis at the earliest designated endpoint The Processing Parameters 5 17 Search Find Again The DyeSet Primer File Parameter About the DyeSet Primer Pop up DyeSet Primer File Required Shortening the Pop up Menu DyeSet Primer Sets Mobility Shift Correction 5 18 The Processing Parameters This pop up menu allows you to specify which DyeSet Primer file to use for base calling The default DyeSet Primer is the one specified in the sample sheet for the run IMPORTANT If you change the DyeSet Primer file and then reprocess the file s the Basecaller recalculates the Peak 1 Location Start Point Stop Point and Spacing Any user entered values for these parameters are overwritten during this operation The pop up menu displays all the DyeSet Primer files in the ABI folder on your hard disk If the filename is displayed in outline font in the DyeSet Primer file field this means that the file is not present in the ABI folder The DyeSet Primer file is required for analysis Sequencing Analysis will not analyze the sample if the DyeSet Primer file field is set to none or if the specified file is not in the ABI folder To make the DyeSet Primer list shorter you can discard any DyeSet Primer files that do not a
50. Sheet data collection Sample Sheet Adjust Gel Command J Adjusts the contrast of each of the dyes in the gel 3 17 Contrast image This does not change the raw data Mark Lane for Option click Sets the selected lane marker so that information 3 28 Extraction lane marker in that lane will be extracted during the extraction process Blue markers are used White markers are for extraction Mark Lane Command click Marks the lane as Used A lane can only be 3 26 Used Unused lane marker marked for extraction if it is first marked Used Gray markers are unused Mark All Lanes Sets the lane markers for all Used lanes the gel 3 28 for Extraction so that the information in those lanes will be extracted during the extraction process Unmark All Sets the lane markers for all Used lanes in the gel 3 28 Lanes for so that information in those lane will not be Extraction extracted during the extraction process A 4 Command Reference in the Sample Sheet Search Find Again Keyboard See Command Shortcut Description Page Mark All Lanes Marks all lanes as Used A lane can only be Used marked for extraction if it is first marked Used Mark All Lanes Marks all lanes as Unused If you want to extract Unused just one or two lanes mark all lanes unused then select and mark for extraction the one or two lanes that you want Straighten Sets the tracker lines straight for the selected Selected lanes The lane mar
51. Start the processing operation See Processing the Sample Files on page 4 18 Check for any problems that might have occurred during file processing See Checking for Processing Problems on page 4 20 There are many reasons to reprocess a sample file or a group of files after automatic file processing is finished Some reasons are To correct initial setup errors for example the wrong instrument file was specified in the data collection program Sample Sheet To change the point where the software stops calling bases and exclude poor quality data near the end of the run To use a different Basecaller or change the spacing estimate in order to improve the analysis results To analyze the new sample data after you adjust the tracking on a gel that ran poorly Search Find Again About the Sample Manager Window Introduction About Auto Analyze Opening and Closing the Window Parts of the Sample Manager Window The Sample Manager window allows you to list sample files you want processed by the Sequencing Analysis software and to choose various analysis parameter values This section describes the parts and functions of the Sample Manager window If you choose Auto Analyze in the data collection program this list is automatically filled out after the instrument run and the samples are processed using the values specified in the run Sample Sheet and the information entered on the Preferences page in the
52. The window is stretched vertically to show a larger portion of the data it would have to be stretched quite a bit farther vertically to show the tops of the highest peaks which are at approximately 1200 on the scale 6 44 Viewing and Editing Sample Files Search Command Reference Overview Introduction In This Appendix Find Again This appendix briefly describes all the commands on the Sequencing Analysis main menu their corresponding keyboard shortcuts and where the main uses of each command are explained This appendix includes the following topics Topic See Page The File Menu A 2 The Edit Menu A 3 The Gel Menu A 4 The Sample Menu A 6 The Manager Menu A 7 The Window Menu A 8 Keyboard Shortcuts for Sample Window Views A 9 Command Reference A 1 Search The File Menu Find Again File Menu The table below lists and describes the commands accessible from the Commands Sequencing Analysis program File menu Keyboard See Command Shortcut Description Page Open Gel Command H Opens a gel file Command is not present if the 3 5 Sequencing Analysis software is installed for use with only ABI PRISM 310 instruments Open Command O Opens a sample file 6 3 Sample Close Command W Closes the active window Save Command S Saves the contents of the active window 3 45 Save As Saves the file with the name and format you 3 45 s
53. View Displays all the data in a standard size window 6 39 Command available for the three graphical views of the Sample window Actual Size Command Displays the contents of the window at 1 1 scale 6 39 no matter what scale is displayed at the time you select this command Command available for the three graphical views of the Sample window Display Changes display options e g ruler indexing 6 41 Options relative or real values visible base traces Command available for the three graphical views of the Sample window Show Hide Command 1 Opens or closes the Sample Manager window 4 3 Sample Manager Show Hide Command 2 Opens or closes the window that displays a list of C 16 Command Log commands performed by the Sequencing Analysis software Show Hide Command 3 Opens or closes the window that displays a list of C 14 Error Log all errors that occurred during analysis Tile Windows Arrange the open Sample windows so they do not 6 37 overlap and a good sized portion of each is visible Stack Arranges windows so they are the same size and 6 37 Windows stacked from back to front with only the title of each visible window Lists all currently open Sequencing Analysis names program windows A 8 Command Reference Search Find Again Keyboard Shortcuts for Sample Window Views Sample Window The table below shows the buttons and keyboard commands that set Views the view of the Sample wi
54. analysis Base Letters Style about preferences page 5 41 5 42 large font problem 5 41 base peak change brightness in gel 5 24 first 5 14 base positions multiple 1 14 base spacing See Also spacing base spacing defined Glossary 1 Basecaller 4 6 ABI CE2 new in v 3 1 1 4 about parameter 5 8 about program 1 14 Adaptive 5 46 Index 2 choosing 5 44 consolidation new in v 3 1 1 4 defined Glossary 1 field 4 6 how base calling works 5 43 menu in Sample Manager Defaults page 5 32 on printed electropherogram 6 35 program file location B 4 same folder as Sequencing Analysis program 6 19 SemiAdaptive 5 45 threshold removed new in v 3 2 1 6 troubleshooting C 8 version on printed electropherogram 6 35 wrong Basecaller running C 8 Basecaller Settings 4 6 5 30 about parameter 5 10 about preferences page 5 28 5 31 creating a set 5 29 editing 5 31 removing aset 5 31 selecting a set 5 28 baseline noise 6 17 bases colors after analysis 0 5 on the real time displays 0 4 BigDye filter wheel D 3 D 7 BigDye primers D 2 BigDye terminators D 2 blue lane marker 3 9 blue outline around text field meaning 4 7 5 9 bold red text See red text C camera CCD D 3 cancel sample file processing 4 19 Cancel button 4 4 Cancel command 7 Case sensitive in Find dialog box 6 24 CD ROM drive 2 4 CEHV in DyeSet Primer filename 8 Change bar 4 5 changing column width 4 17 Search Find Again processing parameters
55. and the tracker lines for all other lanes become hidden or grayed out Pressthe Left or Right Arrow key to move the entire line left or right one channel Move the control points to follow the contour of the signal and to fall in the brightest portion of the lane Use the methods described on pages 3 30 to 3 32 to adjust the control points Add extra control points if necessary Use the horizontal and vertical expand buttons to zoom in After you finish adjusting the tracker line positions for all lanes of interest you can re extract the data in those affected lanes Note Itis easier to adjust the tracker lines when you can see the entire length of the lane Before extracting sample data verify the exact tracker line positions in an expanded view Interpolating The shape of one lane is nearly always very similar to its neighbor lane Tracker Lines Curves or tilts in lanes tend to occur gradually across a gel with each lane a little more curved or tilted than the next until the lane at the right is quite different in shape from the one on the left side of the gel 3 34 Working with the Gel File Use the interpolation mode to quickly optimize the positions of a set a adjacent tracker lines To interpolate tracker lines Step Action 1 Click the interpolation mode button 1 2 Select the first of two lanes to be used as the interpolation guides The positions of the tracker lines bet
56. are selected the file is processed by Factura after it is analyzed by the Sequencing Analysis software When a file is added to the Sample Manager the software sets this checkbox selected de selected to match the F checkbox on the Sample Manager Defaults page of the Preferences dialog box page 5 32 The color of this checkbox indicates the status of Factura processing If the checkbox is Then Factura processing green succeeded red failed no color has not been started since the sample was added to the Sample Manager window If the checkbox is red review the Factura Log For more details see the Factura Feature Identification Software User s Manual Search Find Again The P Parameter About the When this checkbox is selected information from the file is printed as Printing Checkbox part of the processing operation If you also select the A and or F checkboxes printing is done after all other processing of that file is complete This checkbox controls whether or not printing occurs you can specify which pages to print in the Printing Preferences page of the Preferences dialog box page 5 34 When a file is added to the Sample Manager as part of automatic file processing the software sets this checkbox selected de selected to match the P checkbox in the sample sheet When you manually add a file to the Sample Manager window the software sets this checkbox to match the P checkbox on
57. checkbox indicates whether analysis was successful green failed red or has not yet been started no color The default setting for this checkbox is selected in the Sample Manager Defaults page of the Preferences dialog box you can click the checkbox to change the setting Processing Sample Files 4 5 Search Find Again Parameters for Processing Sample Files continued Parameter Description F If this box is checked the file is passed to the Factura program for further processing after processing by the Sequencing Analysis software The color of the checkbox indicates whether the processing was successful green failed red or has not yet been started no color The default setting for this checkbox is selected in the Sample Manager Defaults page of the Preferences dialog box you can click the checkbox to change the setting For more information about the Factura software see the Factura Feature Identification Software User s Manual If this box is checked the selected information for this file is printed after all processing is complete The color of the checkbox indicates whether printing was successful green failed red or has not yet been started no color The default setting for this checkbox is selected in the Sample Manager Defaults page of the Preferences dialog box you can click the checkbox to change the setting Basecaller The Basecaller program used to identify bases
58. data The sequence data produced by the ABI PRISM genetic analysis instrument This data is maintained in its original state in a sample file An editable copy of the data is also stored in the same sample file and changes when you save edits to the file See also editable data sample files preferences Values that are selected by the user stored in the program s Preferences file in the Preferences folder inside the System Folder and used by the program during normal operation For example you can specify that the Sequencing Analysis software should always use the SemiAdaptive Basecaller and save Seq files in the Wisconsin format You can change preference values whenever your needs change you can also temporarily override some types of preferences without changing their values in the preferences file sample files sample file contains raw DNA sequence data as read by the electrophoresis instrument and the base calls peak locations and electropherogram created by the Sequencing Glossary 3 Search Find Again Analysis software After processing by the Factura software or other similar programs the file also contains additional analysis information for example features For the 373 or 377 instruments sample files are created by the PE Applied Biosystems software in the gel extraction process For the 310 instrument raw sample files are created by the 310 Data Collection software Raw sample files are analyzed by Sequencing A
59. data for an instrument file see the instrument User s Manual Deselect auto analyze in the Data Collection software After you have created the raw data use the following procedure Verifying the Raw Data to confirm that the data is satisfactory IMPORTANT We do not recommend making a matrix using analyzed data To confirm that the sample file is not analyzed open the file in the sample window and check that there is no electropherogram view available page 6 9 Once you have satisfactory raw data you can use the DataUtility program to either make a new instrument file or add the matrix data to an existing instrument file as described later in this chapter Making a New Instrument File on page D 12 Adding or Replacing a Matrix in an Existing Instrument File on page D 25 Requires four standards for each matrix After you run the matrix standards the next step is to verify that the run was successful and you have raw data for the matrix To verify lane tracking and peaks in the raw data Step Action 1 Start the Sequencing Analysis program 373 377 D 10 Creating Instrument Files 2 For 373 and 377 runs open the gel file and track and extract the standard lanes into sample files Before beginning extraction check that auto analysis is deselected IMPORTANT Because the Tracker application only recognizes red data you have to adjust the tracker lines by hand for the green blue and yellow
60. deselect checkboxes Select filenames from pop up menus 4 To print the Sample Sheet choose Print from the File menu while the Sample Sheet window is active 5 To change the width of a column in the Sample Sheet so you can see more of the information in that column put the cursor on the divider line to the right of the column title When the cursor changes to two arrows hold down the mouse button and drag the line to the desired location 6 When you are finished click the close box to close the window Installing a New Sample Sheet If you install a Sample Sheet with fewer rows than the current Sample Sheet blank rows will be added to make up the difference If you install Working with the Gel File 3 15 Search 3 16 Working with the Gel File Find Again a Sample Sheet with more rows than the current Sample Sheet rows will be deleted from the bottom of the new Sample Sheet To replace the current Sample Sheet with the contents of a saved Sample Sheet file Step Action 1 Close the current Sample Sheet window 2 Choose Install New Sample Sheet from the Gel menu 3 Select a Sample Sheet from the directory dialog box that appears The Gel s Sample Sheet will be filled in with information from the Sample Sheet that you selected Editing or Adding Project Names To edit project names click Edit Project Name on the pop up menu and the Project Name Editor dialog box appears
61. dialog box Search Find Again To start Sequencing Analysis for the first time continued Step Action 6 Click on the Print button to close the dialog box and save the selected values to the Seq Analysis v3 2 Prefs file When you choose Print the settings are only saved to the Pref file No printing occurs at this time When you close the Printer dialog box the 310 Only dialog box appears Will this application be used ONLY with the ABI PRISM 310 Genetic Analyzer The application may Quit automatically after dismissing this dialog When you double click on it again it will run normally Choose 310 Only or choose 37x according to what you choose at installation step 5 on page 2 7 Choose 310 only if you selected ABI PRISM 310 Only at installation step 5 on page 2 7 Otherwise choose 37x If you choose 310 Only the menu commands and dialog boxes which are used only for ABI 373 and ABI PRISM 377 gel files are removed the amount of memory allotted for the program is reduced and the program may quit If you choose 37x all parts of the Sequencing Analysis program are kept and the program may quit If the program quits double click the Sequencing Analysis icon to restart the program and proceed to the next step Getting Started 2 13 Search 2 14 Getting Started Find Again To start Sequencing Analysis for the first time continued
62. display to turn on or off display of each dye color The default is to have all colors displayed Any change you make in the button settings are saved in the gel file and used the next time that file is opened You can adjust the color contrast in the gel image to increase or reduce the intensity of individual colors These kinds of adjustments can make it easier to see the data in the gel and can improve the appearance of the gel image for publication Working with the Gel File 3 17 Search 3 18 Working with the Gel File Find Again The adjusted color values are saved in the gel file and used each time you open the file in the future If you regenerate the gel image the changes are discarded and the colors revert to their default values To adjust contrast for the gel image Step Action 1 In the Gel File window select any lane that contains the color s you want to adjust The changes you make in this dialog box affect the entire gel not just the selected lane 2 Choose Adjust Gel Contrast from the Gel menu The Adjust Gel Contrast dialog box appears Slice view of Top triangles move down to selected lane increase brightness Adjust Gel Contrast Bottom triangles move up to suppress background noise or hazes Note data shown is from the selected lane If no lane is selected the data from lane 1 is used Search Find Again
63. edited base calls which have been saved to the file Annotation information describing the instrument run and analysis conditions Analysis settings Processed analyzed electropherogram information which visually describes the intensity of each fluorescent signal Summary of electrophoresis conditions voltage temperature power during the run Features added by the Factura application All of this information can be viewed in graphical and text formats Thus sample file contains the target DNA sequence plus all of the historical information about the ABI PRISM analysis necessary to interpret the data and processing parameters 6 2 Viewing and Editing Sample Files Search Find Again Opening a Sample File in a Sample Window Introduction Opening a Sample File from the Finder Opening a Sample File Using Menu Commands Opening Sample Files from the Sample Manager There are several ways to open a sample file in a Sample window The number of sample files that you can have open at one time depends on the amount of free memory on your computer Typically the maximum number of sample files that you can have open at a time is in the range 25 30 There are two ways to open a sample file from the Finder Double click the name or icon of the file you want to open Drag the icon for the file you want to open onto the Sequencing Analysis program icon e RA Sequencing Analysis To open a sample from within the S
64. in the Gel File 5 20 The Processing Parameters The instrument file sometimes referred to as the matrix file is the file used to adjust for spectral overlap between the fluorescent dyes Each analysis instrument normally has one instrument file associated with it per dye type i e one instrument file for Rhodamine dyes and one for dRhodamine dyes and that file contains all the matrices you may need for the instrument For more information about how to create the matrices for an instrument file see Appendix D Creating Instrument Files Information in the instrument file is copied to the gel file when it is made and to each sample file before base calling is done If you selected the wrong instrument file during data collection setup the instrument file information in the gel file and the sample files will be wrong and base calling will be inaccurate To change the instrument file information for a sample file choose the correct instrument file from the pop up menu The menu shows all instrument files in the ABI folder on your computer If the filename is displayed in outline font in the Instrument file field in the Sample Manager this means that the file is not present in the ABI folder The filename in the Instrument file column in Sample Manager window is taken from the sample sheet If the Instrument file specified in the sample sheet is not found in the ABI folder when the sample file is analyzed Sequencing Analysis wil
65. instrument You should create a new instrument file if any of the optics in the instrument change either because of service or age Some specific situations that require a new instrument file are The filter wheel is replaced on an ABI 373 The CCD camera is replaced on an ABI PRISM 377 or ABI PRISM 310 You need a new matrix for a type of chemistry other than the three mentioned above Because fluorescence and spectral overlap are affected by the media gel used for the run you may need to make a Search Find Again new matrix instrument file if you change the type of acrylamide or other gel reagents Arun shows consistent and proportional pull up peaks indicating poor or incorrect spectral separation Pull up peaks appear as smaller peaks of one color directly under larger peaks of another Note If a valid instrument file exists in the ABI folder inside the System Folder on your Macintosh computer you need not create one If you lose your instrument file and do not have a backup copy on a floppy disk see the Viewing and Copying Matrices on page D 30 before re creating the entire instrument file Creating Instrument Files D 9 Search Find Again Running Standards and Viewing Raw Sample Files First Obtain Raw Data Verifying the Raw Data An instrument file can contain a Dye Primer matrix a Taq Terminator matrix and or a T7 Sequenase Terminator matrix For information about how to create raw matrix
66. is common to store many sample files on the analysis computer Gel files are usually stored only on the computer that is connected to the instrument and are removed or archived frequently Getting Started 2 5 Search Find Again Installing Sequencing Analysis Introduction This section describes the following Before Installing IMPORTANT 2 6 Getting Started Topic See Page Before Installing 2 6 Installing the Sequencing Analysis Software 2 7 Removing Sequencing Analysis Software 2 9 Macintosh computer This software cannot be installed on a non PowerPC Before you begin installing the Sequencing Analysis software please do the following 9 9 Check that you have at least 15 MB of free disk space to accommodate the Sequencing Analysis software Backup the contents of the ABI Folder in the System Folder Quit all open applications Turn off any virus protection software that you may have running Delete any aliases to the previous versions of the Sequencing Analysis program If you are installing Sequencing Analysis v 3 2 as an update to Sequencing Analysis v 3 0 you need to find your v 3 0 registration code If you cannot find your code note down the serial number in the splash screen of Sequencing Analysis v 3 0 select About Sequencing Analysis from the Apple menu and call Technical Support page 1 16 Search Find Again Installing the Foll
67. is defined by a scan number and a channel number Working with the Gel File 3 7 Search Find Again Parts of the Gel File Window continued Item Description Slice view Displays a graphical view of the data values in the tracked channel s of the selected lane The display changes as the tracker line moves from one channel to another Each peak in the Slice view corresponds to a band in the gel image and indicates a base in the DNA sequence These bands and peaks do not represent analyzed data but provide an overview of the relative signal intensity between the bands in that lane and thus allowing a qualitative evaluation of the run The Slice view is empty black when no lane is selected Channels Theoretical divisions across the read region of a gel where the data collection software samples the data The number of available channels depends on the instrument and run mode used For more information about run modes see your instrument manual Lane The path followed by the sample as it migrates through the gel A sample lane is several channels wide The number of wells in the loading comb determines the approximate number of channels assigned per lane of the gel For instance on a 377 instrument with a 36 well comb one lane includes approximately five channels Channel Scan The channel number horizontal scale and scan number vertical scale at the current cursor position Thes
68. lane you might need to make some changes The Sequencing Analysis program allows you to Move misplaced lane markers page 3 23 Mark lanes used or unused page 3 26 Mark and unmark lanes for extraction page 3 27 Show and hide tracker lines page 3 29 9 Position and reshape tracker lines so they more accurately track the samples page 3 30 The Sequencing Analysis software allows use of the Shift Tab and Arrow keys to move quickly between lanes and channels Keyboard shortcuts to switch quickly from one lane to the next Atthe top of the display click the Lane Marker of the lane where you want to move Press the Tab key to move one lane to the right Press Shift Tab to move one lane to the left To move from one tracker line control point to the next Press the Up Arrow key to move up one control point Press the Down Arrow key to move down one control point If gel aberrations or weak sample signals exist or if your comb was not properly centered in the gel the Sequencing Analysis software may misinterpret the gel data The program may completely miss a lane declare a lane where none exists or recognize a lane but be unable to follow it Each of these errors can cause lane data to be written to the wrong place For example if the program mislabels lane 2 as lane 1 it will Working with the Gel File 3 23 Search 324 Working with the Gel File Find Again write the lane 2 data into
69. parameter value for this file tests BD R semiadaptive o Default Settings r lo Resize box Vertical change bar shows that at least Scroll bars one of the parameter values for the sample has been changed Description of This table describes the parts of the Sample Manager Window Most of Parts the parts are labeled in the figure above Parts of the Sample Manager Window Item Description Start button Starts processing of the files in the list Pause button Temporarily stops processing of the current file Resume button Starts file processing beginning at the point where processing was temporarily paused The Resume button becomes visible only after the Pause button is selected Cancel button Immediately stops processing of the current file and cancels the entire processing operation Add Files button Opens a directory dialog box so you can add sample files to the list Remove button Removes the selected file s from the list Open Files button Opens the selected file s 4 4 Processing Sample Files Search Find Again Parts of the Sample Manager Window continued Item Description Status field Displays messages about the current state of the processing operation Change bar The thick vertical line that appears to the left of the Sample File Name if you change any processing parameter value for the file Scroll bars You can u
70. patterns that match exactly what you typed in the Find What field IUPAC IUB Choose IUPAC IUB if you included an IUB character as part of the pattern The Find command locates all possible matches For instance if the pattern you enter is TAR the Find command locates either TAG or TAA IUB codes are listed in the Glossary Grep Choose grep if you include an expression in the search string The following table describes some of the expressions you can use and how they function with as first characterinside Expression Match Performed Example 1 brackets Any character inside AA AC GT matches the brackets AAAG AAAT AACG or AACT AGC matches A G or C brackets Any character A AG C matches ACC or EXCEPT the character s inside the brackets ATC after character Zero or more such AT CG T matches ATT or characters ATCT or ATGGT and so on period Any character AA A matches AAAA AACA AAGA AATA AANA and so on dash A range of characters AA A z matches AAA AAC enclosed by AAG AAZ and so on brackets Viewing and Editing Sample Files 6 25 Search Find Again Offset Choose Offset to move the cursor to the position or range of positions you specify If you enter a number in the Find What field the insertion point is moved to that base position If you enter a range of numbers the whole range is highlighted For example Ente
71. sample files from within the Sample Within the Sample Manager Window Manager Window To add sample files from within the window Step Action 1 Click the Add files button in the Sample Manager window or choose Add Files from the Manager menu A directory dialog box appears x Sequencing Analysis 3 2 vY Installer Log File c Jane s C SsRGelTracker folder C3 Sample Scripts eject Desktop Hemape The upper part of the dialog box is similar to a standard directory dialog box but it displays only the names of folders and sample files Processing Sample Files 4 9 Search 4 10 Processing Sample Files Find Again To add sample files from within the window continued Step Action 2 In the upper list box locate and open the folder that contains the files you want to add to the Sample Manager c Jane s Eject Desktop Bene Cancel Add all Hemave Note If a file is already included in the Sample Manager window that file name is not visible in the upper list 3 Add the files that you want in the Sample Manager to the Sample Files list at the bottom of the dialog box To add Do this a single file to the list select the file then choose or double click the name of the file all the files to the list choose Add All some of the files to the list either add them individually or choose Add All then u
72. settings continued Step Action 3 Choose the Save this set as button A Save dialog box appears Save this set as untitled Ctr Type a descriptive name for this parameter value set in the text field Choose Save to save the new Basecaller Settings close the dialog box and add this name to the Basecaller Settings pop up menu Editing a To edit an existing set of Basecaller Settings Parameter Value Set Step Action 1 Choose the set that you want to edit from the Basecaller Settings pop up menu Edit the checkboxes and text fields as needed Choose the Save this set button Choose OK to close the dialog box Removing a delete an existing parameter value set from the Basecaller Settings Parameter Value pop up menu Set Step Action 1 Choose the set that you want to remove from the Basecaller Settings pop up menu Choose the Remove this set button The set is remove from the list and deleted from the program Note set that appears in the pop up menu will be the set specified for any files added to the Sample Manager window after the Preferences dialog box is closed The Processing Parameters 5 31 Search Find Again Sample Manager Defaults About the Sample This page allows you to select which Basecaller to use when Manager Defaults p
73. signal Automatic tracking may misinterpret lane positions or fail to follow the path of a lane completely under certain conditions These conditions include the following Failure to complete the Sample Sheet correctly will almost always cause a problem The Tracker uses the Used lane information to determine if what it found corresponds to what the Sample Sheet says was loaded If too few or too many lanes are marked Used then the software must estimate which lanes to throw out and which to keep Weak signals might cause the software to completely miss or be unable to follow a lane especially if the gel ran aberrantly Although the software creates a track for each used lane on the gel the tracker lines might be incorrectly placed indicating lane positions that do not exist or that are located elsewhere You can verify optimal channel tracking by examining peak heights in the Slice view of the Gel File window If the tracker line for a band Working with the Gel File 3 29 Search Find Again is not optimally located you may need to adjust it and re extract the affected lane Reshaping Tracker tracker line consists of a series of linked control points You Lines Using Optimize the position of the tracker line in the lane by moving the control Control Points points 3 30 Working with the Gel File The control points are displayed on the line as hollow diamonds selected control points are displayed as filled
74. standards For how to view gel files and track and extract sample information see Chapter 3 Working with the Gel File 3 Open the sample file for the standard in a Sample window For how to view files in the Sample window see Chapter 6 Viewing and Editing Sample Files Search Find Again To verify lane tracking and peaks in the raw data continued Step Action 4 Choose Quit from the File menu to quit the Sequencing Analysis program 5 Make backup copies of the standard sample files before you make the instrument file Creating Instrument Files D 11 Search Find Again Making a New Instrument File Introduction Outline of New Matrix Procedure D 12 The Worksheet Creating Instrument Files Follow these instructions to make a new instrument file For information on how to add a matrix to an existing instrument file see Adding or Replacing a Matrix in an Existing Instrument File on page D 25 Note If you need to replace a lost or damaged instrument file and you do not have a backup copy on a floppy disk see Viewing and Copying Matrices on page D 30 before you use these instructions to re create the entire instrument file The steps that you need to perform are outlined briefly below and described in detail later in this section These steps include Run the appropriate matrix standards for your instrument verify that lane tracking is correct 373 and 37
75. terminator chemistry than with primer chemistry C 8 Troubleshooting Search Find Again Troubleshooting Table continued Observation Possible Cause Recommended Action Base spacing value is a negative number The base spacing value is a measure of speed of DNA migration through the gel If the reported value is a negative number the base spacing value was outside the allowed range 8 5 16 so the program used a default spacing of 9 to call the bases A reported value that is a negative number indicates a possible gel or running buffer problem or weak or noisy data The optimal value for a sample depends on your instrument and run configuration see the ABI Prism Automated DNA Sequencing Chemistry Guide P N 4305080 for more details To see the base spacing value for a sample look at Annotation view of the Sample window or the top of the printed electropherogram If the reported negative value occurred while the ABI PRISM instrument was running under normal conditions look for a gel or running buffer problem or weak or noisy data Also you can try using a different Basecaller See Choosing a Basecaller on page 5 44 For more information see Negative Spacing on page C 18 and The Spacing Parameter on page 5 9 Menu and analysis options are disabled in Sample Manager window Many of the menu options and analysis options in the Sample Manager window are automa
76. the SOFTWARE to another party you must immediately transfer all copies to that party or destroy those not transferred Any such transfer terminates your license RESTRICTIONS 1 You may not copy transfer rent modify use or merge the SOFTWARE or the associated docu mentation in whole or in part except as expressly permitted in this Agreement 2 You may not reverse assemble decompile or otherwise reverse engineer the SOFTWARE LIMITED WARRANTY For a period of ninety 90 days after purchase of the SOFTWARE Perkin Elmer warrants that the SOFTWARE will function substantially as described in the documentation supplied by Perkin Elmer with the SOFTWARE If you discover an error which causes substantial deviation from that documenta tion send a written notification to Perkin Elmer Upon receiving such notification if Perkin Elmer is able to reproduce that error reliably at its facility then Perkin Elmer will do one of the following at its sole option i correct the error in a subsequent release of the SOFTWARE which shall be supplied to you free of charge or ii accept a return of the SOFTWARE from the purchaser and refund your purchase price of the SOFTWARE Perkin Elmer does not warrant that the SOFTWARE will meet your require ments or will be error free or will conform exactly to the documentation Any sample or model used in connection with this Agreement is for illustrative purposes only is not part of the basis of the bargai
77. the Sample Manager Defaults page of the Preferences dialog box Checkbox Status The color of this checkbox indicates the printing status If the checkbox is Then printing green is completed red failed no color has not been started since the sample was added to the Sample Manager window If the checkbox is red check your printer connections referring to your printer manual if necessary The Processing Parameters 5 7 Search Find Again The Basecaller Parameter About the Basecaller Program 5 8 The Processing Parameters The Basecaller is the program that identifies the bases in a sample file You can choose the Basecaller for a file from the Basecaller pop up menu in the Sample Manager For a detailed explanation of Basecallers and how to select the best Basecaller for a sample file see About Basecallers and Base Calling on page 5 43 Search Find Again The Spacing Parameter About the Spacing Value Changing the Spacing for a Sample Spacing is defined by the number of scan points from the crest of one peak to the crest of the next peak To calculate spacing the Basecaller averages the peak to peak distance between scan 1000 and 2000 in the raw data relative to the Peak 1 Location Spacing can be changed only in the Sample Manager window You may or may not be able to use the same spacing value for all samples in the run Note If you set this value to the Basecalle
78. the Value for a Data Point Introduction The values for certain data points are used to set the Peak 1 Location Start Point and Stop Point Using the crosshair feature you can determine the exact value at any point in an Electropherogram Raw Data or EPT view of the Sample window Determining To determine the values for a given data point Values of a Given Point Step Action 1 Put the cursor near the point of interest Then hold down the mouse button The scan number ruler disappears and the crosshair locator lines appear zia Sample 01 2 Drag the cursor across the window until the locator lines intersect the point of interest Viewing and Editing Sample Files 6 21 Search Find Again Step Action 3 Note the values at the top of the vertical and the left of the horizontal locator lines For the view Value at the top of vertical line represents the Value at the left of horizontal line represents the Electropherogram re spaced scan normalized number fluorescence intensity Raw Data raw scan number normalized fluorescence intensity EPT raw scan number parameter value 6 22 Viewing and Editing Sample Files Search Find Again Finding Patterns in Sequence View Introduction Searching for Pattern in a Sequence You can use the Find and Find Again commands in the
79. the channel to the right of it You can include data from up to nine channels Three channel averaging is recommended Search Use Weighted Averaging Find Again You might choose to use one channel no averaging if the gel bands are severely tilted For example if the left lane of the gel ran faster than the right a better result would be obtained by taking the center channel alone rather than averaging three channels Note When you use multiple channel averaging be sure each tracker line marks the center of its lane If a tracker line is near the right or left edge of its lane empty channel s between lanes may be included in the average and cause an erroneously low value Or signal from neighboring lanes may be included in the average Weighted channel averaging is a new feature in Sequencing Analysis v 3 2 Weighted averaging is now possible because the new Tracker interface allows tracker line placement to within a tenth of a channel The Use __ Channel Averaging field applies to both weighted and non weighted averaging No Weighted Averaging If the Use Weighted Averaging box is not checked data averaging is done per channel For example if the tracker line falls within channel 10 and 2 channel averaging is set len 10 len 11 channel average 5 Weighted Averaging If the Use Weighted Averaging box is selected data averaging is done to the tenth of a channel For example if the tracker line falls 2096 into
80. the lanes in the gel image Are the fluorescent signals displayed as discrete horizontal bands If not this may be indicative of a poor gel Are any of the colors too bright or too dark Is there a green or red haze Is this something that you can fix by adjusting the gel image contrast See Adjusting the Gel Image on page 3 17 Inspect the lane markers Look for data lanes without lane markers and for lane markers between data lanes See Adjusting Lane Markers and Tracker Lines on page 3 23 Inspect the lane markers Verify that each lane marker corresponds to a sample as designated in the Sample Sheet See Reviewing the Sample Sheet Information on page 3 13 If necessary adjust the locations of the lane markers See Moving Misplaced Lane Markers on page 3 23 Inspect the tracker lines Each tracker line should be in the center of the lane it tracks If necessary adjust the tracker line placement See About Optimizing Tracker Line Locations on page 3 29 IMPORTANT If you change the lane markers or their Sample Sheet designation or reposition any tracker lines after extracting the sample data from the gel file you must re extract the data to include the new information in the sample files Working with the Gel File 3 11 Search Find Again Review the Gel The Gel Info window displays information about the run conditions when Info Window the file was created Reviewing the conditions under which the samples r
81. the sample file for lane 1 the lane 3 data into sample file for lane 2 etc To correct these problems you can compare the lane markers on the gel image to the Sample Sheet then rearrange the lane markers so the lane numbers are properly aligned with the actual rows of information in the Sample Sheet Then when you later regenerate the sample data the lane data will be written out correctly Note For information on how to view the data collection Sample Sheet to confirm that the gel lanes are properly labeled see Reviewing the Sample Sheet Information on page 3 13 To rearrange the lane markers Step Action 1 Inspect the gel image for incorrectly labeled lanes For example in the following illustration the Sequencing Analysis software missed the faint signals from lane 25 As a result lanes 26 36 are mislabeled and the lane 36 marker is over an unused area to the right of the lanes Missed lane 25 has X 5 5 52 3 no marker III 600000000000 Lane 36 marker is not over a lane 2 Click the incorrectly placed marker to select it The selected marker becomes outlined in red Search Find Again To rearrange the lane markers continued Step Action 3 Hold down the mouse button and drag the lane marker to the correct location Lane markers always remain in numerical order from left to right and are attached to their respective tracker lin
82. to the default values for the preferences delete the file Seq Analysis v3 2 Prefs from the Preferences folder in the System Folder All existing preference settings will be lost The preferences are grouped into the following categories which are available on separate pages of the Preferences dialog box Parameters That Are Changed in the Preferences Dialog Box Parameters in the Preferences Dialog Box See Page Gel Preferences 5 23 Basecaller Settings 5 28 Sample Manager Defaults 5 32 Printing Preferences 5 34 Sequence File Formats 5 38 Factura Preferences 5 39 Base Letters Style 5 41 The Processing Parameters 5 21 Search Find Again Changing Parameter Values in the Preferences Dialog Box About Changing Parameter Values Changing a Preference Parameter 5 22 The Processing Parameters When you change a processing parameter value in the Preferences dialog box the new value is used for all future processing until you change the value again or temporarily override that value for selected files in the Sample Manager window Note Changes you make in this dialog box take effect as soon as you close the dialog box However the changes do not affect the values already defined for sample files currently listed in the Sample Manager window This section provides a generic explanation of how to change Preference values The following sections explain how to decide which values are appropriate
83. values 4 14 4 15 Channel Scan 3 8 channel averaging about 5 24 5 26 channel number 3 7 channels defined Glossary 1 checkboxes A F and P in Sample File window 4 21 in Sample window 4 20 chemistries overview D 2 chromatogram defined Glossary 1 Clear command Close command A 2 codes See IUB codes Color buttons 3 9 Color Grayscale 2 12 colors adjust in gel image 3 17 in real time data display windows D 3 See Also dye colors lines base letters column width changing 4 17 comb shark tooth described Glossary 4 square tooth described Glossary 4 Comb Type button 5 27 choosing wrong C 7 Command Log C 16 C 17 location B 2 print C 17 review C 17 commands AppleScript E 3 See Also under command names Comments 3 14 on printed electropherogram 6 36 complement defined Glossary 1 Confidence Threshold text box 5 26 contrast adjust 3 17 control point on tracker line 3 30 adding and deleting 3 32 moving 3 31 selecting and deselecting 3 30 Copy command A 3 Copy Matrix dialog box 0 30 misaligned numbers 0 19 Counts Per Tick 6 43 CPU requirement 2 4 crosshair locator lines 6 21 Electropherogram view 6 22 EPT view 6 22 Raw Data view 6 22 current during 6 18 Cut command A 3 cycle module defined Glossary 3 D data analyzed data missing C 5 edit analyzed sequence 6 27 editable defined Glossary 2 missing C 5 review analyzed sequence 6 19 show original 6 30 source of raw data 6 16 ver
84. with fewer bases per panel Use this text box to effect a zoom in fewer points per panel or a zoom out more points per panel in the printed graphical data 1500 points per panel 700 points per panel GCC TGCC GCAGTC TGAGGGGAGA GCCTGCCGCAGTCTGAGGGGAGA 160 170 180 160 170 180 The Processing Parameters 5 35 Search PostScript Printer Checkbox Use Dot Dash Format Checkbox Print First Page Only Checkbox Print These Checkboxes Page Setup Options Button 5 36 The Processing Parameters Find Again Select this if using a PostScript compatible printer De select this if your printer is not a PostScript printer See your printer manual to determine if you have a PostScript printer Select this to print the lines in Electropherogram Raw Data and EPT views as dotted or dashed lines using a different pattern for each line This option is available only for PostScript printers Select this to print only the first page of the specified sample file data De select this to print all the pages Select the checkbox next to each Sample window view Annotation Sequence Feature Table Electropherogram Raw Data EPT Data to print when printing is started from the Sample Manager window or through auto analysis IMPORTANT Do not select all six views The exact number of views you can print at one time without overloading your printer will depend on your printer and the views selected for printing Opens the st
85. 00 bph 2X 1200 scans hr 36 cm run on the ABI100 ABI PRISM 377 average 200 bph 4x 2400 scans hr 36 cm run on the ABI200 ABI PRISM 377 48 cm run on the ABI 373 ABI50 48 cm run on the ABI PRISM 377 ABI100 run with many insertions or deletions near the end of the run Semi for example if the sample is a PCR product Adaptive spacing that is a negative number Semi Adaptive spacing that is still a negative number with SemiAdaptive Adaptive problems with run conditions Adaptive The ABI The labels 50 100 and 200 on the ABI 373 and ABI PRISM 377 Basecallers Basecallers refer roughly to the bases per hour bph separated on the 5 44 The Processing Parameters slab gel electrophoresis instruments Use one of the ABI Basecallers to perform base calling on a standard run The names indicate the instrument and type of run for which the Basecaller is optimized Search The SemiAdaptive Basecaller Find Again ABI CE1 is optimized for runs on the ABI PRISM 310 instrument CE refers to capillary electrophoresis that use d Rhodamine terminator chemistry and BigDye DNA Chemistry and POP 6 polymer You should not use it with ABI 373 or ABI PRISM 377data ABI CE2 is optimized for runs on the ABI PRISM 310 instrument CE refers to capillary electrophoresis that use the Old Dye Terminator chemistry and POP 6 polymer You should not use it with ABI 373 or ABI PRISM 377data ABI100 is optimized for data collected
86. 12 making from one sample file 0 22 making troubleshooting D 28 missing from ABI folder 5 20 name on printed electropherogram 6 36 store D 24 valid for one instrument D 8 verify accuracy D 19 verify the matrix standard files 0 21 view matrix 0 19 when to make new 0 8 Intelligenetics file format 5 38 internet site See web site interpolating tracker lines 3 34 3 36 Interpolation Mode button 3 10 codes 1 14 adding to sequence 6 29 defined Glossary 2 search expressions using 6 25 IUPAC defined Glossary 3 IUPAC codes adding to sequence 6 29 search expressions using 6 25 L lane 3 8 number on printed electropherogram 6 36 lane assignment confidence value 5 26 5 27 lane markers 3 7 3 9 blue 3 9 grey 3 9 missing C 5 moving 3 23 3 26 Search Find Again orange border 3 9 rearrange 3 24 rules 3 27 white 3 9 yellow 3 9 lane numbers 3 7 3 8 lanes 3 7 mark all for extraction 3 28 mark as used unused 3 26 mark one for extraction 3 28 mark unmark for extraction 3 27 unmark one for extraction 3 28 Lanes marked for Extraction field 3 43 length sequence defined Glossary 3 libmatlb extension B 5 libmcc extension B 5 libtbx extension B 5 license 2 2 F 1 F 2 Limit Check PostScript error 6 lines change color 6 41 hide and display 6 41 Literal search expressions 6 25 lock image 6 5 LR in DyeSet Primer filename B 8 M Make Matrix dialog box 0 14 D 26 manuals related to Sequencing Analysis 1 3 margin
87. 2 10 summary of processing 1 9 summary of processing lt endpage gt 1 12 summary of processing lt startpage gt 1 10 unexpected quits 13 using with Data Collection 1 9 Sequencing Chemistry Guide 1 3 troubleshooting 1 Set endpoint after bases checkbox 5 30 Set endpoint after Ns checkbox 5 30 Set endpoint after Ns in bases checkbox 5 30 Set endpoint at PCR stop checkbox 5 30 setting up Sequencing Analysis software after installation 2 10 settings defined Glossary 4 shark tooth comb described Glossary 4 Show Command Log command 8 Show Data color bars 6 42 Show Error Log command 8 Show Original command 6 30 A 6 Show real values button 6 44 Show relative values button 6 44 Show Sample Manager command A 8 Show Tracker Lines command A 4 signal enhancement 5 43 strength below 40 C 13 defined Glossary 4 troubleshooting C 18 strength on printed electropherogram 6 36 too weak D 28 Single Page button 6 32 Slice view 3 7 3 8 change peak height 5 24 software license 2 2 F 1 F 2 spacing changing 5 9 default value C 18 defined Glossary 1 negative number 9 Glossary 1 negative spacing C 18 on printed electropherogram 6 36 recalculate 5 9 5 11 Spacing field 4 6 5 9 spectral overlap 0 8 square tooth comb described Glossary 4 Stack Windows command 8 Staden file format 5 38 Start at text box 0 26 Start button 4 4 Start command A 7 Start field 3 21 Start Point 4 6 Index 11 Search Find Again
88. 20 000 In the new v 3 2 Basecaller program the maximum number of scans for analyzed data has been increased to 32 000 The raw scan limit remains at 20 000 How Will the New Scan Maximum Effect Data Processing The error data too long should appear less frequently This problem was most likely to occur with long read formulation gels where the number of analyzed scans could often exceed the 20 000 limit when the base spacing estimate was low or if the run time was too long How Can Analyzed Scans Exceed Raw Scans The reason there may be more than 20 000 scans in the analyzed data when there are less than 20 000 raw scans is because of respacing As part of the base calling algorithm raw data is respaced so that the analyzed data will have an average spacing of 12 points peak to peak throughout the run If the raw data spacing is less than 12 the basecaller will interpolate adding more points between peaks as necessary In the electropherogram view the hot spot selectable area around the base letters is larger This makes it easier than before to select bases by clicking on them The DyeSet Primer and Instrument file columns in the Sample Sheet can be edited If you chose the wrong file at data collection you can now easily correct it by choosing a new instrument or DyeSet Primer file in the gel file Sample Sheet About This User s Manual 1 7 Search Find Again Sequencing Analysis Software Applies to Three Instrum
89. 5 tracking a gel file 3 23 3 36 straight line 3 38 tracking and extracting a gel file 3 37 3 44 troubleshooting C 1 C 19 general hints C 2 U Undo command A 3 Unmark All Lanes for Extraction command A 4 Use Channels Averaging text box 5 24 Use dot dash format checkbox 5 36 Use Sample Sheet Settings 3 41 3 43 Use Weighted Averaging checkbox 5 25 Used checkbox 3 14 V Values See parameters values Variable Size button 6 33 Version on printed electropherogram 6 35 Vertical Display button 6 44 Vertical Expand button 3 10 Vertical scale Scan numbers 3 9 Search Find Again Vertical Shrink button 3 10 virtual memory system requirements 2 4 voltage during run 6 18 W warranty 2 2 F 1 F 2 watts during run 6 18 wavelengths filter 0 6 web site for EditView 1 15 for Technical Support 1 16 weighed channel averaging about 5 25 white lane marker 3 9 windows open too many 6 38 tiling or stacking 6 37 Wisconsin file format 5 38 worksheet for making instrument file D 16 D 18 Wrap around Find dialog box 6 24 WTR well to read See separation distance X X96 in DyeSet Primer filename 8 XX in DyeSet Primer filename B 8 Y yellow lane marker 3 9 Z Zoom In command 6 39 A 8 Zoom Out command 6 39 A 8 Index 13 Index 14
90. 7 runs only and verify that peaks exist in the raw data as described earlier in this chapter First Obtain Raw Data on page D 10 Use the DataUtility program to make the instrument file To make the instrument file on page 0 13 Backup the raw sample files for the standards After making the instrument file analyze each matrix standard raw data file with the new instrument file to confirm the accuracy of the instrument file Verifying the Instrument File on page D 19 Properly store the new instrument file Storing and Backing Up the Instrument File on page D 24 If you are new to making an instrument file or if you are not using the default Start Point and Number of Points you may want to use the Worksheet on page D 16 to help you keep track of the standards files Search Placement of Standards Files in DataUtility Making an Instrument File with the DataUtility Program Find Again Placement of standards in DataUtility application for dyes used for Old Dye Primer and Old Dye Terminator chemistries Matrix Standard Tube Labels Corresponding to DataUtility Boxes Taq Terminator T7 Terminator Box Dye Primer Matrix Matrix Matrix C FAM Taq C term not used A JOE Taq A term not used G TAMRA Taq G term not used T ROX Taq T term not used Matrix Standard Tube Labels Corresponding to DataUtility Boxes Taq Terminator T7 Terminator Box Dye Primer Matrix Matrix Matrix
91. AA EAFACTACCCTGCATRACA TGGCHFFFCE TTGTCTRCCRRFRIRT TR COC GBCRT GOT GTCA TOO R GR OR GCE ABA GCAGGTGGATC GACTGA GCCCR GGR g 180 190 200 210 220 230 240 1328 1328 996 996 664 664 wal i 332 M T MW ll BR AUN AU HAVA Lo ALA Us shah aah MALA Ee Mle gt Actual size one scan one screen pixel oomou LAO 123 To return to the default view from any other size choose Actual Size Full view 6 40 Viewing and Editing Sample Files Search Find Again Changing the Displayed Lines and Scales Introduction For the Electropherogram view Raw Data view and view of the Sample window you can use the Display Options dialog box to Changing Trace Lines or Scale Determine which color is used to represent each kind of data Change the colors of the trace lines to make them easier to see on screen Selectively turn off one or more trace line Change the type of scaling used for the display Change the labeling of the tick marks on the scale in the display IMPORTANT Any change you make in this dialog box affects all displays of the selected view and remains in effect until you change the setting again in this dialog box There is no return to default option for this dialog The only way to return to the default settings is by deleting the Seq Analysis Prefs file
92. AB PRISM Automated DNA Sequencing Chemistry Guide P N 4305080 This appendix includes the following topics Topic See Page General Troubleshooting Hints C 2 Troubleshooting Error Log Messages C 4 Troubleshooting Other Types of Sequencing Analysis Software C 7 Problems Reviewing the Sequencing Analysis Error Log C 14 Reviewing the Sequencing Analysis Command Log C 16 Troubleshooting with the Printed Electropherogram C 18 Troubleshooting 1 Search Find Again General Troubleshooting Hints Two Suggestions Checking the Error Log C 2 Troubleshooting The following two general suggestions can be helpful in a variety of situations Check the Error Log for recent error messages Checkthe size of the sample and gel files as compared to the usual size for similar files at your site In the Error Log window note the message number and description for any error messages you find Look for the error message in this troubleshooting chapter If it is not here call PE Applied Biosystems Technical Support and tell them both the number and description of the error message See Technical Support on page 1 16 For information about viewing and printing the Error Log see Reviewing the Sequencing Analysis Error Log on page C 14 Search Find Again Checking the Size Compare the sizes of the gel file and sample files with the size of data of Data Files files for similar files at your s
93. Action 1 Click the lane marker for the lane that you want to unmark 2 Select Unmark Lane For Extraction from the Gel menu When you unmark the lane the lane marker turns from white to blue Note alternate method for unmarking a lane is to press the Option key and click the lane marker Search Showing and Hiding Tracker Lines About Optimizing Tracker Line Locations Find Again The first time that the Sequencing Analysis software opens a gel file it adds tracker lines to the gel image Any time you open a gel file all tracker lines are displayed To make it easier to view the gel image and edit individual tracker lines you can turn this line display on and off To turn off the display of unselected tracker lines Step Action 1 Choose Hide Tracker Lines from the Gel menu All unselected tracker lines disappear If a lane is selected the white tracker line for only that lane remains visible To select one tracker line to display Step Action 1 Click the lane marker 9 for the tracker line you want to view Any time you select a lane or tracker line the program either hides or grays out all the other tracker lines Because the Sequencing Analysis software normally calculates the data values for each lane by averaging the data from multiple channels it is important that tracker lines be positioned over areas of data that display the strong fluorescent
94. Analysis data c Close the Chooser The dialog boxes that appear when you first start the Sequencing Analysis program are specific to the selected printer Search Find Again To start Sequencing Analysis for the first time continued Step Action 2 Double click on the Sequencing Analysis icon to open the program The Sequencing Analysis start up screen appears Analysis Version 3 2 1989 1997 Perkin Elmer Corp All Rights Reserved ABI PRISM and design are trademarks of Perkin Elmer Corp PE Applied Biosystems HP LaserJet Page Setup Paper US Letter w Layout _1 Up v A Reduce or Enlarge roo Orientation Uta Halftone Screens Default v Select the page setup that you want to use when printing is done as a part of automated sample file processing Note When printing from the Sample Manager window the Sequencing Analysis software does not ask for page setup and printer information It uses the values you select in this and the following Printer dialog box If your Seq Analysis v 3 2 Prefs file is lost or discarded these two dialog boxes will appear the next time you start the Sequencing Analysis software The exact contents of the Page Setup dialog box depend on your printer Normally you should select your standard paper size and Landscape orientation If necessary you can change these settings later in the Preferences dialog box Ge
95. Basecaller Settings on page 5 28 During base calling the Basecaller considers both the Basecaller Settings and any Stop Point value in the Sample Manager window and stops as soon as it meets one of the endpoint criteria or the Stop Point value whichever comes sooner Search Find Again The Peak 1 Location Parameter About the Peak 1 The Peak 1 Location is the data point that marks the beginning of the Location first base peak in the data This is initially calculated by the Sequencing Finding the Peak 1 Location Value Analysis software It is the reference point for the spacing and mobility corrections performed by the base calling software The starting point for data analysis the Start Point is normally determined from the Peak 1 Location value If the Peak 1 Location value is wrong due to low signal or any other aberration your data can show bad spacing or strange mobility shifts Follow the instructions in the table below to find the beginning of the first base peak for a sample Then if necessary you can enter a new Peak 1 Location value in the Sample Manager Note Because the Peak 1 Location is linked to the mobility correction changing the Peak 1 Location value affects the way the DyeSet Primer file is applied to correct for mobility shifts If you want to start analysis farther along than the actual location of the first base peak change the value for the Start point not the Peak 1 Location value Note If
96. D 19 Copy a matrix from a source file sample instrument or gel into a destination file sample instrument or gel page D 30 These operations are not necessary for normal operation of an ABI PRISM genetic analysis instrument They are useful if you want to verify an existing matrix or re create a lost matrix or instrument file Why Copy Matrices from Source to Destination Files The table below lists some common reasons you might copy files using the Copy Matrix dialog box Common Uses of the Copy Matrix Dialog Box D 30 Creating Instrument Files Reason for Use Source Destination To recover the information for a lost Sample File Instrument instrument file from a sample file The File New sample file need not contain good data for this to work To recover the information for lost Gel File Instrument 373 instrument file from a gel file The gel file File New 377 need not contain good data for this to work To copy the instrument file contents into Instrument Gel File gel file All sample files that are File Existing subsequently generated from the gel file will contain this instrument file information 310 To copy the instrument file contents into Instrument Sample File 373 sample file for subsequent reanalysis File Existing 377 To copy a matrix from one instrument file Instrument Instrument to another File Existing File Existing Search
97. DyeSet Primer mobility file used for analysis This is originally taken from the data collection Sample Sheet Changes made to the Sample Sheet in the gel file should appear here Select from the pop up menu to change the DyeSet Primer file 4 6 Processing Sample Files Search Find Again Parameters for Processing Sample Files continued Parameter Description Instrument file The instrument file used during analysis The instrument file contains the matrix information that is used to correct for spectral overlap of the fluorescent dyes This is originally taken from the data collection Sample Sheet but changes made to the Sample Sheet in the gel file should appear here Select from the pop up menu to change the instrument file Sample Manager The font style used to display a processing parameter value provides Field Status additional information about that value as shown in the following table Indicators Field Status Indicators Indicator Font Meaning Parameters Affected Plain Text Default no action taken by user Black Bold Text User defined variable Start Peak 1 Location Stop Red Bold Text Basecaller couldn t calculate Start Peak 1 Location Stop Outline Font File not found DyeSet Primer Instrument file File not found in ABI folder in the System Folder Blue Bordered Text User modified but not yet analyzed
98. Edit menu to search for a particular base or pattern of bases in a sequence The search operation must be done in the Sequence view of the Sample window Note You cannot use the Find command in Electropherogram view Instead use the Find command in Sequence view and when the pattern is highlighted switch to Electropherogram view Note To find the next occurrence of an use the Tab key to search forward or Shift Tab to search backward To find a pattern in a sequence Step Action 1 Display the Sequence view of the Sample window 2 Click at the position in the sequence where you want to start the search Note search begins at the cursor position If the pattern is before the cursor it is only found if the Wrap around checkbox is selected see step 3 below If you only want to find a pattern in the valid range place the insertion point just before this range in the sequence 3 Choose Find from the Edit menu A special Find dialog box appears find Find what amp Literal Case sensitive IUPRC IUB O Wrap around Grep Offset Viewing and Editing Sample Files 6 23 Search Find Again To find a pattern in a sequence continued Step Action 4 In the Find What field enter the search instruction In addition to normal base character G A T C patterns the search string can include IUPAC IUB characters G
99. Factura program Print the specified views of the sample file Checkboxes After Following processing each checkbox is colorless green or red Processing depending on the processing outcome Checkbox Color Processing Outcome No color The selected action was cancelled or never started Green The selected action was successfully completed Red The selected action failed If the Analysis Box If file analysis fails the analysis box is red you can is Red Change one or more parameters in the Sample Manager window and reanalyze the affected sample files either individually or as a group Check the Sequencing Analysis Error and Command Logs for information about problems that occurred during analysis for details see Reviewing the Sequencing Analysis Error Log on page C 14 and Reviewing the Sequencing Analysis Command Log on page C 16 Check the run conditions to see if any problems occurred during data collection 4 20 Processing Sample Files Search If the Factura Box is Red If the Printing Box is Red Find Again If Factura processing failed you can check the Factura Log and Factura user s manual for possible causes If printing failed you can check your printer manual and the Troubleshooting chapter of this manual for possible causes or call PE Applied Biosystems Technical Support Processing Sample Files 4 21 4 22 Processing Sample
100. Files Search Find Again The Processing Parameters Overview In This Chapter This chapter explains the sequence data processing parameters how About Processing Parameters certain values are calculated by the Sequencing Analysis software and how to select parameter values that are appropriate for your data This chapter includes the following topics Topic See Page Parameters in the Sample Manager Window 5 2 Parameters in the Preferences Dialog Box 5 21 About Basecallers and Base Calling 5 43 A processing parameter is a word phrase or checkbox that tells the Sequencing Analysis software what to do at a certain point during file processing The Sequencing Analysis parameters described in this chapter generally determine how base calling Factura analysis and printing are carried out For example if you select the A checkbox for a file in the Sample Manager window that file will be analyzed base called during file processing If you select ABI CE1 for the Basecaller parameter the base calling will be done by the ABI CE1 Basecaller You can change some processing parameter values in the Preferences dialog box some in the Sample Manager window and some at either location For all parameters except Basecaller Settings the value entered in the Sample Manager window overrides the value in the Preferences dialog box The Processing Parameters 5 1 Search Find Again Parameters in the S
101. Files Not Located in the System Folder B 6 DyeSet Primer File Naming Conventions B 8 Input and Output Files B 1 Search Find Again Input and Output Files in the System Folder Introduction About the ABI Folder ABI Files in the System Folder The System Folder on the hard disk of your Macintosh computer contains assorted files that are used by the Sequencing Analysis software as well as the preferences file and log files which are created by the software With the exception of the preferences file the Sequencing Analysis System files are contained in the ABI Folder within the System Folder When ABI PRISM software is installed a special folder named the ABI Folder is created in the System Folder To this folder are added various important system files required for running ABI PRISM software Note When Sequencing Analysis software is installed if there is already an ABI Folder used by other ABI PRISM software then a new folder is not created the Sequencing Analysis system files are added directly to the existing ABI Folder The following table lists the Sequencing Analysis files that must be present in the System Folder Input and Output Files Necessary in the System Folder File Type Folder Location in System Folder Description Sequence DyeSet Primer files input ABI folder Contain dye and primer mobility information PE Applied Biosystems supplies these files which are used by bo
102. Find Again DNA Sequencing Analysis Software Version 3 2 User s Manual Applied Biosystems DIVISION OF PERKIN ELMER Search Find Again Copyright 1998 The Perkin Elmer Corporation This product is for research purposes only ABI PRISM GeneScan Genotyper Perkin Elmer and Sequence Navigator are registered trademarks of The Perkin Elmer Corporation ABI the ABI PRISM design Applied Biosystems AutoAssembler BigDye BioLIMS Factura POP 6 PE PE Applied Biosystems and Primer Express are trademarks of The Perkin Elmer Corporation AppleScript and Macintosh are registered trademarks of Apple Inc All other trademarks are the sole property of their respective owners Search Contents Find Again About This User s Manual 1 1 Introduction aeter ete bris x Ed ES 1 1 Manual Contents es 1 2 New Features in Sequencing Analysis Since Version 3 0 1 4 Sequencing Analysis Software Applies to Three Instruments 1 8 What Does Sequencing Analysis Software Do 1 9 Other ABI PRISM Software 1 14 Technical Support csse Rh ered en eed eR qd 1 16 Getting 5 2 1 OVEDVICW ues debo eee eri eee 2 1 Registration and 2 2 Hardware And Software
103. PCR and Sequence Detection pcrlab perkin elmer com Protein Sequencing Peptide and DNA Sequencing corelab Q perkin elmer com About This User s Manual 1 17 Search Find Again Regional Offices lf you are outside the United States and Canada you should contact your local PE Applied Biosystems service representative The Americas United States PE Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 Tel 650 570 6667 800 345 5224 Fax 650 572 2743 Canada Mississauga Ontario Tel 905 821 8183 800 668 6913 Fax 905 821 8246 Latin America Del A Obregon Mexico Tel 52 5 651 7077 Fax 52 5 593 6223 Europe Benelux Nieuwerkerk IJssel Netherlands Tel 81 0 180 331400 Fax 31 0 180 331409 Hungary Budapest Tel 1 251 11 16 Fax 1 251 14 61 Chekia Rep Praha Tel 2 61 22 21 64 Fax 2 61 22 21 68 Italy Milano Tel 039 23831 Fax 039 2383490 Denmark Aller d Tel 48 100 400 Fax 48 100 401 Norway Oslo Tel 0 22 68 65 65 Fax 0 22687068 Finland Espoo Tel 0 880 144 Fax 0 803 8002 Poland Warszawa Tel 22 33 09 36 Fax 22 33 09 96 France Paris Russia Moskva Fax 0 8 619 4401 Tel 1 69 59 85 85 Tel 095 952 7961 Fax 1 69 59 85 00 Fax 095 952 7514 Sweden Sundbyberg Spain Madrid Tel 0 8 619 4400 Tel 1 803 4210 Fax 1 804 0414 Switzer
104. Processing Sample Files 4 7 Search Find Again Adding Sample Files to the Sample Manager Window Introduction You can add files to the Sample Manager window in three ways as described below In addition the Sequencing Analysis software can open the window and add files as part of automatic analysis Files are arranged in the list in the order in which they were added to the list To Add Oneor To add one or more sample files from the Macintosh Finder to the More Files from Sample Manager follow the steps in the table below This applies in the Finder Sample File mode only Step Action 1 Drag the icon s for the file s you want to add onto the Sequencing Analysis program icon A sample window opens for each file If the Sequencing Analysis application is not already open dragging the sample files onto the icon will open the application For each sample window a Click on the sample file window to make it active b From the Sample menu choose Add to Sample Manager The sample is then listed in the Sample Manager window To Add a File from To add an open sample file to the Sample Manager the Sample Window 4 8 Processing Sample Files Step Action 1 Make sure the sample window is active 2 From the Sample menu choose Add to Sample Manager The sample is then listed in the Sample Manager window Search Find Again To Add Files from Follow this procedure to add
105. Runs folder of the same several formats and can open and print them inside the name as the from word processing programs You can also ABI PRISM 310 gel file import Seq files into other programs that folder accept text files in these formats B 6 Input and Output Files Search Find Again Output Files That Are External to the System Folder continued Location for ABI PRISM 377 Location for and File Type ABI PRISM 310 ABI 373XL Description MatLab text SAGelTracker MatLab text files with extension mat are files folder inside output to the SAGelTracker whenever a gel is the tracked You can ignore these files if you Sequencing throw them away new ones are created when Analysis 3 2 you next track a gel folder Input and Output Files B 7 Search Find Again DyeSet Primer File Naming Conventions Introduction The files installed by the Sequencing Analysis program have specific file names that provide information about the files Many filenames are self explanatory log files for instance The naming conventions for the DyeSet Primer files are less straightforward File Naming The DyeSet Primer File names use a combination of characters to Conventions indicate the chemistry e g dye primer dye terminator gel concentration and gel type The abbreviations are as follows Abbreviation Meaning DP Dye Primer chemistry was used DT Dye Terminator chemistry wa
106. Sequencer about 1 8 data collection program D 3 See Also ABI Prism 377 ABI100 Basecaller 5 45 ABI200 Basecaller 5 45 ABI50 Basecaller 5 45 ABI CE1 Basecaller 5 45 ABI CE2 Basecaller 5 45 Ac in DyeSet Primer filename 8 Actual Size command 6 39 8 Adaptive Basecaller 5 46 Add All button 4 10 Add files button 4 4 4 9 Add Files command 7 Add To Sample Manager command 4 8 A 6 adding control points on gel image 3 32 Project Names to pop up menu 3 16 sample files to Sample Manager window 4 8 4 11 Adjust Gel Contrast command A 4 Adjust Gel Contrast dialog box Apply button 3 18 triangles 3 18 adjusting lane markers 3 23 3 26 tracker lines 3 23 3 36 All Used Lanes 3 43 Allow for 3 hole punch checkbox 6 31 analysis endpoint 5 10 fails 6 no base calling C 8 results review 6 19 start after first peak 5 16 Analysis checkbox See A checkbox Index 1 Search Find Again Analyze All Files 3 41 3 43 Annotation view about 6 8 print contents 6 8 See Also Sample window Annotation View button 9 Apple Events E 3 AppleScript 1 5 Apple Events E 3 commands and objects E 3 Process Gel Script 5 Sample Manager Script E 5 Apply button 3 18 Auto Analyze after Extraction 3 41 in Data Collection program 4 3 New Sample Files 3 43 AutoAssembler about program 1 14 manual 1 3 Auto Track Lanes 3 38 B balloons on line help 6 5 base change in sequence 6 28 print in color 2 12 base calling about 4 1 See Also
107. Sequencing Analysis software When the Sequencing Analysis program starts an empty Sample Manager window appears on the screen To Open To open the Sample Manager window choose Show Sample Manager from the Window menu To Close To close the Sample Manager window click the Close box at the top left corner of the window or choose Close from the File menu or choose Hide Sample Manager from the Window menu Note If you close and then reopen the Sample Manager window during a single Sequencing Analysis session the contents of the window remain the same The current list contents are always discarded when you quit the Sequencing Analysis program When an empty Sample Manager window appears on the screen only the upper left portion of the Sample Manager is visible in the window After files are added the window shows the current processing parameter values for each file Processing Sample Files 4 3 Search Find Again Name of the sample file Status field reports the Buttons for various program from the data collection current state of the r features program Sample Sheet processing operation Sample Manager gt Yaad fites Remove pen File Processing parameter name Basecaller Settings Blo ABI CE1 r 12 19 Default Settings P Basecaller Current processing
108. Sequencing press 22 Fax 650 638 5891 Fluorescent Fragment Analysis press 23 Fax 650 638 5891 Integrated Thermal Cyclers 800 and 877 press 24 Fax 650 638 5891 PCR and Sequence Detection press 5 or call 1 800 762 4001 and press 1 for PCR or 2 for Sequence Detection Fax 203 761 2542 Peptide Synthesis press 31 Fax 650 638 5981 Protein Sequencing press 32 Fax 650 638 5981 Chemiluminescence call 1 800 542 2369 U S only or 1 617 271 0045 Fax 1 617 275 8581 Tropix 9 00 5 00 ET LC MS call 1 800 952 4716 Fax 650 638 6223 9 00 5 00 PT 9 9 9 Search Fax on Demand To Reach Us by E Mail Find Again In the United States and Canada free 24 hour access to PE Applied Biosystems technical documents is available by fax There are two ways to access Fax on Demand documents Order through our web site on the Internet at http Awww perkin elmer com fod Search for documents to order using keywords Up to five documents can be faxed to you if you already know the titles Order by phone Call 1 800 487 6809 from a touch tone phone Have your fax number ready Press 1 to order an index of available documents and have it faxed to you Press 2 to have up to five documents faxed to you Contact Technical Support by E Mail for help in the following product areas Chemiluminescence info tropix com Genetic Analysis galab perkin elmer com LC MS apisupport sciex com
109. Step Action 9 When the following Product Registration dialog box appears type your registration information into the three fields Product Registration Your Name Organization Please enter the registration code for this product The registration code is on the Software License and Limited Product Warranty card that comes with the product If you are upgrading from Sequencing Analysis v 3 X enter the registration code that you received with your original 3 X software This dialog box appears the first time you start the Sequencing Analysis program and any time you move the program to a different hard disk or partition Each installed Sequencing Analysis program must have a different registration code Every time the Sequencing Analysis software is started it searches the network for any other copy with the same registration code If another copy is found the program will not start Because of how the registration code is stored the Sequencing Analysis software will not run from a locked disk a CD ROM disc or a read only network volume Search Find Again To start Sequencing Analysis for the first time continued Step Action 10 Choose OK to save the registration information and close the dialog box When the Registration dialog box closes the Sample Manager window appears Fi Sample Manager Ej tare Paus
110. TTTGGRRC GGCGRRRRRC RRRTCRRGTT TRRRGGGRGC CGRGRRRGGR CRRGTGTRGC GCCGCTACAN GTRTRRCGHG S IT TRRRHNI Center column contains sequence data TTRTCCGCTC RRGCCTGGGG TCRCTGCCCG RRTCGGCCRR GTTTTTCTTT CTGGCCCTGR GGCGRRRRTC RRTCRRRRGR RRGRGTCCRC CGTCTRTCRG TTTTGGGGTC CCCCGRTTTR RGGGRRGRRR GGTCRCSTGC GGCGCGTRCT AG 8 1050 Left and right columns show the base positions at the beginning and end of each row Viewing and Editing Sample Files 6 9 Search Find Again Find Edit and n Sequence view you can Print 6 10 Viewing and Editing Sample Files Use the Find command to search for a base character a range of bases or a specified base pattern for details see Finding Patterns in Sequence View on page 6 23 Use any of the standard Macintosh commands to edit the sequence for details see Editing Bases in Sequence View on page 6 27 Print the contents of the window for details see Printing the Sample Window Views on page 6 31 Search Feature View Displaying About Feature View View and Print Find Again To display Feature view Command T or Click the button shown below The Feature view shows features that were added to the analyzed sequence data by the Factura software If the sequence data has not been processed in Factura this window is empty After processing in Factura the window displays the features list
111. acy with the ABI Basecallers is low especially when many insertions or deletions exist near the end of the run The gel ran too slow or too fast The Processing Parameters 5 45 Search The Adaptive Basecaller 5 46 The Processing Parameters Find Again The spacing value is a negative number The spacing value appears both in the Annotation view of the Sample window and on the electropherogram printout Note If length of read total number of bases is critical to your run try using the SemiAdaptive Basecaller Under some run conditions it is able to accurately read more bases than the other Basecallers with the potential loss of losing some basecalls at the beginning of the run Use the Adaptive Basecaller for data from any of the genetic analysis instruments This Basecaller dynamically measures both mobility shifts and spacing from the data for each sample It uses this information to calculate the data preprocessing before calling the bases Use the Adaptive Basecaller if You performed the run with nonstandard conditions such as a different gel type or speed The results from using the ABI Basecaller or the SemiAdaptive Basecaller are not satisfactory You experienced problems during the run Often the Adaptive Basecaller can correct problems that occurred during a run IMPORTANT Although each ABI Basecaller is tuned for a specific type of run depending on your run conditions you might get stronger
112. age C 5 print 3 47 regenerate with different values 3 20 resolution 3 5 Ge Index 5 Search Find Again reviewing 3 11 Gel Info button 3 10 Gel Info command A 4 Gel Info window edit information 3 12 reviewing and editing 3 12 Gel Preferences about preferences page 5 23 5 27 Gel Sample Sheet command A 4 GeneScan about program 1 15 Genotyper about program 1 15 Get Info window C 10 green checkbox in Sample Manager window 4 20 Grep search expressions 6 25 grey lane marker 3 9 H hardware and software requirements to run program 2 3 2 5 help on line 6 5 See Also technical support heterozygote defined Glossary 2 Hide Command Log command A 8 Hide ErrorLog command A 8 Hide Sample Manager command 8 Hide Tracker Lines command 4 Horizontal Expand button 3 10 Horizontal Shrink button 3 10 I incorrect files or chemistry D 29 initial base calling 5 43 Inst File field 3 14 Install New Gel Matrix command A 5 Install New Sample Sheet command A 5 Installer dialog box 2 7 installing a new Sample Sheet 3 15 3 16 new instrument file in gel file 3 21 3 22 Sequencing Analysis software 2 6 2 8 instrument genetic analysis defined Glossary 2 instrument file about D 8 about field 4 7 5 20 add or replace matrix 0 25 changing in Sample Manager window 5 20 contained in gel file when used 5 20 contents D 8 defined Glossary 2 install new 3 21 3 22 location B 2 making and editing D 1 D 33 making first matrix 0
113. al and vertical ruler display see Changing the Displayed Lines and Scales on page 6 41 Change the colors of the trace lines that represent the bases or hide one or more trace lines see Changing the Displayed Lines and Scales on page 6 41 Hold down the mouse button while the cursor is in the data area of the window to display cross hairs and the coordinates for the current cursor location Print the window contents for details see Printing the Sample Window Views on page 6 31 Viewing and Editing Sample Files 6 15 Search Raw Data View Displaying About Raw Data View Find Again To display Raw Data view Command U or Click the button shown below The Raw Data view shows the raw data for the sample before any processing is performed This is the first view you see if you open a sample file before the bases are called After bases are called you see Electropherogram view first when you open the file If the sample was run on a ABI PRISM 310 Genetic Analyzer this is the information collected by the data collection software If the sample was run on a 373 or 377 analysis instrument this is the data that the Sequencing Analysis software extracted from the gel file created during the instrument run Relative peak amplitude Scan signal intensity numbers a Example Sample i a 1008 2016 3024 4032 5040
114. ally prints the sample information after it analyzes the sample data Project Namea If the samples are extracted into the BioLIMS 2 0 Database this is the name of the collection that will contain them If a collection of that name does not exist in the database one is created See Editing or Adding Project Names on page 3 16 Project Comment Comment text associated with the BioLIMS 2 0 collection name specified in the Project Name field described above Search Find Again Components of the Sample Sheet continued Item Description Project Owner Collection Creator text associated with the BioLIMS 2 0 collection name specified in the Project Name field described above a Sequencing Analysis v 3 2 is not compatible with the BioLIMS system Reviewing the Sample Sheet To review edit and print the Sample Sheet Step Action 1 Click the Sample Sheet button near the top of the Gel File window EES or choose Gel Sample Sheet from the Gel menu The Sample Sheet window appears 2 Confirm that the information in the following fields is correct If necessary edit the Sample Sheet information instrument file sample names comments etc that is automatically transferred to the sample files 3 To edit the information in the Sample Sheet Double click in a text field and type in new text Use standard Edit menu commands Select
115. ames Check that the correct radio button for the correct chemistry type is selected Dye Primer Taq Terminator or T7 Sequenase Terminator Type or edit comment information in the Instrument and Comment text boxes 10 Choose Save to close the dialog box and save the instrument file in the ABI Folder in the System Folder Choose a descriptive name for the file Since instrument files are specific to instruments and chemistries use these to name the file E g 474 BigDye InstFile 11 Choose OK to start the matrix calculation The calculation takes about one minute When the matrix is complete the message Make matrix successfully completed appears If an error message appears and the matrix is not made see Correcting Errors in Matrix Creation on page D 28 12 Choose OK to close the Make Matrix dialog box or wait about 20 seconds for the dialog box to disappear 13 Repeat steps 2 12 for the Taq Terminator Matrix except that at steps 6 and 7 choose Update File instead of New File to open the instrument file that you saved in step 10 on page D 15 14 Repeat steps 2 12 for the T7 Terminator Matrix except that at steps 6 and 7 choose Update File instead of New File to open the instrument file that you saved in step 10 on page D 15 You should now see matrices in all three boxes 15 Quit the DataUtility program Creating Instrument Files D 15 S
116. ample Manager Window About Sample You can change many of the processing parameter values in the Manager Sample Manager window You can apply these changes to a single file Parameters Some of the files or all of the files in the window The following sections pages 5 3 to 5 20 describe each of the parameters in the Sample Manager window and discuss the various factors to consider before you select a new value For an explanation of how to select and change a parameter value for one or more files see Changing the Processing Parameter Values on page 4 14 The Sample The table below lists the parameters that are changed through the Manager Sample Manager Window Parameters Listed Parameters Set in the Sample Manager Window See Page The Sample File Name Parameter 5 3 The Sample Name Parameter 5 4 The A Parameter 5 5 The F Parameter 5 6 The P Parameter 5 7 The Basecaller Parameter 5 8 The Spacing Parameter 5 9 The Basecaller Settings Parameter 5 10 The Peak 1 Location Parameter 5 11 The Start Point Parameter 5 16 The Stop Point Parameter 5 17 The DyeSet Primer File Parameter 5 18 The Instrument File Parameter 5 20 5 2 The Processing Parameters Search Find Again The Sample File Name Parameter About the Sample This is the name of the file that contains the sample information This File Name Field name appears with the icon for the sample file when viewed in the Finder Chan
117. an can give you helpful information for reviewing the gel file 3 12 Working with the Gel File You can view and edit the contents of this window whenever the gel file is open in the Gel File window Changes you make in this window are stored in the gel file To view and edit the Gel Info Window Step Action 1 Click the Gel Info button i near the top of the Gel File window or select Gel Info from the Gel menu The Gel Info Window appears gel File Gel Info Run Information User Name 139115 Run Date Thu Dec 4 1997 Instrument 377XL Start Time 5 18 35 PM Data Coll Version 2 0 Run Duration 9 Hrs 9 Mins 48 Secs Total Scans 10624 Gel Characteristics Gel Type Number of Channels 194 Gel Percent 0 00 GeiThickness o 00 mm Number of Lanes 36 Well To Read Distance 12 0 Jom Number of Dyes 4 This gel has been multicomponented Gel Image Information Gel Image Range 0 10624 Multicomponented Yes Estimated Maximum Peak Height 1000 Matrix File dRhodLR Check that the gel has been multicomponented The Tracker application cannot track gels that have not been multicomponented The Gel Info window displays information about the run gel characteristics and the gel image This information is saved with each sample file generated from the gel file Not all the information in the g
118. andard Page Setup dialog box for your printer so you can select paper size and orientation screening options etc HP LaserJet Page Setup Paper US Letter w Layout T p v Reduce or Enlarge roo Orientation E Halftone Screens Default v The exact contents of the Page Setup dialog box depend on your printer Normally you should select your standard paper size and landscape orientation Choose OK to save the selected page setup to the Seq Analysis v3 2 Prefs file and close the Page Setup dialog box Note If your Sequencing Analysis prefs file is lost or discarded the print options dialog box appears when you start the Sequencing Analysis software Search Find Again IMPORTANT Each time the printer selection in the Apple Chooser window is changed you must open the Page Setup dialog box to reestablish the default selection Print Options Opens the standard Printer dialog box for your printer so you can Button select a default number of copies to print paper source etc When printing from the Sample Manager window the Sequencing Analysis software does not ask for printer information The software uses the values you select in this Printer dialog box If your Sequencing Analysis Prefs file is lost or discarded this dialog box will appear the next time you start the Sequencing Analysis software Printer DeskJet 1600CM 821 Copies I Pages amp All From To Cancer
119. anging the Processing Parameter Values Introduction Changing Parameter Values in the Sample Manager Window 4 14 Processing Sample Files Processing parameters are instructions and program settings that are used by the Sequencing Analysis software during file processing The parameter values that are used for each file are the values currently displayed in the Sample Manager window For example if the A checkbox is selected that file is analyzed base called during file processing If ABI CE2 is selected for the Basecaller parameter the base calling is done by the ABI CE2 Basecaller You can change some processing parameter values in the Preferences dialog box some in the Sample Manager window and some at either location For all parameters except Basecaller Settings the value entered in the Sample Manager window always overrides the value in the Preferences dialog box In the Sample Manager window you can change processing parameter values for individual sample files or for groups of files These changes affect only the files currently listed in the window This section explains how to change parameter values Chapter 5 The Processing Parameters explains how to decide which values are appropriate for your situation To Change a Parameter Value for One File Ifthe field has a checkbox click once in the checkbox to select or de select it Ifthe field has a pop up menu point to the pop up menu icon and pres
120. annot cut or paste 6 5 content locked 6 5 contents 6 2 Glossary 4 file size 2 5 troubleshooting C 3 incorrect printed format 12 input error C 6 location B 6 maximum open at once 6 3 move to new location 4 12 naming conventions 3 44 open 6 3 6 4 processing 4 1 4 21 processing overview 4 2 processing problems 4 20 reasons to reprocess 4 2 remove from window 4 12 truncated 5 viewing and editing 6 1 6 44 Sample Manager Defaults about preferences page 5 32 5 33 Sample Manager Script 5 Sample Manager window 4 3 4 21 add sample files 4 8 4 11 change values 4 14 4 15 font colors 4 7 meaning of special fonts 4 7 menus disabled C 9 move file to new location 4 12 moving around 4 16 open and close 4 3 open sample files 6 3 parts of 4 3 4 5 printing from 2 11 processing files 4 1 4 18 processing parameters 5 2 5 20 processing problems 4 20 remove sample files 4 12 scrolling and resizing 4 17 text colors 4 20 Sample Name about field 5 4 Index 10 changing 5 4 field in Sample Manager window 4 5 field on Sample Sheet 3 14 link to Sample Sheet 5 4 on printed electropherogram 6 36 Sample Sheet change the width of columns 3 15 edit 3 15 error when making changes 4 link to Sample Name field 5 4 print 3 15 review 3 13 Sample Sheet button 3 10 Sample window F and P checkboxes 4 20 4 21 about views 6 5 add files to Sample Manager 4 8 print views 6 31 See Also Annotation view Sequence vi
121. application Set processing parameters of sample files E 4 AppleScripting Search Sample Scripts The Scripts Process Gel Script Sample Manager Script Find Again Two sample scripts are provided with Sequencing Analysis software Process Gel Script Sample Manager Script At installation the Process Gel Script is placed in the Sample Scripts folder of the Sequencing Analysis folder This script Prompts you to select a gel file for processing Opens the gel file Tracks the gel Extracts the sequence information into sample files 9 9 Closes the gel file During Sequencing Analysis software installation this script is installed on your hard disk in the Sample Scripts folder inside the Sequencing Analysis folder During Sequencing Analysis software installation the Sample Manager Script is installed on your hard disk in the Sample Scripts folder inside the Sequencing Analysis folder This script Prompts the user for a folder of sample files to be analyzed First analyzes all the files with a certain Basecaller here the ABI100 Basecaller Then checks to see if the spacing value for each file is less than a specific value Uses a different Basecaller SemiAdaptive and reanalyzes the files if the spacing value is too low AppleScripting 5 E 6 AppleScripting Search Find Again License and Warranty Software License and Limited Product Warranty SOFTWARE LICENSE and
122. ark the position that represents the center of the lane You can manually adjust the placement of these lines if you are not satisfied with their location Description of This table describes the buttons on the Gel File window Buttons Program Feature Buttons on the Gel File Window Button Name Function wje v Colors Allow you to turn off the display of one or more colors in the gel image and Slice view Working with the Gel File 3 9 Search Find Again Program Feature Buttons on the Gel File Window continued Button Name Function Sample Sheet Allows you to display a copy of the data collection Sample Sheet associated with the gel file You can then use the Sample Sheet information to check that lanes are correctly labeled on the gel image For more information about the Sample Sheet see Reviewing the Sample Sheet Information on page 3 13 Gel Info Allows you to display the Gel Info i window which contains information about the run conditions when the gel file was created For more information about the Gel Info window see Review the Gel Info Window on page 3 12 Horizontal Compresses the gel image horizontally Shrink SO you can see all the gel lanes in a standard size window Horizontal Expands the gel image horizontally so Expand you can more easily adjust the tracker lines There are four levels of horizontal zoom 1X 2X 4X and 8X Verti
123. ary you can reposition these lines after auto tracking Note cancel the tracking process at any time press Command period and choose Cancel in the alert box that appears About Straight Line Tracking For straight line tracking the Sequencing Analysis software draws straight evenly spaced tracker lines on the gel while ignoring any data that is present The software applies straight line tracking the first time you open a gel file that has not been through automatic processing To change this tracking you can either manually adjust the tracker lines or choose the Track command from the Gel menu to have automatic tracking applied When you choose the Track and Extract Lanes command the Tracker application calculates tracker lines then extracts sample information from the tracked gel This command is useful if you expect that automatic tracking will be satisfactory and there will be no need to correct tracking errors IMPORTANT When you Track and Extract a gel file be sure the Sample Sheet associated with the gel file has the checkbox labeled Used selected for each sample you want to extract The Sequencing Analysis software only extracts data from used lanes Search Find Again Disk Space Check Before Extraction Before Sequencing Analysis begins extracting data from the gel file into sample files it checks that there is sufficient space on the local hard disk to contain the sample files If there is insufficie
124. ase peak the Peak 1 Location value The general appearance of this peak depends on whether you used dye primer or dye terminator chemistry If you used dye terminator chemistry to prepare your samples the raw data might show peaks between scan points that can be erroneously designated as the Peak 1 Location value by the software The correct Peak 1 Location value is at the beginning of the sample peaks The following figure shows the correct Peak 1 Location value at scan 889 for a sample prepared with Taq terminator chemistry LE Sample 21 T TT With the mouse cursor point to the beginning of the peak and hold the mouse button down to display locator lines Note the cursor position on the x axis this is the scan point number at the top of the vertical locator line This number is the Peak 1 Location value to use for analysis The Processing Parameters 5 15 Search Find Again The Start Point Parameter About the Start Point Changing the Start Point Making the Software Recalculate 5 16 The Processing Parameters The Start Point is the raw data point where you want base calling to start in the sample file The Start Point is normally the same as the beginning of the first base peak the Peak 1 Location value If any of the raw data immediately after the Peak 1 Location is clearly unusable or if you want to analyze only a portion
125. at approximately 100 bph 1200 scans hr The ABI PRISM 377 instrument runs at approximately 100 bph using the 2X run module including 48 cm wtr runs as defined for the data collection software in the ABI PRISM DNA Sequencer User s Manual The ABI 373 runs at approximately 100 bph when in BaseSprinter 373 18 mode You should not use this Basecaller with ABI PRISM 310 data 200 is optimized for 200 bph 2400 scans hr runs on the ABI PRISM 377 instrument using the 4X run module as defined for the data collection software in the AB PRISM DNA Sequencer User s Manual You should not use this Basecaller with ABI PRISM 310 data ABI50 is optimized for data collected using a 24 or 34 cm separation distance and Full Scan or XL Scan mode on the ABI 373 instrument It is the base calling method called Standard in previous versions of the Analysis software You should not use this Basecaller with ABI PRISM 310 data The ABI Basecallers differ from each other primarily in the shape of the internal spacing curves All of them use DyeSet Primer files stored in the ABI folder Use the SemiAdaptive Basecaller for data from any of the genetic analysis instruments This Basecaller dynamically measures spacing from the data Unlike the ABI Basecallers it does not use standard spacing curves It does however use the DyeSet Primer files stored in the ABI folder as do the ABI Basecallers Use the SemiAdaptive Basecaller when Accur
126. ata and ABI PRISM 310 raw data There are three virtual filter sets that are used with sequencing chemistry Be sure to choose the correct run modules and dye set primer mobility files for the chemistry used Raw Data Colors for Virtual Filter Set A Old Dye Primers Old Dye Terminators Color Base Dye Base Dye Blue C 5 FAM G R110 Green A JOE A R6G Yellow G TAMRA T TAMRA Red T ROX C ROX Raw Data Colors for Virtual Filter Set E dRhodamine Terminators BigDye Primers BigDye Terminators Color Base Dye Base Dye Base Dye Blue G dR110 C FAM dR110 G FAM dR110 Green A dR6G A FAM dR6G A FAM dR6G Yellow C dTAMRA G FAM dTAMRA T FAM dTAMRA Red T dROX T FAM dROX C FAM dROX D 4 Creating Instrument Files Search Find Again Color Guide for The following tables list the raw data display colors and dyes for the ABI 373 ABI 373 gel image and raw data 310 373 SA Raw Data Colors for Filter Set A BigDye Filter Wheel dRhodamine Terminators BigDye Primers BigDye Terminators Color Base Dye Base Dye Base Dye Blue G dR110 C FAM dR110 G FAM dR110 Green A dR6G A FAM dR6G A FAM dR6G Yellow C dTAMRA G FAM dTAMRA T FAM dTAMRA Red T dROX T FAM dROX C FAM dROX After Analysis The Sequencing Analysis program converts the information collected Color Guide by the data collection program so that after analysis the colors representing each base are consistent regardless of the chemistry used The colors on all display
127. ata looks OK In each file you should see one color trace with obvious peaks and all other color traces should be flat throughout the run A pattern of pronounced peaks or dips in any of the other three colors indicate that something is wrong If all the data looks OK go to To properly store the instrument file on page D 24 below If the data does not look OK pick a different range of raw data points and remake the matrix Be sure to use the raw data files that you backed up in step 5 on page D 11 An analyzed file cannot be used to make an instrument file See Important note on page D 10 Creating Instrument Files D 21 Search Find Again Making an Instrument File from a Sample File Introduction An instrument file can be made from matrix standards as explained Making the Instrument File from a Sample File D 22 Creating Instrument Files above or it can be made from a sample file This procedure requires fewer steps than running matrix standards however the matrix made from a sample file may not be as good as one made from matrix standards The quality of an instrument file made from a sample file depends on the quality of the sample file used The best samples to choose for making a matrix have approximately 25 each of A C G and T A good example of this is the pGEM DNA with the 21M13 primer that is included as a control in every Ready Reaction Sequencing Kit To create an instrumen
128. bout one third Note Only gels with 194 channels and 36 or fewer lanes can be saved in this way PICT File Saves the gel image as a PICT file The PICT file can be viewed on screen and printed using Simple Text or other Macintosh programs It cannot be opened by the Sequencing Analysis program This option typically creates a 300K file 3 46 Working with the Gel File Search Find Again Printing the Gel Image To Print a Gel You can print a gel image any time it is displayed on screen When you Image use this option the printed image matches what you see on the screen Step Action 1 If necessary open the gel file or make the Gel window active 2 If you want to check or modify the page size scale or orientation use the page Setup dialog box accessible from the File menu 3 Choose Print from the File menu Working with the Gel File 3 47 3 48 Working with the Gel File Search Find Again Processing Sample Files Overview In This Chapter About Base Calling This chapter explains how to set up batches of sequence data for processing and how to change the processing parameter values Note learn about each of the processing parameters in detail and how to select the best parameter values for your situation see Chapter 5 The Processing Parameters This chapter includes the following topics Topic See Page About the Sample Manag
129. but does not extract sample data This command is useful to view the results of auto tracking and if necessary to correct any tracking errors before the Sequencing Analysis software extracts the lanes and generates sample data It is also useful if you change your mind about the edited tracker information and wish to redraw the lines based on original tracking information If you have not saved the edited information you can also simply close the gel file To track the gel file Step Action 1 Choose Track Lanes from the Gel menu The Track Lanes dialog box appears Track Lanes A Proceeding with this command will over write current Lane Tracking Cancel Revert to Straight Tracking Ruto Track Lanes Working with the Gel File 3 37 Search Tracking the Gel and Extracting the Data 3 38 Working with the Gel File Find Again To track the gel file continued Step Action 2 Choose one of the three buttons Button Function Cancel Cancels the tracking operation Choose this if you do not want to lose the current tracking information Revert to Adds straight evenly spaced tracker lines to Straight the gel You can later cut and move these lines Tracking to follow the region of highest signal strength within the lane Auto Track Places a tracker line on the center of each Lanes used lane in the gel If necess
130. cal Shrink Returns the vertical scale to normal after you use the Vertical Expand button see below to expanded it e Vertical Expand Expands the gel image vertically so you can more easily adjust the tracker lines There are two levels of vertical zoom full scale and 600 scans Previous versions of the Sequencing Analysis software displayed at 350 scans in vertical expand mode Interpolation Mode Puts you into tracker line interpolation mode In this mode if you select two lanes by clicking the tick marks at the bottom of the gel image the tracker lines for the lanes between the selected lanes are interpolated from the tracker lines of the two selected lanes For more information see Interpolating Tracker Lines on page 3 34 3 10 Working with the Gel File Search Find Again Checking the Gel File Introduction Before you look at the lane markers and tracker lines you should Inspect the gel image see below Review the Gel Info window see Review the Gel Info Window on page 3 12 Check the information contained in the data collection software Sample Sheet see Reviewing the Sample Sheet Information on page 3 13 Inspecting the Gel An inspection of the gel image can give you a general measure of the Image quality of the run and its extracted sample data Your review of the gel image should include the following Inspect the general condition of the bands in
131. ce Feature Table Electropherogram Raw Electropherogram EPT Electropherogram O Allow for 5 hole punch Check the view s you want to print If you want to leave an extra wide left margin to allow for three hole punched paper select Allow for 3 hole punch Choose OK to close the Printing Options dialog box and open the standard Printer dialog box for your printer Viewing and Editing Sample Files 6 31 Search Find Again To print the contents of a displayed sample file continued Step Action 7 Make any required changes in the Printer dialog box then choose Print to start printing About the Page If you open the Page Setup dialog box when a Sample window is active Setup Dialog Box you see a special section at the bottom under the heading Electropherogram Settings These are the Page Setup special settings options which apply to all graphical data sequence raw and EPT that are printed from the Sample window These four options are described in the table below Portrait mode Landscape mode HP LaserJet Page Setup Paper Layout 1 Up v Reduce or Enlarge Orientation lectropherogram Settings Single Page Number of Panels per Page 5 Variable Size Number of Points per Panel 1500 Page Setup special setting options The Page Setup Special Settings Options Setting Descripti
132. ck the Sample File Name for the sample Toselect a consecutive range of samples Click the Sample File Name of the first sample in the group Hold down the Shift key and click the Sample File Name of the last sample in the group Toselect some samples and leave other discontinuous samples un selected hold down the Command key and click the Sample File Names for the samples you want to select To Select Entire Columns Click the title of the column Place the cursor over the vertical line to the right of the column title When the cursor symbol changes from k to H hold down the mouse button and drag the line to the right to widen the column or to the left to narrow the column width You can change the width of all columns except the Sample File Name column Some of the rows or columns may not be visible on the Sample Manager window To display additional information in the Sample Manager window do either of these things Use the size box in the bottom right corner of the Sample Manager to stretch the window Click on the vertical or horizontal scroll bar to see another part of the window contents Processing Sample Files 4 17 Search Find Again Processing the Sample Files Introduction Starting File Processing During Processing Pausing Processing 4 18 Processing Sample Files Once you start the processing operation the Sequencing Analysis software processes each of the sample files
133. componented Estimated The maximum signal level you expect from Maximum samples in the run This can be an Peak Height approximate number based on your typical run conditions and samples 3 Choose OK to close the dialog box and start regenerating the gel image You can use Command period to cancel the regeneration process at any time Installing New The data collection program copies the matrix information in the Matrix specified instrument file matrix file to the gel file during data collection Information The Sequencing Analysis software used this matrix information to generate the gel image It is also copies this information to each sample file for use during data analysis Installing a new matrix changes the appearance of the gel image If you install a new instrument file in the gel file change the instrument file in the Sample Sheet also to ensure that the extracted samples are analyzed with the new instrument file If the instrument file in the gel file and the Sample Sheet are different the Sample Sheet instrument file if present is applied when sample files are extracted If the Sample Sheet instrument file is missing from the ABI Folder the instrument file in the gel file is applied when sample files are extracted Working with the Gel File 3 21 Search 3 22 Working with the Gel File Find Again IMPORTANT There is no undo or cancel for the Install New Gel Matrix operation When the new matrix is i
134. cular color of line Print the window contents for details see Printing the Sample Window Views on page 6 31 6 18 Viewing and Editing Sample Files Search Find Again Reviewing the Analysis Results Introduction Reviewing the Error Log Reviewing the A F P Checkboxes Reviewing the Analyzed Data When sample file processing is finished you should review the results before you begin to work with the analyzed data If a problem occurred during processing the Error Log will be displayed in front of the other windows If the log is visible determine the source of the problem and take appropriate action Make the Error Log visible by choosing Show Error Log from the Window menu Review the A F and P checkboxes in the Sample Manager window for details see Checking for Processing Problems on page 4 20 If the Analysis checkbox for any file is red determine the source of the problem If necessary reanalyze the file A checkbox without color means that the processing step did not occur it does not indicate a problem The following review steps are recommended for each sample file Review the Spacing Values Review the spacing values in the Sample Manager window If a value is displayed in bold red text the Basecaller encountered a problem while calculating the value and was unable to resolve the problem Review the Files Used in Processing Review the files specified for use during processing If the
135. d Step Action 2 Use the checkboxes and text fields to create a parameter value set as explained in the table below You can set more than one endpoint condition The Basecaller will stop when any one of the conditions are met Item Description Basecaller The name for this value set Settings Set endpoint at PCR stop Sets the analysis endpoint at the end of the PCR fragment The software determines the endpoint by locating the large peak that is characteristic of the end of a short PCR fragment Use this only if you are sequencing short PCR products Note If there is noise after the PCR data this is considered as signal and the stop point is incorrectly calculated to be after the noise Set endpoint after bases Sets the analysis endpoint after a certain number of Ns occur within a certain number of bases for example after 5 Ns are detected within a range of 10 bases Set endpoint after Ns Sets the analysis endpoint after a certain number of Ns occur for example after 20 Ns are detected Set endpoint after bases Sets the analysis endpoint after a certain number of bases for example after 800 bases are detected Default Settings button Changes the values for the current value set to the default values all checkboxes de selected 5 30 The Processing Parameters Search Find Again To create and save a new set of Basecaller
136. data on one page on the screen you can only see one section of the data at a time Trace and Base For analyzed data Electropherogram view the four colors represent Colors the individual bases in the sequence The Default Colors for the Bases Base Color C Blue A Green G Blacka T Red a G is shown as yellow in AutoAssembler software Note For raw data the meaning of each color depends on the chemistry dyes and filter set physical or virtual For details see Colors in Real Time Data Display Windows on page D 3 The letters above the peaks are colored to represent the appropriate bases An N above a peak means that the software could not confirm that base or that there is more than one base at that position for example a heterozygote 6 34 Viewing and Editing Sample Files Search Find Again The Printer The header on the printed electropherogram contains information about Header the run and can be useful for troubleshooting The following figure and table explain the header contents Spacing used for this analysis spacing calculated by the Basecaller Instrument Model Sequencing Analysis version Basecaller name Basecaller version An P Sample file name Comment Sample name Lane number Model 3734 Version 3 PRISM erion Yersion 3 sample 04 sample 04 Lane 4 48 cm LR 4 0 gel 55 3 dG Page number Date and time of analysis Date and time of data collection Si
137. data using a different Basecaller Analyze your data with different Basecallers to determine which one works best for your run conditions If you reanalyze a sample file the previous analysis results are overwritten by the new results To avoid erasing the previous analysis results save a copy of the sample file under a different name before you do the second analysis Search Find Again Viewing and Editing Sample Files Overview In This Chapter This chapter explains how to view edit and print the analyzed sequence data in the six views of the Sample window This chapter includes the following topics Topic See Page Opening a Sample File in a Sample Window 6 3 The Six Sample Window Views 6 5 Annotation View 6 8 Sequence View 6 9 Feature View 6 11 Electropherogram View 6 12 Raw Data View 6 16 EPT View 6 18 Reviewing the Analysis Results 6 19 Determining the Value for a Data Point 6 21 Finding Patterns in Sequence View 6 23 Editing Analyzed Sequence Data 6 27 Showing Original Data in Electropherogram View 6 30 Printing the Sample Window Views 6 31 Viewing and Editing Sample Files 6 1 Search Find Again What Information Sample files contain the following information about the DNA sequence Do Sample Files 4 Contain Raw data as captured by the instrument before any post collection processing The first sequence called by the Basecaller program Any
138. dded to that window as part of automatic analysis the software matches the A checkbox setting in the window to the A checkbox setting in the sample sheet notto the setting in this dialog box When the A checkbox is selected in the Sample Manager window the software analyzes base calls the file as part of file processing If the Factura checkbox is selected the software selects the F checkbox for all files added to the Sample Manager window When the F checkbox is selected in the Sample Manager window the file is submitted to the Factura program for further processing after base calling and before printing If this checkbox is selected the Sequencing Analysis software selects the P checkbox in the Sample Manager window for each file that you add to the Sample Manager When files are added to the window as part of automatic analysis the software matches the P checkbox setting in the window to the P checkbox setting in the sample sheet not to the setting in this dialog box When the P checkbox is selected in the Sample Manager window the file is printed after all other requested processing is finished The Processing Parameters 5 33 Search Find Again Printing Preferences About the This page allows you to choose Printing arrangement of the information on the page Preferences Page appearance of the data on the page size and other standard page setup options many copies are print
139. de the log and the Error Log window appears In the Error Log window the newest entry is at the top of the list Note You cannot select multiple lines or edit the Error Log Search Find Again Printing the Error To print a copy of the Error Log Log Step Action 1 Choose Print from the File menu while the Error Log window is active 2 In the Printer dialog box either select All to print all the log pages or type in the page numbers for the range of pages you want to print Note Because the most recent entry is at the top of the log file most often it is enough to print only the first one or two pages of the file 3 Choose Print Troubleshooting 15 Search Find Again Reviewing the Sequencing Analysis Command Log Introduction The Command Log lists all commands performed by the Sequencing C 16 Troubleshooting Analysis software either as requested directly or in the course of analysis The newest command appears at the top of the list This log can be very useful during troubleshooting It also can help you remember where you stopped if you are interrupted while using the software Where Is the Command Log File The Command Log is maintained in a file called Seq Analysis Command File which resides in the ABI Folder in the Macintosh System Folder If this file is removed from the ABI Folder a new command file is created automatically when the Sequencing Analysis applicat
140. duction The following table describes the input files that are not located in the System Folder The locations shown are the system defaults You can change the locations of ABI PRISM 310 and ABI PnisM 377 files and specify the new locations of these in the Preferences Folder Locations dialog box in the Data Collection software Input Files External to the System Folder The following table lists the input files for Sequencing Analysis software that are not stored in the System Folder Necessary Input Files That Are External to the System Folder File Type Folder Location Description Program files Sequencing Sequencing Analysis 3 2 folder Provide the primary input that analyzes data The Sequencing Analysis program analyzes the data sent from the ABI PRISM instrument after the run is complete Es The Basecaller and Tracker are opened automatically by the Sequencing Analysis program as needed you ataUtility specify which to use The DataUtility allows you to make and copy matrices IMPORTANT Do not move or rename these files Gel file from Sequencing A large file created by the Data Collection program The ABI 373 instrument Analysis 3 2 folder The gel file from Individual Run gel file contains all of the original raw data from all channels of the gel For a typical run a gel file can be very large 20 90 MB ABI PRISM 377 folder inside the instrument Runs folder inside the
141. during the most recent file analysis Select from the pop up menu to change the Basecaller Spacing The average number of data points between peaks This is defined by the Basecaller program during analysis You can type in a new value to change the Spacing Basecaller Settings The user created set of rules and values that is used by the Basecaller program to decide the endpoint for file analysis Select a different rule set from the pop up menu or define a new rule set in the Basecaller Settings page of the Preferences dialog box Peak 1 Location The scan number that marks the beginning of the first real base peak in the file This is defined by the Basecaller during analysis You can type in a new value to change the Peak 1 Location Start Point The point in the sample file at which the Basecaller program starts analyzing data You can type in a new value to change the Start Point The number you enter must be equal to or greater than the Peak 1 Location value The number must be the scan number not the base number for the point where you want analysis to start Stop Point The point in the file at which the Basecaller program stops analyzing data This is controlled by the values selected for the Basecaller Settings You can type in a new value to change the Stop Point The number must be the scan number not the base number for the point where you want analysis to stop DyeSet Primer file The
142. e ance files Remove Open File Status Sample File Name Basecaller Settings The Sample Manager window is used to specify which sample files to process and the parameter values to be used during processing For now you can ignore this window while you view and adjust the program preference settings as described in the Selecting Processing Preferences section Getting Started 2 15 Search Find Again Selecting Processing Preferences Introduction The Preferences When in Doubt Use Default Values 2 16 Getting Started You can select preferred values for most of the processing parameters used by the Sequencing Analysis software These values will be used for all fully automated operations for example when you process a batch of samples overnight When you perform manual operations for example when you re analyze selected files with the Sequencing Analysis software you can either use the existing preference values select new preference values or select temporary values for individual files These preferences are grouped into categories on the pages of the Preferences dialog box Gel Preferences 377 and 373 only Basecaller Settings Sample Manager Defaults Printing Preferences Sequence File Formats Factura Preferences 9 9 9 9 9 Base Letters Style The default preference values are those most commonly used by PE Applied Biosystems customers If you are a new use
143. e Gel File Find Again For example if SAMPLEO1 1 SAMPLE01 2 and SAMPLE01 3 exist and you discard SAMPLE01 2 the Sequencing Analysis software names the next file SAMPLE01 2 not SAMPLEO 1 4 Each time you change the tracker line positioning in a lane or the information in the Sample Sheet you must extract the sample data again to incorporate the new information into the sample files Normally you do this with the Extract Lanes command Disk Space Check Before Extraction Before Sequencing Analysis begins extracting data from the gel file into sample files it checks that there is sufficient space on the local hard disk to contain the sample files To extract the sample data Step Action 1 Choose Extract Lanes Command L from the Gel menu The Extract Lanes dialog box appears Extract Lanes Lane Extraction Extract From Q All Used Lanes Lanes marked for Extraction white markers amp Over Wwrite Original Sample Files Sample File Analysis amp Auto Analyze New Sample Files e Analyze All Files Lir rint Results Use Sample Sheet Settings Save Gel after Extraction tance Search Find Again To extract the sample data continued Step Action 2 Select the settings you want to use for this operation Setting Description All Used Generates a new sample data for every lane Lanes marked Used Lanes marked for Ext
144. e Sample window To change views click the button for the view you want to see Summary of Sample Window Views Button View Short cut Description Annotation Command E Summary sample information entered in the data collection program and additional information entered by the data collection and Sequencing Analysis programs See page 6 8 Sequence Command R The nucleotide base sequence text called for the data The Sequencing Analysis software displays an empty window if base calling has not yet occurred Edit the sequence after analysis in either this view or in the Electropherogram view See page 6 9 fh Feature Command T The features that were found in the sequence Features are added to the analyzed sequence data by the Factura software which is used for further processing of the data If features are visible the sequence has been processed by Factura If no features are available the Sequencing Analysis software displays an empty window See page 6 11 m Electro pherogram Command Y A four color picture of analyzed data with peaks representing the bases It is the default view that appears when an analyzed sequence opens This view is available only after base calling is done See page 6 12 laf Raw Data Command U The raw data collected by the instrument This is the default view if base calling has not been done See page
145. e name Copy 3 Creating Instrument Files 23 Search Find Again Storing and Backing Up the Instrument File Introduction The instrument file must be placed in the ABI Folder in the System Folder and obsolete instrument files should be deleted or archived The new instrument file should be backed up Follow the steps in the table below after creating and verifying a new instrument file Storing the properly store the instrument file Instrument File D 24 Creating Instrument Files Step Action 1 Use the Finder to make sure the new instrument file is stored in the ABI Folder inside the System Folder If you saved the file to a different location drag it to the ABI folder now To be used by the Sequencing Analysis program the instrument file must be in the ABI folder Clean up the ABI folder by deleting any invalid instrument files Put a backup copy of the instrument file on a server or a disk and put the disk in a safe location It s a good idea to put the raw sample files for the standards in the same place Follow the instructions in the next section Adding or Replacing a Matrix in an Existing Instrument File to add the other two matrices to the new instrument file Search Find Again Adding or Replacing a Matrix in an Existing Instrument File Introduction Use the procedure described below to Add a matrix to an incomplete instrument file Replace an e
146. e numbers change as you move the cursor over the image Lanes Used The number of lanes marked as used in the Sample Sheet Lane numbers The numbers across the top of the gel image that show the lane number currently assigned to each lane on the gel 3 8 Working with the Gel File Search Find Again Parts of the Gel File Window continued Item Description Lane markers The diamond shaped markers that show the current status of each lane Item Description White Lane is marked for extraction Blue Lane is not marked for extraction Yellow Lane was edited and extracted but the gel file was not saved with the new information Gray Lane is not marked Used in the Sample Sheet The Tracker software does not expect to find a lane here if it does it will confuse it and lane assignment confidence will be low Orange Lane was inferred by the Tracker border software If you move or reshape an inferred lane tracker line it ceases to be inferred and the orange border is lost Note If the Save Gel After Extraction option is selected the white and yellow lane markers revert to blue after you generate new sample data Vertical scale The scale between the gel image and the Slice view Scan numbers which shows the scan number at each location on the gel image and the Slice view Tracker lines Lines that the Tracker application draws on the gel image to m
147. e side summary graphic horizontal line displayed near the top of the Sample window It is used to show the location of features and the currently selected section of the sequence Glossary 4 Search Find Again tracker line line drawn on a gel display to track the migration of the DNA sample through the gel matrix during electrophoresis You can edit the tracker line to correct for migration problems You can also specify the number of channels on either side of the tracker line to be used when creating an averaged data value views Various displays provided in the Sample window For information about the Sample window views see The Six Sample Window Views on page 6 5 WTR well to read See separation distance Glossary 5 Glossary 6 Search Find Again Index Symbols field 3 14 Numerics 108 error C 5 310 instrument See ABI Prism 310 Genetic Analyzer 310 Only button 2 13 373 instrument See ABI 373 DNA Sequencer 377 instrument See ABI Prism 377 DNA Sequencer 37x button 2 13 3 hole punch paper printing on 6 31 96 Lane Upgrade 1 6 A A checkbox 4 5 4 12 about 5 5 box colors 4 20 in Sample Sheet 3 14 review 6 19 selected 5 33 ABI 373 DNA Sequencer about 1 8 data collection program D 3 See Also ABI 373 ABI file format 5 38 ABI Folder about B 2 ABI instruments overview D 2 ABI Prism 310 Genetic Analyzer about 1 8 data collection program D 3 See Also ABI Prism 310 ABI Prism 377 DNA
148. e the value again or temporarily override that value for selected files in the Sample Manager window Note Changes that you make in the Preferences dialog box affect only files that you add to the Sample Manager window after you make the change Files that are already listed in the window are not affected For how to change parameter values in the Preferences dialog box and how to decide which values that are appropriate for your situation see Chapter 5 The Processing Parameters Processing Sample Files 4 15 Search Find Again Navigating the Sample Manager Window Introduction The Sequencing Analysis software includes an assortment of keyboard shortcuts to enable you to easily move around and make changes in the Sample Manager window Place cursor on a column dividing Click the column title to line then drag the line right or left to select the entire column widen or narrow the column Sample Manager Pause Cancel tad files Remove open ites Sample Name A F P Basecaller Spacing Basecaller Settings test test2 test3 test4 testS test test testa test test10 test test12 test13 testi4 SemiAdaptive Default Settings Default Settings Default Settings Default Settings Default Settings Default Settings Default Settings Default Settings Default Settings Default Settings Default Settings Default Settings Default Settings Default Settings Default Setti
149. e truncated gel file and sample files less scan points than a normal run Choose the Regenerate Gel Image command from the Sequencing Analysis Gel menu Error 2700 Could not do this task because the tracking process failed Runtime error Couldn t open file Tracker settings file missing from the SAGelTracker folder Find the setting file check its name and that it is in the SAGelTracker folder See list of settings files on page B 5 If settings file is correct it could be that the gel is too difficult for the Tracker application Track the gel manually See Adjusting Lane Markers and Tracker Lines on page 3 23 Error 10023 TDGetBuff Tag not found Gel image present no tracker lines or lane markers Gel file is present and correct size no analyzed data Choose the Regenerate Gel Image command from the Sequencing Analysis Gel menu If this doesn t recover the file the instrument file may be corrupted re install it from backup Or the instrument file may be incomplete and need to be remade see Running Standards and Viewing Raw Sample Files on page D 10 Error 10024 TDGetBuf DATA error Tag not found TDPutBuf Bad Data Size Cannot process file data length less than 50 Possibly none gel file of the correct size Sample files created 2K 6K in size no raw or analyzed data Choose the Regenerate Gel Image command from the Sequencing Analysis Gel menu
150. e within a few channels to either side Note Lane markers are aligned with their respective lanes at the top of the gel image If the gel contains lanes which drift the drifted portion of the lane may seem to be incorrectly aligned with its lane marker when viewed in zoomed in mode If you drag a lane marker across another marker all the affected markers are renumbered accordingly For example if you drag the 36 marker in the preceding illustration to the real lane 25 lanes 25 36 all become correctly marked as shown in the figure below Note If the Sequencing Analysis software missed the first lane in the gel and put all the lane markers one position too far right you can drag the right most lane marker to the left most lane the missed lane to label all the lanes correctly Lane 25 now has a marker 22 25 28 A P Lane 36 marker is now above right most QUUQUUUQQUUUUUQU lane of gel To move multiple lane markers at once a Shift click to select the lane markers you want to move b Drag the markers to the correct location Working with the Gel File 3 25 Search Find Again To rearrange the lane markers continued Step Action 5 Sometimes the Tracker detects noise in the gel and tracks that noise as one or more extra lanes In particular this may occur on the left side of the gel leaving lanes on the right side of the gel without tracker lines
151. earch Find Again A Worksheet for Instrument File Matrices This Worksheet Make All These Matrices Setting Start Points and Number of Points D 16 Creating Instrument Files You may want to photocopy and enlarge the worksheet on page D 17 and use it to help you keep track of which standards sample file should be assigned to which base letter in which matrix in the DataUtility program If you are making an instrument file for the dRhodamine or BigDye sequencing you need only run four matrix standards But you should make all three matrices Leaving one blank even if you think that you do not need that chemistry can cause software and analysis problems If you are making an instrument file for Old Dye Primer and Old Dye Terminator sequencing i e pre dRhodamine and BigDye chemistries you may need to run eight standards four to make the primer matrix and another four for the terminator matrices You may leave the T7 Terminator matrix blank For each matrix do the following Choose start and end points for the data Step Action 1 Open all the sample files for the standards in a Sample window in the Sequencing Analysis application 2 For each sample file identify a start point where there are no peaks and where the baseline is flat beyond the primer peak or first large peaks that appear You may want to note down this start point in the worksheet below Each of the four standards can have diff
152. ed and other standard print options What will be printed when printing from the Sample Manager window m Preferences Page Printing Preferences hd Panels per Page 5 Page Setup Options Points Per Panel 1500 Print Options D PostScript Printer oO Use dot dash format Print First Page Only Print These Annotation amp Electropherogram Sequence Raw Data CO Feature Table Data The Printing Preferences parameters discussed in detail below 5 34 The Processing Parameters Search Find Again Panels Per Page The number of panels to print on each page of graphical Text Box Electropherogram Raw Data views The default is five panels A sample print out with five panels is shown below 81200 M13 done RBIPBICH F5 Taq Matrix 4 15 92 MTAX 001 Modal 373A HEP 204 Signal C223 4 106 G 77 84 Page 1 of ane Version 3 1 DL24 1 21 DysPrimer 21m13 Fri Aug 29 1997 955 PR Version 1 2 0a8 Lane 21 Spacing 12 56 GAGTCAAA CACACTOGATCCTT G CT GCTTT GTT ACAAC CAT GCAAC T AACACAGCGGTA AT T TC AT TATA AT TT TA GA TAA AT TTC GAACA A o 20 30 40 50 60 70 80 90 100 one panel Points Per Panel The number of data points in each panel The default is 1500 data Text Box points per panel If you decrease the number of data points per panel the peaks are broader
153. ed as unsuccessful you should then examine and delete the remaining files in the Sequencing Analysis folder yourself Files installed in the system folder are not removed a Open the Installer Log File step 10 on page 2 8 and note the files that were installed in the System Folder b Delete these files from the System Folder Getting Started 2 9 Search Find Again Setting Up the Sequencing Analysis Program Introduction Before You Begin Starting the Program for the First Time 2 10 Getting Started After you install the Sequencing Analysis software you can set up the program for your site Setting up includes the following operations Starting the Sequencing Analysis program for the first time and entering the requested information See below Selecting Program Preference settings that are suitable for your site See Selecting Processing Preferences on page 2 16 Sequencing Analysis software is easier to use if you make the following adjustment Choose Control Panels from the Apple menu then choose General Controls In the Documents box select Last folder used in the Application When you start the Sequencing Analysis program the first time follow this procedure To start Sequencing Analysis for the first time Step Action 1 Before opening the Sequencing Analysis application for the first time a Open the Chooser b Selectthe printer you expect to use for Sequencing
154. el The filters used in set A are 531 560 580 and 610 nm Use set A with the Old Dye Primers and Old Dye Terminators The filters used in set B are 531 545 560 and 580 nm Use Filter Set B for GeneScan applications that use different dyes Sequenase T7 terminator chemistry is now obsolete Search Find Again The table below summarizes the relationship between the filters and dyes for the individual sequencing reaction chemistries Five Filter Wheel Filter Center Old Dye Band nm Old Dye Primers Terminators 531 C Rxn ddG 545 ES 560 A Rxn ddA 580 G Rxn ddT 610 T Rxn ddC IMPORTANT You cannot use both filter sets on a single 373 run Instruments with If you want to use dichlororhodamine dRhodamine based sequencing the BigDye Filter chemistries exclusively you can have the BigDye filter wheel installed Wheel On your ABI 373 instrument BigDye Filter Wheel Filter Center dRhodamine BigDye Band nm Terminators BigDye Primers Terminators 540 ddG C Rxn ddG 570 ddA ddA 595 ddC G Rxn ddT 625 ddT T Rxn ddC IMPORTANT Once you have installed the BigDye filter wheel these three chemistries dRhodamine Terminators BigDye Primers BigDye Terminators are the only ones that you can use Creating Instrument Files D 7 Search Find Again The Instrument File Correction for Spectral Overlap What Does the Instrument File Contain When to Make a New Instrument File D 8 Creating Ins
155. el file window can be edited Some information such as the date of the run cannot be changed To edit information in the Gel Info window click on any text field that is surrounded by a black rectangle Then type in the new information To close the window click the close box at the top left corner of the window Search Reviewing the Sample Sheet Information Find Again The Sample Sheet contains the run information that you recorded in the data collection program before you started the run Information entered in the Sample Sheet is extracted into the sample file and used by the base calling algorithms to create the analyzed sample data In the Gel File window only tracker lines for the sample lanes marked as used are displayed A copy of the Sample Sheet for the run is embedded in the gel file during data collection You can view edit and print this Sample Sheet copy whenever the gel file is open in the Gel File window Changes you make in this copy are stored in the gel file they do not affect the original Sample Sheet file IMPORTANT If you change the Sample Sheet after extracting the sample information from the gel file you must re extract the sample data to include the new information in the sample files Be sure the Used checkbox is selected for each sample you wish to extract Information is only extracted for samples that have the Used checkbox selected Note Changes to the Sample Sheet only affect ex
156. el of noise in the sample due to low template concentrations fluorescent contaminants secondary priming two primers or poor priming which gives rise to weak signal Short PCR fragments where less than 3000 data points of actual sequence are present Basecaller Default Spacing When the Basecaller cannot accurately measure the peak spacing in a sample it assumes a default spacing value and examines the data based on that value For example when the ABI100 Basecaller cannot accurately measure the spacing it assumes the spacing is 9 00 corrects the data based on a spacing of 9 00 and enters 9 0 in the Sample Manager window in Annotation view of the Sample window and in the header information of the printed analyzed chromatogram Search Find Again The default spacing values for ABI Basecallers are shown below Basecaller Default Spacing ABI50 ABI100 ABI200 SemiAdaptive Adaptive 9 00 ABI CE1 ABI CE2 12 00 Troubleshooting 19 C 20 Troubleshooting Search Find Again Creating Instrument Files Overview Introduction In This Appendix This appendix describes how to create and change instrument files Instrument files contain matrix information specific to each filter set and chemistry This appendix includes the following topics Topic See Page Summary of the Instruments and Chemistries D 2 Colors in Real Time Data Display Windows D 3
157. elow The contents of the window and the available menu choices depend on the view selected Note see the on line help for these windows choose Show Balloons from the Balloon menu near the right end of the main menu bar Summary graphic EB Example Sample Lock image Window Contents area Buttons used Ea od 5 to change the displayed view When the lock image appears closed locked the sample file is protected from edits you cannot cut from or paste to the sample file using the Edit menu To open or close the lock click on the lock image Immediately below the window name and to the right of the Lock Image is a horizontal line inside a frame This line represents the length of the sequence The larger tick mark shows the cursor position as you move it to different places in the sequence The smaller tick marks if present show the location of color marked features in the sequence The Viewing and Editing Sample Files 6 5 Search Window Contents Area Find Again arrowhead at either the right or left end of the line indicates the orientation of the sequence If you select an area of the sequence in Sequence view that area is shown as a rectangle on the Summary graphic in all views E The main portion of the Sample window contains the information pertaining to the sequence You can display six different data views in th
158. ents Three Sequencing The Sequencing Analysis software described in this manual can be Instruments used to analyze raw sequencing data collected from the three instruments described in the table below Margin Notation 373 377 1 8 About This User s Manual Name This instrument ABI PRISM 310 Genetic Analyzer analyzes one sample at a time using capillary electrophoresis technology This instrument provides high resolution for short fragments and uses a minimal amount of sample ABI 373 DNA Sequencer including XL performs slab gel electrophoresis allowing the user to analyze multiple samples on a gel ABI PRISM 377 DNA Sequencer including XL and 96 Lane Upgrades is a high throughput slab gel electrophoresis instrument created to meet the needs of high volume DNA sequencing or genetic analysis laboratories Throughput is more than four times that of the ABI 373 Although most of the information in this manual applies to all three instruments certain parts apply to only one or two of the instruments Throughout the manual a notation appears in the left margin when the text applies to only one or two instruments The instrument or instruments to which the text does not apply are crossed out gt lt The notation that appears here to the left would indicate that the text applies to the ABI 373 and ABI PRISM 377 instruments but not to the ABI PRISM 310 instrument
159. equencing Analysis program using the pulldown menus Step Action 1 Choose Open Sample or Command O from the Sequencing Analysis program File menu 2 Locate and select the desired sample file in the directory dialog box that appears Then choose Open To Open One Sample File There are three ways to open a single sample file from the Sample Manager window Double click the Sample File Name for the file Click once on the file name then click the Open Files button Click once on the file name then choose Open Files from the Manager menu Viewing and Editing Sample Files 6 3 Search Find Again To Open Multiple Sample Files Step Action 1 Hold down the Command key while you click the Sample File Names of the files you want to open 2 Click the Open Files button at the top of the window Or choose Open Files from the Manager menu The Sequencing Analysis software displays the Sample window for as many of the selected files as memory allows You can choose any of the six views for each file 6 4 Viewing and Editing Sample Files Search Find Again The Six Sample Window Views Introduction Common Features in Views Lock Image Summary Graphic The Sample window is used to view or edit the sequence data There are six different views available in the Sample window Certain features of the Sample window are available in all six window views as shown b
160. er Window 4 3 Adding Sample Files to the Sample Manager Window 4 8 Moving and Removing Sample Files from the Sample Manager 4 12 Window Changing the Processing Parameter Values 4 14 Navigating the Sample Manager Window 4 16 Sample file analysis base calling is the primary activity of the Sequencing Analysis software During base calling the software identifies each base in the sample and the order in which the bases are arranged The software also marks locations where there is some question about the base identification as when two bases seem to occur at the same position This allows you to determine whether the ambiguity is caused by uneven base migration a heterozygote condition or some other irregularity Processing Sample Files 4 1 Search Factura Processing and Printing Overview of Sample File Processing Reasons to Reprocess Files After Automatic Processing 4 2 Processing Sample Files Find Again The Sequencing Analysis software can also manage further processing of files by the Factura Feature Identification Software and the printing of all processing results All this is done from the Sequencing Analysis Sample Manager window To process one or more sample files Add the files to the Sample Manager window See Adding Sample Files to the Sample Manager Window on page 4 8 If necessary change the processing parameter values See Changing the Processing Parameter Values on page 4 14
161. er or another descriptive name so this file is not confused with any other instrument file Then choose Save IMPORTANT The only permissible characters for instrument file names are alphanumeric characters the period the dash and the comma Choose OK to start the copy matrix procedure Follow the steps under Inspect the Matrices Using the DataUtility Program on page D 19 to view the destination file and verify that the matrices were successfully copied Creating Instrument Files 0 33 D 34 Creating Instrument Files Search Find Again AppleScripting Introduction This appendix contains Alistofthe AppleScript commands that are supported by the Sequencing Analysis program Some sample scripts About AppleScript AppleScript is a simple programming language a scripting language that is part of the Macintosh Operating System Using AppleScript you can automate many routine tasks For example you might write a five to ten line script that would take a folder full of sample files add the files to the Sample Manager turn on the checkboxes for analysis and printing and start processing For more information about how to create and use AppleScript scripts see the Applescript Language Guide by Apple Computer Inc or other similar books In This Appendix This appendix includes the following topics Topic See Page Commands Objects and Events E 3 Sample Scripts E 5
162. erent start and stop points but the number of points used for each sample must be the same 3 Select a number of data points to analyze such that no peaks in the range are off scale above 4000 relative fluorescence units rfu and that the baseline at the end of the range is flat A typical number of data points is 1500 You may want to note down the number of data points in the worksheet below 4 Calculate the stop point for each standard and verify that the baseline at the stop point is flat Search Find Again The Worksheet You may wish to photocopy and fill in this worksheet before starting the procedure Making an Instrument File with the DataUtility Program on page D 13 Data for Dye Primer Matrix Sample File Number of Name Start Point Points Stop Point C matrix A matrix G matrix T matrix a Number Points Stop Point Start Point Every number in this column must be the same Data for Taq Terminator Matrix Sample File Number of Name Start Point Points Stop Point C matrix A matrix G matrix T matrix a Number Points Stop Point Start Point Every number in this column must be the same Data for T7 Terminator Matrix Sample File Number of Name Start Point Stop Point C matrix A matrix G matrix T matrix a Number
163. erminator and one for the T7 Terminator Matrix Specify the sample file to be used for each standard Refer to tables on page D 13 a Click the C button b Inthe directory dialog box that appears select the file that contains the data from the C standard then choose Open c Repeat this selection process with for the A G and T standards In each Start at text box either accept the default value or type the correct start point value for that standard Note defaults of 2000 for start point and 1500 for data points is almost always appropriate However if your first attempt at matrix making fails or if you want to reduce the chance of initial failure you should follow the procedure on page D 16 that describes how to set Start and Stop Points Search Find Again To make the instrument file continued Step Action 5 In the Points text box either accept the default value or type the number of data points to be used for the matrix See Note above Choose the New File button In the Save dialog box that appears type a name for this new instrument file Use the instrument s serial number e g 474 instrument file or another descriptive name so this file is not confused with files for other instruments or chemistries IMPORTANT Only alpha numeric characters the period the dash and the comma are permissible characters for instrument file n
164. ew Feature view Electropherogram Raw Data view EPT view Save As command 2 Save command 2 Save Gel after Extraction 3 43 Save this set as button 5 31 scale in Sample window changing 6 41 scan number 3 7 defined Glossary 4 maximum new in v 3 2 1 7 raw vs analyzed 1 7 Scan window D 3 scroll bars 4 5 not visible 5 search expressions 6 25 for bases in a sequence 6 23 Select All command A 3 selecting bases in electropherogram view 6 20 SemiAdaptive Basecaller 5 45 separation distance defined Glossary 4 Seq Analysis v3 2 Prefs file 2 16 Seg files 5 38 defined Glossary 4 formats 1 13 Search Find Again location B 6 sequence add baseto 6 27 change bases 6 28 defined Glossary 4 edit in Electropherogram view 6 28 edit in Sequence view 6 27 find in Electropherogram view 6 13 only first portion called 8 Sequence File Formats about preferences page 5 38 Sequence Manager window processing files 4 1 Sequence Navigator about program 1 14 Sequence view about 6 9 See Also Sample window switch to 6 9 updated to match Electropherogram view 6 29 Sequence View button A 9 Sequencing Analysis About file 2 7 Command Log C 16 disk space recommended 2 5 disk space required 2 4 Error Log C 14 hardware and software requirements 2 3 installing software 2 6 2 8 program disabled C 9 program file location B 4 program files described B 4 registration number 2 2 removing installed software 2 9 setup 2 10 start program
165. files into other programs select the appropriate sequence file format for that software 5 38 The Processing Parameters Search Find Again Factura Preferences About the Factura This page allows you to specify the Factura application and settings file Preferences Page used when automatic Factura Feature Identification processing is selected for a sample file m Preferences Page Factura Preferences v Factura Preferences Factura Application PE ABD Factura Factura 2 0 Y Factura Settings File PE ABD Factura Factura Settings _ Y Factura Specifies the version of the Factura program to be used for further Application sample processing If you do not want to use the Factura program Factura Settings File select none from the pop up menu The Factura program is used to further process sequence files produced by PE Applied Biosystems instruments Raw DNA sequences often contain vector sequence and ambiguously called bases at both ends that you should remove prior to assembly or final analysis This program allows you to clean up sequence files by identifying designated vectors and ambiguous regions and flagging these features in the sequence file Assembly and analysis applications can then disregard these ambiguous regions using only the target DNA data Specifies the Factura settings file to use for processing when the F checkbox is selected If you do not want automa
166. for both data collection and analysis Sequencing Analysis v 3 2 only runs on a PowerPC CPU If you want to use Sequencing Analysis v 3 2 to analyze gel files collected on a ABI 373 instrument you must transfer the gel files from the ABI 373 instrument Macintosh to a Power Macintosh where Sequencing Analysis v 3 2 software is installed Each ABI PRISM genetic analysis instrument is shipped with a Macintosh computer If you received this software with a newly purchased ABI PRISM genetic analysis instrument the Sequencing Analysis software is installed by your PE Applied Biosystems Customer Support Engineer as part of the installation and setup of the instrument The system requirements for that computer are described in the instrument manual If you are replacing an earlier version of the Sequencing Analysis software or if you are using this software for the first time your computer MUST meet our minimum requirements to run the new Sequencing Analysis software Our state of the art software requires a PowerPC CPU and at least 32 MB of physical RAM to achieve proper performance If you are unable to meet these requirements you will not be able to use this software Getting Started 2 3 Search System Requirements and Recommendations 2 4 Getting Started Find Again Below are the system requirements and recommendations for running the Sequencing Analysis v 3 2 on your instrument or analysis computer Note These are the m
167. for your situation To change a preference value Step Action 1 Highlight the Preferences command on the Edit menu to open the Preferences submenu then select one of the commands from the Preferences submenu The Preferences dialog box appears It displays the current value s for the Preferences item that you selected This is one page of Preferences that you can view and change in this dialog box 2 Use the checkboxes text fields and pop up menus in the dialog box to change the preference value s For an explanation of each Preferences page see the following sections of this chapter 3 After you make any required changes on the page either select a different page from the Page pop up menu at the top of the dialog box or choose OK to close the dialog box The changes take effect as soon as you close the dialog box Search Gel Preferences About the Gel Preferences Page 373 377 Multicomponent Gel Image Find Again The Sequencing Analysis software uses the values on this page when it tracks and extracts information from ABI 373 and ABI PRISM 377 gel files Preferences Page Gel Preferences Image Generation Defaults Multicomponent Gel Image Estimated Maximum Peak Height 1000 Lane Extraction Use s Channel Averaging Use Weighted Averaging Stop extraction when below confidence threshold Confidence Threshold 70
168. g Instrument Files Search Find Again Verifying the Instrument File Introduction There are two procedures to check the instrument file Inspect the Matrices Using the DataUtility Program Inspect the instrument file using the DataUtility program page D 19 View and verify the matrix standard files in the Sequencing Analysis application page D 21 This operation allows you to Check the quality of the matrices in the instrument file Verify that you have the matrix needed for the selected chemistry Determine if the matrix you used is responsible for poor data To view the instrument file Step Action 1 Open the DataUtility program 2 From the Utilities menu choose Copy Matrix 3 Under Source select Instrument file and choose the new instrument file name The three matrices within the instrument file appear as shown below The numbers shown here are not representative values for all chemistries Note For dRhodamine and BigDye chemistries all three matrix boxes must be completed and the numbers for all three matrices are the same Note For Old Dye Primers and Rhodamine chemistries only the Primer and Taq Terminator matrix boxes are completed and the numbers in the two matrices are different Note If you find that the numbers in the matrix appear misaligned change your System Font from Charcoal to Chicago From the Finder choose Options in the Appearance control panel t
169. ge 5 34 The other Printing Preferences PostScript Printer Use dot dash format and Print First Page Only are applied directly when printing from the Sample window just as they are applied when automatic printing from the Sample or Sequence Manager is used Preferences Page Printing Preferences hd Panels per Page 5 Page Setup Options Defaults for Page Points Per Panel se Setup dialog box s PostScript Printer Use dot dash format Settings used for Print First Page Only Sample window printing rint These Li Annotation Electropherogram Defaults for Printing Options dialog box Sequence Raw Data Feature Table CEPT Data Viewing and Editing Sample Files 6 33 Search Find Again Viewing Printed Electropherograms Introduction The printed electropherogram shows a four color picture of analyzed data with peaks representing the bases The number of panels displayed on each page depends on the value selected for Number of Panels Per Page in the Page Setup dialog box Described in Panels Per Page Text Box on page 5 35 Why Print the Printed electropherograms have two advantages over Electropherogram electropherograms viewed on screen The printed electropherogram includes information from the Sample Sheet that is only visible on screen in Annotation view The printed electropherogram can display several panels of
170. ging You cannot change the Sample File Name from within the Sample Sample File Name Manager window If you double click on that field the Sequencing Analysis software opens that sample file If you need to change the Sample File name do it through the Macintosh Finder changing the Sample File name as you would change the name of any other file The Processing Parameters 5 3 Search Find Again The Sample Name Parameter About Sample Name Field Changing a Sample Name 5 4 The Processing Parameters This is the name of the sample Unless you have edited it this is the sample name that was originally entered in the Sample Name column of the sample sheet for the run Note This is distinct from the name of the sample file although the same name may be given to both the Sample File and the Sample You can edit the Sample Name in the Sample Manager window The new name is recorded in the sample file when you move the cursor to a different field Changing the Sample Name is immediate and permanent Note information in the sample file is normally connected to the sample sheet information through the Sample Name You break this connection when you change the Sample Name If necessary you can use the run time and lane number to find the source of the sample file information it is simpler to keep the original Sample Name until you no longer need the connection Search Find Again The A Parameter About the When this c
171. gnal DyeSet Primer file Instrument file Points Base 1 Signal 327 4 209 G 201 T 172 DP4S6AcC21M12 397 MATRIX FILE Points 1204 to 5000 Base 1 1204 Page 1 of 1 Thu Jun 20 1996 8 01 Tue Jun 1 1993 5 53 PM Spacing 10 50 11 06 uud Ml TTCR TGCTIGRGGTC GE TC TAGAGGATOOOOGG GTFCC AGC TAA TTCGTRR TCR T GG TCR TRGCTG TT TOC TGTG TGARA TT GTTATOCGC TCRCRRIT TOCACACAAC 90 100 11c pou mw Electropherogram Header Information Column Field Description First Model The instrument model used to collect the data Version The version of Sequencing Analysis software used to analyze the data Basecaller The name of the Basecaller used to analyze the data Version The version of the Basecaller used to analyze the data Second Sample file name The name used for the sample file This is the name shown in the File Name column in the Sample Sheet Viewing and Editing Sample Files 6 35 Search Find Again Electropherogram Header Information continued Column Field Description Comments The comments entered in the comment field of the Sample Sheet Sample name The name entered in the Sample Name column of the Sample Sheet Lane not included for 310 runs The lane in which the sample ran on the gel Third Signal The signal strengths or intensity of the fluorescence for each nucleotide in the sample D
172. he ABI PRISM 310 the wavelengths are separated by a spectrograph into a predictably spaced pattern across a CCD camera On the ABI 373 the wavelengths are separated by physical band pass filters and the signal is amplified by a photomultiplier tube PMT D 2 Creating Instrument Files Search Find Again Colors in Real Time Data Display Windows ABI 373 Filter Wheel 373 Au The CCD Camera 310 BRL 377 Real Time Display Colors Vary 310 373 377 Colors Represent Relative Wavelengths On the ABI 373 a physical four filter wheel or five filter wheel is used to separate the wavelengths emitted by the fluorescent dyes There are three types of filter wheel Filter Wheel Filter Set Original four filter wheel Filter set A Five filter wheel Filter set A and Filter set B BigDye filter wheel Filter set A The ABI PRISM 377 and ABI PRISM 310 data collection programs collect the fluorescent signal from specific locations on a CCD camera These locations correspond to different wavelengths of light The result is the same as using a physical filter to separate the light wavelengths This is referred to as a virtual filter since no physical filtering hardware is used See the instrument User s Manual for more details On the real time displays the Scan window and the ABI 373 ABI PRISM 377 Gel File window the data collection program displays the lig
173. he Pause button becomes the Resume button When you are paused you can edit the contents of the fields in the Sample Manager For example if you started the analysis and noticed that you had set the P field in error you could pause edit the print boxes and resume processing Search Resuming Processing Cancelling Processing Find Again There are two ways to resume processing Click the Resume button or Choose Resume from the Manager menu The program resumes processing beginning at the point where it was paused There are two ways to cancel processing Click the Cancel button or Press Command period or choose Cancel from the Manager menu The program immediately stops processing the current file and cancels the whole processing operation The phrase Sample Analysis Cancelled appears in the Status field To process the remaining files you must click the Start button or choose Start from the Manager menu Processing Sample Files 4 19 Search Find Again Checking for Processing Problems Introduction After processing is completed look at the A F and P columns in the Sample Manager window These three narrow columns are the parameters that specify the processing actions to be taken on the listed files See summary table below or page 4 5 for details Parameter Processing Action A Analyze the sample file in the Sequencing Analysis program Process the sample file with the
174. he channels on either side of it Through the Gel Preferences dialog box you can choose to use simple channel averaging or weighted channel averaging For more information see Gel Preferences on page 5 23 The software also copies all the information required to identify and analyze base call the sample You define the parameter values to use for gel file processing on the Gel Preferences page of the Preferences dialog box You specify whether or not you want automatic lane tracking and extracting in the instrument s data collection program before you start the instrument run In most cases if the run was successful and the analysis settings are correct the gel file should be properly tracked and you need only review it If however the tracking is incorrect or the signal is weak and the Tracker missed a lane you might need to make some changes and then re extract the sample data After the gel image has been generated and the lanes tracked you should perform the following review steps You can do this either before or after extracting the sample data from the gel file Checkthe gel image See page 3 11 If necessary adjust the appearance and content of the gel image See page 3 17 Check the lane assignment confidence value that is written to the Error Log See page 5 26 If necessary adjust the lane markers to correct lane numbering errors See page 3 23 If necessary adjust the placement of the
175. he left from the currently selected lane Search Find Again To review and edit tracker line placement Step Action 2 Inspect the placement of the tracker line on the lane Does the tracker line seem to follow the brightest part of the lane usually the center for the full length of the lane Or does the lane drift to the side while the tracker line does not You may need to horizontally expand the gel image to see this clearly Inspect the Slice view of the lane data Are the raw data peaks high enough for the full length of the lane Or are some peaks very low because the tracker line is not located correctly on the lane Gel Fil l a leo Bs 30 ay Charre 166 63 34 Lt E 2 High peaks in upper part of Slice view because tracker line is in center of lane No peaks in lower part of Slice view because tracker line is not on lane AA A A A If you find that the location of the tracker line in the lane does not result in optimal peak heights you can move the entire tracker line right or left step 4 Or you can reshape the tracker line step 5 Working with the Gel File 3 33 Search Find Again To review and edit tracker line placement Step Action 4 To move an entire tracker line Click the lane marker for the tracker line you want to move The lane marker becomes outlined in red
176. he sample file All editing is done on a copy of the original data Normally only the editable copy is visible in the Sample window In Sequence view you can use the standard editing commands from the Edit menu to cut copy paste and clear bases or ranges of the sequence in the active window You can also use the Select All command to select the entire sequence Note If you add bases in Sequence view then change to Electropherogram view the new bases are spaced as evenly as possible between the previously existing bases To add a base or range of bases to the sequence Step Action 1 Place the insertion point at the position in the sequence where you want to add one or more bases The program allows you to add any base identification character that is recognized by the program including IUPAC IUB codes 2 Type the character s you want to insert To delete a base or range of bases from the sequence Step Action 1 Select the base or range of bases 2 Use the Delete key or choose Clear from the Edit menu Viewing and Editing Sample Files 6 27 Search Find Again To change a base in the sequence Step Action 1 Select the base you want to change 2 Type the new character for that position Note If you edit data in Sequence view the Electropherogram view is immediately updated to match the changed Sequence view data Editing Bases In Electropherogram view
177. heckbox is selected the Sequencing Analysis software Analysis Checkbox analyzes base calls the file as a part of the processing operation When a file is added to the Sample Manager as part of automatic file processing the software sets this checkbox selected de selected to match the A checkbox in the sample sheet When you manually add a file to the Sample Manager window the software sets this checkbox to match the A checkbox on the Sample Manager Defaults page of the Preferences dialog box page 5 32 Checkbox Status The color of this checkbox indicates the analysis status If the checkbox is Then the analysis green succeeded red failed no color has not been started since the sample was added to the Sample Manager window If the checkbox is red see Changing the Processing Parameter Values on page 4 14 and Reviewing the Analysis Results on page 6 19 The Processing Parameters 5 5 Search Find Again The F Parameter About the Factura When this checkbox is selected the Factura program processes the file Checkbox as part of the processing operation Checkbox Status 5 6 The Processing Parameters The Factura program which is bundled with the Sequencing Analysis software allows identification of heterozygous base positions and quick cleanup of sequences before alignment For more details see the Factura Feature Identification Software User s Manual If both the A and F checkboxes
178. help Getting Started describes The Sequencing Analysis package contents System requirements How to install and set up the Sequencing Analysis software How to exit from the program Working with the Gel File explains how to View and edit a gel file in the Gel File window Generate sample files from a gel file Processing Sample Files explains how to Openand close the Sample Manager window Add and remove sample files Change the processing parameters Submit the list of sample files for processing The Processing Parameters explains the processing parameters and how to decide which parameter values will yield the best results for you Viewing and Editing Sample Files describes The six views of the Sample window Ways to change the appearance of the window How to search and edit the sequence 9 9 How to save the changes made Appendix A Command Reference includes brief descriptions of the Sequencing Analysis main menu commands and cross references to other sections that provide more detail Appendix B Input and Output Files describes the files created and used by the Sequencing Analysis software 1 2 About This User s Manual Search Find Again Chapter contents continued Chapter Content Appendix Troubleshooting describes Sequencing Analysis error C messages and other problems and what to do about each Appendix
179. horizontal axis is the number of scans performed on the instrument to obtain the data Vertical The vertical axis indicates signal intensity The Counts Per Tick value is not initially applied when the vertical display is set to Show relative values In this mode the default Counts Per Tick value 20 would present too many tick marks If you desire you can change the Counts Per Tick value to recalibrate the vertical scale Viewing and Editing Sample Files 6 43 Search Find Again To change trace line or scale display continued Step Action 7 Use the Vertical Display radio buttons to toggle between relative and real values for the intensity axis scale The default setting is Show relative values Show relative values compresses the vertical scale of the electropherogram display so that the electropherogram fits within a standard size Sample window Always select this option unless you have a specific reason to select Show real values Show real valuesdisplays the real scale of the fluorescence data as shown in the following illustration Only select this option if you need to see the real data values for example to resolve a problem EC T TGCRTGCCTGCRGGTCGOGR 10 20 Note window above uses the original value 20 for vertical scale and Show Real Values
180. ht intensities color coded according to wavelength Blue green yellow and red in that order represent the wavelengths of the dye emissions within each dye set Blue represents the shortest wavelength and red represents the longest The colors on the real time displays therefore represent the wavelengths of the dyes being detected rather than the bases being detected Different filter sets both virtual and physical use the same four colors to represent different wavelengths so the colors do not represent actual wavelengths They represent the relative wavelengths of the four dyes in each dye set For example Filter Set A uses the four colors to represent wavelengths within Dye Set 1 and Dye Set 2 Each of the chemistries used for preparing DNA is associated with a dye set Each dye set labels the four bases differently so the relative wavelength and therefore the color associated with each base varies with the chemistry used to label it Because of this the four colors on Creating Instrument Files D 3 Search Color Guide for ABI PRISM 377 and 310 310 3A 377 Find Again the real time displays represent different bases depending on the chemistry used for labeling The tables below describe the colors that represent each of the four bases on the real time displays for the ABI PRISM instruments The following tables lists the raw data display colors and dyes for the ABI PRISM 377 gel image and raw d
181. idity illegality or unenforceability shall not affect any other provision of this Agreement and this Agreement shall be construed as if such invalid illegal or unenforceable provisions had never been contained herein 3 This Agreement shall be construed and governed by the laws of the State of California 4 This Agreement and the Perkin Elmer Sales Quotation constitute the entire agreement between Perkin Elmer and you concerning the SOFTWARE Search Find Again Glossary This glossary includes some of the special terms used in the Sequencing Analysis Software User s Manual If a special term is not defined here check the index to see if it is explained elsewhere in the manual Base Spacing Base Spacing is the number of data points from one peak to the next The value is used to improve the accuracy of the base calling algorithm used in analysis Spacing values between 8 5 and 14 are generally acceptable Spacing values outside this range may indicate errors in base calling Spacing of a negative number indicates a problem with your samples the gel and or the analysis parameters Basecaller The Basecaller is a program that determines the bases of a sequence during analysis Seven types of Basecaller are included with this version of the Sequencing Analysis software ABI CE1 ABI CE2 ABI50 ABI100 ABI200 SemiAdaptive and Adaptive They are described under separate headings in About Basecallers and Base Calling on page 5 43 Channe
182. ifying the raw data for standards 0 10 Data Collection Auto Analyze 4 3 using with Sequencing Analysis 1 9 data formats sample files and text files 1 13 data point in Sample window determine value for 6 21 data point defined Glossary 1 DataUtility about program 1 14 D 13 misaligned numbers in matrix 0 19 program file location B 4 date and time on printed electropherogram 6 36 default preferences return to 5 21 Default Settings button 5 30 deleting control points on gel image 3 32 See Also removing disk space recommended 2 5 disk space required 2 4 for gel extraction 3 39 Index 3 Search Find Again Display Options command 6 41 dialog box 6 41 Display Options command 8 displays real time D 3 Done button 4 11 DP in DyeSet Primer filename 8 dRhodamine terminators D 2 DSP in DyeSet Primer filename B 8 DT in DyeSet Primer filename 8 dye colors hide and display 3 17 See Also colors dye primer chemistry 5 13 dye sets D 3 dyes D 8 DyeSet Primer files 3 14 4 6 about parameter 5 18 choosing 5 19 defined Glossary 1 editing the pop up menu 5 18 in ABI folder 6 19 location B 2 naming conventions 8 on printed electropherogram 6 36 reasons to change 5 18 results of changing 5 18 shorten list 5 18 E edit analyzed sequence data 6 27 bases in sample file 6 28 Gel Info window 3 12 Project Names 3 16 Sample Sheet 3 15 EditView about program 1 15 electropherogram advantages of printed 6 34 colors on
183. ile Gel files are too large to fit on floppy disks For long term storage use magnetic tapes removable cartridge drives or optical drives to archive gel files To Save Selected Information From a Gel File Use the Save As command from the File menu The default filename is the original filename plus the word copy In the Save Gel As dialog box you specify the file format The file formats are described in the table below Working with the Gel File 3 45 Search Find Again amp Results 4 1 95 v c Hard Drive D Results 4 1 96 l Eject D Sample 01 D Sample 02 Desktop D Sample 03 New D Sample 04 D Sample 05 Save Gel fis Cancel ae v Gel File Gel without Image Gel with Sequencing 2 4 Image PICT File File Format File Format Description Gel File Saves the entire gel file including the raw run data Sample Sheet data instrument file information and gel image with tracker lines This option typically creates a 20 90 MB file Gel Without Image Saves everything in the gel file except the gel image A gel image can recreated from this file later if it is needed This option typically reduces the file size by about one third Gel With Saves the gel file in a special format so it can be Sequencing 2 x displayed by the Sequencing Analysis software Image version 2 1 2 and earlier versions This option typically reduces the file size by a
184. in the list according to the parameter values selected for the file There are two ways to begin the processing of files in the Sample Manager list Click the Start button in the Sample Manager window or Choose Start from the Manager menu During processing the status of the processing operations appears in the Status field above the file list While a sample file is being processed the Start button becomes inactive and the Pause Stop and Cancel buttons become active The Sequencing Analysis software starts with the first file in the list If analysis base calling is requested the base calling results are written to the sample file as the calling is done After base calling the file is submitted for Factura processing if requested and finally for printing if requested When one file is fully processed the Sequencing Analysis software moves to the next file in the list until all processing is complete Note When the Sequencing Analysis software performs base calling it stores the base calls as the original results If you edit the sequence the original results are kept and the edited sequence is kept as the most recent sequence Each additional time that you edit the sequence the most recent sequence is updated There are two ways to temporarily pause processing Click the Pause button or Choose Pause from the Manager menu The program pauses processing on the current file When processing is paused t
185. indow The upper line is the original uneditable data and the lower line is the editable copy M 002589 5 mJ Original data Editable data Hiding Original To hide the original data in Electropherogram view Choose Show Data Original from the Sample menu 6 30 Viewing and Editing Sample Files Search Find Again Printing the Sample Window Views Introduction Automatic printing is set up at the Printing Preferences page of the Preferences dialog box for details see Printing Preferences on page 5 34 You can use the steps below to temporarily change those settings and to print directly from the sample in the currently active Sample window Printing Follow the steps in the table below to print from an active Sample Displayed Sample window Window To print the contents of a displayed sample file Step Action 1 If you want to temporarily change the page orientation paper type panels page etc choose Page Setup from the File menu to open a special Page Setup dialog box If you opened the Page Setup dialog box adjust the settings as needed Then choose OK to close the dialog box The bottom part of the dialog box contains the four special setting options described on the table on page 6 32 Choose Print from the File menu A Printing Options dialog box appears Printing options Print these Rnnotation Sequen
186. ing option is empty that process is skipped Follow this procedure to move a file to a new location in the Sample Manager list Step Action 1 Click the name of the file in the Sample File Name column The entire row becomes highlighted 2 Hold down the Option key while you drag the Sample File Name to the new location in the column Follow this procedure to remove a single sample file from the Sample Manager window Step Action 1 Click the name of the file in the Sample File Name column The entire row becomes highlighted 2 Press the Delete key or click the Remove button at the top of the window or choose Remove Files from the Manager menu The Sequencing Analysis software removes that file from the list Search Find Again To Remove To remove multiple files from the Sample Manager window Multiple Files To remove Do this all the files a Choose Select All from the Edit menu b Press the Delete key several adjacent files a Click the Sample File Name of the first file in the group b Hold down the Shift key and click the Sample File Name of the last file in the group c Choose the Remove button multiple files that are not a Hold down the Command button while you next to each other click the File Name of each file that you want to remove b Choose the Remove button Processing Sample Files 4 13 Search Find Again Ch
187. inimum requirements In general the more memory the larger the screen size and the more processing power you have the better System Requirements System Component Requirements CPU A Power Macintosh PowerPC CPU computer You will benefit from using the fastest computer available CD ROM Drive Any Operating System Mac OS version 8 0 with Open Transport 1 1 or later Disk Space A minimum of 15 MB free disk space See also Disk Space under Recommendations below Memory RAM The minimum memory requirement is 32 MB total with at least 25 MB of this available to run the Sequencing Analysis program Virtual Memory Virtual memory must be turned on if the physical RAM is less than 48 MB Set the Memory control panel so that the memory available after restart is 45 55 MB Using more virtual memory than required can slow software performance Search Find Again System Recommendations System Component Recommendations Monitor A 17 inch monitor or larger is recommended Although a monitor of 640 x 480 resolution can be used you will benefit from having a monitor of higher resolution Printer A PostScript compatible color printer is recommended E g HP DeskJet 1600CM and 1200C PS printers Disk Space Storage requirements depend primarily on the quantity of data to be generated and stored Sample files are approximately 150 250 KB each and gel files are 20 90 MB each It
188. int and end point for the range If the file does not contain enough good data run a new set of matrix standards 5 Repeat the Make Matrix process or the Add Replace Matrix process using the new start point and data range numbers D 28 Creating Instrument Files Search Incorrect Files or Chemistry 373 377 Find Again If any of the files selected are obviously incorrect or you selected the wrong chemistry button an error message appears and the matrix is not made To correct file or chemistry selection Step Action 1 Repeat the Make Matrix process selecting the correct chemistry button for the correct set of matrix sample files 2 Use the gel file to verify that the matrix sample files contain the base that the file indicates The section Colors in Real Time Data Display Windows on page D 3 explains the correlation between the colors in the gel file and the base that each color represents IMPORTANT The gel file in the data collection program shows unconverted raw data so the colors displayed represent different bases depending on the chemistry See Colors in Real Time Data Display Windows on page D 3 Creating Instrument Files D 29 Search Find Again Viewing and Copying Matrices Introduction n addition to making matrices you can use the DataUtility program to View existing matrices Inspect the Matrices Using the DataUtility Program on page
189. ion next opens Can the Command Log Become Full No the Command Log never becomes full because when it reaches its maximum length the oldest messages are automatically deleted from the log as new messages are added to the top Search Find Again Reviewing the Choose Show Command Log Command 2 from the Window menu C dL MER The menu command changes to Hide Command Log so you can choose the command again to hide the log and the Command Log window appears Command Log Thu Apr 9 1998 11 27 AM Show Hide Command Window Thu Apr 9 1998 11 37 AM Program Start Up Mon Mar 16 1998 9 59 AM Show Hide Command Window Mon Mar 16 1998 9 59 AM Program Start Up Mon Mar 16 1998 9 54 AM Call Bases Mon Mar 16 1998 9 54 AM Call Bases Mon Mar 16 1998 9 54 AM Call Bases Mon Mar 16 1998 9 54 AM Engine Quit Mon Mar 16 1998 9 54 AM Call Bases Mon Mar 16 1998 9 49 AM Show Hide Errors Window Mon Mar 16 1998 9 49 AM Program Start Up Mon Mar 16 1998 9 48 AM Write Preferences Mon Mar 16 1998 9 48 AM Program Shut Down In the Command Log window the newest entry is at the top of the list Note You cannot select multiple lines or edit the Command Log Printing the To print a copy of the Command Log Command Log Step Action 1 Choose Print from the File menu while the Command Log window is active 2 In the Printer dialog box either select All to print a
190. is User s Manual 1 11 Search Flowchart for ABI 373 and ABI PRISM 377 373 377 1 12 About This User s Manual Find Again User starts data collection with Automatic Analysis selected Data collection software captures sample data in gel file Sequencing Analysis automatically tracks gel file and extracts raw data Sequencing Analysis automatically does base calling of data If requested Sequencing Analysis automatically submits data for Factura processing If requested Sequencing Analysis automatically submits data for printing y User reviews Sequencing Analysis and Factura software error logs No Yes Analysis procedure for samples from ABI 373 and ABI Prism 377 Sequencers User makes changes required by problems in error log If necessary user opens gel file and starts tracking and base calling data User reviews lane tracking in gel files Ok No Yes User reviews base calling results No User edits and manually r J tracks gel file if necessary then re extracts sample files User sets parameters and I starts analysis OK Yes If desired user edits bases in analyzed data User adjusts parameters and reanalyzes samples files DNA sequence data completed Search Find
191. ite Gel File If a gel file is much smaller than normal the run data is probably missing Sample File Sample files are normally 70 80 KB when they contain only raw data and up to 250 KB after analysis If the file is either too small or too big there is probably something wrong with the data Troubleshooting C 3 Search Find Again Troubleshooting Error Log Messages Introduction Errors that occur during analysis appear in the analysis software Error Log When you encounter an error message in the log consult the table below for the meaning of the error message and suggested corrective action For more details about the Error Log see Reviewing the Sequencing Analysis Error Log on page C 14 Error Message Listing The following table lists some of the more common error messages and what action to take for each For help with error messages that do not appear in this table contact PE Applied Biosystems Technical Support See Technical Support on page 1 16 Table of Common Error Messages Error Message Observed Symptoms Recommended Action Error 0 Could not do this task because of a program error The tracker application could not be loaded A shared library may be missing Make sure that the three extensions libmatlb libmcc and libtbx are within the SAGelTracker folder with the SAGelTracker application Error Z0 Changed gel image resolution Regenerate gel image Gel was previ
192. ker position does not alter The Lanes tracker line is drawn as a straight line from the marker Force Moves selected tracker lines to the far right of the 3 26 Selected gel image Lanes are renumbered accordingly All Lanes to Right lanes moved right are stacked on top of each other Regenerate Regenerates the gel image from the raw data 3 20 Gel Images Install New Replaces the current Sample Sheet contained in 3 15 Sample the gel file with the contents of the Sample Sheet Sheet file you select If you select the wrong Sample Sheet at the time of data collection this is the best way to repair your error Install New Attaches new instrument file information to the gel 3 21 Gel Matrix file but does not change the instrument file name Command Reference 5 Search Find Again The Sample Menu Sample Menu The table below lists and describes the commands accessible from the Commands Sequencing Analysis program Sample menu Keyboard See Command Shortcut Description Page Add To Command B Adds the file in the active Sample window to the 4 8 Sample current Sample Manager Manager Show Original Displays the original base calls on a separate line 6 30 above the editable values in the Electropherogram view A 6 Command Reference Search Find Again The Manager Menu Manager Menu The table below lists and describes the commands accessible from the Commands Sequencing Analysis program Manager me
193. l try to use the instrument file saved in the gel file The Sample Manager window will be updated to show the name which ever instrument file was used to analyze the sample files Search Find Again Parameters in the Preferences Dialog Box Introduction About the Default Values The Preferences Parameters Listed You can select preferred values preferences for most of the processing parameters used by the Sequencing Analysis software Some of these parameters will guide the software s actions during auto analysis Some will be the parameter values automatically listed for each sample file that you manually add to the Sample Manager window When desired you can override these preference values for individual files or groups of files The following sections pages 5 23 to 5 46 describe each of the parameters that can be set through the Preferences dialog box For a general explanation of how to select and change a Preferences parameter value see Changing Parameter Values in the Preferences Dialog Box on page 5 22 The default values in this dialog box are the values most commonly used by PE Applied Biosystems customers You can open the Preferences dialog box and change these values at any time Note X Changes you make in this dialog box take effect as soon as you close the dialog box However the changes do not affect the values already defined for sample files currently listed in the Sample Manager window To return
194. land Rotkreuz Tel 0 41 799 7708 Fax 0 41 790 0676 United Kingdom Warrington Cheshire Tel 01925 825650 Fax 01925 282502 1 18 About This User s Manual Search Find Again Europe continued Germany Weiterstadt Tel 0 6150 101 0 Fax 0 6150 101 101 All Other European Countries Middle East West Asia Africa Langen Germany Tel 49 6103 708 301 Fax 49 6103 708 310 Japan Pacific Rim Japan Chiba Tel 0473 80 8500 Fax 0473 80 8505 Eastern Asia China Oceania Australia Scoresby Victoria Malaysia Kuala Lumpur Tel 03 9212 8585 Tel 60 3 758 1118 Fax 03 9212 8502 Fax 60 3 758 5688 China Beijing Singapore Tel 86 10 6238 1156 Tel 65 336 0322 Fax 86 10 6238 1162 Fax 65 338 3991 Hong Kong Taiwan Taipei Hsisn Tel 852 2590 0238 Tel 886 2 698 3505 Fax 852 2590 0513 Fax 886 2 698 3405 Korea Seoul Tel 822 592 7238 Fax 822 532 4908 Thailand Bangkok Tel 662 719 6406 Fax 662 319 9788 About This User s Manual 1 19 1 20 About This User s Manual Search Find Again Getting Started Overview In This Chapter This chapter contains information about installing and registering the Sequencing Analysis software This chapter also describes how to customize the program preference settings This chapter includes the following topics Topic See Page Regi
195. le in order to be auto tracked Tracking times depend upon number of lanes channels and scans in the gel file Consult the table below to estimate gel tracking times for your sequencing system Time min for CPU Speed Number Number of Number of Size of Gel of Lanes Channels Scans MB 7200 902 4400 2002 9500 2005 G3 2663 36 194 10628 24 8 27 15 11 6 36 194 10756 25 1 28 16 12 6 48 388 7348 34 1 36 21 15 8 48 388 11804 54 2 58 34 25 13 64 388 9808 45 2 54 32 24 13 64 388 14164 64 8 76 45 32 17 96 480 11806 66 8 93 57 40 21 8 7200 4400 G3 32MB 10MB VM b 9500 64MB 10MB VM About This User s Manual 1 5 Search New Manual Tracking UI 96 Lane Capability Fifth Dye Support for Gel Files Basecaller Threshold Removed 1 6 About This User s Manual Find Again The new user interface UI for manual tracking is very easy to use Tracking lines are adjusted by moving and adding control points A new interpolation mode makes it possible to adjust many lanes at once For more information about the new manual tracking user interface Chapter 3 Working with the Gel File In Sequencing Analysis v 3 2 96 lane gel files can be opened viewed and tracked and extracted like any other gel An optimized Tracker settings file for 96 lane gels is included with Sequencing Analysis v 3 2 For more information see the AB PRISM 377 DNA Sequencer 96 Lane Upgrade User s Manual P N 4305423 Some labs have c
196. ll the log pages or type in the page numbers for the range of pages you want to print Note Because the most recent entry is at the top of the log file most often it may be enough to print only the first few pages of the file 3 Choose Print Troubleshooting 17 Search Find Again Troubleshooting with the Printed Electropherogram Introduction Signal Strength Values Spacing Values C 18 Troubleshooting Two items of information in the header of the printed electropherogram can be especially useful for troubleshooting Signal Strength Spacing This information is also found in the annotation view of the Sample window The signal strength numbers at the top of the third column when below forty 40 for any one base might indicate a problem with the data Signal strength is very chemistry dependent If any of the signal strength numbers falls below 40 you should examine both your raw data and your analyzed data closely for possible problems Negative Spacing Negative spacing is a signal from the Basecaller program that it could not properly analyze your data Try analyzing this data with the SemiAdaptive or Adaptive Basecaller to see if it produces a better result Or try changing the spacing in the Sample Manager See Changing the Spacing for a Sample on page 5 9 Negative spacing values can be caused by The DNA running through the gel too quickly or too slowly Ahigh lev
197. ls Channels are the theoretical divisions across the read region of a gel where the 373 or 377 data collection software samples the data The number of wells in the loading comb determines the approximate number of channels assigned per lane of the gel for instance with a 36 well comb one lane includes approximately five channels When the Sequencing Analysis Tracker software tracks a gel it places the tracker line for each lane down the middle of the lane data During extraction it averages the data from that channel with the data from adjoining channels as specified by the user to determine the raw data for the sample file Chromatogram A chromatogram is a multi color picture of a sequence in which the bases are represented by peaks The term is used interchangeably with electropherogram in this manual complement The opposite strand of double stranded DNA For example if you sequenced the 3 to 5 strand then the 5 to 3 strand is the complement cycle See module data point sampling of fluorescence Each data point has scan number and a channel number associated with it DyeSet Primer file file used to adjust for varying mobility between the dyes and primers used to label DNA for runs on the ABI PRISM9 Genetic Analysis Instruments The Sequencing Analysis installer installs DyeSet Primer files in the ABI Folder located in your System Folder These files are sometimes referred to as mobility files Glossary 1 Search Find
198. mple 21 Ea od eT LRO 123 About Stacking To arrange a large number of open sample files so they are reduced in size and stacked from back to front choose Stack from the Window menu When you choose Stack only a small amount of each window is visible Viewing and Editing Sample Files 6 37 Search If You Try to Open Too Many Windows Find Again LAO 123 l Sample 01 Sample 15 fy 1 1880 1 360 1 1040 1 M2 V 1000 THGCTCRCTCCRRTGTCCTGGRG ABTTTCCTCAGTGTTTICTT 80 90 100 110 1 n 182 I 332 i i E A AN M i NA JA EN lick the edge of any window to bring it to the front To bring any window to the front of the stack Click the exposed edge of the window that you want to bring to the front If you try to open too many windows for the available memory the Error Log opens with an A 108 error listed at the top and a warning dialog box appears Many of the menu options and analysis options on the Sample Manager are disabled when memory is low To free up memory close some of the open windows or increase the amount of memory allocated to the program for details see Out of Memory dialog box on page C 10 6 38 Viewing and Editing Sample Files Search Find Again
199. n and is not to be construed as a warranty that the SOFTWARE will conform to the sample or model LIMITATION OF LIABILITY EXCEPT AS SPECIFICALLY STATED IN THIS AGREEMENT THE SOFTWARE IS PROVIDED AND LICENSES AS IS THIS WARRANTY IS GIVEN IN LIEU OF ALL OTHER WARRANTIES EXPRESSED OR IMPLIED INCLUDING THOSE OF MERCHANTABILITY OR FITNESS FOR A PAR TICULAR PURPOSE NOTWITHSTANDING ANY FAILURE OF THE CENTRAL PURPOSE OF ANY License and Warranty 1 Search F 2 License and Warranty Find Again LIMITED REMEDY PERKIN ELMER S LIABILITY FOR BREACH OF WARRANTY SHALL BE LIM ITED TO A REFUND OF THE PURCHASE PRICE FOR SUCH PRODUCT IN NO EVENT WILL PER KIN ELMER BE LIABLE FOR ANY DAMAGES INCLUDING INCIDENTAL OR CONSEQUENTIAL DAMAGES EVEN IF PERKIN ELMER HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAM AGES TERM You may terminate this Agreement by destroying all copies of the SOFTWARE and documentation Perkin Elmer may terminate this Agreement if you fail to comply with all of its terms in which case you agree to return to Perkin Elmer all copies of the SOFTWARE and associated documentation MISCELLANEOUS 1 Failure to enforce any of the terms and conditions of this Agreement by either party shall not be deemed a waiver of any of the rights and privileges under this Agreement 2 n case any one or more of the provisions of this Agreement for any reason shall be held to be invalid illegal or unenforceable in any respect such inval
200. n Data Collection software Retracking Gel Data After analyzing ABI 373 or ABI PRISM 377 data you can inspect the gel and retrack a lane manually or specify processing parameters and reanalyze the data for a given lane This may allow you to salvage an otherwise unusable sample in the case of a chemistry or gel problem Because each sample on an ABI PRISM 310 instrument is run individually the data collection program creates the sample files automatically when the samples are run About This User s Manual 1 9 Search Analysis and Printing Process Flowcharts 1 10 About This User s Manual Find Again Once the sample files are available the Sequencing Analysis program can Create analyzed data based on the raw data in which the bases in the sequence are identified Pass the analyzed sample files to the ABI PRISM Factura Feature Identification Software for further processing The Factura software package is included with each copy of Sequencing Analysis software For example Factura is used to identify and remove vector sequence and ambiguous regions of sequence For more information about Factura see ABI Prism Factura Feature Identification Software User s Manual Printthe electropherogram data for each sample file after all requested processing is finished Reanalysis of Base Calling For files and database records from all ABI analysis instruments the software allows you to re base call sample files
201. nalysis and saved as analyzed sample files scan number During an ABI 373 or ABI PRISM 377 run the data collection software typically scans the gel some 15 000 times It samples the data 194 times in full scan mode or 388 times in XL mode or 480 times in 96 Lane mode during each scan Each sampling is stored as a data point that is described in terms of its scan number A data point is represented by one line number on the Gel display The scan number describes the location of the data point On an ABI PRISM 310 instrument one sampling is taken during each scan and the information is stored as a data point selected sequence A sequence that you have specified by clicking its name in the Sample Manager separation distance The length from the wells of the gel to the read region of the gel Also called the well to read or WTR distance Seq files Text files created by the Sequencing Analysis program The Seq files contain only the characters of the sequence and can be created in several formats ABI Intelligenetics Staden and Wisconsin for use with other programs sequence linear series of characters The characters are displayed in rows from left to right More specifically a sequence is a series of nucleotide base characters that represent a linear DNA sequence or a series of amino acid characters that represent a protein sequence sequencing reactions The reactions performed to incorporate fluorescent dye labels into DNA extension
202. name of a file appears as outlined text the software could not find that file in the expected location For analysis to proceed you must specify a Basecaller that is present in the same folder as the Sequencing Analysis software and a DyeSet Primer file that is present in the ABI folder in the System Folder on your hard disk Scroll through the Electropherogram Scroll through the length of the data in Electropherogram view Look for peaks at discrete locations with no gaps or overlaps and very little noise Scroll to the end of the window and look for well resolved peaks Viewing and Editing Sample Files 6 19 Search Find Again Well resolved peaks Poorly resolved peaks If there are problems see Appendix C Troubleshooting Check Base Calls in the Electropherogram Look at the base calls in the Electropherogram view Where two peaks are close together or the peak is low or the background noise level is high compare each peak to the bases called for that peak If necessary edit incorrect base calls manually Selecting Bases Bases can be selected either with the mouse or using the arrow keys The arrow keys are the easier way to select bases Search for Ns in the Electropherogram Use the Tab key and Shift Tab to search for Ns If you can visually determine the correct base call at an N location manually change the N to the correct character 6 20 Viewing and Editing Sample Files Search Find Again Determining
203. nd the Sample Manager window choose the gel file from the Window menu to bring it to the front There are three ways to open a gel file manually Double click on the icon for the gel file Drag the gel file icon onto the Sequencing Analysis program icon Choose Open Gel from the Sequencing Analysis File menu select the name of the file and then choose Open Note If the Sequencing Analysis v 3 2 software has not already created a gel image for the file it creates one when you open the file This process can take anywhere from a few seconds to a minute Even if an image for the gel file was create in an earlier version of Sequencing Analysis a new image is created when the gel file first opens in Sequencing Analysis v 3 2 This is because Sequencing Analysis v 3 2 displays the expanded image at 600 scans window where previous versions of the software display at 350 scans window Once the gel file is opened check the quality of the image See Checking the Gel File on page 3 11 To learn more about the gel window see About the Gel File Window on page 3 6 Working with the Gel File 3 5 Search Find Again About the Gel File Window Introduction The gel image displayed in the Sequencing Analysis Gel File window is 34d 393 377 3 6 Working with Gel File different from what is displayed by the data collection program during a run In the Data Collection Program During the run the Gel File windo
204. ndow Keyboard See Button Command Shortcut Description Page Change to Command E Switches from any other Sample window 6 6 By Annotation view to Annotation view View Change to Command R Switches from any other Sample window 6 6 Sequence view to Sequence view View Change to Command T Switches from any other Sample window 6 6 Feature View view to Feature view Change to Command Y Switches from any other Sample window 6 6 Electrophero view to Electropherogram view gram View Change to Command U Switches from any other Sample window 6 6 Raw Data view to Raw Data view View Change to Command l Switches from any other Sample window 6 6 EPT Data view to EPT Data view View Command Reference 9 A 10 Command Reference Search Input and Output Files Overview Introduction In This Appendix Find Again This appendix describes the files that contribute information for the operation of the Sequencing Analysis software input files and the files created by the software output files Some of these files must be located in the System Folder on your computer Others can be kept in various locations depending on the type of instrument used and your personal preference This appendix includes the following topics Topic See Page Input and Output Files in the System Folder B 2 Input Files Not Located in the System Folder B 4 Output
205. ng Parameters Search Find Again About Basecallers and Base Calling Introduction Base calling is the primary function of the Sequencing Analysis software For accurate base calling it is important to understand the process and to select the best Basecaller for your data How Base Calling Works The Sequencing Analysis program analyzes the data in the sample files for signal strength to evaluate whether the data should be analyzed and printed and performs base calling The following describes the processes involved Preprocessing includes noise filtering signal strength analysis and finding the first base peak in the sample A first pass of the software determines the spacing between peaks This includes the following processes Multicomponent analysis adjusts for the spectral overlap of the dyes This function utilizes the instrument file Mobility shift adjusts for differences in mobility between the dyes This function utilizes the DyeSet Primer file The raw data is re spaced based on information computed in this initial processing A second processing is based on the re spaced raw data The software begins again with location of the primer peak multicomponent analysis and mobility shifts then performs the following processes Peak height normalization normalizes the signal strengths between the colors Each dye exhibits different levels of fluorescence so this process scales each color so the t
206. ng Selected Information and Archiving Gel Files 373 373 377 Find Again IMPORTANT If you save changes to the gel file the original tracking information is overwritten You can retrieve the originally calculated tracking by choosing Track Gel from the Gel menu to retrack the gel If you select the checkbox labeled Save Gel File Before Extraction in the Generate New Samples dialog box you need not manually save the gel file using the Save command Because a gel file normally contains the raw data acquired by the data collection program a gel image created by the Sequencing Analysis software a copy of the data collection Sample Sheet and a copy of an instrument file the size of the file is normally 20 90 MB You do not usually need to keep a gel file once the tracking is verified and the sample data are extracted from it If desired you can keep parts of the information while discarding the image IMPORTANT Do not discard any gel file until you have verified the tracking and taken any required corrective action To Store a Gel File Temporarily If you are running the ABI 373 with Data Collection version 1 2 the gel file is overwritten on the hard disk every time a new gel file is created because the default name for all new gel files is Gel file If you want to temporarily save the current gel file on your hard disk give the current file a new filename before you begin the next data collection run To Archive a Gel F
207. ng the Zoom Commands 6 39 Changing the Displayed Lines and 6 41 Command Reference 1 OVertVIeW ee doen qus edu a avc he dete 1 The File Men olei RR ee ed E E A 2 The Edit Menu aie deer 3 The Gel Menu 0 0 e 4 Search Find Again The Sample Menu p RUPES METRE ge have ta eed RS A 6 The Manager Menu 2 eye ck been ena even URBES EE Ee ES A 7 The Window Menu 00 cette A 8 Keyboard Shortcuts for Sample Window A 9 Input and Output Files Bel OVV E Wenca iiaa 1 Input and Output Files in the System Folder B 2 Input Files Not Located in the System Folder B 4 Output Files Not Located in the System 1 B 6 DyeSet Primer File Naming B 8 Cul OVERVIEW xe e v OC pP ee aa ES Up UR Vea mes C 1 General Troubleshooting Hints 0 0 0 eee eee eee eee C 2 Troubleshooting Error Log C 4 Troubleshooting Other Types of Seq
208. ngs z Tela SemiAdaptive SemiAdaptive SemiAdaptive SemiAdaptive SemiAdaptive SemiAdaptive ABITOO SemiAdaptive SemiAdaptive SemiAdaptive SemiAdaptive emi amp daptive emi Adaptive emiAdaptive 1 03 ES C3 C3 C3 C3 P3 D C3 OOOO 0000 0 0 0 0 VENEEN Click the File Name Click on any Use the scroll bar to scroll and the to select a sample field to select it size box to stretch the window Moving Within Rows and Columns 4 16 Processing Sample Files There are keyboard shortcuts for moving from column to column and row to row in the Sample Manager window To Move from Column to Column Within One Row Press the Tab key or the Right Arrow key to move to the next right column Press the Shift Tab keys or the Left Arrow key lt to move to the next left column To Move from Row to Row Within One Column Press the Return key or the Down Arrow key to move down one row Press the Up Arrow key 1 to move up one row Search Selecting Fields and Samples To Change Column Width To View Additional Information in the Window Find Again To Select a Field to Edit Click once to highlight the field you want to edit To Select Samples When you select a sample in the Sample Manager window the entire row containing the sample is selected Select samples as follows Toselect one sample and to de select all other samples cli
209. notation explained 1 8 Mark All Lanes for Extraction command A 4 Mark All Lanes Unused command 5 Mark All Lanes Used command 5 Mark Lane for Extraction command A 4 Mark Lane Used command A 4 markers See Also lane markers sequencing lane markers 3 27 MatLab text files B 7 matrix copy from one file to another file D 31 incorrect files or chemistry D 29 new overwrites old 0 27 signal too low 0 28 standards running D 10 D 11 standards tracking D 10 view in the instrument file D 19 matrix file See instrument file matrix information See instrument file memory allocate more C 10 errors if low C 7 C 9 minimum required 2 4 troubleshooting errors 7 menu commands 1 8 unavailable C 5 C 6 misaligned numbers in DataUtility 0 19 mobility file See DyeSet Primer file mobility shift 5 43 Model on printed electropherogram 6 35 module defined Glossary 3 monitor recommended 2 4 moving control points 3 31 lane markers 3 23 3 26 sample files in Sample Manager window 4 12 tracker lines 3 23 3 36 Multicomponent analysis 5 43 Multicomponent Gel Image 3 21 checkbox 5 23 N Neural Net Tracker defined Glossary 3 See Also Tracker new features in Sequencing Analysis v 3 2 1 4 Ns find the next occurrence 6 23 in sequence 6 13 search for 6 20 nucleotide sequence See sequence Number of Panels Per Page text box 6 33 Number of Points Per Panel text box 6 33 Index 7 Search Find Again O
210. nstallation CD ROM disc in a safe place If you ever need to reinstall the application you will need the Installer CD ROM disc You cannot successfully install the Sequencing Analysis software by copying it from one computer to another 10 The Installer Log File is created by the Installer The log file is placed in the Sequencing Analysis folder and contains a list of all the files installed Use this log file if you need to remove Sequencing Analysis from your hard disk See Removing Sequencing Analysis Software below After Installing the After installing the Sequencing Analysis software you should rebuild Sequencing the desktop check your ABI Folder and enable any virus protection Analysis software you turned off before the installation follow the steps in the table below To rebuild the desktop enable virus protection and check ABI Folder Step Action 1 If you disabled your virus protection before installation enable it now While holding down the Command and Option keys choose Restart from the Special menu in the Finder Continue to hold down these keys as the computer reboots Depending on how your system is configured you may be prompted to respond to various system requests Respond to each of these prompts appropriately but do not release pressure on the Command and Option keys until a dialog box appears that asks if you want to rebuild the desktop Choose OK to reb
211. nstalled it is written immediately to the gel file Even if you close the file without saving the new matrix is incorporated into the gel file To install new instrument file information in the gel file Step Action 1 Choose Install New Gel Matrix from the Gel menu A directory dialog box appears It shows only the names of folders and instrument matrix files Find and select the desired instrument file Then choose Open A dialog box like the following appears Installation of dR mtx 10101 10 15 97 within the Gel File was successful NOTE Previously extracted sample files DO NOT contain the newly installed matrix Do you want to regenerate the Gel Image Regenerate Image Don t Regenerate Image Choose Regenerate Image or Don t Regenerate Image The new Matrix is installed regardless of which option you choose The new Matrix name is shown on the Gel Info Window Search Find Again Adjusting Lane Markers and Tracker Lines Introduction Using the Keyboard to Move Between Lanes Moving Misplaced Lane Markers When the Sequencing Analysis software first opens a gel file it adds lane numbers lane markers and tracker lines to the gel image In most cases if you used a good gel for your run and the analysis settings are correct the gel file should be properly tracked If however the tracking is incorrect because the signal is weak and the tracker missed a
212. nt disk space a message is written to the Error Log Error 34 Could not do this task because the disk is full The amount of disk space required depends upon the number of sample files you want to extract Use the table below as a guide You need approximately this To extract this many lanes much disk space 36 8 MB 64 16 MB 96 24 MB Working with the Gel File 3 39 Search 3 40 Working with the Gel File Find Again Tracking and Extracting Data in Sample File Mode To track and extract the gel file Step Action 1 Choose Track and Extract Gel from the Gel menu The Track amp Extract Lanes dialog box appears Track amp Extract Lanes Over Write Original Sample Files Auto Analyze after Extraction Analyze All Files Print Re Use Sample Sheet Settings C C Search Find Again To track and extract the gel file continued Step Action 2 Select the settings you want to use for this operation Setting Description Over Write Overwrites any existing sample files that have Original the same name with the new sample data Sample Files Deselect this if sample files with these names already exist and you want the Sequencing Analysis software to preserve the existing files and create new sample files for this data If you track and extract the gel file a second time without overwriting
213. ntroduction The Sequencing Analysis program creates two types of data files for analyzed data and two log files Additionally when Sequencing Analysis software is installed the installer program creates a file named Installer Log File and places it in the Sequencing Analysis 3 2 folder The two log files Command Log and Error Log are located in the System Folder as described on page B 2 Output Files The following table describes the three output files created by External to the Sequencing Analysis software that are not stored in the System Folder System Folder Output Files That Are External to the System Folder Location for ABI PRISM 377 Location for and File Type ABI PRISM 310 ABI 373XL Description Sample Files Individual Run Next to the gel The sample file contains six parts folder in the file in a folder annotation features table sequence Runs folder of the same chromatogram electropherogram raw data inside the name as the and EPT data electrophoresis conditions It ABI PRISM 310 gel file combines information from the Sample folder Sheet raw data and analysis conditions and results The annotation has Sample Sheet information analysis results like basespacing and signal strength The features table contains the results from Factura processing Seq Files Individual Run Next to the gel Text files that contain the base letter folder in the file in a folder sequence only You can create these files in
214. nu Keyboard See Command Shortcut Description Page Add Files Command N Adds files to the Sample Manager 4 9 Remove Files Delete Removes files from the Sample Manager 4 12 Open Files Opens all files currently selected in the Sample 6 3 Manager window Pre Analysis For the currently selected file s in the Sample 4 15 Settings Manager replaces any values that you changed with the original values from the Sample Sheet Be careful there is no undo for this command Start Command M Starts processing of files in the Sample Manager 4 18 Pause Temporarily stops the processing of files in the 4 18 Sample Manager Resume Continues a paused processing of files in the 4 19 Sample Manager Cancel Command Cancels the processing of files in the Sample 4 19 Period Manager Command Reference 7 Search Find Again The Window Menu Window Menu table below lists and describes the commands accessible from the Commands Sequencing Analysis program Window menu Keyboard See Command Shortcut Description Page Zoom In Command Enlarges an area of the active window so that 6 39 more detail is visible Command available for the three graphical views of the Sample window Zoom Out Command Reduces the scale of the active window so that 6 39 you can see a larger area Command available for the three graphical views of the Sample window Full
215. nu 3 16 Project Owner field 3 15 Q Quit command A 2 R raw data analyze only a portion 5 16 some is unusable 5 16 unusable at 5 17 Raw Data view about 6 16 crosshair locator lines 6 22 initial display 6 16 line colors 6 17 See Also Sample window uses of data 6 17 Raw Data View button A 9 reactions sequencing defined Glossary 4 red checkbox in Sample Manager window 4 20 red text in Sample Manager window 4 7 6 19 Regenerate Gel Image command 5 Regenerate Gel Image dialog box 3 20 registration code entering 2 14 what to do if v 3 0 code is lost 2 6 registration number 2 2 registration number See Also registration code Remove button 4 4 Remove Files command 7 removing Basecaller Settings 5 31 installed Sequencing Analysis software 2 9 sample files from Sample Manager window 4 12 See Also deleting requirements hardware and software 2 3 2 5 reshaping tracker lines 3 30 3 36 resolution peaks illustrated 6 19 resume sample file processing 4 19 Resume button 4 4 Resume command A 7 Revert to Straight Tracking 3 38 row selector for control points 3 30 S SA194Tracker34SHK mat 5 SA388Tracker48SHK mat 5 SA388Tracker64SHK mat B 5 SA480Tracker96SHK mat 5 sample data extract 3 42 sample file checking that not analyzed 0 10 Sample FileName 4 5 Index 9 Search Find Again about field 5 3 changing 5 3 on printed electropherogram 6 35 sample files adding from Finder 4 8 c
216. o close the dialog box b Repeat this selection process with for the A G and T standards In each Start at text box either accept the default value or type the correct start point for analyzing that standard If you do not use the defaults use the numbers you wrote down during step 4 b on page D 19 Note For ABI 373 instrument data and ABI PRISM 377 instrument data the defaults of 2000 for start point and 1500 for data points is almost always appropriate For ABI PRISM 310 data you should look at the raw data to determine the start point and number of data points to include a start point of 2000 is usually satisfactory but 1000 is sometimes better Search Find Again To add or replace a matrix in an existing instrument file continued Step Action 5 In the Points text box either accept the default value or type in the number of data points to be used for the matrix If you do not use the defaults use the range of values you identified in the Raw Data view in step 4 b on page D 19 6 Choose the Update File button In the directory dialog box that appears select the name of the instrument file where you want to add the new matrix Then choose Open 8 Click the button for the appropriate matrix chemistry Dye Primer Taq Terminator or T7 Sequenase Terminator at the bottom of the Make Matrix dialog box IMPORTANT When you add a new matrix to an instrument file it overwrite
217. o do this Creating Instrument Files D 19 Search Find Again To view the instrument file continued Step Action Copy Matrix Source Instrument Comment Destination No Destination File Instrument Comment 3 Copy Primer Matrix 3 Copy Term Matrix 1 000 0 12 0 011 0 000 0 455 1 000 0 183 0 000 0 248 0 483 1 000 0 151 1 000 0 12 0 011 0 000 0 455 1 000 0 183 0 000 0 248 0 483 1 000 0 151 0 115 0 282 0 529 1 000 0 115 0 282 0 529 1 000 3 Copy T Term Matrix 1 000 0 127 0 011 0 000 0 455 1 000 0 183 0 000 0 248 0 483 1 000 0 151 0 115 0 282 0 529 1 000 Cancel 4 Make sure that all three matrix boxes have numbers that range from 0 1 The numbers on the diagonals from top left to bottom right should be 1 If not then repeat the matrix making procedure starting with Making a New Instrument File on page D 12 5 Click Cancel Quit from the DataUtility program D 20 Creating Instrument Files Search Inspect the Matrix Standard Files with Sequencing Analysis Find Again Verify the matrix standard files in the Sequencing Analysis application To verify matrix standards Step Action 1 Open the Sequencing Analysis program 2 Open the standard sample files used to create the instrument file 3 Use the electropherogram analyzed data view to confirm that the analyzed d
218. of the raw data you can start calling bases later in the raw data In such a case the Start Point value is greater than that of the Peak 1 Location value The Start Point value can never be less than the Peak 1 Location value IMPORTANT If you want to start analysis further along than the actual location of the first base peak change the Start point value not the Peak 1 Location value Changing the Peak 1 Location value affects the way the DyeSet Primer file is applied to correct for mobility shifts To have the Sequencing Analysis software recalculate the start point after you have changed a setting such as the DyeSet Primer enter a zero in the Start Point field and reanalyze the data Search Find Again The Stop Point Parameter About the Stop Point Changing the Stop Point The First Endpoint Encountered Is Used The Stop Point specifies the last raw data point to be included in the base calling If the default Stop Point is used this endpoint is the last data point in the file It is possible to stop base calling earlier if there is clearly unusable raw data at the end of the file or if you want to analyze only a portion of the raw data in the file Most often this is done for short PCR products to eliminate the unusable data at the end of the run Set an earlier Stop Point either by changing the values on the Basecaller Settings page of the Preferences dialog box page 5 28 or by entering an early Stop Point in the
219. on Single Page radio Prints all the information for the Electropherogram button view Raw Data view or EPT view on a single page If this button is selected the Number of Panels and the Number of Points text boxes are grayed out 6 32 Viewing and Editing Sample Files Search Page Setup and Printing Defaults Find Again Setting Description Variable Size radio Specifies the number of panels and data points to button print on any given page If you select Variable Size the two entry field options become available Number of Panels Specifies the number of panels of data to print on a Per Page text box page when printing Electropherogram view Raw Data view or EPT view These views are printed in tiled panels on the page For more information see Panels Per Page Text Box on page 5 35 Number of Points Specifies the number of data points to be included in per Panel text box each panel on the page Because all panels are the same width the peaks appear wider and flatter when you include fewer points For more information see Points Per Panel Text Box on page 5 35 Note default values for the text boxes are taken from the Printing Preferences Page see Page Setup and Printing Defaults below The default values for the Page Setup special settings options and for the Printing Options dialog box are determined by what is set in the Printing Preference dialog box described on pa
220. on of how well the tracker lines follow the fluorescence intensity within the lanes Search Find Again Lane assignment confidence values tend to be extreme numbers very low or very high Although a value of 70 or more generally indicates that the lane assignment for the gel is correct it is recommended that you check the tracker lane assignment anytime the reported lane assignment confidence value is less than 100 Comb Type The Neural Net Tracker uses special tracker settings files that are optimized according to the number of channels and lanes in the gel file mM and the comb type shark tooth 377 Itis important that you set the correct comb type to Shark Tooth in the Gel Preferences page so that the Tracker applies the correct tracker settings file The Processing Parameters 5 27 Search Find Again Basecaller Settings About the Basecaller Settings Page 310 373 377 The Default Setting Recommended Selecting a Set of Basecaller Settings 5 28 The Processing Parameters The Basecaller Settings tell the Basecaller program what rules to use to decide the analysis endpoint for each sample IMPORTANT The Basecaller stops when it reaches the Stop Point set in the Sample Manager window or an endpoint specified in the Basecaller Settings page whichever it meets first This page allows you to create multiple sets of Basecaller Settings then select one as the preference Preferences
221. ormats See Seq files File Name field 3 14 files Command Log 2 DyeSet Primer B 2 DyeSet Primer files naming convention B 8 ErrorLog B 3 input and output described B 1 B 9 instrument file B 2 located in System Folder B 2 B 3 MatLab mat B 7 not located in the System Folder B 4 B 7 preferences B 3 program files described 4 See Also gel file sample files and instrument file Seq text B 6 Tracker Extensions B 5 Tracker Settings B 5 Fill Down command A 3 filter sets 0 3 filter wheels 0 3 0 6 Find command 6 23 dialog box 6 23 Find Again command 6 24 A 3 Find command A 3 Find What field 6 24 five filter wheel 0 6 flowchart 310 sequencing 1 11 373 373 sequencing 1 12 font as status indicator in text fields 4 7 Base Letters Style printing only 5 41 5 42 Force Selected Lanes to Right command 3 26 A 5 four filter wheel 0 6 Full View command 6 39 8 G gel 3 45 gel file archive 3 45 contents 3 2 described B 4 displaying 3 5 file size 2 5 troubleshooting C 3 install new instrument file 3 21 3 22 location B 4 open manually 3 5 overview 3 1 reviewing 3 3 3 11 3 16 save 3 45 save selected information 3 45 See Also gel image track and extract 3 38 tracking 3 23 3 36 3 37 tracking and extracting 3 37 3 44 truncated 5 working with 3 1 3 47 File window D 3 about 3 6 3 10 move to next line 3 23 move to next line segment 3 23 gel image adjust contrast 3 17 defined 3 7 hide colors 3 17 no gelim
222. otal signals of each are equal Signal enhancement enhances the peak shape by applying a bandpass filter to the data Initial base calling locates the best candidate peak in each interval of 12 data points If none is found or the data is conflicting the software calls an N A final pass of the software adds or deletes bases based on the distance between each peak and its nearest neighbors The analyzed data and other information are stored in the sample file The Processing Parameters 5 43 Search Choosing a Basecaller Find Again The actual base calling is performed by the Basecaller program There are seven types of basecaller these are described under separate headings later in this section Choosing the most effective Basecaller for any given sample file depends on the quality of the data the type of run and the run and gel conditions The following information can help you decide which Basecaller is most suitable In addition you can try each Basecaller with some typical data to see which works best under your laboratory conditions Then If you have a use run on the ABI PRISM 310 that used d Rhodamine terminators ABI CE1 or BigDye primers BigDye terminators run on the ABI PRISM 310 that used Old Dye Terminators ABI CE2 24 or 34 cm well to read Full or XL Scan run on the ABI 373 ABI50 BaseSprinter or 373 18 run on the ABI 373 ABI100 average 1
223. ously opened with another version of Sequencing Analysis Ignore this message The Sequencing Analysis application regenerated the gel image Error 22 Could not do this task because of a program error Multicomponent matrix error Bad data Reanalyze the sample file with a better instrument file Error 43 Could not do this task because file not found The tracker application is missing Sequencing Analysis failed to launch the Tracker application Check that the Tracker application SAGelTracker is in the SAGelTracker folder in the Sequencing Analysis v 3 2 folder and that it is correctly named Error 61 Could not do this task because the edition is not a publisher Making changes to the Sample Sheet Ignore this message Changes to the Sample Sheet are saved despite the error message C 4 Troubleshooting Search Find Again Table of Common Error Messages continued Error Message Observed Symptoms Recommended Action 108 error Some Sample Manager window menu commands become unavailable Program produces erratic results or crashes Close unneeded windows and other programs Use the Get Info window to allocate more memory see To allocate more memory on page 10 for more details Error 40 SetMark Error Power Failure No gel image no scroll bar blank gel image In some cases gel file present with analyzed data Some cases will hav
224. ow these steps to install the Sequencing Analysis software Sequencing Analysis Software To install Sequencing Analysis from CD ROM disc Step Action 1 Insert the Sequencing Analysis CD ROM disc into the computer s CD ROM drive Open the Sequencing Analysis folder and read the About Sequencing Analysis 3 2 file in the folder This file contains information that is too new to be in the manual This sometimes includes information which affects the installation process Double click the Sequencing Analysis Installer icon When the Installer start up screen appears choose Continue The Installer dialog box appears Select the checkbox for the type of data you expect to analyze on this computer ABI Prism 310 only ABI Prism 37x only Both 310 and 378 Note installer loads only the required files based on the checkbox you select To begin the installation choose Install The following dialog box appears when installation is complete Installation was successful If you are finished click Quit to leave the Installer If you wish to perform additional installations click Continue Choose Quit Drag the Sequencing Analysis Installer CD ROM disc icon to the trash to eject the CD ROM disc Getting Started 2 7 Search Find Again To install Sequencing Analysis from CD ROM disc continued Step Action 9 Put the I
225. own Command D Copies the value in the topmost selected field to all other selected fields in the same column Preferences Opens a submenu with options one for each page 5 21 in the Preferences dialog box Allows you to change the values used by the Sequencing Analysis software when it processes gel files and sample files when it passes a file to the Factura program for further processing and when it prints Command Reference 3 Search Find Again The Gel Menu Gel Menu The table below lists and describes the commands accessible from the Commands Sequencing Analysis program Gel menu 310 Note This menu contains commands that affect gel files The menu is 373 present only if the Sequencing Analysis software was installed for use with 377 ABI 373 and ABI PRISM 377 instruments Keyboard See Command Shortcut Description Page Extract Command L Copies the raw fluorescence data and other run 3 42 Lanes information from the gel file to individual sample files Track Lanes Discards the current tracking information and 3 37 retracks the entire gel image Track amp Tracks lanes in the gel image and extracts the 3 38 Extract sample file data Lanes Hide Show Command K Turns the display of tracker lines off and on 3 29 Tracker Lines Gel Info Displays information about the run the gel used 3 12 and the gel image Gel Sample Displays the information that was included in the 3 13
226. p 1 on page 3 12 If not then a Install a new instrument file if necessary See Installing New Matrix Information on page 3 21 b Regenerate the image with the Multicomponent Gel Image box checked See Regenerating the Gel Image with Different Option Values on page 3 20 Tracking fails Comb Type on Gel Preferences page not set to Shark Tooth Select Preferences Gel Preferences from the Edit menu Set Comb Type to Shark Tooth Tracking fails Tracker application or settings files are misplaced or misnamed Check that the Tracker application SAGelTracker and the required settings file are in the SAGelTracker folder in the Sequencing Analysis v 3 2 folder Check that the files are correctly named refer to the list of settings filenames on page B 5 Tracking fails Not enough memory to run the Tracker application Choose About This Computer under the Apple menu Check to see that the largest block of unused memory is at least 20 MB If it is less than 20 MB you may need to defragment your hard disk using a defragmenting utility program e g Norton Utilities Tracking fails Sample lane does not contain red data Track lane by hand Troubleshooting 7 Search Find Again Troubleshooting Table continued Observation Possible Cause Recommended Action No base calling occurred when you chose Start to begin analysis No Basecaller is
227. pecify Page Setup Allows you to choose page size orientation and other settings for printing Print Command P Allows you to choose which pages to print the 3 47 number of copies etc and to start printing Quit Command Q Closes the Sequencing Analysis program A 2 Command Reference Search Find Again The Edit Menu Edit Menu The table below lists and describes the commands accessible from the Commands Sequencing Analysis program Edit menu Note availability of the various Edit menu commands depends on which type of window is currently active Gel File Sequence view Command Log etc Keyboard See Command Shortcut Description Page Undo Command Z Undoes the effects of the most recent command Some commands cannot be undone Cut Command X Cuts the selected item from the window and puts it on the clipboard Copy Command C Copies the selected item in the window to the clipboard Paste Command V Copies the current clipboard contents to the current cursor location Clear Cuts the selected item from the window and discards it without disturbing the current clipboard contents Select All Command A Selects the entire contents of an active Sample window Find Command F In Sequence view searches for a specific base or 6 23 a string of bases Find Again Command G In Sequence view searches for the next 6 24 occurrence of the string specified in the Find dialog box Fill D
228. per the File menu add the sample files to the Sample Manager and print by selecting the Print box only and clicking the Start button Troubleshooting 11 Search Find Again Troubleshooting Table continued Observation Possible Cause Recommended Action Printed sample file Check that all the printer settings are correct ormat is incorect Select the printer and printer driver through the Chooser Onthe Printing Preferences page of the Preferences dialog box a Formost printers make sure the PostScript Printer checkbox is selected If you have a non PostScript printer you may need to de select this option b Checkthat the Panels per Page and Points per Panel values are correct c Click the Page Setup Options button to open the Page Setup dialog box Check that all options are set correctly in that dialog box then close the dialog box d Click the Print Options button to open the Printer dialog box Check that all options are set correctly in that dialog box e Inthe Printer dialog box click the Options button to open the Print Options dialog box Check that the Color Grayscale button is selected in that dialog box Then close the Print Options dialog box and the Printer dialog box C 12 Troubleshooting Search Find Again Troubleshooting Table continued Observation Possible Cause Recommended Action Sequencing Analysis software unexpec
229. ple data with peaks representing the bases called for the sample View The spacing corrected scan line Example Sample ais amp Base called for 80 160 240 320 400 E this location CTTGCRTGCCT GCRGGTCGRCTCT AG AGGA a 10 20 30 J 1056 The number of the base at this 792 location 1 i fi h ll 528 MH n J N M il A i The peak at this ul nk a i position LAY A Epiri The normalized fluorescence intensity 6 12 Viewing and Editing Sample Files Search Correlation with Other Views Find Again Trace and Base Colors The trace lines and the letters above the peaks are colored to represent the four bases The Default Colors for the Bases Base Color C Blue A Green G Yellow or Blacka T Red a Gis shown as black when printed or shown against white on the screen Ambiguous Bases An N above a peak means that the software could not confirm that base or that there is more than one base at that position for example a heterozygote The default style is to have Ns displayed in bold type making them easier to find To alter this style see Base Letters Style on page 5 41 If the sequence has been processed by the Factura application you may also see IUB codes If you are using the default Mark Style in Factura IUB codes are displayed underlined and in red type
230. pply to your laboratory s procedures just open the ABI folder and drag the unwanted files to the Trash To remove the files only temporarily from the list drag the files to any folder other than the ABI folder The Basecaller algorithm needs the DyeSet Primer information to be able to apply the proper mobility shift corrections If you specified the wrong DyeSet Primer mobility file in the data collection software or used a different chemistry from the one for the selected DyeSet Primer file you can change this setting for each affected sample file and reanalyze the files Search Find Again Choosing the The table provides guidance for choosing the correct DyeSet Primer file Correct for the concentration of your gel or polymer For an explanation of DyeSet Primer File DyeSet Primer file names see DyeSet Primer File Naming Conventions on page B 6 Gel Type of Gel Polymer Polymer Instrument DyeSet Primer File 5 POP 6 ABI PRISM 310 DT or DP5 CEHV XX 6 Acrylamide ABI 373 or ABI PRISM 377 DT or DP6 Ac XX 4 75 Acrylamide ABI 373 or ABI PRISM 377 DT or DP69 eAc XX 4 25 Acrylamide ABI 373 or ABI PRISM 377 DT or DP4 Ac XX 4 5 Acrylamide Long Ranger ABI 373 or ABI PRISM 377 ABI 373 or ABI PRISM 377 DT or DP4 Ac XX DT or DP4 Ac XX The Processing Parameters 5 19 Search Find Again The Instrument File Parameter About the Instrument File Changing the Instrument File The Instrument File
231. printed 6 34 defined Glossary 2 troubleshooting printed C 18 view printed 6 34 Electropherogram view about 6 12 base calls in 6 20 Index 4 crosshair locator lines 6 22 edit base 6 28 hide original data 6 30 line colors 6 13 not available 6 12 Ns 6 13 See Also Sample window show original data 6 30 updated to match Sequence view 6 28 Electropherogram View button 9 ellipsis dots totype 6 26 E Mail for technical support 1 17 EPT Data View button A 9 EPT view about 6 18 crosshair locator lines 6 22 line colors 6 18 See Also Sample window switch to 6 18 Error 0 C 4 Error 22 C 4 Error 10023 5 Error 10024 C 5 Error 2700 C 5 Error 40 C 5 Error 43 C 4 Error 61 C 4 Error Log for troubleshooting C 2 location B 3 print C 15 review 6 19 C 14 Estimated Maximum Peak Height 3 21 Estimated Maximum Peak Height text box 5 24 Extract Lanes command 3 42 4 dialog box 3 42 F F checkbox 4 6 4 12 about 5 6 box colors 4 20 review 6 19 selected 5 33 Factura Search Find Again about preferences page 5 39 about program 1 14 5 39 manual 1 3 view features in sample file 6 6 6 11 Factura checkbox See F checkbox Factura Settings File 5 39 adding to pop up menu 5 40 false start behavior troubleshooting C 8 Fax on Demand 1 17 Feature view about 6 11 contents explained 6 11 See Also Sample window window empty 6 11 Feature View button A 9 features color marked 6 5 defined Glossary 2 fifth dye support 1 6 file f
232. quence File Formats 2 0 0 0 0 cece eee eens 5 38 Factura Preferences 42 5 39 Base Letters Style cases cce X Ra EGRE RR EE 5 41 About Basecallers and Base Calling 5 43 Viewing and Editing Sample Files 6 1 OVEDVICW RR E 6 1 Opening a Sample File in a Sample Window 6 3 The Six Sample Window 8 6 5 Annotation VIEW vein eee ee ek bet beue Re ee dc es 6 8 Sequence VIEW ba m ERR gea eR E pec 6 9 Feature View ee QU PT RERO DENS Vr a IER bg 6 11 Electropherogram View nets 6 12 Raw Data View e Caen eae bon RARE dee Ron hn 6 16 eee den en eere ud pierde 6 18 Reviewing the Analysis 6 19 Determining the Value for a Data 6 21 Finding Patterns in Sequence 6 23 Editing Analyzed Sequence 6 27 Showing Original Data in Electropherogram 6 30 Printing the Sample Window Views 6 31 Viewing Printed Electropherograms 6 34 Tiling or Stacking Windows 0 0c cece eee eee eee 6 37 Usi
233. r 123 in the Find What field to move the insertion point to the base character at position 123 Enter the range 123 250 to highlight all the base characters between number 123 and number 250 IMPORTANT Type Option semicolon to create the ellipsis dots between the numbers The summary graphic shows the relative position of the highlighted range E JE Sample j Em H CT CTTGTCGCCC RGGCRGGRGT GTRGTGGTGT CCTTRGTCTC CTGRGTRGCT RRTTTTTTT TGTRTTTTTR G A GCTGGTCTTG AACTCCTGAC CTCATGATCT RCCCRCCRTG GCCTCCCRRR GTGCTGGGAT TAGACGTGTG AGCCACCGTG CCTGGCCTGG TTGCAGATTT CTTTCRGCTC TTGTCRTTCC RGTTGRRGRG RGRCCRTTCT AGAGATGGCT GCAGGCAAGC RTTTRRRRCC TTTGRGRGRR CRRCRGCRCR TCRGGGRGRG RTRRTRCC RGGRRGTTGR GTRTGCTCTT Ae 6 26 Viewing and Editing Sample Files Search Find Again Editing Analyzed Sequence Data Introduction Editing Bases in Sequence View can You can use the Sequencing Analysis software to change a base that was Called by the software during analysis or to enter bases where the software called Ns To help you keep track of changes you can display the original unedited base calls in addition to the editable base characters You can edit the sequence directly in the Sample window either in Electropherogram view or in Sequence view Note original ABI PRISM instrument produced sequence data is always maintained in its unmodified state in t
234. r Panel text box 5 35 Points Base 1 on printed electropherogram 6 36 POP6 in DyeSet Primer filename 8 PostScript Printer checkbox 5 36 power and current during run 6 18 Pre Analysis Settings command A 7 preference values changes in Preferences dialog box 5 22 in Preferences dialog box 5 21 5 42 preferences defined Glossary 3 stored in Prefs file 2 16 Preferences command A 3 Preferences dialog box 2 17 change parameter values 4 15 5 22 Preferences files location B 3 Preferred Size text box 10 Primer Express about program 1 15 print A4 paper fails 11 Command Log C 17 Error Log C 15 Search Find Again fails C 6 gelimage 3 47 in color 2 12 multiple copies 2 12 on 3 hole punch paper 6 31 sample window views 6 31 wrong page format 12 Print command A 2 Print First Page only checkbox 5 36 Print Options button 5 37 Print Results 3 41 3 43 Print These 5 36 printer recommended 2 5 Printer dialog box 2 12 about 5 37 Printer Options dialog box 2 12 Printing checkbox See P checkbox Printing Options dialog box 6 31 Printing Preferences about preferences page 5 34 5 37 Process Gel Script 5 processing parameters 5 1 5 46 defined 5 1 preferences setting initial 2 16 2 17 See Also parameter values processing sample files 4 1 4 21 overview 4 2 Product Registration dialog box 2 14 program files described B 4 Project Comment field 3 14 Project Name field 3 14 Project Names editing and adding in pop up me
235. r or if you are uncertain about how to set a preference use the default setting The preferences are stored in the Seq Analysis v 3 2 Prefs file which is located in the Preferences folder in the System Folder To return all the preferences to the original installation defaults delete the Seq Analysis v 3 2 Prefs file Search Find Again Before Using Before using Sequencing Analysis software review and edit if Sequencing necessary the processing parameters preferences shown in the Analysis Preferences dialog box which is accessed from the Preferences item of the Edit menu Gel Sample Manager Window Can t Undo Z Cut 36H Copy 3C Paste aeu Clear Select RII 3A Find Find figain 366 Fill Down te Gel Preferences Basecaller Settings Sample Manager Defaults Printing Preferences Sequence File Formats Factura Preferences Base Letters Style Please read pages 5 21 to 5 42 for detailed information about the processing parameters and how to change them When Do You can open the Preferences dialog box and change these processing Preferences Take preference values at any time The new values take effect when you Effect close the Preferences dialog box Getting Started 2 17 2 18 Getting Started Search Working with the Gel File Overview In This Chapter 373 377 Find Again This chapter contains information about how to view and edit
236. r recalculates the spacing Note Since the Basecaller application calculates spacing based on average later in the run if you are sequencing short PCR products you are particularly likely to benefit from entering spacing calculated from early in the run as described in the procedure below To change the spacing for a sample Step Action 1 Open the sample file 2 Click the Raw Data view button 3 a Zoom command to enlarge the view until peak spacing is easy to see 4 Use the cross hair cursor to determine the scan number at the approximate beginning and end for a typical peak Then subtract the smaller number from the larger number to determine the spacing 5 Enter the spacing value into the Spacing field for that sample The Spacing field is outlined in blue to indicate that you have overridden a calculated value and the value entered is in bold indicating that the value has been changed in this session The Processing Parameters 5 9 Search Find Again The Basecaller Settings Parameter About the Basecaller Settings 5 10 The Processing Parameters The Basecaller Settings are features of the Basecaller program which automatically truncate sample file analysis To change the Basecaller Settings for a file choose the name of a parameter value set from the pop up menu The available parameter value sets are the ones you created in the Preferences dialog box For more information see
237. raction Generates a new sample data only for each lane with a white lane marker Note If a lane is not marked with a white lane marker and you want to mark it as modified click the lane marker while holding down the Option key or select the marker and choose Mark Lane for Extraction from the Gel menu The marker turns white Over Write Original Sample Files If you select this checkbox the newly generated files will have the same names as the old files and the old files are lost If you deselect this checkbox a number is appended to the name for each newly generated file and the original files are preserved Auto Analyze Automatically analyzes the sample data after New Sample extraction is finished Deselect this if you want Files the sample data extracted but not analyzed Analyze All Analyzes all the sample data created from the Files gel Print Results After analysis prints the analysis results for all the new sample data Use Sample Sheet Settings Analyzes and prints the sample data as designated in the Sample Sheet Save Gel after Extraction Saves tracker lines and other gel file modifications to the gel file after extracting the sample data If you do not select this the settings used for the extraction are discarded when you close the gel file without saving When all of the information in the Extract Lanes dialog box is correct click OK to begin extracting data
238. rates powerful algorithms for pairwise or multiple alignment of DNA and protein sequences AutoAssembler DNA Sequence Assembly Software allows you to assemble small pieces of DNA into larger contiguous segments Search Programs for Find Again of DNA using ABI PRISM genetic analysis instrument data as well as other sequence text files EditView is a free DNA Sequence viewer that allows you to view edit and print sequence data from an ABI PRISM 378 377 or 310 Genetic Analyzer Using EditView on your Macintosh computer you can open an analyzed sample file and view the sequence data either as an electropherogram traces or in text format You can then edit individual bases export the data to a text file or print it EditView is available on the PE Applied Biosystems web site at http Awww perkin elmer com ab Primer Express is a primer design program with an easy to use interface The software is applications oriented taking into consideration the most updated criteria for primer design In addition to sequencing applications you can perform sizing and Fragment Analysis quantifying applications with the genetic analysis instruments To do so you must use the GeneScan Analysis Software instead of the Sequencing Analysis software For further analysis of GeneScan data you can use the Genotyper Fragment Analysis Software which converts data from GeneScan results files into the format required by downst
239. ream applications such as linkage analysis programs databases or spreadsheets About This User s Manual 1 15 Search Find Again Technical Support To Reach Us On Our web site address is http www perkin elmer com ab the Web Hours for Telephone Technical Support To Reach Us by Telephone or Fax 1 16 About This User s Manual We strongly encourage you to visit our web site for answers to frequently asked questions and to learn more about our products You can also order technical documents and or an index of available documents and have them faxed to you through our site see the Fax on Demand section on the following page In the United States and Canada technical support is available between 5 30 a m and 5 00 p m Pacific Time These hours are for all products except the following two Chemiluminescence 9 00 a m to 5 00 p m Eastern Time LC MS 9 00 a m to 5 00 p m Pacific Time See the Regional Offices section that follows for information on how to contact local service representatives outside of the United States and Canada Call Technical Support at 1 800 831 6844 and select the appropriate option below for support on the product of your choice at any time during the call To open a service call for other support needs or in case of an emergency press 1 after dialing 1 800 831 6844 The BioLIMS system press 25 Fax 650 638 5891 DNA Synthesis press 21 Fax 650 638 5981 Fluorescent DNA
240. rep search expressions or offset instructions For details see About Search Expressions on page 6 25 Select the radio button that matches the type of instruction entered in the Find What field For details see About Search Expressions on page 6 25 Select or de select the two checkboxes as needed Check Case sensitive to have the upper and lower case variants of a letter be recognized as different symbols If this checkbox is not selected the Sequencing Analysis software considers upper and lower case versions of a character to be the same for example A and Check Wrap around to have the search start again at the beginning of the sequence after it has reached the end If the Wrap Around checkbox is not selected the search stops at the end of the sequence Choose Find to start the search The Sequencing Analysis software highlights the first instance of the specified pattern and marks its position in the summary graphic at the top of the sequence window To find other occurrences of the same pattern Choose Find Again from the Edit menu This allows you to bypass the Find dialog box and search for the next occurrence of the specified pattern 6 24 Viewing and Editing Sample Files Search Find Again About Search Expressions 4 Literal IUPAC IUB Grep Offset Literal In the Find dialog box choose one of four different types of search Choose Literal to search for
241. rocessing samples and to specify whether or not all the files will be Page base called processed in Factura and or printed Basecaller 5 32 The Processing Parameters Preferences Page Sample Manager Defaults Basecaller SemiAdaptive Y Analysis Factura Printing There four parameters on the Sample Manager Defaults page Basecaller pop up menu Analysis checkbox Factura checkbox Printing checkbox These are described in detail below The Basecaller is the program that determines the individual base identities in a sequence To choose a Basecaller select the name from the Basecaller pop up menu The Sequencing Analysis software package includes the Basecaller stand alone application During analysis the Sequencing Analysis application automatically calls the Basecaller application For an explanation of Basecallers and how to choose the best one for your data see About Basecallers and Base Calling on page 5 43 Search Analysis Factura Printing Find Again Note Basecaller application must be stored in the same folder as the Sequencing Analysis application At installation it is placed in the same folder as the Sequencing Analysis application If the Analysis checkbox is selected the Sequencing Analysis software selects the A checkbox in the Sample Manager window for each file that you add to the Sample Manager When files are a
242. s also omitted when the view is printed Note base calls shown on the line at the top of the Electropherogram view window cannot be selectively turned off To change the color of a trace line use the Show Data color bars a Click the color bar to open the Color Picker dialog box b Click the color you want to use or enter numeric values in the text fields c Choose OK to close the dialog box and change the color The color change applies to all sample files displayed until you again change the line color in this dialog box This change does not affect the colors used on printed Electropherogram Raw Data or EPT views 6 42 Viewing and Editing Sample Files Search Find Again To change trace line or scale display continued Step Action 5 To toggle the display of the vertical and horizontal rulers use the Show data points checkbox Vertical and horizontal rulers Display without rulers Normally the show data points option is selected If you select Show Real Values for the vertical scale see Show real values below the maximum vertical value is normally about 1200 full scale and the tick marks are too close together to be useful Under those conditions deselect Show data points To change the horizontal and vertical indexing of the rulers edit the Counts Per Tick text boxes Horizontal The unit of measure the count on the
243. s any existing matrix of the same type It has no effect on the other matrices in the file 9 Choose OK to start the matrix calculation The calculation takes about one minute 10 When the message Make matrix successfully completed appears choose OK or wait about 20 seconds for the dialog box to disappear If an error message appears and the matrix is not made see Correcting Errors in Matrix Creation on page D 28 11 Analyze the new matrix standard verify the accuracy of the instrument file and properly store the new file as described in Verifying the Instrument File on page D 19 and in Storing and Backing Up the Instrument File on page D 24 Creating Instrument Files D 27 Search Find Again Correcting Errors in Matrix Creation Introduction This section describes the two most common problems that can occur during matrix creation and how to resolve each problem Ifthe signal is too weak see below Ifan error message reports that the matrix was not made successfully see page D 29 Signal Too Weak If the signal size for any of the data is too small an error message appears and the matrix is not made To correct for weak signal Step Action 1 Open the Sequencing Analysis program 2 Open sample file for the standard in the Sample window 3 Choose Raw Data from the Window menu 4 Find a data range with about 1500 points with reasonable signal strength Write down the start po
244. s more than one nucleotide peak indicating the possible presence of different alleles instrument file A file stored in the ABI Folder inside the System Folder The file contains one to three matrices a Comment field where you can enter comments about the file and an Instrument Name field where you can enter the name of the instrument the file is to be used with This file defines the matrices used to correct for the spectral overlap between the fluorescent dyes used on the ABI Prism genetic analysis instruments A mathematical matrix of the spectral overlaps is created and the inverse matrix is used to correct the data during analysis This file is also sometimes called the matrix file because it contains one or more matrices code An alphabetic character representing the occurrence of mixed bases at a given position in a sequence These codes were originally defined by the International Union of Biochemistry The table below contains a table of IUB codes the mixed bases they represent and a listing of the complements IUB Codes Base IUB Code Complement Adenosine A T Cytidine Guanosine Thymidine Adenosine or Guanosine puRine Cytidine or Thymidine pYrimidine Ax DADO lt lt gt Guanosine or Thymidine Keto Glossary 2 Search Find Again IUB Codes continued Base IUB Code Complement Adenosine or Cytidine aMino M K Guanosine or Cytidine Strong bonds S W Adenosine or Thymidine
245. s of analyzed data including printed electropherograms are as follows Color Guide for All Analyzed Data Base Color C Blue A Green G Blacka T Red a G is shown as yellow in AutoAssembler software Creating Instrument Files D 5 Search Find Again ABI 373 Instrument Configurations Three Filter Wheels Instruments With a Four Filter Wheel Instruments with a Five Filter Wheel D 6 Creating Instrument Files There are three filter wheels for the ABI 373 instrument The four filters contained in the filter wheel are unique to your instrument The wavelength centers of detection of the individual filters are 531 560 580 and 610 nm Use this filter set only with Old Dye Primers and Old Dye Terminators The table below summarizes the relationship between the filters and dyes for the individual sequencing reaction chemistries Four Filter Wheel Filter Center Band nm Old Dye Primers Old Dye Terminators 531 C Rxn ddG 560 A Rxn ddA 580 G Rxn ddT 610 T Rxn For more details see the AB PRISM Automated DNA Sequencing Chemistry Guide P N 4305080 or the instrument User s Manual The five filters contained in the filter wheel are unique to your instrument The wavelength centers of detection of the individual filters are 531 545 560 580 and 610 nm Only four of the filters are used for each sequencing run one for each dye Two filter sets A and B are available with the five filter whe
246. s the mouse button to open the menu Highlight the value you want to select then release the mouse button Ifthe field has neither a checkbox nor a menu icon double click the field to activate the text entry cursor Then type in the new value Search Changing Parameter Values in the Preferences Dialog Box Find Again To Change the Same Value for Several Files Step Action 1 Change the parameter value in the first field where you want to make the change 2 While the new value is still highlighted hold down the Shift key or Command key and select the remaining fields that you want to change to the new value 3 Choose Fill Down from the Edit menu The Fill Down command copies the value in the first selected field to all the other selected fields in the column To Revert to the Original Values for the Parameters Step Action 1 Select the Sample File Name for the sample that you want to change back to the original values The entire row becomes highlighted 2 Choose Pre Analysis Settings from the Manager menu All the values for the selected sample are changed to the value specified in the sample file at the time of original analysis no matter how many times the values have been modified since they were entered in the file When you change a processing parameter value in the Preferences dialog box the new value is used for all future processing until you chang
247. s used X96 The approximate percent of the gelling agent that was used Ac Acrylamide For ABI 373 and ABI PRISM 377 runs the type of gel used Currently PE Applied Biosystems offers files which are compatible with acrylamide type gels LR LongRanger For ABI 373 and ABI PRISM 377 runs the type of gel used POP6 For ABI PRISM 310 runs which use performance Optimized Polymer POP 6 polymer DSP For ABI PRISM 310 runs which use DNA Sequencing Polymer CEHV Capillary Electrophoresis High Viscosity For ABI PRISM 310 runs which use capillary electrophoresis XX The filter set and primer Example 1 The filename DP4 Ac 21M1 3 indicates Dye Primer chemistry DP 4 acrylamide gel 4 Ac The 21 M13 primer 21M13 B 8 Input and Output Files Search Find Again Example 2 The filename DT5 CEHV B Set AnyPrimer indicates Dye Terminator chemistry DT 5 capillary electrophoresis 5 CEHV Any unlabeled primer requiring Filter set B B Set AnyPrimer Input and Output Files B 9 B 10 Input and Output Files Search Troubleshooting Overview Introduction If You Don t Find Help Here In This Appendix Find Again This appendix describes various problems that can occur when using the Sequencing Analysis software and what to do about each problem For additional information about troubleshooting sequence data see the
248. se the Remove button to remove the files you do not want in the list Note find a file in the list quickly highlight the name of any file in the list Then begin typing the name of the file you want As you type the highlight moves to the first file name that matches the character you have typed Search Find Again To add sample files from within the window continued Step Action 4 When all the files you want are in the lower lists click the Done button to close the dialog box and add the files to the Sample Manager x 10101 12 4 9 3 56 Y c Jane s Eject Desktop Sample Files Sample 02 Sample 03 Add All Sample 04 Sample 05 Remove Processing Sample Files 4 11 Search Find Again Moving and Removing Sample Files from the Sample Manager Window Introduction To Move a File Within the Window To Remove a Sample File 4 12 Processing Sample Files You can remove a sample file from the Sample Manager window at any time as long as the program is not currently processing that file You can also rearrange the order that the sample files appear in the Sample Manager window Note You do not have to remove a file from the list in order to avoid processing it The Sequencing Analysis software decides whether or not to process files based on the current information in the A F and P checkboxes if the checkbox for a process
249. se the scroll bars to bring other parts of the window contents into view Processing Parameters The processing parameters are defined briefly in the table below For more details about processing parameters see Chapter 5 The Processing Parameters Note If you change the value for a processing parameter in the Sample Manager window or if the software encounters a problem with the selected value the condition is reflected by a change in the appearance of the value in the window This is explained in the table Sample Manager Field Status Indicators on page 4 7 Parameters for Processing Sample Files Parameter Description Sample File Name The name of the sample file This is originally taken from the File Name field in the Sample Sheet You cannot change the Sample File Name from within the Sample Manager window but after the file is created you can change it in the Finder using normal Macintosh operations If you double click on the Sample File Name for a file the Sequencing Analysis software opens that sample file Sample Name The name of the sample as it is recorded in the sample file The name is originally taken from the data collection Sample Sheet The name can be edited in this window but changing the name will un link the sample file from the Sample Sheet If this box is checked the file is analyzed when you select the Start button in the Sample Manager window The color of the
250. sis This software package includes the following utility programs in addition to the main Sequencing Analysis program The Neural Net Tracker program performs the tracking determining the center of the gel lanes The Tracker program is called by the Sequencing Analysis software to processing gel files from a ABI 373 or ABI PRISM 377 instrument The Basecaller program performs the actual base calling operation Once you select the Basecaller to be used the Sequencing Analysis program automatically opens and applies that Basecaller at the appropriate analysis step The DataUtility program is used to make matrices for instrument files which are used with the data collection and analysis software and to monitor noise levels during troubleshooting by PE Applied Biosystems technical specialists After you analyze the raw sample data with the Sequencing Analysis software that analyzed data can be further processed in any of the following software programs Factura Feature Identification Software identifies specified vector and ambiguity ranges restriction sites and a specified confidence range It also identifies multiple base positions with codes described by the International Union of Biochemists IUB codes based on a user defined threshold This program is used to prepare the sequence for further analysis using only the target DNA Sequence Navigator DNA and Protein Sequence Comparison Software incorpo
251. squares 19 20 21 22FE 2425 26 27 8245p Control point not selected 1 Control point selected Row selector The operations that you can perform on control points are Selecting and deselecting below Moving page 3 31 Adding and deleting page 3 32 Selecting Control Points Before you can move a control point you must select it Methods for selecting are Click on the control point this method only allows you to select one control point at a time no shift select allowed Drag to select one or more control point Select a complete row of control points by clicking on the row selector red triangle to the left or right of the gel image Search Find Again If a control point is already selected you can select the point immediately above or below it using the up or down arrow key In vertical expand mode if a control point is already selected you can select the point immediately above or below it and scroll to that new point by holding the shift key down when pressing the up or down arrow key Moving Control Points To optimize data extraction from the gel file move the control points so as to center the tracker line over the most intense signal in the lane Use the slice view as a guide Methods for moving control points are Drag the control point with the mouse only one point at a time can be moved with this method Use the left and right arro
252. stration and Warranty 2 2 Hardware And Software Requirements 2 3 Installing Sequencing Analysis 2 6 Setting Up the Sequencing Analysis Program 2 10 Selecting Processing Preferences 2 16 Getting Started 2 1 Search Find Again Registration and Warranty License and Warranty Registering Your Software 2 2 Getting Started Before you begin please read the License and Warranty in Appendix F It explains your rights and responsibilities regarding this software To register your copy of the Sequencing Analysis software fill out the registration card included in this software package and return it to PE Applied Biosystems This enables us to send you notification of software updates and any other future information that may be specific to Sequencing Analysis owners IMPORTANT Your product registration number is located on the Registration card Be sure to record this number here before you return the Registration card Registration Number Search Find Again Hardware And Software Requirements Introduction If Using an ABI 373 Instrument 373 3L Computers Connected to ABI Instruments The Sequencing Analysis software can be installed on the Macintosh computer connected to your ABI PRISM instrument or on any other Macintosh computer that meets the minimum requirements stated below The software can be installed on a computer used for analysis only as well as on one used
253. t file from a sample file Step Action 1 Before making the matrix verify that lane tracking is accurate Adjust if necessary 2 Duplicate the unanalyzed sample file three times Use the Duplicate command from the File menu in the Finder You will have a total of four copies of the same sample file with the following names Sample name Sample name Copy 1 Sample name Copy 2 Sample name Copy 3 These four sample files can now be used in the same way as the four matrix standard samples The same instructions can be used with these four samples as with the four matrix standard samples Search Find Again To create an instrument file from a sample file continued Step Action 4 For Filter Set A instrument files Follow the directions in your instrument user s manual Whenever the protocol indicates a specific matrix standard to be used follow the table below Matrix Standard Standard File C Sample name Sample name Copy 1 Sample name Copy 2 A G Sample name Copy 3 For Filter Set E instrument files Follow the directions in Appendix A of the protocol for your sequencing chemistry Whenever the protocol indicates a specific matrix standard to be used follow the table below Matrix Standard Standard File dR110 Sample name dR6G Sample name Copy 1 dTAMRA Sample name Copy 2 dROX Sampl
254. tedly quits Running the Sequencing Analysis software and another RAM intensive program at the same time may cause the same problem Do not run the Sequencing Analysis software at the same time that you run another RAM intensive program Signal strength is below 40 It is important that the signal from your sequence samples be higher than the background fluorescence of the plate and gel an average signal strength of 40 or above is generally adequate If the signal strength number for any of the four bases in the sample is below forty there might be a problem with the data Signal strength numbers are shown in Annotation view of the Sample window and in the header of the printed electropherogram Two possible causes are a Thereported signal strength number for each base is an average value calculated over the range of analyzed data points If the Start point and Stop point are not defined correctly data values on either end of the run can skew the averaged value b The sample or reaction did not work well or the data is too weak Examine both your raw data and your analyzed data closely for possible problems If appropriate change the analysis Start and Stop points then reanalyze the data Ifthe sample or reaction was not satisfactory rerun the sample Note Signal strength is very dependent the chemistry For example the dRhodamine terminator chemistry t
255. th the Data Collection software and the Sequencing Analysis Basecaller program Instrument file also called the matrix file input ABI folder Contains three mathematical matrices that correct for spectral overlap The matrix to be applied to the data is specified by the user prior to analysis based on the dyes and the chemistry used to prepare the samples Command Log output ABI folder Lists all commands performed by the Sequencing Analysis software either as requested directly or in the course of analysis Note If this file is deleted or removed from the System Folder a new log file is generated by the Sequencing Analysis application B 2 Inputand Output Files Search Find Again Input and Output Files Necessary in the System Folder continued Folder Location in File Type System Folder Description Error Log ABI folder Lists all errors that occurred during analysis output Note If this file is deleted or removed from the System Folder a new log file is generated by the Sequencing Analysis application Preferences files Preferences folder Record Preferences selected in the Sequencing Analysis program input Note If this file is deleted or removed from the System Folder a new default preferences file is generated by the Sequencing Analysis application Input and Output Files B 3 Search Find Again Input Files Not Located in the System Folder Intro
256. that the latest generated sample does not reflect the saved tracking information If a lane marker is selected it has a red border If the Tracker has inferred a lane for some reason the lane marker has an orange border Working with the Gel File 3 27 Search 3 28 Working with the Gel File Find Again To mark all lanes for extraction Step Action 1 From the Gel menu select Mark All Lanes For Extraction The markers for all Used lanes turn white If you choose the Extract Lanes command the Sequencing Analysis software will use the current tracker line locations to extract the data in all Used lanes and put the extracted data into new sample files To mark a single lane for extraction Step Action 1 Click the lane marker to select the lane that you want to mark for extraction 2 Either choose Mark Lane For Extraction from the Gel menu or Press the Option key and click the lane marker The lane marker becomes white with a red outline When you choose the Extract Lanes command the Sequencing Analysis software will use the current tracker line locations to extract the data in this and other similarly marked lanes and put the extracted data into new sample files Note This option is useful if you want to re extract data from only selected lanes or if you want to extract data from a lane that was not automatically extracted To unmark a lane that is marked for extraction Step
257. the gel file and how to generate sample files after editing the gel file Note This entire chapter applies to the gel file which is generated by the ABI 373 DNA Sequencer Instrument and the ABI PRISM 377 DNA Sequencer Instrument If you are using an ABI PRISM 310 Genetic Analyzer or working only with analyzed sequence data ignore this chapter This chapter includes the following topics Topic See Page Displaying the Gel File in the Gel File Window 3 5 About the Gel File Window 3 6 Checking the Gel File 3 11 Adjusting the Gel Image 3 17 Adjusting Lane Markers and Tracker Lines 3 23 Tracking Lanes in the Gel File and Extracting the Data 3 37 Saving Gel Files 3 45 Printing the Gel Image 3 45 Working with the Gel File 3 1 Search The Gel File Stores Raw Data Neural Net Tracker Problem Gel Files 3 2 Working with the Gel File Find Again The gel file stores the raw data collected during the entire run of a ABI 373 or ABI PRISM 377 instrument Initially the file contains the raw data collected during the run a gel image a color picture similar to an autoradiogram a copy of the data collection Sample Sheet and a copy of the instrument file After lane tracking and editing the file also contains the lane tracking information and any changes you make to the original information in the file The Neural Net Tracker is a stand alone application that is called as needed by the Seq
258. the original sample files the software creates new sample files with a dot and a number appended to the original names for example if file named MySample exists the program will create files named MySample 1 MySample 2 etc See also Note below Auto Analyze Analyzes the sample data after extraction is after finished De select this if you want the sample Extraction files extracted but not analyzed Analyze All Analyzes all the sample files created from the Files gel file Print Results After processing prints the processing results for all the new sample files Use Sample Analyzes and prints only those files that are Sheet Settings marked for analysis and printing in the Sample Sheet for the gel file Select this option if you want to process only some of the new sample files created from the gel 3 Click OK to start tracking and data extraction Sample files are written to the run folder in the same folder as the gel file If the run folder does not exist one is created Note To cancel the Track and Extract process at any time press Command period and choose Cancel in the alert box that appears Note If a series of numbered files exist you discard one of the files and you then have the Sequencing Analysis software re extract that sample the Sequencing Analysis software uses the first available number to the new file Working with the Gel File 3 41 Search Extracting the Sample Data 3 42 Working with th
259. tic Factura processing to occur select None For more information about this file see Factura Feature Identification Software User s Manual The Processing Parameters 5 39 Search Find Again Adding a File to add a program or settings file to the pop up menu the Pop up Menu 5 40 The Processing Parameters Step Action 1 Select Other from the pop up menu A directory dialog box appears Only the names of folders and files of the specified type are visible in the directory lists 2 Locate and select the name of the program or settings file you want to add to the list Then choose Open When you choose Open the complete file name and path name are added to the corresponding pop up menu Search Find Again Base Letters Style About the Base On the Base Letters Style page specify the font size and style for the Letters Style Page base letters and Ns that appear on printed Electropherogram views For the Ns select the color of the letters Scaling of the printed base peaks is adjusted according to the font size selected IMPORTANT If you pick an extremely large font the base call letters will not line up correctly with their corresponding electropherogram peaks Preferences Page Base Letters Stule X Base Letters Font Style for printing only Set Style for Q Base Letters N s Style Size Style Color Example RCGTN RCGTN RCGTN RCGTN A
260. tically disabled when memory is low See the following problem Out of Memory dialog box appears Troubleshooting 9 Search Find Again Troubleshooting Table continued Observation Possible Cause Recommended Action Out of Memory dialog box appears during tracking or extracting of a gel Too many windows are open and there is not enough memory for tracking and extracting During the Track and Extract phase of gel processing almost all of the program memory is required for the gel processing a Do nottry to extract data while you have two gel files or one gel file and several sample files open b If you must have those windows open at the same time allocate more memory to the program as described below To allocate more memory a Quitthe Sequencing Analysis program b Inthe Finder click the Sequencing Analysis program icon once to select it Then choose Get Info Command l from the File menu IMPORTANT Do not double click the icon The program must remain closed c Highlight the number in the Preferred Size entry field in the lower right corner of the Get Info window then type a larger number in its place LLL 7 Memory Requirements i i Suggested size 6500 K i i Minimum size 6500 K Preferred size 6500 K Type a larger number here d Click the close box at the top left corner to close the Get Info window When
261. to a file the new matrix overwrites any existing matrix of the same type in that file From the Destination pop up menu see following figure select the type of file into which you want to copy the selected matrices De select the checkbox for any matrix you do not want to copy opy Matrix Source Instrument file Instrument machine 128 5 19 90 Comment recreated from Gel File 2M Sample File Existing Instrument File Gel File New Instrument File lestination Instrument Comment Copy Primer Matrix Copy Taq Term Matrix Select the 1 000 0 550 0 003 0 002 1 000 0 362 0 003 0 001 0 663 1 000 0 273 0 000 0 632 1 000 0 290 0 000 checkbox to 0 332 0 539 1 000 0 140 0 313 0 662 1 000 0 150 0 160 0 275 0 558 1 000 0 156 0 524 0 595 1 000 the matrix p Term Matris tance No T7 Sequenase matrix present in file Search Find Again To copy a matrix from one file to another file continued Step Action 7 In the directory dialog box that appears do one of the following For file types Sample File Existing Instrument File and Gel File locate and select the name of the file into which you want to copy the selected matrices Then choose Open For file type New Instrument File name the new instrument file with the instrument s serial numb
262. tracker lines See page 3 37 If you change any of the gel file or Sample Sheet information after extracting the sample data re extract the data from the edited lanes to regenerate the information in the sample files See page 3 42 Working with the Gel File 3 3 Search Find Again IMPORTANT Review the gel file to see that all lanes were correctly labeled and tracked before data extraction Do this before you view or edit any analyzed data from this gel 3 4 Working with the Gel File Search Find Again Displaying the Gel File in the Gel File Window The Gel File Window Displaying the Gel File after Automatic Analysis Opening a Gel File Manually What Next The Gel File window allows you to observe sample migration lane tracking and signal strength in the gel image You can also easily adjust the image to improve visibility realign individual lane markers and edit the position of the tracker lines For details about the Gel File window see About the Gel File Window on page 3 6 After automatic analysis the Gel File window opens and displays the newly created gel file To set up automatic gel file analysis select Autoanalyze with Sequencing Analysis on ABI PRISM 377 instruments or Analyze All Samples on ABI 373 instruments in the data collection program before you start the sequencing run Note If the Gel File window is not visible on the screen after automatic processing it may be hidden behi
263. traction but not tracking The Tracker doesn t refer to the Sample Sheet until after tracking It then sets lane assignment confidence values according to how well the tracked lanes match the Sample Sheet About the Sample Sheet The Sample Sheet looks like this Sample Sheet Gel File EE Sequence Analysis Sample Sheet Used File Name Sample Comments DyeSet Primer Inst File A Project Name Project Comment Project Owner 0 1 D1e20ul 1 20u1 1 6001 Isopropanol BDT E set anyprifh Jfar mtx 10101 0O 2 02020u1 2 20u1 2 6041 isopropanol EDT E set mtx 10101 f gt 5 ose20u s 201 5 600 Isopropanol BOTIE set mtx 10101 D 4 D 040201 4 20014 600 Isopropano1 EDT E set Jfar mtx 10101 f gt 5 Dd osezours 2045 6001 IsepropanoT EDT E set mtx 10101 P C2 LT 6 6 2 2016 6001 Isopropano1 EDT E set mtx 7 Dd 07e20u 7 200 7 6001 Isopropanol EDT E set Jfar mtx 10101 P 8 osezous 2008 6001 Isopropanol EDT E set Jfar mtx 10 JE LT 9 _ 09020u1 9 2001 9 6001 Isopropano2 EDT E set
264. trument Files Although the dyes fluoresce at different wavelengths there is some overlap in the spectra To correct for this overlap when analyzing data a mathematical matrix is created for each dye set and stored in a file called the instrument file The instrument file must contain a matrix for each chemistry that you run on the instrument During data analysis the appropriate matrix is applied to remove any spectral overlap The instrument file normally contains Three matrices comment field Aninstrument name field These can be seen in the Copy Matrix window in the DataUtility program A copy of this instrument file is attached to every gel file and sample file when these files are first created For this reason each computer on which you use the Sequencing Analysis program must have an instrument file in the ABI folder which is located in the System Folder IMPORTANT Due to slight variations in the filters of the ABI 373 instruments and the CCD cameras of the ABI PRISM 377 and ABI PRISM 310 instruments the instrument file created for your ABI PRISM genetic analysis instrument is sub optimal for other ABI PRISM genetic analysis instruments If you analyze sample files on a different computer from the one that was used to collect data be sure to copy the correct instrument file s to the analysis computer When each ABI PRISM genetic analysis instrument is installed an instrument file is created specifically for that
265. tting Started 2 11 2 12 Search Getting Started Find Again To start Sequencing Analysis for the first time continued Step Action 4 Choose OK to save the selected page setup to the Seq Analysis v3 2 Prefs file and close the Page Setup dialog box IMPORTANT Each time the printer selected in the Apple Chooser is changed you must open the Page Setup dialog box to reestablish the default selection When you close the Page Setup dialog box the Sequencing Analysis software opens the Printer dialog box Printer DeskJet 1600CM 821 Copies 1 Pages amp All From To Paper Source Destination i amp RII First from amp Printer O File 5 Select the printer settings that you want to use when printing is done as a part of automated sample file processing The exact contents of this dialog box depend on your printer To print multiple copies of each page enter the number of copies desired in the Copies field To ensure base letters on the electropherogram print in color Click the Options button to open the Printer Options dialog box Print Options Cover None Before After Document Print Color Grayscale w Print Quality Printer s Current Setting v E PaperType Printer s Current Setting Print in Grayscale Printer s Current Setting w 5 Select Color Grayscale for the Print option then choose OK to close the Print Options
266. uencing Analysis Software Problems C 7 Reviewing the Sequencing Analysis Error Log C 14 Reviewing the Sequencing Analysis Command Log C 16 Troubleshooting with the Printed Electropherogram C 18 Creating Instrument Files D 1 rcu Ln D 1 Summary of the Instruments and Chemistries D 2 Colors in Real Time Data Display Windows D 3 ABI 373 Instrument D 6 The Instrument File 0 0 eee eee D 8 Running Standards and Viewing Raw Sample Files D 10 Making a New Instrument D 12 A Worksheet for Instrument File D 16 Verifying the Instrument File D 19 Making an Instrument File from a Sample D 22 Search Find Again Storing and Backing Up the Instrument D 24 Adding or Replacing a Matrix in an Existing Instrument File D 25 Correcting Errors in Matrix Creation D 28 Viewing and Copying D 30 Apple Scripling 1 OVERVIEW hee cides bd eee me te bee eae KEEN KA eee ee dae eee E 1 AppleScript and Sequencing Analysis llle cee ee eee ee E 2 Commands Objects and
267. uencing Analysis application When called the Tracker Reads the sequencing gel file Locates the center of each lane Derives a tracker line down the center of each lane The tracker line is used to extract the signal intensities from the gel The tracker line can also be manipulated if manual correction is needed Also associated with the Tracker application are Tracker settings files that contain various tracker parameters optimized according to the number of channels and lanes in the gel file and the comb type set in the Gel Preferences Gel Preferences on page 5 23 If gel aberrations or weak sample signals exist or if your comb was not properly centered in the gel the Sequencing Analysis software may misinterpret the gel data The program may completely miss a lane declare a lane where none exists or recognize a lane but be unable to follow it Each of these errors can cause lane data to be written to the wrong file For example if the program mislabels lane 2 as lane 1 it will write the lane 2 data into the sample file for lane 1 the lane 3 data into sample file for lane 2 etc Search Data Extraction Gel Processing Parameters Review the Gel File Find Again During data extraction the software generates a sample file for each tracked lane by averaging the data from the tracked channel and the number of channels you specify on either side of it The default is three channels the tracked channel and t
268. uild the desktop When this process is complete your usual desktop screen will appear Check the contents of the ABI Folder in the System Folder to be sure that all the DyeSet Primer and Instrument files that you use are present If any are missing copy them from the old ABI Folder that you backed up before installing page 2 6 2 8 Getting Started Search Removing Sequencing Analysis Software Find Again This section describes how to remove the Sequencing Analysis software from your Macintosh computer The Remove process deletes the Sequencing Analysis application folder and its installed contents but not the files and folders placed in the System folder by the installer To remove installed Sequencing Analysis software Step Action 1 Follow steps 1 to 5 in the procedure Installing the Sequencing Analysis Software on page 2 7 Select Remove from the pop up menu at the top left of the window Choose the Select Folder item on the Install Location pop up menu A Macintosh browser box appears Use the browser box to locate the folder that contains the Sequencing Analysis folder Click Remove to begin the removal of the files from your disk At the conclusion of the remove operation an alert box appears with the message whether or not the remove was successful Note If files have been moved or added to the Sequencing Analysis folder the remove operation will be report
269. ustomized their sequencing setups to use a fifth dye to facilitate gel tracking Sequencing Analysis version 3 2 can Open and display gel files that contain five colors Extract five dye data from the gel file into sample files Note Since the fifth dye is not used for base calling the fifth dye color is not displayed in the sample window electropherogram within the Sequencing Analysis program The new version 3 2 Basecaller can read signals of lower intensity Previous versions of the Sequencing Analysis Basecallers contained a fixed signal cutoff value Any signal intensity below this preset value caused the Basecaller program to fail This threshold cutoff has been removed in the version 3 2 Basecaller How Will the New Basecaller Effect Data Processing You will no longer see the error signal too weak This error was most problematic for those using dRhodamine Terminator DNA sequencing chemistries which have weaker signal intensity than the other chemistries With the new v 3 2 Basecaller program all data is analyzed regardless of the signal intensity Because of this you may want to take more care setting the analysis endpoints For more information see pages 5 16 and 5 28 Search Maximum Number of Scans Increased Easier Selection of Bases for Editing More Sample Sheet Columns Editable Find Again In previous versions of the Basecaller program the maximum number of scans for analyzed data was set to
270. w for the data collection program shows real time data as it is being collected New data appears at the bottom of the screen as it is collected so the top of the screen shows the start of the run This data has not yet been saved to a file In the Sequencing Analysis Program The Gel File window for the Sequencing Analysis software displays an image of the gel after data collection is finished This image is inverted so the bottom of the window displays the start of the run The smallest fragments appear near the bottom of the window just as they would on an autoradiogram Search Find Again Parts of the Gel The Gel File window includes the following parts File Window Buttons for various program features Channel number and scan number Lanes used Lane at current cursor location markers ig a Gel File g i rol I 198 75 Son 73 Lanes Used 36 45 6 9 10 11 H 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 3233 34 35 36 10600 Lanes Slice view Current Comb Type set in prefs Shark Tooth Scan numbers Tracker line for the selected lane Gel image Description of This table describes the parts of the Gel File Window Parts Parts of the Gel File Window Item Description Gel image Represents a time history of all fluorescence detected during the run Each base peak appears as a brightly colored band within the sample lane Each position on the gel image
271. w keys to move the control points in one channel increments this method applies to all points selected Hold the option key down and use the left and right arrow keys to move the control points in 0 1 channel increments this method applies to all points selected Working with the Gel File 3 31 Search 3 32 Working with the Gel File Find Again Adding and Deleting Control Points Extra rows of control points can be added if necessary for finer control Rows of control points can also be deleted Toadd a row of control points hold the option key down and click in the area between the existing row selectors Option click here or here to 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 add a new row 106 asas 000 x tee of control points 9425 8245 gt Bb p Todelete a row of control points hold the option key down and click on the selector Select OK in the dialog box that appears you sure you wish to remove a control row Spline accuracy can be lost Cras How to Reshape Tracker Lines The following procedure describes how to reshape tracker lines to better follow the signal intensity in the lane To review and edit tracker line placement Step Action 1 In the Gel File window click the lane marker for the lane you want to review You can also press Tab to move one lane to the right or Shift Tab to move one lane to t
272. ween the guide lines will be interpolated from the guide lines To select the lane click in the tick mark at the bottom of the lane as shown below Search Find Again To interpolate tracker lines continued Action pel File copy i o 10 Chanel 183 25 152 LanesUsed 36 1 2 4 5 9 9 9 5 The Interpolation Mode button is shown depressed and tick marks appear at the bottom of the gel indicating that the window is in interpolation mode The interpolation guides are lanes 1 and 6 Selected guide lanes are indicated by the red triangle mark and the lane number Click tick marks here and here to select the guide lanes Click the second of the two guide lines the lanes between are interpolated El Gel File copy Lanes Used 36 21800 92 50 Son 762 1 2 3 4 5 Working with the Gel File 3 35 Search 3 36 Working with the Gel File Find Again To interpolate tracker lines continued Step Action 4 While in interpolation mode if you move the guide control points all the interpolated lines move proportionately EB Gel File cop EE EB 3 olf sii Charel 14 75 Soan 4592 Lares Used 36 1 5 m 10600 9425p
273. which resets all preferences to the default values Follow the steps below to change the trace lines or the scale on the electropherogram Raw Data or EPT display To change trace line or scale display Step Action 1 Click any Sample window which displays the view Electropherogram Raw Data or EPT where you want to make the changes 2 Choose Display Options from the Windows menu A Display Options dialog box appears the exact name and contents depend on which Sample window view is active Electropherogram Display Options Sh amp Show data points The name and Show Data section depend on the view selected r Counts Per Tick Horizontal 0 Vertical Vertical Display Show relative values Show real values Viewing and Editing Sample Files 6 41 Search Find Again To change trace line or scale display continued Step Action 3 To alter which of the four base lines are displayed use the Show Data checkboxes You can turn off any combination of lines This can make it easier to identify heterozygotes or to hide baseline or noisy data For the view The four colors represent the Electropherogram four analyzed bases Raw Data detected raw fluorescent signals from the four dyes EPT voltage temperature power and current during the run If you turn off the screen display of a trace line that trace line i
274. with different settings from those used for the automatic analysis You can also edit the base sequence in the analyzed data The basic steps used in DNA sample analysis are outlined in the following two flow charts Analysis procedure for samples from the ABI PRISM 310 Genetic Analyzer on page 1 11 and Analysis procedure for samples from ABI 373 and ABI Prism 377 Sequencers on page 1 12 Search Flowchart for ABI PRISM 310 310 3 d 37 Find Again User starts instrument run with Automatic Analysis selected Data collection software automatically captures raw data in sample files Software automatically does base calling of sample files If requested Sequencing Analysis automatically submits files to Factura Y If requested Sequencing Analysis automatically submits files for printing User reviews Sequencing Analysis and Factura software Analysis procedure for samples from the ABI PRISM 310 Genetic Analyzer User makes changes required by problems in error log User sets parameters and starts analysis User adjusts parameters and reanalyzes samples files error logs Ne Yes User reviews base calling results N OK 5 9 Yes User may open analyzed lt sample files to edit bases v DNA sequence ready for further processing About Th
275. xisting matrix Make an additional instrument file for testing purposes Note sure to make a backup copy of the original instrument file before you modify it Adding or Replacing a Matrix To add or replace a matrix in an existing instrument file Step Action 1 Open the DataUtility program The program icon looks like this The program is located in the Utilities folder inside the Sequencing Analysis folder Creating Instrument Files 25 Search D 26 Creating Instrument Files Find Again To add or replace a matrix in an existing instrument file continued Step Action 2 Choose Make Matrix from the Utilities menu The Make Matrix dialog box appears Make Matrix Name of file containing C data Start at Name of file containing A data Start at s Name of file containing G data Start at Name of file containing T data Start at Name of new matrix file Update File Points Instrument Comment Dye Primer Matrix Taq Terminator Matrix Cancel QT Terminator Matrix Note files you select for the four nucleotides are the sample files you named on the Sample Sheet when you electrophoresed the matrix standards Specify the sample file to be used for each standard a Click the C button In the directory dialog box that appears select the file that contains the data from the C standard then choose Open t
276. yeSet Primer file The DyeSet Primer file used during analysis to adjust for mobility shifts Instrument file name The instrument file used to analyze the data and adjust for spectral overlaps Points Base 1 The range of the data points collected that were used to analyze the data Base 1 is the data point where the analyzed data starts Fourth Page x of x The page number for this page and the total number of pages Date and time The date and time the analysis took place Date and time The date and time the data collection took place Spacing Basecaller Calculated Spacing Base spacing used for this analysis Spacing as calculated by the Basecaller If the two spacing values are different the sample was analyzed with a user defined value 6 36 Viewing and Editing Sample Files Search Find Again Tiling or Stacking Windows Introduction The number of Sample windows sample files that you can have open at one time is limited only by the amount of available computer memory RAM You can quickly organize multiple open windows by either tiling or stacking them About Tiling To arrange the open sample files so they do not overlap and a good sized portion of each is visible choose Tile Windows from the Window menu This method is useful when you have only a few samples open and you want to compare bases as shown in the following figure Sa
277. you reset the Peak 1 Location value to 0 the software recalculates the Peak 1 Location Start Point Stop Point and Spacing The ABI 373 and ABI PRISM 377 data collection software samples data 194 times each time it scans across the gel The ABI PRISM 310 data collection software samples data at one second intervals Each sampling is stored as a data point The Peak 1 Location value is defined as the first data point in the file that is from the sample not including primer If you are using dye primer chemistry follow the instructions in the table below If you are using dye terminator chemistry follow the instructions in the table on page 5 14 For dye primer chemistry to find the Peak 1 Location value Step Action 1 Open the sample file 1 388 times in 377 XL mode and 480 times in 377 96 Lane mode The Processing Parameters 5 11 Search 5 12 The Processing Parameters Find Again For dye primer chemistry to find the Peak 1 Location value continued Step Action 2 Click the Raw Data view button Peaks are normally present in four colors on the display They extend throughout the width of the window If the colored lines representing the bases do not appear use the following steps to display them a Choose Display Options from the Window menu b Click to select the check boxes for all four bases c Choose OK 3 Use the scroll bar at the bottom of the Raw
278. you start the Sequencing Analysis software the Finder will allocate the newly specified amount of memory to the program C 10 Troubleshooting Search Find Again Troubleshooting Table continued Observation Possible Cause Recommended Action Printing is slow Graphical view pictures To increase printing speed make the following gel image and changes Electropherogram Raw Data and EPT views contain many bytes of data Select the fast print or draft printing option if available on your printer Turn off background printing in the Chooser dialog box Onthe Printing Preferences page of the Preferences dialog box and in the special Page Setup dialog box that is available whenever a Sample window is open do the following Select the Print First Page Only checkbox b Selectto print only the Electropherogram view rather than multiple views c Decrease the Number of Panels per Page value and or the Points per Panel value At most print no more than five panels of 1500 points each for the Electropherogram view Printer crashes while Printing analyzed data If the problem is lack of printer memory add printing sample file and raw data at the more memory to your printer See also the views same time can options under Printing is slow above overload some types of printers and cause printing to fail Trouble printing sample Instead of printing by the Print command from files on A4 pa
279. ypically has weaker fluorescence but signal strengths below 40 are rarely a problem with this chemistry Troubleshooting C 13 Search Find Again Reviewing the Sequencing Analysis Error Log Introduction Lane Assignment Confidence Values Reviewing the Error Log C 14 Troubleshooting The Error Log lists all errors that occurred during analysis and can be useful for troubleshooting Where Is the Error Log File The Error Log is maintained in a file called Seg Analysis Error File which resides in the ABI Folder in the Macintosh System Folder If this file is removed from the ABI Folder a new error file is created automatically when the Sequencing Analysis application next opens Can the Error Log Become Full No the Error Log never becomes full because when it reaches its maximum length of 200 lines the oldest messages are automatically deleted from the log as new messages are added to the top In addition to errors the lane assignment confidence value calculated during gel tracking is also written to the Error Log You should make a point of checking the lane assignment confidence value for each gel tracked For more information about lane confidence values see Stop Extraction When Below Confidence Threshold on page 5 26 If the Error Log is not already visible choose Show Error Log Command 3 from the Window menu The menu command changes to Hide Error Log so you can choose the command again to hi

DNA Sequencing Analysis User`s Manual 3.2

Contents

Download Pdf Manuals

Related Search

Related Contents