Home

SOLiD 4 System Library Preparation Guide

1. 234 gt o gej o Q x T fed 59 2 0 E Q zx g a Qa 9 Ei A SOLID 4 System Library Preparation Guide 201 Appendix F Checklists and workflow tracking forms Workflow checklists prepare a standard fragment library Workflow checklists prepare a standard fragment library 222 Equipment Preparation steps O Covaris S2 System O 1x Low TE Buffer O Degas the water in the s O Covaris microTube O Ethylene glycol Covaris S2 System 30 a O Covaris microTube adaptor minutes prior to use 2 O Covaris microTube loading O Supplement the pad station circulated water chiller P O 1 5 mL LoBind tubes with 2096 ethylene glycol 5 O Pipettors O Filtered pipettor tips O Microcentrifuge 5x End Polishing Buffer Thaw 5x End Polishing 2 O NanoDrop amp ND 1000 dNTP Mix Buffer and dNTP Mix on pe Spectrophotometer End Polishing Enzyme 1 ice i g O Vortexer End Polishing Enzyme 2 20 O Picofuge Nuclease free Water D O Pipettors SOLID Library Column O 1 5 mL LoBind tubes Purification Kit L Filtered pipettor tips S O Microcentrifuge L1 P1 Adaptor ds 50 uM O Thaw P1 and P2 8 lt Vortexer O P2 Adaptor ds 50 uM Adaptors on ice ri O Picofuge O 5x T4 Ligase Buffer O Thaw 5xT4 Ligase Buffer So O_1 5 mLLoBind tubes O T4Ligase onice t mg Pipettors L1 Nuclease free Water EIN 9 O Filtered pipettor tips O SOLiD Library Column Purification Kit
2. For the SDS of any chemical not distributed by Applied Biosystems contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions SOLID 4 System Library Preparation Guide 169 gt 9 o D 5 2 x gt ZU D Je s a m D D 2 Appendix A Required Materials Prepare a barcoded fragment library Table 79 Required equipment Item Source Covaris S2 System 110 V for U S customers 220 V for international customers The system includes e Covaris S2 sonicator e Latitude laptop from Dell Inc e MultiTemp IIl Thermostatic Circulator e Covaris 2 series Machine Holder for one 1 5 mL microcentrifuge tube e Covaris 2 series Machine Holder for one 0 65 mL microcentrifuge tube e Covaris 2 series Machine Holder for one 13 mm x 65 mm tube e Covaris 2 Series Machine Holder for one microTUBE e Covaris microTUBE Prep Station e Covaris Water Tank Label Kit e Covaris microTUBEs 1 pack of 25 For system materials summary see Covaris S2 System Materials Summary SOLiD 4 System Site Preparation Guide PN 4448639 Applied Biosystems 4387833 110 V Applied Biosystems 4392718 220 V or Covaris Microcentrifuge 5417R refrigerated without rotor e Eppendorf 022621807 120 V 60 Hz e Eppendorf 022621840 230 V 50 Hz FA 45 24 11 fixed angl
3. SOLID 4 System Library Preparation Guide 181 Appendix B SOLID 4 System Library Quantitation with the SOLID Library TagMan9 Quantitation Kit Example data Standard curve Standard Curve 24 234 22 21 20 19 18 17 CT 16 154 144 134 12 1 114 10 9 a 0 001 aox am amz 1 02 1 2 345 10 20 31 100 200 1000 Quantity r Legend m Standard E Unknown Unknown Flagged 182 SOLiID 4 System Library Preparation Guide Appendix B SOLID 4 System Library Quantitation with the SOLID Library TagMan9 Quantitation Kit Determine the optimal library concentration for ePCR Determine the optimal library concentration for ePCR Perform a WFA run The SOLiD Library TagMan Quantitation Kit will accurately quantify your with dilutions of the unknown library however it will not tell you how much library to use in ePCR To QPCR standard determine this we recommend preparing a three point titration of the SOLiD Library qPCR Standard in ePCR and performing a workflow analysis WFA run on the templated beads You can then analyze the run to determine the optimal concentration of library to use in ePCR D IMPORTANT You only need to perform this assay once to determine the optimal titration point for all libraries quantitated by the qPCR standard If the ePCR protocol is updated we recommend running the assay again with the new protocol General procedure For detailed in
4. 10 Load 2 uL of DNA sample onto the lower measurement pedestal and lower the sampling arm 192 SOLID 4 System Library Preparation Guide Appendix C Supplemental Procedures Phenol chloroform isoamyl alcohol extraction Phenol chloroform isoamyl alcohol extraction Phenol chloroform isoamyl alcohol extraction can be used to isolate DNA Qiagen MaxXtract High Density Tubes can be used in an alternative procedure see Phenol chloroform isoamyl alcohol extraction with MaXtract on page 194 Materials and Table 95 Required equipment equipment required Item Source Microcentrifuge 5417R refrigerated without rotor e Eppendorf 022621807 120 V 60 Hz e Eppendorf 022621840 230 V 50 Hz FA 45 24 11 fixed angle rotor 24 x 1 5 2 mL including Eppendorf aluminum lid aerosol tight 022636006 Pipettors Major Laboratory Supplier MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Or equivalent but validation of the equipment for library preparation is required Table 96 Required consumables Item Source Phenol chloroform isoamyl alcohol with pH 7 9 buffer Applied Biosystems AM9730 1 5 mL LoBind Tubes Eppendorf 022431021 Filtered pipettor tips Major Laboratory Supplier MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect syst
5. Appendix A Required Materials Prepare a 2 x 50 bp mate paired library Prepare a 2 x 50 bp mate paired library Table 66 Required Applied Biosystems reagent kits Item part number Components Kit components used in SOLiD Mate Paired Library Oligos Kit 4400468 SOLiD Long Mate Paired Library Construction Kit 4443474 8 154 SOLiD Library Oligos Kit 1 P1 Adaptor ds SOLiD Library Oligos Kit 1 P2 Adaptor ds Ligation of adaptors SOLiD Library Oligos Kit 1 Library PCR Primer 1 SOLiD Library Oligos Kit 1 Library PCR Primer 2 Library amplification SOLiD Library Oligos Kit 2 LMP CAP Adaptor ds 2 x 50 bp mate paired library preparation SOLiD Library Oligos Kit 2 Internal Adaptor ds DNA circularization SOLiD Library Oligos Kit 2 EcoP15I CAP Adaptor ds 2 x 25 bp mate paired library preparation SOLiD Long Mate Paired Library Enzyme Kit 1 e 5X End Polishing Buffer End Polishing Enzyme 1 10 U uL End Polishing Enzyme 2 5 U uL dNTP 10 mM e 5X Ligase Buffer TA DNA Ligase 5 U uL e DNA Polymerase 10 U uL e Nick Translation Buffer e 0 5 M EDTA e 100X BSA e Platinum PCR Amplification Mix DNA end repair Adaptor ligation DNA circularization Nick translation Stop end repair reaction Bead wash Library amplification Table continued on next page
6. STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Nick translate then amplify the library on page 140 SOLID 4 System Library Preparation Guide 139 Chapter 4 Barcoded Fragment Library Preparation Nick translate then amplify the library Nick translate then amplify the library Nick translate then 1 Prepare a PCR reaction mix see Table 54 amplify the library Table 54 PCR reaction mix a mix for nick translation and amplification of the library Component Volume pL Platinum PCR Amplification Mix 400 Multiplex Library PCR 1 50 uM 10 Multiplex Library PCR 2 50 uM 10 Adaptor ligated purified DNA 48 to 50 Nuclease free Water Variable Total 500 2 Pipet 125 uL of the PCR reaction mix into each of four PCR tubes Depending on the pooling conditions the number of PCR reactions can be scaled up 3 Run the PCR Table 55 D IMPORTANT The number of cycles should be minimized and determined based on the amount of starting input DNA Minimal cycling is desirable to avold over amplification and production of redundant molecules Table 55 PCR conditions to nick translate and amplify the library Stage Step Temp Time Holding Nick translation 72 C 20 min Holding Denature 95 C 5 min Cycling Denature 95 C 15 sec ee eee Anneal 62 C 15 sec Extend 70 C 1 min Holding Extend 70 C 5 min Holding 4 C co t
7. 0 00 eee SOLID 4 System Library Preparation Guide Contents Appendix D Appendix E Appendix F Appendix G Appendix H Appendix Protocol Oligonucleotide Sequences 2 0000 cece eee eee 205 Library construction oligonucleotides 0 cece eee 206 Formulas and calculations 6 cee 215 Fragment lIDrary x sauer ena SMe gee Mok Sal da hag wa ee eee ed YS uis 216 2 x 50 bp mate paired library 000 ee 216 2 x 25 bp mate paired library llli 219 Checklists and workflow tracking forms 000005 221 Workflow checklists prepare a standard fragment library lues 222 Workflow checklists prepare an express fragment library llle 223 Workflow tracking prepare standard and express fragment libraries 224 Workflow checklists prepare a 2 x 50 bp mate paired library lll 225 Workflow tracking prepare a 2 x 50 bp mate paired library 05 228 Workflow checklists prepare a 2 x 25 bp mate paired library llus 229 Workflow tracking prepare a 2 x 25 bp mate paired library 005 232 Workflow checklists prepare a barcoded fragment library eee eee 233 Workflow tracking prepare a barcoded fragment library llle 234 GOValls S2 System vases a tel aep atu uro teat 235 Operation Notes xls IRR Meee dae E e REV waned eee a s 236 Covaris
8. 155 bp reaches the reference line press Go to stop the run Proceed to step 4 4 When the band reaches the reference line refill the bottom row again with Nuclease free Water until each well is full Some pre filled water is lost during the run SOLID 4 System Library Preparation Guide 123 3 Chapter 3 Mate Paired Library Preparation Gel purify the library with a Size Selection gel 5 Press Go to run the gel until the 155 bp band enters the collection well For optimal results monitor the run in a darkened room 6 Collect the DNA from the collection well using a 20 uL pipette fitted with a tip see Figure 19 Do not perforate the bottom of the agarose collection well Due to migration of the DNA into the bottom of the well some residual DNA remains underneath the well D IMPORTANT If the 155 bp band overruns the collection well and reenter the gel select REVERSE E Gel on the iBase Power System to run the band backwards into the collection well Collect the DNA Figure 19 Collection of the of 155 bp library band from the SOLiD Library Size Selection gel 124 SOLID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Gel purify the library with a Size Selection gel Optional Purify the Note If a concentrated sample is not necessary skip this purification step then DNA with the proceed to Quantitate the library by performing quantitative PCR qPCR on SOLiD L
9. 3 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column 4 Repeat steps 2 and 3 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s 5 Add 650 uL of Wash Buffer W1 with ethanol to wash the column s 6 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at maximum speed to remove residual wash buffer T Transfer the column s to clean 1 5 mL LoBind tube s 8 Add 50 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature 9 Centrifuge the column s at maximum speed for minute 10 Add the eluate from step 9 back to the column s then let the column s stand for 1 minute at room temperature 11 Centrifuge the column s at maximum speed for 1 minute SOLID 4 System Library Preparation Guide 57 3 Chapter 3 Mate Paired Library Preparation End repair the sheared DNA 12 Ifnecessary pool the eluted DNA 13 Quantitate the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer see Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer on page 189 STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Ligate LMP CAP Adaptors to the DNA on page 59 14 Optional For st
10. Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Size select the DNA 11 Add 50 uL of Elution Buffer E1 from the SOLiD Library Column Purification Kit not Buffer E5 from the SOLiD Library Quick Gel Extraction Kit to the center of the column s to elute the DNA then let the column s stand for 5 minutes at room temperature hM Note For large fragments increasing the incubation time to 10 minutes will increase the yield uonejedaug 12 Centrifuge the column s at gt 12 000 x g for 1 minute The 1 5 mL LoBind tube s contain the purified DNA 9 D iei 3 gj oo lt a n U g 2 ki um ed E S a lt 13 Add the eluate from step 13 back to the Quick Gel Extraction column s then let the column s stand for 1 minute at room temperature 14 Centrifuge the column s at gt 12 000 x g for 1 minute 15 Ifnecessary pool the eluted DNA into one 1 5 mL LoBind tube 16 Quantitate the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer see Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer on page 189 STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Circularize the DNA with the Internal Adaptor on page 64 SOLID 4 System Library Preparation Guide 63 3 Chapter 3 Mate Paired Library Preparation Circularize the DNA Circularize the DNA Circularize the DNA 1 Prepare a circularizatio
11. lt gt xe Ke o 5 2 x us ep 9 E is A op lt Q o 3 co 9 lt Appendix B SOLID 4 System Library Quantitation with the SOLID Library TaqMan Quantitation Kit The qPCR protocol The cycling programs have been developed as a general starting point when using the SOLiD Library qPCR Mix The fast cycling program was developed using the AB 7500 in Fast mode see Table 88 N Note This mix is highly robust and can be used with a wide range of cycling programs on different instruments If you have an alternative program that you want to use test it with this mix Table 88 Suggested cycling programs to use with the SOLiD Library qPCR Mix Fast cycling Standard cycling Cycles program Cycles program Temp Time Temp Time 95 C 20 sec 95 C 2 min 40 95 C 3 sec 40 95 C 15 sec 60 C 30 sec 60 C 1 min t Developed using the AB 7500 in Fast mode Perform qPCR Use the procedure below as a general starting point Volumes for a standard 20 uL reaction are provided Scale the reaction volume as needed for your real time instrument 1 Based on the number and size of your qPCR reactions including no template controls prepare a master mix of all components except template on ice Volumes for a single reaction are shown below scale as needed see Table 89 Table 89 Master mix for a single 20 uL qPCR reaction Compone
12. or UltraPure Agarose 1000 Invitrogen 10975 035 SYBR Safe DNA Gel Stain 10 000X Invitrogen 33102 10X BlueJuice Gel Loading Buffer Invitrogen 10816 015 25 bp DNA Ladder Invitrogen 10597 011 100 bp DNA Ladder Invitrogen 15628 050 1 Kb Plus DNA Ladder Invitrogen 10787 018 UltraPure Glycerol Invitrogen 15514 011 Covaris Tubes and Caps 125 Applied Biosystems 4399054 Ethanol Sigma Aldrich E7023 Isopropyl alcohol Sigma Aldrich 19516 Ethylene glycol American Bioanalytical AB00455 01000 0 5 mL LoBind Tubes Eppendorf 022431005 1 5 mL LoBind Tubes Eppendorf 022431021 2 0 mL LoBind Tubes Eppendorf 022431048 Hydrochloric Acid 0 20 N VWR VW8888 0 SOLID 4 System Library Preparation Guide Appendix A Required Materials Prepare a 2 x 50 bp mate paired library Table 70 Required consumables Item Source Sodium Hydroxide 0 20 N VWR VW8889 0 CF 1 Calibration Fluid Kit Thermo Scientific CF 1 PR 1 Conditioning Kit Thermo Scientific PR 1 Filtered pipettor tips Major Laboratory Supplier MLS Razor blades MLS PCR strip tubes MLS 15 mL conical polypropylene tubes MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance 8 The NanoDrop Conditioning Kit is useful for reconditioning the sample measurement pedestals to a hydrophobic state if they become unconditioned refer to the Nanod
13. products may be agarose gel after the reaction to amplified identify contaminants PCR efficiency is The PCR Verify that the reagents you are below 9096 conditions are using have not been freeze thawed suboptimal multiple times and have not remained at room temperature for too long Verify that the amount of primers you are using is correct SOLID 4 System Library Preparation Guide Appendix C Supplemental Procedures This appendix covers E Load and unload Covaris microTUBE vials from the Covaris microTUBE holdet o ener hes eed batts ped Sat sede eee teeta eie Oe ees 186 E Hybridize oligonucleotides eee 187 E Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer 189 E Phenol chloroform isoamyl alcohol extraction 0 020 eee 193 E Phenol chloroform isoamyl alcohol extraction with MaXtract 194 B PAGE gel DNA elution ssessssesseeseee e 196 B Isopropanol precipitation 0 0 cette I 198 E Confirm complete methylation of DNA fragments 2 4 200 2 xe o o Q x ie ie xe je D 3 D E m 2v fe 9 o E I n SOLID 4 System Library Preparation Guide 185 Appendix C Supplemental Procedures Load and unload Covaris microTUBE vials from the Covaris microTUBE holder Load and unload Covaris microTUBE vials from the Covaris microTUBE holder Load Covaris microTUBE vials Unload
14. truncated version of the 5 strand sequence of P2 These primers can be used only for library amplification and not for alternative or modified library construction adaptor design because they do not have 3 sequences compatible with the sequencing primers SOLID 4 System Library Preparation Guide 45 3 Chapter 3 Mate Paired Library Preparation Overview didi ob ie Dd od Did od Dik ob MBE ol if od A AT od od ad el tt od Ld dl dl dl gL UME cht eh Aaa Tak ad LA ck Ud Dad ih TP eT cd df A ed PND ih AE ad PAD a ad BaD ed fad Bd A id aAA ad al OUDUDUUDODUCDOUUBSEPBBESUE jad abled ad ad LU eal vad Ded eld od td a dD ad al l dU Figure 10 Mate paired library amplification design This chapter is organized into two sections Section 3 1 describes how to generate a 2 x 50 bp mate paired library Section 3 2 describes how to generate a 2 x 25 bp mate paired library 46 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Materials and equipment required Section 3 1 Prepare a 2 x 50 bp mate paired library Materials and equipment required See Appendix A on page 145 for a list of equipment kits and consumables necessary for this procedure uolyesedaid 9 zx D iei 3 8j oo lt 2 n U g 2 ki um ed E S a lt SOLID 4 System Library Preparation Guide 47 3 Chapter 3 Mate Paired Library Preparation Workflow Workflow
15. 022621840 230 V 50 Hz FA 45 24 11 fixed angle rotor 24 x 1 5 2 mL including Eppendorf aluminum lid aerosol tight 022636006 Pipettors Major Laboratory Supplier MLS affect system performance Table 102 Required consumables t Applied Biosystems has validated this protocol using this specific material Substitution may adversely Or equivalent but validation of the equipment for library preparation is required Item Source e 7 5 M Ammonium acetate or e Sigma Aldrich A 2706 e 3M Sodium acetate pH 5 5 Applied Biosystems PN AM9740 Glycogen 5 mg mL Applied Biosystems AM9510 Isopropyl alcohol Sigma Aldrich 19516 Ethanol E7023 Filtered pipettor tips Major Laboratory Supplier MLS affect system performance t Applied Biosystems has validated this protocol using this specific material Substitution may adversely SOLID 4 System Library Preparation Guide Appendix C Supplemental Procedures Isopropanol precipitation Procedure 1 Add either an equal volume of 7 5 M ammonium acetate or 1 10 volume of 3 M sodium acetate pH 5 5 to the aqueous phase 2 Add 1 100 volume of glycogen 3 Add 0 7 volume of 100 isopropyl alcohol at room temperature Vortex well 4 Incubate at room temperature for 5 minutes to precipitate 5 Centrifuge the solution at 21 000 x g minimum 14 000 x g for 15 minutes 6 Remove the supernatant 7 Wash the DNA pellet three times with 200 u
16. 65 68 69 72 73 76 77 80 81 84 85 88 89 92 or 93 96 Use only one of the barcoded Multiplex P2 Adaptors for each ligation reaction unless fewer than four libraries are being barcoded If fewer than four samples are to be prepared for sequencing use multiple barcodes per sample in equal ratios see the next step 2 For each library combine see Table 53 Table 53 Ligation mix Component Volume pL Multiplex Library P1 Adaptor 50 uM Y Barcode 0XX 50 uM Y 5X T4 Ligase Buffer 40 DNA 48 to 50 T4 Ligase 5 U uL 10 Nuclease free Water Variable Total 200 3 Incubate at room temperature for 15 minutes 1 Add 4 volumes 800 uL of Binding Buffer B2 L with 40 isopropanol to the sample hM Note You can proceed in one of two ways Purify each barcoded library separately go to step 2 Individually purified barcoded libraries are then pooled after quantification by qPCR see Pool the barcoded libraries on page 142 You can normalize the amount of each barcoded library or Pool barcoded libraries before proceeding to step 2 to reduce the number of tubes during preparation however each library may be unequally represented after sequencing Pool equivalent amounts of barcoded libraries before column purification 5 ug DNA column if the libraries are of similar size and unequal library representation is acceptable Ensure that each library 1s in binding buffer bef
17. 80 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Amplify the library Purify the DNA with 1 Pre spin an empty PCR Micro column in a collection tube at 10 000 x g for the SOLiD Library 1 minute before use Micro Column Purification Kit Add 4 volumes of Binding Buffer B2 L with isopropanol 4096 to 1 volume of sample 3 Apply 750 uL of the PCR product in the binding buffer to the PureLink Micro column in a collection tube uonejedoug 4 Centrifuge the column at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column Qo F RV go et D a Co U a E o on Es o o s lt 5 Repeat steps 3 and 4 until the entire sample has been loaded onto the column Place the PureLink Micro column back into the same collection tube 6 Add 650 uL of Wash Buffer W1 with ethanol to wash the column 7 Centrifuge the column at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at 14 000 x g to remove residual wash buffer 8 Transfer the column to a clean 1 5 mL LoBind tube 9 Add 25 uL of Elution Buffer E1 to the center of the column to elute the DNA then let the column stand for 1 minute at room temperature 10 Centrifuge the column at 14 000 x g for 1 minute 11 Add the eluate from step 10 back to the column then let the column stand for 1 minute at room temperature 20 to 25 C 12
18. Component Amount Sheared end repaired DNA 12 5 ug 10X NEBuffer 3 12 5 uL 100x BSA 1 25 uL EcoP15l 10 U uL 12 5 uL S adenosylmethionine 32 mM 1 5 uL Nuclease free Water Variable Total 125 uL D IMPORTANT S adenosylmethionine is an extremely labile molecule sensitive to repeated freeze thaw cycles Always dispense S adenosylmethionine into smaller aliquots at the first thaw to avoid multiple freeze thaws S adenosylmethionine should not be used beyond its expiration date 2 Incubate the methylation reaction mixture at 37 C for 2 hours or overnight 100 SOLID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Methylate the genomic DNA EcoP15l sites Purify the DNA with 1 Add4 volumes of Binding Buffer B2 S with isopropanol 5576 to 1 volume of the SOLID Library sample Mix well Column Purification Kit 2 Apply about 700 uL of the sample in the binding buffer to the PureLink column s in collection tube s 3 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column U 0 ge o E e E 4 Repeat steps 2 and 3 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s Aeq peureq eie N 4e1deuo 5 Add 650 uL of Wash Buffer W1 with ethanol to wash the column s 6 Centrifuge the column s at 10 000 x g for 1 minute then discard the
19. Covaris microTUBE vials 186 1 Use a thumb to push the stainless steel plunger up into the body of the microTUBE holder 2 Place the body of the microTUBE against the two amber plastic prongs with the cap of the microTUBE positioned above the prongs 3 Use a finger to press against the middle of the glass tube not against the cap With a single motion push the tube between the prongs to position the tube see Figure 27 IMPORTANT Do not press against the cap to load or unload microTUBE vials because pressing against the cap may dislodge or damage the cap 4 Release the plunger The plunger pushes the tube until the base of the cap rests against the prongs The tube and holder are now ready to be inserted into the S Series instrument microTUBE loading and unloading 1 depress plunger thumb 2 to load grip glass and insert tube not cap 3 to unload press on side of tube not cap Figure 27 How to load and unload a microTUBE vial from the microTUBE holder 1 Use a thumb to push the stainless steel plunger up into the body of the microTUBE holder to relieve pressure on the cap 2 Press against the side of the glass tube not against the cap to free the microTUBE from the grip of the holder see Figure 27 SOLID 4 System Library Preparation Guide Appendix C Supplemental Procedures Hybridize oligonucleotides Hybridize oligonucleotides Oligonucleotide hybridization is required to
20. D zh D 2i SOLID 4 System Library Preparation Guide 155 Appendix A Required Materials Prepare a 2 x 50 bp mate paired library Table 67 Optional Applied Biosystems reagent kits Item part number SOLiD Long Mate Paired Library Construction Kit without Purification 4443711 8 Components Kit components used in SOLiD Long Mate Paired Library Enzyme Kit 1 e 5X End Polishing Buffer e End Polishing Enzyme 1 10 U uL e End Polishing Enzyme 2 5 U uL e dNTP 10 mM e 5X Ligase Buffer e T4 DNA Ligase 5 U uL DNA Polymerase 10 U uL e Nick Translation Buffer e 0 5 M EDTA e 100X BSA e Platinum PCR Amplification Mix DNA end repair Adaptor ligation DNA circularization Nick translation Stop end repair reaction Bead wash Library amplification SOLiD Long Mate Paired Library Enzyme Kit 2 Exo Nucleases T7 Exonuclease 10 U uL e 10X Buffer 4 e S1 Nuclease e 3MNaCl e S1 Dilution Buffer e 10X Plasmid Safe Buffer e Plasmid Safe DNase e ATP 25 mM Gap creation at a nicked site Digestion at gap sites to release mate paired fragments Uncircularized DNA removal Table continued on next page SOLID 4 System Library Preparation Guide Appendix A Required Materials Prepare a 2 x 50 bp mate paired library Table 67 Optional Applied Biosystems reagent kits Item part number Components Kit components used
21. G4010 02 UltraPure DNA Typing Grade 50X TAE Invitrogen Butter 24710 030 Agarose LE Applied Biosystems AM9040 or UltraPure Agarose 1000 Invitrogen 10975 035 SYBR Safe DNA Gel Stain 10 000X Invitrogen 833102 10X BlueJuice Gel Loading Buffer Invitrogen 10816 015 25 bp DNA Ladder Invitrogen 10597 011 1 Kb Plus DNA Ladder Invitrogen 10787 018 UltraPure Glycerol Invitrogen 15514 011 Covaris Tubes and Caps 125 Applied Biosystems 4399054 S adenosylmethionine SAM 32 mM New England BioLabs B9003S EcoP15l New England BioLabs R0646L Ethanol Sigma Aldrich E7023 Isopropyl alcohol Sigma Aldrich 19516 Ethylene glycol American Bioanalytical AB00455 01000 0 5 mL LoBind Tubes Eppendorf 022431005 1 5 mL LoBind Tubes Eppendorf 022431021 2 0 mL LoBind Tubes Eppendorf 022431048 SOLID 4 System Library Preparation Guide Appendix A Required Materials Prepare a 2 x 25 bp mate paired library Table 76 Required consumables Item Source Hydrochloric Acid 0 20 N VWR VW8888 0 Sodium Hydroxide 0 20 N VWR VW8889 0 CF 1 Calibration Fluid Kit Thermo Scientific CF 1 PR 1 Conditioning Kit Thermo Scientific PR 1 Filtered pipettor tips Major Laboratory Supplier MLS Razor blades MLS PCR strip tubes MLS 15 mL conical polypropylene tubes MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance The NanoD
22. Library PCR Primer 2 Library amplification SOLiD Library Oligos Kit 2 EcoP15I CAP Adaptor ds 2 x 25 bp mate paired library preparation SOLiD Library Oligos Kit 2 Internal Adaptor ds DNA circularization SOLiD Library Oligos Kit 2 LMP CAP Adaptor ds 2 x 50 bp mate paired library preparation Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance 162 SOLID 4 System Library Preparation Guide Appendix A Required Materials Prepare a 2 x 25 bp mate paired library Table 73 Required Applied Biosystems reagent kits continued Item part number Components Kit components used in SOLID 2 x 25 bp Mate SOLID 2 x 25 bp Mate Paired Library Construction Paired Library Enzyme Kit Ki e 5X End Polishing Buffer DNA end repair 4443472 8 e End Polishing Enzyme 1 10 U uL e End Polishing Enzyme 2 5 U uL dNTP 10 mM 5X Ligase Buffer Adaptor ligation DNA T4 DNA Ligase 5 U uL circularization DNA end repair e Klenow Fragment Stop Buffer DNA Polymerase 10 U uL Nick Translation Buffer Nick translation e Sinefungin 10 mM EcoP15l digestion cofactor e 10X Plasmid Safe Uncircularized DNA removal Buffer Plasmid Safe DNase ATP 25 mM e Platinum PCR Library amplification Amplification Mix SOLiD Mate Paired Library Bead amp Buffer Ki
23. O Pipettors m LH 231 gt Ke Ke v E e x eid o 59 a0 e x g a S a s fa a s F Appendix F Checklists and workflow tracking forms Workflow tracking prepare a 2 x 25 bp mate paired library Workflow tracking prepare a 2 x 25 bp mate paired library 232 Sample Quantitation Lot number Step Quantity of DNA Step Lot number Starting Amount SOLID Library Oligos Kit 1 Shearing the DNA End Repair Methylation of Genomic EcoP 151 Size Selection Plasmid Safe DNase Treatment Quantitative PCR P1 Adaptor P2 Adaptor Library PCR Primer 1 Library PCR Primer 2 SOLiD Library Oligos Kit 2 EcoP151 CAP Adaptor Sample Quantitation Internal Adaptor Lot number Starting Amount Shearing the DNA Ste Quantity of DNA Lot number Starting Amount SOLiD Library Oligos Kit 1 Shearing the DNA P1 Adaptor End Repair P2 Adaptor Methylation of Genomic EcoP15l Library PCR Primer 1 Size Selection Library PCR Primer 2 Plasmid Safe DNase nner Treatment SOLiD Library Oligos Kit 2 Quantitative PCR EcoP151 CAP Adaptor Internal Adaptor Sample Quantitation Lot number Step Quantity of DNA Step Lot number Starting Amount SOLiD Library Oligos Kit 1 Shearing the DNA P1 Adaptor End Repair P2 Adaptor Methylation of Genomic EcoP151 Library P
24. O iBase System O E Gel 296 SizeSelect gel Thaw 50 bp DNA Ladder E O E Gel Safe Imager O 50 bp DNA Ladder on ice g 4 instrument O Nuclease free Water o L L1 Pipettors O Filtered pipettor tips O Thermal cycler Library PCR Primer 1 O Thaw Library PCR 2 2 O Microcentrifuge Library PCR Primer 2 Primers 1 and 2 on ice E 2 O Vortexer Platinum PCR Amplification O Thaw Platinum amp PCR 52 S O Picofuge Mix Amplification Mix on ice 5 s Ll Pipettors SOLID Library Column 5 2 1 5 mL LoBind tubes Purification Kit Z O PCR strip tubes O Filtered pipettor tips O Real time PCR system SOLID Library TaqMan 9 Quantitation Kit 5 c 3 s SOLID 4 System Library Preparation Guide Appendix F Checklists and workflow tracking forms Workflow checklists prepare an express fragment library Workflow checklists prepare an express fragment library Emdipmet Reagents Preparation steps Covaris S2 System O 1x Low TE Buffer Degas the water in the Shear the DNA Covaris microTube Covaris microTube adaptor Covaris microTube loading station 1 5 mL LoBind tubes Pipettors Filtered pipettor tips oO Ethylene glycol Covaris S2 System 30 minutes prior to use Supplement the circulated water chiller with 20 ethylene glycol Ligate P1 and End repair the Nick translate then amplify the library DNA P2 Adaptors to the DNA Microcentrifuge NanoDrop ND 1 000 Spectrophoto
25. S2 System PIOGFamis s cesso sec wort pee eet od che Shane heeled 237 Instrument Warranty Information lisse 239 Computer configuration 0 2 0 hn 240 Limited product warranty ecis 0 0 00 cee eet 240 Warranty period effective date 1 2 ete 241 Warranty claims sex eig EERPSnUESE GEORG epee bed eee nee be 3 Eg dope 241 Warranty exceptioris i lle eme ERR Een Rr Redon vo e ade e CER e ad 241 Warranty limitations slleseeeeeee RR IIR t 242 Damages claims and returns llli 243 Safety Gori Mes aded id umts uidemus Cae ne Ue eA 245 Instrumentation safety 0 000 eee eee nh 246 Chemical Satetyiss aagiedke fait teas ba gad Ge ck Oye edad Shae Sk Ayes 248 Glossa ck EE LUAM C ee ee eee ee 253 SOLID 4 System Library Preparation Guide Protocol SOLiD 4 System Library Preparation Guide Contents DOCUMENTAHON ato ecd oU IOTER rd Scie i ee RA ES 255 Related documentation ieena bi eek sek tbe ae Oh ER La eed didn Le 255 Send us your comments erro irene rya eae ieee eee eee 256 lae P a eu ets este ee cote 2 Oe ote ec va at StS oe Sea ats ses 257 Contents 8 SOLID 4 System Library Preparation Guide Preface Safety information Safety alert words SDSs SOLiID 4 System Library Preparation Guide N Note For important instrument safety information refer to the Applied Biosystems SOLiD 4 System Instrument Operation Guide PN 4448379 For general safety info
26. Some countries or jurisdictions limit the scope of or preclude limitations or exclusion of warranties of liability such as liability for gross negligence or willful misconduct or of remedies or damages as or to the extent set forth above In such countries and jurisdictions the limitation or exclusion of warranties liability remedies or damages set forth above shall apply to the fullest extent permitted by law and shall not apply to the extent prohibited by law Damages claims and returns Damages If shipping damage to the product is discovered contact the shipping carrier and request inspection by a local agent Secure a written report of the findings to support any claim Do not return damaged goods to Applied Biosystems without first securing an inspection report and contacting Applied Biosystems Technical Support for a Return Authorization RA number Claims After a damage inspection report is received by Applied Biosystems Applied Biosystems will process the claim unless other instructions are provided Returns Do not return any material without prior notification and authorization If for any reason it becomes necessary to return material to Applied Biosystems contact Applied Biosystems Technical Support or your nearest Applied Biosystems subsidiary or distributor for a return authorization RA number and forwarding address Place the RA number in a prominent location on the outside of the shipping container and return the m
27. Thaw 5x End Polishing Buffer and dNTP Mix on ice L Oo O L Oo LH L L L L L L LH L L L L L L Pipettors Purification Kit Filtered pipettor tips Microcentrifuge O Multiplex Library P1 Adaptor Thaw P1 and P2 g 2 Vortexer ds 50 uM Adaptors on ice S 22a Picofuge O Barcode 0XX 50 uM Thaw5x T4 Ligase a 2 1 5 mL LoBind tubes O 5x T4 Ligase Buffer Buffer on ice ggo Pipettors O T4 Ligase D lt E Filtered pipettor tips O Nuclease free Water ag O SOLID Library Column Purification Kit ow O Thermal cycler O Multiplex Library PCR 1 Thaw Library PCR s O Microcentrifuge O Multiplex Library PCR 2 Primers 1 and 2 on ice O Vortexer O Platinum PCR Thaw Platinum PCR S a O Picofuge Amplification Mix Amplification Mix on 5 E O PCR strip tubes O SOLID Library Column ice t O 1 5 mL LoBind tubes Purification Kit z O Pipettors 9 O Filtered pipettor tips O Real time PCR system SOLiD Library Taq Man E S Quantitation Kit nm So P S pad 2 3 0 Qa E Sy DL Vortexer 3o o 3 H Picofuge eee 92 I 1 5m LoBind tubes lt Ooo H Pipettors Q or 20 i n A aS O Filtered pipettor tips d O iBase System O E Gel 296 SizeSelect gel O Thaw 50 bp DNA 2g O E gel Safe Imager O 50 bp DNA Ladder Ladder on ice 5 8 instrument O Nuclease free Water 22 LH Pipettors o2 O Filtered pipettor tips SOLiID 4 System Library Preparation Guide 233 F Appendix F Chec
28. contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions Table 63 Optional Applied Biosystems reagent kits Item part number Components Kit components used in SOLiD Fragment Library Construction Kit Reagents 4443713 SOLiD Fragment Library Enzyme Core Kit e 5X End Polishing Buffer e dNTP 10 mM End Polishing Enzyme 1 e End Polishing Enzyme 2 DNA end repair e 5X Ligase Buffer e T4 DNA Ligase Ligation of P1 and P2 Adaptors Platinum PCR Amplification Mix Nick translation library amplification Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance S Invitrogen products can be ordered at www invitrogen com SOLID 4 System Library Preparation Guide 151 gt 9 o D 2 2 x gt ZU D Je s a m D D 2 Appendix A Required Materials Prepare an express fragment library Table 64 Required equipment Item Source Covaris S2 System 110 V for U S customers 220 V for international customers The system includes e Covaris S2 sonicator e Latitude laptop from Dell Inc e MultiTemp IIl Thermostatic Circulator e Covaris 2 series Machine Holder for one 1 5 mL microcentrifuge tube e Covaris 2 series Machine Holder for one 0 65 mL microce
29. ethylene glycol SOLID 4 System Library Preparation Guide 135 Chapter 4 Barcoded Fragment Library Preparation End repair the DNA 4 Place the Covaris microTUBE into the loading station While keeping the snap cap on insert a pipette tip through the pre split septa then slowly remove the sheared DNA Transfer the sheared DNA into a new 1 5 mL LoBind tube End repair the DNA Repair the DNA ends with End Polishing Enzyme 1 and End Polishing Enzyme 2 Purify the DNA with SOLiD Library Column Purification 136 Kit Combine and mix the following components in a 1 5 mL LoBind tube see Table 52 Table 52 Mix for end repair of DNA Component Volume pL Sheared DNA 100 5X End Polishing Buffer 40 dNTP Mix 10 mM 8 End Polishing Enzyme 1 10 U uL 4 End Polishing Enzyme 2 5 U uL 16 Nuclease free Water 32 Total 200 Incubate the mixture at room temperature for 30 minutes Add 4 volumes of Binding Buffer B2 S with 55 isopropanol to the end repaired DNA Apply about 700 uL of end repaired DNA in the Binding Buffer B2 S to the column s The maximum yield of DNA can be achieved if the amount of DNA loaded to a SOLiD Library column is lt 5 ug Use more columns if necessary Let the column s stand for 2 minutes at room temperature Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute and discard the flow through Repeat steps 2 and 4
30. 12 C Mode Frequency sweeping Water Quality Testing Function Off Duty cycle 2 e Intensity 7 e Cycles burst 200 Time 10 seconds 800 to Covaris Shearing in 2096 glycerol Number of Cycles 30 1000 Bp 13 mm x 65 mm borosilicate tube Bath Temperature 5 C e Bath Temperature Limit 12 C Mode Frequency sweeping Water Quality Testing Function Off e Duty cycle 2 ntensity 5 e Cycles burst 200 Time 10 seconds gt 5 Oo D 2 x 9 e lt go A 7 E n D o m o 0 Bl SOLID 4 System Library Preparation Guide 237 e Appendix G Covaris S2 System Covaris S2 System Programs 238 SOLID 4 System Library Preparation Guide Appendix H Instrument Warranty Information This appendix covers B Computer configuration 0 0 00 ccc ee 240 E Limited product warranty 2 02 0 ccc eee nea 240 B Warranty period effective date 0 0 cee teens 241 B Warranty claims 0 ccc a 241 E Warranty exceptions 0 0 ccc cece a 241 E Warranty limitations 1 0 20 0 242 E Damages claims andreturns 00 00 243 uoneuuoJu gt ke Ke Lo E Q E E zy 7 ct o 5j 3 R EI x SOLID 4 System Library Preparation Guide 239 Appendix H Instrument Warranty Information Computer configuration Computer configuration Applied Biosystems supplies or recommends cer
31. 3 Mate Paired Library Preparation Gel purify the library with a Size Selection gel Gel purify the library with a Size Selection gel 122 Load the library 1 Plug the adapter plug of the E Gel iBase system into an electrical outlet Remove the SOLiD Library Size Selection gel from its package then insert the gel with its combs into the iBase system a Slide the gel into the two electrode connections on the iBase system Ensure that the two electrodes on the right side of the cassette touch the two contacts on the iBase system The Invitrogen logo should be at the bottom of the base b Press the gel firmly at the top and bottom to seat the gel in the iBase system If the gel is correctly inserted a red light glows Remove the combs Load lt 500 ng of sample in 25 uL volume without loading dye into the wells of the top row Use Nuclease free Water as diluent if necessary Skip the center well smaller well in the top center of the gel for the ladder and skip a single well to the right and left of the center top well Skip the two outermost wells to avoid edge effects Do not load more than 500 ng of DNA per lane see Figure 18 on page 123 Mix 0 5 uL of 1 ug uL of 25 bp DNA Ladder Invitrogen 10597 011 with 20 uL of Nuclease free Water Load 10 uL of the diluted DNA ladder into the small middle well of the top row marked M see Figure 18 on page 123 Load 25 uL of Nuclease free Water into any remaining e
32. 3 Mate Paired Library Preparation Nick translate the circularized DNA IMPORTANT DNA must be quantitated with the NanoDrop ND 1000 Spectrometer not by PicoGreen or any other fluorescence assay If you have 2100 ng DNA NanoDrop measurement proceed directly without stopping to Nick translate the circularized DNA 100 ng DNA NanoDrop measurement prepare the library again with any necessary changes to improve yield Restart the library preparation from Shear the DNA on page 53 Nick translate the circularized DNA Nick translate the D IMPORTANT Incubate the nick translation reaction at 5 C on a thermocycler circularized DNA using the No heated lid feature DNA polymerase I is very sensitive to slight changes in temperature Before adding enzyme to the reaction mix for nick translation chill the enzyme and the reaction mix separately in a thermocycler at 5 C according to the procedure below 1 Calculate the amount of DNA polymerase I 10 U uL needed Y pL in the nick translation reaction For X ng of circularized DNA use X 100 uL of DNA polymerase I where X is the number of nanograms of circularized DNA If X lt 400 ng Y 4 uL use 4 uL 2 Prepare the reaction mix in a 0 2 mL PCR tube see Table 19 on page 69 68 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Nick translate the circularized DNA Table 19 Reaction mix for nick transla
33. 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTATGTCATAAGCT GCT GTACGGCCAAGGCG 3 52 Barcode 050 50 uM 5 CGCCTTGGCCGTACAGCAG3 19 5 CTGCCCCGGGTTCCTCATTCTCTGAAGGCTTGCCTGCTGTACGGCCAAGGCG 3 52 Barcode 051 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTAAGCAGGAGTCTGCTGTACGGCCAAGGCG 3 52 Barcode 052 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGTAATTGTAACTGCTGTACGGCCAAGGCG 3 52 Barcode 053 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGTCATCAAGTCT GCT GTACGGCCAAGGCG 3 52 210 SOLID 4 System Library Preparation Guide Appendix D Oligonucleotide Sequences Library construction oligonucleotides Multiplex adaptor and barcode sequence Sequence bp Barcode 054 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTAAAAGGCGGACTGCTGTACGGCCAAGGCG 3 19 52 Barcode 055 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTAGCTTAAGCGCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 056 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGCATGTCACCCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 057 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTCTAGTAAGAACTGCTGTACGGCCAAGGCG 3 19 52 Barcode 058 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTTAAAGTGGCGCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 059 50 uM 5 C
34. 98 Required consumables Item Source MaxXtract High Density Tubes Qiagen 129046 Phenol chloroform isoamyl alcohol with pH 7 9 buffer Applied Biosystems AM9730 1 5 mL LoBind Tubes Eppendorf 022431021 Filtered pipettor tips Major Laboratory Supplier MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance 194 SOLID 4 System Library Preparation Guide Appendix C Supplemental Procedures Phenol chloroform isoamyl alcohol extraction with MaXtract Procedure 1 Centrifuge the MaXtract tube at 21 000 x g minimum 14 000 x g for 20 seconds 2 Addan equal volume of cold phenol chloroform isoamyl alcohol to the aqueous sample 3 Mix by inversion 4 Transfer the solution to the pre spun MaXtract tube 5 Centrifuge at room temperature at 21 000 x g minimum 14 000 x g for 5 minutes 6 Transfer the upper aqueous layer to a new tube 7T Discard the MaXtract tube with phenol chloroform isoamyl layer in hazardous waste 8 Proceed to Isopropanol precipitation on page 198 2 xe o o Q x i ie o je D 3 D E m av fe 9 o o E I n SOLID 4 System Library Preparation Guide 195 Appendix C Supplemental Procedures PAGE gel DNA elution PAGE gel DNA elution Materials and Table 99 Required equipment equipment required Item Source Microcentrifuge 5417R refrigerated
35. Adaptors to the DNA LMP CAP ligation adds the LMP CAP Adaptors to the sheared end repaired DNA The LMP CAP Adaptor is missing a 5 phosphate from one of its oligonucleotides which results in a nick on each strand when the DNA is circularized in a later step The LMP CAP Adaptors are included in double stranded form in the SOLiD Mate Paired Library Oligos Kit Size select the DNA Size selection is performed after CAP adaptor ligation to remove unbound CAP adaptors Depending on the desired insert size range the ligated purified DNA is run on a 0 8 or 1 agarose gel The correctly sized ligation products are excised and purified using the SOLiD Library Quick Gel Extraction Kit IMPORTANT Size selection should not be skipped under any circumstances Contamination of unbound CAP adaptors can compromise the circularization reaction in the next step SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Workflow Circularize the DNA Sheared DNA ligated to LMP CAP Adaptors is circularized with a biotinylated internal adaptor To increase the chances that ligation will occur between two ends of one DNA molecule versus two different DNA molecules a very dilute reaction is used The circularization reaction products are purified using the SOLiD Library Quick Gel Extraction Kit The Internal Adaptor is included in double stranded form in the SOLiD Mate Paired Library Oligos Kit uolj
36. C or proceed directly to Amplify the library on page 80 SOLID 4 System Library Preparation Guide 79 3 Chapter 3 Mate Paired Library Preparation Amplify the library Amplify the library Perform 1 Prepare a master mix for amplification reactions see Table 30 PCR on the library Table 30 PCR master mix for amplification of the library Component Volume pL Platinum PCR Amplification Mix 350 Library PCR Primer 1 50 uM 7 Library PCR Primer 2 50 uM 7 Total 364 t Platinum PCR Amplification Mix contains a proofreading enzyme for high fidelity amplification 2 For the negative control aliquot 50 uL of PCR master mix to a PCR tube Add 5 uL of Nuclease free Water to the tube 3 Add 26 uL of DNA bead complex solution to the remaining 314 uL of PCR master mix Vortex to mix then divide evenly 784 uL among four PCR tubes 4 Run see Table 31 Table 31 PCR conditions to amplify the library Stage Step Temp Time Holding Denature 94 C 3 min Cycling Denature 94 C 15 sec Anneal 62 C 15 sec Extend 70 C 1 min Holding Extend 70 C 5min Holding 4 C oo t Cycling number determined by trial amplification See Trial amplify the library on page 78 5 Pool all of the PCR samples into a 1 5 mL LoBind tube 6 Place the tube of beads in a magnetic rack then transfer the supernatant to a fresh 2 mL LoBind tube Discard the tube containing the beads
37. Centrifuge the column at 14 000 x g for 1 minute 13 Run 1 uL ofthe concentrated library on a DNA 1000 Chip on the Agilent Technologies 2100 Bioanalyzer see Figure 13 on page 82 If the library size distribution is between 250 and 350 bp and there are no PCR by products lt 200 bp detectable see Figure 13B on page 82 skip Gel purify the library with a Size Selection gel on page 82 Proceed directly to Quantitate the library by performing quantitative PCR qPCR on page 87 SOLiID 4 System Library Preparation Guide 81 Chapter 3 Mate Paired Library Preparation Gel purify the library with a Size Selection gel A B F INGN5 F 2 Cy MON 3 s 1 1404 14 SU i 1204 1204 i 1004 1004 604 PCR by products e i Library Libra j a i E A ma ll S Ss eS a iara T so 500 70 1000 2000 000 10380 bo M 300 500 p 1000 2000 H 5000 10380 bp Figure 13 Bioanalyzer electropherograms of libraries that were amplified by PCR and were purified with the SOLiD Library Micro Column Purification Kit 3A A library with PCR by products that needs to be gel purified with a SizeSelect gel 3B A library without PCR by products that can be quantitated by qPCR STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Gel purify the library with a Size Selection gel or Quantitate the
38. Preparation Quantitate the library by performing quantitative PCR qPCR 30 SOLID 4 System Library Preparation Guide Section 2 2 Prepare an express fragment library 2 Materials and equipment required Section 2 2 Prepare an express fragment library This protocol is designed for 10 ng to 5 ug of genomic DNA or ligated PCR product You should modify the protocol with any change in the starting amount of DNA If you are constructing a targeted resequencing library with small sized PCR products S500 bp then you must perform a PCR product ligation step For a concatenation protocol contact your field applications specialist Materials and equipment required See Appendix A on page 145 for a list of equipment kits and consumables necessary for this procedure o F hy xe a 0 N Tm x o Ke 3 D Ee E o lt e lt 2e 0 xe o lt fe 2 SOLID 4 System Library Preparation Guide 31 2 Chapter 2 Fragment Library Preparation Workflow Workflow Shear the DNA Repair the DNA ends with End Polishing Enzymes 1 and 2 Purify the DNA with the SOLID Library Column Purification Kit Ligate P1 Ligate P1 and P2 Adaptors to the DNA Purify the DNA with the SOLID Library Column Purification Kit Nick translate then amplify the library Workflow overview 32 Purify the DNA with the SOLID Library Column Purification Kit Quantitate the library by performing quantitativ
39. Preparation Guide Appendix H Instrument Warranty Information Warranty period effective date Applied Biosystems warrants that for a period of ninety 90 days from the date the warranty period begins the tapes diskettes or other media bearing the operating software of the product if any will be free of defects in materials and workmanship under normal use If there is a defect in the media covered by the above warranty and the media is returned to Applied Biosystems within the ninety 90 day warranty period Applied Biosystems will replace the defective media Unless indicated herein Applied Biosystems makes no warranty whatsoever in regard to products or parts furnished by third parties including but not limited to the non APC branded UPS or APC UPS Covaris S2 Genomic Solutions Hydroshear Reciruclating Chiller and IKA ULTRA TURRAX purchased or obtained from a third party Such products or parts will be subject to the warranties if any of their respective manufacturers to the extent they are transferable or otherwise available to Applied Biosystems buyer Applied Biosystems at its sole discretion may refuse to provide buyer with support or service for buyer s use of Covaris S2 in a method not described in a SOLiD System protocol Applied Biosystems does not warrant that the operation of the instrument or its operating software will be uninterrupted or be error free Warranty period effective date Any applicable warranty per
40. Preparation Steps Degas the water in the Covaris S2 System 30 minutes prior to use Supplement the circulated water chiller with 20 ethylene glycol Thaw end repair reagents on ice Thaw 10x NEBuffer 3 100x BSA and S adenosylmethionine on ice Thaw EcoP15l CAP Adaptor on ice O Thaw ligation reagents on ice Prepare 1x TAE buffer Prepare a 0 8 or 1 0 agarose gel 229 suJJoJ 6urjoen MOJ P1JOM pue SiSIpjoeu 4 xipueddy F Appendix F Checklists and workflow tracking forms Workflow checklists prepare a 2 x 25 bp mate paired library Circularize the Isolate the circularized DNA Digest the DNA End repair with Klenow Bind the Ligate P1 and Nick translate 230 DNA library molecules to P2 Adaptors the DNA library beads numum QOOOOOOO0Q000000 00 OOOOOOOOOOOOO ODO00000 000000 Equipment Microcentrifuge Vortexer Picofuge Pipettors Filtered pipettor tips Microcentrifuge NanoDrop ND 1000 Spectrophotometer Incubator 37 C Vortexer Picofuge 1 5 mL LoBind tubes Pipettors Filtered pipettor tips Incubator 37 C Incubator 65 C Vortexer Scale Picofuge 1 5 mL LoBind tubes Pipettors Filtered pipettor tips Incubator 65 C Vortexer Picofuge 5 mL LoBind tubes ipettors Itered pipettor tips 1 ortexer icofuge Tube Magnetic Rack Rotator 1 5 mL LoBind tubes ipettors iltered pipettor tips ortexer icofuge ipett
41. SDS provided by the manufacturer and observe all relevant precautions SOLID 4 System Library Preparation Guide 147 gt 9 o D 5 2 x gt ZU D Je s a m D D D Appendix A Required Materials Prepare a standard fragment library Table 58 Required equipment Item Source Covaris S2 System 110 V for U S customers 220 V for international customers The system includes e Covaris S2 sonicator e Latitude laptop from Dell Inc e MultiTemp IIl Thermostatic Circulator e Covaris 2 series Machine Holder for one 1 5 mL microcentrifuge tube e Covaris 2 series Machine Holder for one 0 65 mL microcentrifuge tube e Covaris 2 series Machine Holder for one 13 mm x 65 mm tube e Covaris 2 Series Machine Holder for one microTUBE e Covaris microTUBE Prep Station e Covaris Water Tank Label Kit e Covaris microTUBEs 1 pack of 25 For system materials summary refer to Covaris S2 System Materials Summary SOLiD 4 System Site Preparation Guide PN 4448639 Applied Biosystems 4387833 110 V Applied Biosystems 4392718 220 V or Covaris Microcentrifuge 5417R refrigerated without rotor e Eppendorf 022621807 120 V 60 Hz e Eppendorf 022621840 230 V 50 Hz FA 45 24 11 fixed angle rotor 24 x 1 5 2 mL including aluminum lid aerosol tight Eppendorf 022636006 96 well GeneAmp PCR System 9700 Applied B
42. SDSs See About SDSs on page 249 Cleaning or CAUTION Using a cleaning or decontamination method other than that decontaminating specified by the manufacturer may result in damage to the instrument the instrument 246 SOLID 4 System Library Preparation Guide Appendix Safety Instrumentation safety Physical hazard safety Solvents and WARNING PHYSICAL INJURY HAZARD Always wear eye protection pressurized fluids when working with solvents or any pressurized fluids Be aware that PEEK tubing is a polymeric material Use caution when working with any polymer tubing that is under pressure Always wear eye protection when near pressurized polymer tubing Extinguish all nearby flames if you use flammable solvents Do not use PEEK tubing that has been severely stressed or kinked Do not use PEEK tubing with tetrahydrofuran or nitric and sulfuric acids Be aware that methylene chloride and dimethyl sulfoxide cause PEEK tubing to swell and greatly reduce the rupture pressure of the tubing Be aware that high solvent flow rates 40 mL min may cause a static charge to build up on the surface of the tubing Electrical sparks may result SOLID 4 System Library Preparation Guide 247 Appendix Safety Chemical safety Chemical safety General chemical safety 248 WARNING CHEMICAL HAZARD Before handling any chemicals refer to the Safety Data Sheet SDS provided by the manufacturer an
43. Spectrophotometer software dialog box from http nanodrop com nd 1000 software html 3 Select the Nucleic Acid button 4 Lift the sampling arm and load 2 uL of Nuclease free Water onto the lower measurement pedestal and lower the sampling arm see Figure 29 on page 191 190 SOLID 4 System Library Preparation Guide Appendix C Supplemental Procedures Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer Sampling Arm Measurerrent Pedestal Figure 29 Components of the NanoDrop ND 1000 Spectrophotometer 5 In the dialog box click OK and allow the instrument to initialize 6 Lift the sampling arm and use a Kimwipe to remove water from the measurement pedestal and the sampling arm 7 Load 2 uL of the same buffer that was used to resuspend or elute the DNA onto the measurement pedestal and lower the sampling arm 8 Click Blank and allow the instrument to take a measurement see Figure 30 on page 192 gt ko o o 2 x o ie iS sok o 3 o 5 e RS Q fe o Q E n SOLID 4 System Library Preparation Guide 191 C Appendix C Supplemental Procedures Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer Figure 30 NanoDrop ND 1000 Spectrophotometer software measurement dialog box 9 Lift the sampling arm and wipe away the buffer from both the upper and lower measurement pedestals with a Kimwipe The instrument is now ready to take readings
44. Starting amount of DNA number of cycles 500 ng to 1 ug 6 to 8 cycles 1 ug to 2 ug 4 to 6 cycles 2 ug to 5 ug 3 to 6 cycles 4 Pool all four of the PCR tubes into new 1 5 mL LoBind Tubes SOLID 4 System Library Preparation Guide Chapter 4 Barcoded Fragment Library Preparation 4 Quantitate the library by performing quantitative PCR qPCR Purify the DNA with 1 Add 4 volumes of Binding Buffer B2 L with 40 isopropanol to the sample the SOLiD Library Column Purification 2 Apply about 700 uL of PCR product in the Binding Buffer B2 L to the Kit column s The maximum yield of DNA can be achieved if the amount of DNA loaded to a SOLiD Library column is lt 5 ug Use more columns if necessary 3 Let the column s stand for 2 minutes at room temperature 4 Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute and discard the flow through 5 Repeat steps 2 and 4 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s 6 Add 650 uL of Wash Buffer W1 to wash the column s 7 Centrifuge the column s at 210 000 x g 13 000 rpm for 2 minutes then discard the flow through Repeat to remove residual wash buffer RU Eo o 2 K e ES 8 Air dry the column s for 2 minutes to evaporate any residual alcohol Transfer the column s to clean 1 5 mL LoBind tube s Aeq 1ueuu6e44 pepooueg p 19 deyo 9 Add 50 uL of Elution Buffer E1 to
45. Water Fill each of the collection wells in the middle of the gel with 25 uL of Nuclease free Water Add 20 uL of Nuclease free Water to the middle center well see Figure 23 on page 143 SOLID 4 System Library Preparation Guide Chapter 4 Barcoded Fragment Library Preparation 4 Gel purify the libraries Nuclease Nuclease Nuclease Nuclease free free free free Water DNA Water Ladder water DNA Water 25 uL 20 uL 25 uL Nuclease Nuclease Nuclease free free Water Water Figure 23 Where to load DNA ladder and Nuclease free Water in a SOLiD Library Size Selection gel to size select the DNA 3 Run the gel iBase system program SizeSelect 2 Runtime 14 30 14 minutes and 30 seconds Monitor the SOLID Library Size Selection gel in real time with the E Gel Safe Imager Real Time Transilluminator 4 If needed during the run fill the middle collection wells with Nuclease free Water 5 When the 250 bp band from the marker ladder lane is at the top of the collection well stop the run if the run has not already stopped see Figure 24 on page 144 hw Note After amplification the total size of the adaptors in a barcoded library is 93 bp The elution size is 240 to 270 bp 6 Collect the solution from the wells and pool according to samples 7 Wash each collection well with 25 uL with Nuclease free Water then retrieve the wash solution with the solution collected in Step 6 8 Optional Concentrate
46. adaptor needed x pmol 3 Y uL adaptor needed xzpmol x S H p 2p 2 pmol Example For 20 ug of DNA with an insert size of 1 to 2 kb 6 1 10 p gt ipmol X pmol ug DNA 1 ug DNA T EO 7500 1 0 pmol yg DNA H lt 1 0 pmol 1 pL adaptor needed Y uL adaptor needed 20 ug DNA 7a DNA Ug DNA 3 mi 30 pL adaptor needed XpmollugDNA 1ugDNA x OPQ pmol 5 17 6 pmollug DNA X1 9 DNA for linker ligation x2 pmol DNA available for adaptor ligation xs pmol adaptor needed Y uL adaptor needed x2 pmol X3 pmol Xiug x 60 1 uL i 50 pmol ug DNA Fold reduction 17 6 pmol 1 ug DNA SOLID 4 System Library Preparation Guide Appendix F Checklists and workflow tracking forms This appendix covers E Workflow checklists prepare a standard fragment library 222 W Workflow checklists prepare an express fragment library 223 E Workflow tracking prepare standard and express fragment libraries 224 B Workflow checklists prepare a 2 x 50 bp mate paired library 225 HW Workflow tracking prepare a 2 x 50 bp mate paired library 228 B Workflow checklists prepare a 2 x 25 bp mate paired library 229 E Workflow tracking prepare a 2 x 25 bp mate paired library 232 W Workflow checklists prepare a barcoded fragment library 233 E Workflow tracking prepare a barcoded fragment library
47. back to the column s then let the column s stand for 2 minutes Repeat step 10 SOLID 4 System Library Preparation Guide Section 2 1 Prepare a standard fragment library P End repair the DNA 12 If necessary pool the eluted DNA 13 Ifthe starting DNA input amount is 2500 ng quantitate the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer see Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer on page 189 Ifthe starting DNA input amount is 500 ng assume 70 recovery of input material after shearing STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Ligate the P1 and P2 Adaptors to the DNA on page 22 o F 5 xe et N TI EM o Ke zi E ler ES e lt o xe o E fe 2 SOLID 4 System Library Preparation Guide 21 Chapter 2 Fragment Library Preparation Ligate P1 and P2 Adaptors to the DNA Ligate P1 and P2 Adaptors to the DNA Ligate the P1 and P2 Adaptors to the DNA Purify the DNA with the SOLiD Library Column Purification Kit 22 1 Calculate the amount of adaptor needed Y for the reaction based on the amount of DNA from the last purification step for calculation details see Ligation of P1 and P2 Adaptors on page 216 If DNA fragments were sheared using the standard protocol for fragment library preparation the average insert size sho
48. below see Table 109 Covaris S2 System l 2 ii Table 109 Required maintenance of the Covaris S2 System Required maintenance task Frequency to perform task Degas water for 30 minutes prior to use Before every use Every two weeks Change water Daily Clean with bleach 236 SOLID 4 System Library Preparation Guide Appendix G Covaris S2 System Covaris S2 System Programs Covaris S2 System Programs Fragment library IMPORTANT Ensure that the bath temperature during shearing is between g preparation 5 to 10 C Higher shearing temperatures can be harmful to DNA standard express and barcoded m Program the Covaris S2 System Number of Cycles 6 Bath Temperature 5 C Bath Temperature Limit 30 C Mode Frequency sweeping Water Quality Testing Function Off Duty cycle 10 Intensity 5 e Cycles burst 100 Time 60 seconds IMPORTANT Set the chiller temperature to between 2 to 5 C to ensure that the temperature reading in the water bath displays 5 C The circulated water chiller should be supplemented with 20 ethylene glycol Mate paired library Table 110 Recommended shearing conditions or desired mate paired library preparation insert sizes Insert size Shearing method Shearing conditions 600 to Covaris Shearing in 2096 glycerol e Number of Cycles 75 SE Spe 13 mm x 65 mm borosilicate tube Bath Temperature 5 C e Bath Temperature Limit
49. conditions Number of Cycles 6 Bath Temperature 5 C Bath Temperature Limit 30 9C Mode Frequency sweeping Water Quality Testing Function Off Duty cycle 10 Intensity 5 e Cycles burst 100 Time 60 seconds D IMPORTANT Make sure that the water in the Covaris S2 tank is filled with fresh deionized water to fill line level 12 on the graduated fill line label The water should cover the visible glass part of the tube Set the chiller temperature to between 2 to 5 C to ensure that the temperature reading in the water bath displays 5 C The circulated water chiller should be supplemented with 20 ethylene glycol To load and unload the Covaris microTUBE correctly from the microTUBE holder see Load and unload Covaris microTUBE vials from the Covaris microTUBE holder on page 186 4 Place the Covaris microTUBE into the loading station While keeping the snap cap on insert a pipette tip through the pre split septa then slowly remove the sheared DNA Transfer the sheared DNA into a new 1 5 mL LoBind tube SOLiID 4 System Library Preparation Guide 19 End repair the DNA Chapter 2 Fragment Library Preparation End repair the DNA Repair the DNA 1 ends with End Polishing Enzyme 1 and End Polishing Enzyme 2 Purify the DNA with Is SOLID Library Column Purification Kit 2 10 11 20 Combine and mix the following components in a 1 5 mL LoBind tube see Table 3 T
50. ds and P2 Adaptor ds on ice Thaw dNTP Mix on ice Appendix F Checklists and workflow tracking forms Workflow checklists prepare a 2 x 25 bp mate paired library Equipment Reagents Preparation Steps Quantitate Filtered pipettor tips Real time PCR system SOLiD 4 System Library Preparation Guide SOLiD Library TaqMan Quantitation Kit gt O Thermal cycler O Library PCR Primer 1 Thaw Library PCR Primers 1 ES O E Gel iBase Power O Library PCR Primer 2 and 2 on ice E E System O Platinum amp PCR Amplification Thaw Platinum amp PCR s O PCR strip tubes Mix Amplification Mix g O Pipettors O Nuclease free Water e O Filtered pipettor tips O 2 E Gel EX Gel a O Thermal cycler O Library PCR Primer 1 Thaw Library PCR Primers 1 5 O E Gel iBase Power O Library PCR Primer 2 and 2 on ice E System L Platinum PCR Amplification Thaw Platinum PCR F O 6 Tube Magnetic Rack Mix Amplification Mix S O PCR strip tubes O 25 bp DNA Ladder ay O 1 5 mL LoBind tubes O Nuclease free Water a O 2 0 mL LoBind tubes O SOLiD Library Micro E O Pipettors Column Purification Kit O Filtered pipettor tips O E Gel8 iBase Power E Gel SizeSelect 2 Gel x System 25 bp DNA ladder S O Safe Imager Real Time Nuclease free Water 2 Transilluminator SOLiD Library Micro o O Gelimaging system Column Purification Kit O Microcentrifuge Fa O Vortexer 5 O Picofuge LH Scale E O 1 5 mL LoBind tubes
51. flow through Repeat centrifugation at maximum speed to remove residual wash buffer 7 Transfer the column s to clean 1 5 mL LoBind tube s 8 Add 50 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature 9 Centrifuge the column s at maximum speed for 1 minute 10 Add the eluate from step 9 back to the column s then let the column s stand for 1 minute at room temperature 11 Centrifuge the column s at maximum speed for 1 minute 12 Ifnecessary pool the eluted DNA 13 Quantitate the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer see Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer on page 189 14 Optional To confirm DNA methylation see Confirm complete methylation of DNA fragments on page 200 STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Ligate EcoP15I CAP Adaptors to the methylated DNA on page 102 SOLiID 4 System Library Preparation Guide 101 Chapter 3 Mate Paired Library Preparation Ligate EcoP15 CAP Adaptors to the methylated DNA Ligate EcoP15I CAP Adaptors to the methylated DNA Ligate the adaptors 1 to the DNA of DNA from the last purification step Calculate the amount of adaptor Y needed for the reaction based on the amount 10 1 pmol X pmol ig DNA 1ggDNA 1 ug i T Averag
52. flow through 5 Repeat steps 2 and 4 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s 6 Add 650 uL of Wash Buffer W1 to wash the column s 7 Centrifuge the column s at 210 000 x g 13 000 rpm for 2 minutes then discard the flow through Repeat to remove residual wash buffer 8 Air dry the column s for 2 minutes to evaporate residual alcohol Transfer the column s to clean 1 5 mL LoBind tube s 9 Add 50 uL of Elution Buffer E1 to the column s to elute the DNA then let the column s stand for 2 minutes 10 Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute 11 Add the eluate from step 10 back to the column s then let the column s stand for 2 minutes Repeat step 10 o F hy xe et N TI EM o Ke zi E o ES e lt 0 xe amp E fe 2 12 If necessary pool the eluted DNA STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Size select the DNA on page 24 SOLID 4 System Library Preparation Guide 23 Chapter 2 Fragment Library Preparation Size select the DNA Size select the DNA 24 1 Remove a SOLiD Library Size Selection gel from its package Remove the combs from fop sample loading wells and middle collection wells Set the gel on the E Gel iBase system linked with the E Gel Safe Imager Real time Tran
53. gt applied AB Biosystems Applied Biosystems SOLID 4 System Library Preparation Guide April 2010 Library Templated Bead Instrument Preparation Preparation Operation For Research Use Only Not intended for any animal or human therapeutic or diagnostic use This user guide is the proprietary material of Applied Biosystems LLC or its affiliates and is protected by laws of copyright The customer of the SOLID System is hereby granted limited non exclusive rights to use this user guide solely for the purpose of operating the SOLID System Unauthorized copying renting modifying or creating derivatives of this user guide is prohibited Information in this document is subject to change without notice APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT EXPRESSED OR IMPLIED INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE OR NON INFRINGEMENT OF INTELLECTUAL PROPERTY TO THE FULLEST EXTENT ALLOWED BY LAW IN NO EVENT SHALL APPLIED BIOSYSTEMS BE LIABLE WHETHER IN CONTRACT TORT WARRANTY OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL INCIDENTAL INDIRECT PUNITIVE MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT INCLUDING BUT NOT LIMITED TO THE USE THEREOF WHETHER OR NOT FORESEEABLE AND WHETHER OR NOT APPLIED BIOSYSTEMS IS ADVISED OF THE POSSIBILITY OF SUCH DAMAGES TRADEMARKS The trademarks mentioned herein are the prope
54. imaging system Major Laboratory Supplier MLS Tabletop Centrifuge MLS Gel boxes and power supplies for agarose MLS gels Vortexer MLS Picofuge MLS Incubator 37 C MLS Incubator 70 C MLS Scale MLS Timer MLS Pipettors 2 uL MLS Pipettors 20 uL MLS Pipettors 200 uL MLS Pipettors 1000 uL MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance 8 For more information on the HydroShear DNA Shearing Device and materials refer to the manufacturer s documentation Or equivalent but validation of the equipment for library preparation is required gt ke o o 5 Q x gt D D fe s 5 a m D D 2 Table 69 Optional equipment Product name Vendor 2100 Bioanalyzer Agilent Technologies G2938C Qubit Fluorometer Invitrogen Q32857 t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance SOLID 4 System Library Preparation Guide 159 UN Appendix A Required Materials Prepare a 2 x 50 bp mate paired library 160 Table 70 Required consumables Item Source E Gel SizeSelect 2 Agarose optional Invitrogen G6610 02 E Gel EX Gel 2 10 Pak Invitrogen G4010 02 UltraPure DNA Typing Grade 50X TAE Invitrogen Bure 24710 030 Agarose LE Applied Biosystems AM9040
55. is complete 7 Pool the aliquots of sheared DNA if applicable SOLiID 4 System Library Preparation Guide 55 3 Chapter 3 Mate Paired Library Preparation Shear the DNA Purify the DNA with the SOLiD Library Column Purification Kit 56 10 11 12 13 Add 4 volumes of Binding Buffer B2 S with isopropanol 55 to 1 volume of sample Mix well Apply about 700 uL of the sample in the binding buffer to the PureLink column s in collection tube s Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat steps 2 and 3 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s Add 650 uL of Wash Buffer W1 with ethanol to wash the column s Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at maximum speed to remove residual wash buffer Transfer the column s to clean 1 5 mL LoBind tube s Add 50 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature Centrifuge the column s at maximum speed for 1 minute Add the eluate from step 9 back to the column s then let the column s stand for 1 minute at room temperature Centrifuge the column s at maximum speed for 1 minute If necessary pool the eluted DNA Quantitate the purified DNA by using 2 uL of the sample
56. library by performing quantitative PCR qPCR on page 87 as required Gel purify the library with a Size Selection gel 82 Load the library 1 Plug the adapter plug of the E Gel iBase Power System into an electrical outlet 2 Remove the SOLiD Library Size Selection gel from its package then insert the gel with its combs into the iBase system a Slide the gel into the two electrode connections on the iBase system Ensure that the two electrodes on the right side of the cassette touch the two contacts on the iBase system The Invitrogen logo should be at the bottom of the base b Press the gel firmly at the top and bottom to seat the gel in the iBase system If the gel is correctly inserted a red light glows 3 Remove the combs 4 Load 500 ng of sample in 25 uL volume without loading dye into the wells of the top row Use Nuclease free Water as diluent if necessary Skip the center well smaller well in the top center of the gel for the ladder and skip a single well to the right and left of the center top well Skip the two outermost wells to avoid edge effects Do not load more than 500 ng of DNA per lane see Figure 14 on page 83 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Gel purify the library with a Size Selection gel 5 Mix 0 5 uL of 1 ug uL of 100 bp DNA Ladder Invitrogen 15628 050 with 20 uL of Nuclease free Water Load 10 uL of the diluted DN
57. may adversely affect system performance Or equivalent but validation of the equipment for library preparation is required Table 65 Required consumables Item Source 1X Low TE Buffer Applied Biosystems 4389764 Nuclease free Water 1 L Applied Biosystems AM9932 Covaris microTUBEs Covaris 520045 Isopropyl alcohol Sigma Aldrich 19516 Ethylene glycol American Bioanalytical AB00455 01000 z 0 5 mL LoBind Tubes Eppendorf s 022431005 D 1 5 mL LoBind Tubes Eppendorf g 022431021 8 CF 1 Calibration Fluid Kit Thermo Scientific 3 CF 1 D PR 1 Conditioning Kits Thermo Scientific i PR 1 Filtered pipettor tips Major Laboratory Supplier MLS PCR strip tubes MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance The NanoDrop Conditioning Kit is useful for reconditioning the sample measurement pedestals to a hydrophobic state if they become unconditioned refer to the Nanodrop user s manual for more information The PR 1 kit consists of a container of specially formulated polishing compound and a supply of convenient applicators For the SDS of any chemical not distributed by Applied Biosystems contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions SOLiID 4 System Library Preparation Guide 153
58. of 1 1 6 kb range in a 1 0 agarose gel Elute the DNA using 1 Weigh the gel slice in a 15 mL polypropylene conical colorless tube the SOLiD Library Sa A 2 Add 30 uL of Gel Solubilization Buffer L3 for every 10 mg of gel 3 Dissolve the gel slice by vortexing the tube at room temperature until the gel slice has dissolved completely 15 minutes IMPORTANT Do not heat the gel to dissolve the gel slice When heated the DNA denatures and short insert libraries form heteroduplexes Heteroduplexes are deleterious to the library 4 Add 1 gel volume of isopropanol to the dissolved gel slice For example add 10 uL of isopropanol to 10 mg of gel Mix well 5 Apply the dissolved gel mixture to the Quick Gel Extraction column s in Wash Tube s Use one column per 400 mg agarose or load lt 2000 uL of dissolved gel mixture per column Use more columns if necessary 6 Centrifuge the column s at gt 12 000 x g for 1 minute then discard the flow through and place the column back on the Wash Tube s 7 Add 700 uL of Wash Buffer W1 with ethanol to the Quick Gel Extraction column s 8 Centrifuge the column s at gt 12 000 x g for 1 minute then discard the flow through 9 Centrifuge the Quick Gel Extraction column s again at maximum speed for 2 minutes to remove any residual Wash Buffer 10 Transfer the Quick Gel Extraction column s to clean 1 5 mL LoBind tube s 62 SOLID 4 System Library Preparation Guide
59. rpm for 3 minutes to shred the gel and collect in the bottom tube 5 If some gel pieces remain in the 0 5 mL LoBind tube repeat the centrifugation step using a new 1 5 mL LoBind tube and then pool the tubes 6 Add enough PAGE Elution Buffer 1 volume of 7 5 M ammonium acetate in 5 volumes of 1X TE to soak the gel pieces completely with a thin layer of liquid on top 7 Incubate at room temperature for 20 minutes The length of elution time can be increased 2 to 3 times for maximum elution 8 Transfer supernatant to a new 1 5 mL LoBind tube 9 Add 250 uL of PAGE Elution Buffer to the gel pieces 10 Incubate at 37 C for 40 minutes 11 Pool all of the liquids including the first elution into a 0 45 um filter Nanosep spin column with a 1 5 mL LoBind tube as the collection tube Centrifuge the column at 210 000 x g 13 000 rpm for 5 minutes 12 Proceed to Isopropanol precipitation on page 198 gt 19 o D 2 x 9 ie el 19 D 3 o Ej amp I Q o o o 9 2 SOLID 4 System Library Preparation Guide 197 Appendix C Supplemental Procedures Isopropanol precipitation Isopropanol precipitation Materials and equipment required 198 Table 101 Required equipment Isopropanol precipitation can be used to purify and or concentrate DNA Item Source Microcentrifuge 5417R refrigerated without rotor e Eppendorf 022621807 120 V 60 Hz e Eppendorf
60. then amplify the library lli eee 27 Quantitate the library by performing quantitative PCR qPCR 5 29 Section 2 2 Prepare an express fragment library 20005 31 Materials and equipment required 0 000 eee 31 WOrKHOW LT 32 TPS a nse tech hese sede EP 33 Shear the DNA xx egRa RR ERR RR Eee EE Ged RG Bas eee eee 34 End repair the DNA ucs tassi 02 0 0 tee 35 Ligate P1 and P2 Adaptors to the DNA 1 eee 37 Nick translate then amplify the library llle eee 39 Quantitate the library by performing quantitative PCR QPCR 40 SOLiID 4 System Library Preparation Guide 3 Contents Chapter 3 Mate Paired Library Preparation 000 0c eee eee 41 OVerVIeW kapd eed og e ate a Ke un gud ts opp ed ERU be ee agis 43 Section 3 1 Prepare a 2 x 50 bp mate paired library 47 Materials and equipment required liliis 47 Workflow uie E AN E ea a eet a RR e e eu aes PUE 48 TNS aces Vad tate ad deua eu NIRE aloha a te et ale et d apio duet Pent 52 Shear the DNA sonore Agau et eae 2 nde nce ade eee an ES 53 End repair the sheared DNA 0 000 cee eee eae 57 Ligate LMP CAP Adaptors to the DNA 2 0 eee 59 Size select the DNAS svi RR er RENE Hass we AS Ronee Ba S Ss 61 Circularize the DNA iare ea ee ee a am Ie ure pha A ie ee See 64 Isolate the circularized DNA 200 ce eee 66 Nick translate the circul
61. then let the column s stand for 1 minute at room temperature 11 Centrifuge the column s at maximum speed for 1 minute 12 Ifnecessary pool the eluted DNA 13 Quantitate the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer see Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer on page 189 STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to End repair the sheared DNA on page 98 SOLiID 4 System Library Preparation Guide 97 3 Chapter 3 Mate Paired Library Preparation End repair the sheared DNA End repair the sheared DNA Repair the DNA ends with the End Polishing reaction Purify the DNA with the SOLiD Library Column Purification Kit 98 bw T1 10 11 Note This reaction is optimal for lt 20 ug of starting material If 20 ug of starting material is used for shearing scale up the reaction as needed Combine and mix the following components in a LoBind tube see Table 34 Table 34 Combine components for end repair of DNA Component Amount Sheared DNA 48 uL 5X End Polishing Buffer 20 uL dNTP 10 mM 2 5 uL End Polishing Enzyme 1 10 U uL 3 uL End Polishing Enzyme 2 5 U uL 8 uL Nuclease free Water 18 5 uL Total 100 uL Incubate the mixture at room temperature 20 to 25 C for 30 minutes Add 4 volumes of Binding Buffer B2 S with isopropanol 55 to 1
62. volume of sample Mix well Apply about 700 uL of the sample in the binding buffer to the PureLink column s in collection tube s Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA 1s bound to the column Repeat steps 2 and 3 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s Add 650 uL of Wash Buffer W1 with ethanol to wash the column s Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at maximum speed to remove residual wash buffer Transfer the column s to clean 1 5 mL LoBind tube s Add 50 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature Centrifuge the column s at maximum speed for 1 minute Add the eluate from step 9 back to the column s then let the column s stand for 1 minute at room temperature Centrifuge the column s at maximum speed for 1 minute SOLID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Methylate the genomic DNA EcoP151 sites 12 Ifnecessary pool the eluted DNA 13 Quantitate the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer see Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer on page 189 14 Optional For structural variat
63. without rotor e Eppendorf 022621807 120 V 60 Hz e Eppendorf 022621840 230 V 50 Hz FA 45 24 11 fixed angle rotor 24 x 1 5 2 mL including Eppendorf aluminum lid aerosol tight 022636006 Pipettors Major Laboratory Supplier MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Or equivalent but validation of the equipment for library preparation is required Table 100 Required consumables Item Source TE pH 8 0 Applied Biosystems PN AM9858 7 5 M Ammonium acetate Sigma Aldrich A 2706 100X BSA New England Inc B9001S 0 45 um Nanosep spin columns VWR ODM45C34 0 5 mL LoBind Tubes Eppendorf 022431005 1 5 mL LoBind Tubes Eppendorf 022431021 21 gauge needle Major Laboratory Supplier MLS Razor blades MLS Filtered pipettor tips MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance 196 SOLID 4 System Library Preparation Guide Appendix C Supplemental Procedures PAGE gel DNA elution Procedure 1 Excise the appropriate sized band using a clean razor blade 2 Using a 21 gauge needle make a hole in the bottom of a 0 5 mL LoBind tube 3 Place the gel piece s in the 0 5 mL LoBind tube 4 Place the 0 5 mL LoBind tube with the gel in a 1 5 mL LoBind tube and centrifuge at 210 000 x g 13 000
64. 0 c cece eens 39 Quantitate the library by performing quantitative PCR qPCR 40 SOLID 4 System Library Preparation Guide 13 Z Chapter 2 Fragment Library Preparation Overview Overview This chapter describes the method to generate a small insert library 150 to 180 bp before adaptor ligation This method involves shearing DNA into small fragments and ligating P1 and P2 Adaptors see Figure 2 and Figure 3 o gt Genomic DNA Sheared DNA P1 P2 Ligated Library Molecule Figure 2 Basic fragment library preparation workflow overview Jalal diel sl alelal all ol abl aL Oia all ott otal SPM oT Ll lhl tl llth SL lbh LD oath od MTS Lo L8 Lo 3 d Ld d Ld Ld d sd Ld d Pad 93 39 3 d od d d d 3 3 103 313 9 d a 3 3 Dod 3 3 J 41M ad dikdi iadi od LMR Ted hod thet d od iat af a th dd es add MA EJIUEImUPmEEBITEBpuIIEmSISIBSEBEIEE ITE Figure 3 Fragment library design 14 SOLID 4 System Library Preparation Guide Chapter 2 Fragment Library Preparation 2 Overview After P1 and P2 Adaptors are ligated to the sheared DNA the library is amplified using primers specific to the P1 and P2 Adaptors see Figure 4 Library PCR Primer 1 is a 3 truncated version of the 5 strand sequence of P1 while Library PCR Primer 2 is a 3 truncated version of the 5 strand sequence of P2 These primers can be used only for library amplification and not for alternative or modified library constr
65. 0 V 50 Hz FA 45 24 11 fixed angle rotor 24 x 1 5 2 mL including Eppendorf aluminum lid aerosol tight 022636006 Incubator 37 C Major Laboratory Supplier MLS MLS Pipettors t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Or equivalent but validation of the equipment for library preparation is required Table 105 Required consumables Item Source 1 E Gel EX Gel Invitrogen G401001 1 Kb Plus DNA Ladder Invitrogen 10787 018 Gel Loading Solution All Purpose Native Agarose Applied Biosystems PN AM8556 SOLID 4 System Library Preparation Guide Appendix C Supplemental Procedures Confirm complete methylation of DNA fragments Table 105 Required consumables Item Source EcoP15l 10 U uL New England Biolabs RO646L 100X BSA New England Biolabs B9001S Sinefungin Sigma Aldrich 8559 1 5 mL LoBind Tubes Eppendorf 022431021 Filtered pipettor tips Major Laboratory Supplier MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance 2 xe o o Q x ie ie xe je D 3 D E m 2v fe 9 o E I n SOLID 4 System Library Preparation Guide 201 Digest the DNA with EcoP15l 202 Appendix C Supplemental Procedures Confirm complete methylation of DNA fragment
66. 0 uL in 1X Low TE Buffer in a LoBind tube see Table 7 Table7 Dilute the DNA for shearing Component Amount DNA 10 ng to 5 ug 1X Low TE Buffer Variable Total 100 uL 2 Place a Covaris microTUBE into the loading station Keep the cap on the tube and use a tapered pipette tip to slowly transfer the 100 uL of DNA sample through the pre split septa Be careful not to introduce a bubble into the bottom ofthe tube 3 Shear the DNA using the following Covaris S2 System conditions Number of Cycles 6 Bath Temperature 5 C Bath Temperature Limit 30 C Mode Frequency sweeping Water Quality Testing Function Off Duty cycle 10 Intensity 5 Cycles burst 100 Time 60 seconds IMPORTANT Make sure that the water in the Covaris S2 tank is filled with fresh deionized water to fill line level 12 on the graduated fill line label The water should cover the visible glass part of the tube Set the chiller temperature to between 2 to 5 C to ensure that the temperature reading in the water bath displays 5 C The circulated water chiller should be supplemented with 20 ethylene glycol To load and unload the Covaris micro TUBE correctly from the microTUBE holder see Load and unload Covaris microTUBE vials from the Covaris microTUBE holder on page 186 4 Place the Covaris microTUBE into the loading station While keeping the snap cap on insert a pipette tip through the pre split septa then slowly remove the shea
67. 00 x g for 1 minute Add the eluate from step 10 back to the column s then let the column s stand for 1 minute at room temperature Centrifuge the column s at 14 000 x g for 1 minute If necessary pool the eluted DNA into one 1 5 mL LoBind tube STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Digest the DNA with T7 exonuclease and S1 nuclease on page 71 70 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library Digest the DNA with T7 exonuclease and S1 nuclease Digest the DNA with T7 exonuclease and S1 nuclease Digest the DNA 1 Combine see Table 20 Q 5 Ke oF with T7 wo v exonuclease Table 20 T7 exonuclease reaction mix from X ng circularized DNA E z Component Amount 2 p E vU DNA From X ng circularized DNA 2 SH 10x Buffer 4 X 20 uL E T7 exonuclease 10 U uL X 80 uL g Nuclease free Water Variable Total X 2 uL Example For 200 ng of circularized DNA Component Amount DNA From 200 ng circularized DNA 10X Buffer 4 10 uL T7 exonuclease 10 U uL 2 5 uL Nuclease free Water Variable Total 100 uL 2 Incubate the reaction mixture at 37 C for 30 minutes 3 Heat inactivate the T7 exonuclease at 70 C for 20 minutes 4 Chill the reaction on ice for 5 minutes SOLID 4 System Library Preparation Guide 71 3 Chapter 3 Mate Paired Library Prepar
68. 0600 ee eee 113 Bind the library molecules to streptavidin beads lees 114 Ligate P1 and P2 Adaptors to the DNA 00 eee ee 116 Nick translate the library lllleeeeeeee RII 117 Trial amplify the library aaa a a a A A a II 118 Amplity the libram iu oua E ee ie E AE E ee OEA E RAR dad oh 120 Gel purify the library with a Size Selection gel 0 cee ee 122 Quantitate the library by performing quantitative PCR qPCR 0 126 SOLID 4 System Library Preparation Guide Chapter 4 Appendix A Appendix B Appendix C Contents Barcoded Fragment Library Preparation OVENVIEW ces tmo e a Pala eS Rede Me ee ee ee wa Peed un e eet Prepare a barcoded fragment library 0 cee eee Materials and equipment required 0000 cee WOFKTIOW s cte cee wet e EM Red sheeted Latest EVE WORT PII Hlc Shear the DNA nre um mmn US eme bua RIS DX e Em AREE EUER End repair the DNA i taai oda iae pondra dn a eal e aae hn Ligate Multiplex P1 and Multiplex P2 Adaptors to the DNA 220005 Nick translate then amplify the library lille izzrhyish Quantitate the library by performing quantitative PCR qPCR Pool the barcoded libraries liliis Gel purify the libraries i isse m ERR ur RR EOE OSE ea RETI E REFERS Required Materials so wri wom 19 or e m ee ada rd SR pss Prepare a standard fragme
69. 1 1 Chapter 1 Introduction Choose the appropriate library type Choose the appropriate library type Table 1 Libraries that can be sequenced on the SOLiD 4 System Library type Features Go to Fragment Adaptors on each end of sheared DNA insert see Figure 1 on page 11 Less input DNA required 10 ng to 5 ug Appropriate for sequence lengths x300 bp Simpler library construction workflow Higher recovery of unique molecules Chapter 2 Fragment Library Preparation on page 13 Mate paired Two DNA insert tags 600 bp to 6 kb apart see Figure 1 on page 11 More input DNA required 5 ug to 20 ug More even coverage of genome Better ability for unique tag placement Chapter 3 Mate Paired Library Preparation on page 41 Barcoded fragment Same as fragment library except with a barcode sequence located on one of the adaptors to enable multiplexed sequencing see Figure 1 on page 11 500 ng to 5 ug input DNA required Can be pooled for templated bead preparation Chapter 4 Barcoded Fragment Library Preparation on page 127 The type of library used depends on the application and information needed For deeper coverage of large and complex genomes for example human genomes more DNA is required to prepare libraries For smaller and less complex genomes for example microbial genomes less DNA can be used and shorter read lengths are adequate For information abou
70. 10 uL of mate paired library 4 Load the 1 Kb Plus DNA Ladder Invitrogen 10787 018 to one well Load dye mixed sample per well according to the well capacity into remaining wells Use the minimum number of wells possible There should be at least one lane between the ladder well and the sample wells to avoid contamination of the sample with ladder 5 Run the gel at the appropriate voltage to achieve optimal separation of the size of interest D IMPORTANT To obtain maximum resolution of DNA fragments agarose gels should be run at 5 V cm The distance is measured as the shortest path between the electrodes not the agarose gel length itself 6 Visualize the gel on a Safe Imager Blue Light Transilluminator with a ruler lying on top of the transilluminator D IMPORTANT Exposing DNA to UV light may damage the DNA Using SYBR Safe gel stain and the Safe Imager Blue Light Transilluminator eliminates the risk of UV damage to DNA during size selection 7 Using the ladder bands and the ruler for reference excise the band of the gel corresponding to the insert size range of interest with a clean razor blade see Figure 11 on page 62 If desired take a tighter cut for a tighter size selection If the gel piece is large slice it into smaller pieces SOLiID 4 System Library Preparation Guide 61 3 Chapter 3 Mate Paired Library Preparation Size select the DNA Excision of 1 1 6 kb band 1 6 kb Figure 11 Excision
71. 117 3 Chapter 3 Mate Paired Library Preparation Trial amplify the library Trial amplify the library Perform 1 Prepare a PCR master mix for amplification reactions see Table 47 trial PCR on the library Table 47 PCR master mix for amplification of the library Component Volume pL Platinum PCR Amplification Mix 70 Library PCR Primer 1 50 uM 1 4 Library PCR Primer 2 50 uM 1 4 Total 72 8 t Platinum PCR Amplification Mix contains a proofreading enzyme for high fidelity amplification 2 Vortex the master mix For the negative control transfer 23 uL of the PCR master mix to a PCR tube Label the tube PCR 0 3 Add4 uL of DNA bead complex solution to the remaining 49 8 uL of PCR master mix Vortex the mix then divide evenly 25uL between two PCR tubes labelled PCR 1 and PCR 2 4 Run see Table 48 Table 48 PCR conditions to amplify the library Stage Step Temp Time Holding Denature 94 C 3 min Cycling Denature 94 C 15 sec Anneal 62 C 15 sec Extend 70 C 1 min Holding Extend 70 C 5 min Holding 4 C co t Tube 1 10 cycles Tubes 0 and 2 14 cycles For starting DNA gt 20 ug you can use 8 and 12 cycles for the trial amplification Confirm library 1 Mix 0 5 uL of 1 ug uL 25 bp DNA Ladder Invitrogen 10597 011 with 40 uL of amplification with a Nuclease free Water 2 E Gel EX Gel 2 Load 20 uL of PCR 0 PCR 1 and PC
72. 2 Adaptors with different barcode sequences Ninety six barcode sequences are available to tag different libraries see Figure 21 on page 129 SOLID 4 System Library Preparation Guide Chapter 4 Barcoded Fragment Library Preparation 4 Overview Multiplex P1 Adaptor ds 23 25 bp Multiplex P2 Adaptor Multiplex P1 Adaptor Sheared DNA I Multiplex P1 Adaptor Sheared DNA eaaa Barcode P2 Adaptor 9 SECUDUDSOG6D GUDDBOSEE SEISSUDUODIUOODUGUSUIEIBUIBUL LU JUUOUU UU UUUUBUDBUUDBUDBBUUUGDIISEUDEODLD E D Eo o 2 o e ES Multiplex P2 Adaptor ds 19 52 bp Aeq yuswbes4 pepooueg p 19 deyo Figure 21 Barcoded fragment library design After Multiplex P1 and Multiplex P2 Adaptors are ligated to the sheared DNA the library is amplified using primers specific to the Multiplex P1 and Multiplex P2 Adaptors see Figure 22 on page 130 Multiplex Library PCR Primer 1 is a 3 extended version of the 5 strand sequence of Multiplex P1 that adds back the truncated part of the standard P1 sequence while Library PCR Primer 2 is a 3 truncated version of the 5 strand sequence of standard P2 Amplification with Multiplex Library PCR Primer 1 adds back the P1 sequence that was truncated in the Multiplex P1 Adaptor These primers can be used only for library amplification and not for alternative or modified library construction adaptor design because they do not have 3 sequences compatible
73. 4 System Library Preparation Guide Appendix Safety Chemical safety Ensure that the instrument waste is stored transferred transported and disposed of according to all local state provincial and or national regulations IMPORTANT Radioactive or biohazardous materials may require special handling and disposal limitations may apply SOLID 4 System Library Preparation Guide 251 Appendix Safety Chemical safety Biological hazard safety General biohazard WARNING BIOHAZARD Biological samples such as tissues body fluids infectious agents and blood of humans and other animals have the potential to transmit infectious diseases Follow all applicable local state provincial and or national regulations Wear appropriate protective equipment which includes but is not limited to protective eyewear face shield clothing lab coat and gloves All work should be conducted in properly equipped facilities using the appropriate safety equipment for example physical containment devices Individuals should be trained according to applicable regulatory and company institution requirements before working with potentially infectious materials Read and follow the applicable guidelines and or regulatory requirements in the following US Department of Health and Human Services guidelines published in Biosafety in Microbiological and Biomedical Laboratories stock no 017 040 00547 4 http www cdc gov OD ohs biosfty bmbl4 bmbl4
74. 5 in a 1 5 mL LoBind tube SOLID 4 System Library Preparation Guide 69 3 Chapter 3 Mate Paired Library Preparation Nick translate the circularized DNA 10 11 Purify the DNA with 1 the SOLiD Library Micro Column Purification Kit 2 10 11 12 13 At the end of the incubation immediately transfer the nick translation reaction to the 1 5 mL LoBind tube containing the binding buffer Binding buffer denatures the enzyme and stops the reaction Proceed to Purify the DNA with the SOLiD Library Micro Column Purification Kit Pre spin empty PureLink Micro columns in collection tubes at 10 000 x g for 1 minute before use Mix well the nick translated DNA in Binding Buffer B2 S with isopropanol 55 Apply all of the mix to the PureLink Micro column s in collection tube s Let the column s stand for 1 minute at room temperature Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column Add 650 uL of Wash Buffer W1 with ethanol to wash the column s Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at 14 000 x g to remove residual wash buffer Transfer the column s to clean 1 5 mL LoBind tube s Add 25 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature Centrifuge the column s at 14 0
75. A ladder into the small middle well of the top row marked M see Figure 14 6 Load 25 uL of Nuclease free Water into remaining empty wells in the top row 7 Load 25 uL of Nuclease free Water into wells 1 to 8 in the middle of the gel and 10 uL of Nuclease free Water in the middle marker well of the bottom row see Figure 14 Nuclease Nuclease Nuclease Nuclease free free free free Water DNA Water Ladder water DNA Water 25 pL 10 uL 25 uL Nuclease Nuclease Nuclease free free free We Water Water mimimumimimi Figure 14 Where to load DNA ladder and Nuclease free Water on a SOLiD Library Size Selection gel to size select the DNA Run the SOLiD 1 Place the E Gel iBase Power System over a Safe Imager Real Time Sel ida per Transilluminator Use the orange cover or orange goggles to view the bands and to election gel an collect the library avold overexposure of your eyes to the blue light fragment 2 Run the gel On the iBase system a Select SizeSelect 2 refer to the iBase Power System manual for instructions b Press Go The red light turns green SOLID 4 System Library Preparation Guide 83 U 6 o o EX E e E Aeq peureq eie N seideyo 3 Chapter 3 Mate Paired Library Preparation Gel purify the library with a Size Selection gel 3 Monitor the gel At the end ofa run the iBase system flashes a red light and beeps rapidly Ifthe front line of libra
76. AAGGCG 3 19 52 Barcode 008 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGAGCGAGGATCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 009 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTAGGTTGCGACCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 010 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGCGGTAAGCTCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 011 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGTGCGACACGCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 012 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTAAGAGGAAAACTGCTGTACGGCCAAGGCG 3 19 52 Barcode 013 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGCGGTAAGGCCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 014 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGTGCGGCAGACTGCTGTACGGCCAAGGCG 3 19 52 SOLiD 4 System Library Preparation Guide 207 gt o D 2 2 x U Q Li e 2 em e D fe ct o D n D 4e D 2 o D n Appendix D Oligonucleotide Sequences Library construction oligonucleotides Multiplex adaptor and barcode sequence Sequence bp Barcode 015 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGAGTTGAATGCTGCTGTACGGCCAAGGCG 3 52 Barcode 016 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTG
77. Amplify the library The library is amplified using Library PCR Primers 1 and 2 with the Platinum PCR Amplification Mix which includes a proofreading enzyme for high fidelity amplification Reduce the number of cycles as much as possible and use the entire nick translated product for amplification to get maximum representation of the library and to avoid PCR related biases due to differential amplification of library molecules Gel purify the library with a Size Selection gel The library is run on an SOLiD Library Size Selection gel The library band 250 to 350 bp can be extracted and desalted using the SOLiD Library Micro Column Purification Kit Quantitate the library by performing quantitative qPCR The library is quantitated by using the SOLiD Library TaqMan Quantitation Kit PN 4449639 described in Appendix B SOLiD 4 System Library Quantitation with the SOLiD Library TaqMan Quantitation Kit on page 173 Adjust microcentrifuge speeds and times according to the g forces specified in the protocols Applied Biosystems recommends the Eppendorf 5417R tabletop microcentrifuge Perform all steps requiring 0 5 mL 1 5 mL and 2 mL tubes with Eppendorf LoBind Tubes Thaw reagents on ice before use SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Shear the DNA Shear the DNA Prepare for IMPORTANT For accuracy determine sample DNA concentration usin
78. Buffer Vortex the beads for 15 seconds then pulse spin SOLID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Nick translate the library 8 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 9 Repeat steps 7 and 8 once Nick translate the library uonejedojg 1 Combine see Table 46 Table 46 Combine for nick translation le F RV pel et D a Co z m U Er E I Sb o ei o s lt Component Volume uL Nuclease free Water 83 Nick Translation Buffer 10 dNTP 10 mM 5 DNA Polymerase I 10 U uL 2 Total 100 2 Add the mix for nick translation to the washed beads 3 Incubate the mixture at room temperature 20 to 25 C for 15 minutes 4 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 5 Resuspend the beads in 500 uL of Elution Buffer E1 from the SOLiD Library Column Purification Kit Vortex then pulse spin the beads 6 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 7 Resuspend the beads in 30 uL of Elution Buffer E1 STOPPING POINT Store the DNA Bead complexes in Elution Buffer E1 at 4 C or proceed directly to Trial amplify the library on page 118 SOLiID 4 System Library Preparation Guide
79. CR Primer 1 Size Selection Library PCR Primer 2 Plasmid Safe DNase aw Treatment SOLID Library Oligos Kit 2 Quantitative PCR EcoP151 CAP Adaptor Internal Adaptor Sample Quantitation Lot number Ste Quantity of DNA Lot number SOLiD Library Oligos Kit 1 P1 Adaptor End Repair P2 Adaptor Methylation of Genomic EcoP 15l Library PCR Primer 1 Size Selection Plasmid Safe DNase Treatment Quantitative PCR Library PCR Primer 2 SOLiD Library Oligos Kit 2 EcoP151 CAP Adaptor Internal Adaptor SOLID 4 System Library Preparation Guide Appendix F Checklists and workflow tracking forms Workflow checklists prepare a barcoded fragment library Workflow checklists prepare a barcoded fragment library _ ______ Equipment Reagents Preparation steps Shear the Covaris S2 System Covaris microTube adaptor Covaris microTube loading station 1 5 mL LoBind tubes Pipettors Filtered pipettor tips 1x Low TE Buffer Ethylene glycol Covaris microTube Ethylene glycol Degas the water in the Covaris S2 System 30 minutes prior to use Supplement the circulated water chiller with 20 ethylene glycol End repair the Microcentrifuge NanoDrop ND 1000 Spectrophotometer Vortexer Picofuge 1 5 mL LoBind tubes OOoOogoogo 5x End Polishing Buffer dNTP Mix End Polishing Enzyme 1 End Polishing Enzyme 2 Nuclease free Water SOLiD Library Column
80. Describes the software and provides procedures SOLID 4 System ICS for common tasks see the Instrument Control Software Help Software BioScope Software for 4448431 Provides a bioinformatics analysis framework for Scientists Guide flexible application analysis data generated mapping SNPs count reads from sequencing runs Working with 4452359 Provides an online suite of software tools for Next SOLiDBioScope com Generation Sequencing NGS analysis Quick Reference Card SOLiDBioScope com leverages the scalable resources of cloud computing to perform compute intensive NGS data processing Applied Biosystems 4448432 Describes the relationship between the softwares SOLiD 4 System comprising the SOLID 4 platform and provides Software Integrated quick step procedures on operating each Workflow Quick software to perform data analysis Reference Guide SOLiID 4 System Library Preparation Guide 255 Documentation Send us your comments Part Document number Description Applied Biosystems 4452360 Provides a quick guide to the sequencing kits you SOLID 4 System need to perform fragment paired end mate pair Product Selection Guide multiplex fragment and multiplex paired end sequencing Applied Biosystems 4451929 Provides a brief summary of changes made SOLiD System between the SOLiD 3 Plus System SOLiD 3 Plus to documentation and the SOLiD 4 System SOLiD 4 System User documentat
81. Distance from an Initial Probe A Circularization method PNAS 81 1984 6812 6816 is 63 4 DNA size in kb Ing pl J IH Targeted circularization efficiency Final concentration of DNA for circularization Example For an insert size of 1 to 2 kb 63 4 SO 518 1 5 51 8 Ing yuL 095 51 8 2 74 ng uL The final concentration of DNA required for circularization can be calculated using the formula above The circularization reaction volume per ug of DNA can then be calculated see Table 107 Table 107 Circularization reaction volumes Final concentration of Circularization Insert Size DNA for Calculation reaction volume per circularization 1 ug DNA 600 to 800 bp 4 3 ng uL 1000 ng 4 3 ng uL 235 uL 800 to 1000 bp 3 75 ng uL 1000 ng 3 75 ng uL 270 uL g 1 to 2 kb 2 74 ng uL 1000 ng 2 74 ng uL 365 uL a 2 to 3 kb 2 1 ng uL 1000 ng 2 1 ng uL 500 uL a 3 to 4 kb 1 8 ng uL 1000 ng 1 8 ng uL 560 uL o 4 to 5 kb 1 6 ng uL 1000 ng 1 6 ng uL 625 uL a 5 5 to 6 kb 1 4 ng uL 1000 ng 1 4 ng uL 720 uL S a e D QO c 2 E 7 SOLID 4 System Library Preparation Guide 217 218 Ligation of P1 and P2 Adaptors Appendix E Formulas and calculations 2 x 50 bp mate paired library The amount of Internal Adaptor ds needed for circularization can be calculated as follows _ 108 pg 1pmo et X pmol ug DNA 1 gg DNA 1ibg 660pg Average ins
82. Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature 9 Centrifuge the column s at maximum speed for 1 minute 10 Add the eluate from step 9 back to the column s then let the column s stand for 1 minute at room temperature 11 Centrifuge the column s at maximum speed for 1 minute 12 If necessary pool the eluted DNA STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Size select the DNA on page 61 60 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Size select the DNA Size select the DNA Size select the DNA 1 Determine the appropriate percentage of agarose gel needed to size select DNA with an agarose gel see Table 16 y Table 16 Percent agarose gel needed to size select DNA E Desired insert size Agarose gel needed 2 600 to 3000 bp 1 0 i Qo F RV pel et D Co 2 U E E I Q o A e lt 3 to 6 kb 0 8 2 Prepare the appropriate percentage agarose gel in 1X TAE buffer with 10 uL of 1 10 000 SYBR Safe gel stain Invitrogen S33102 per 100 mL gel volume To prepare the gels use either Agarose LE Applied Biosystems AM9040 or UltraPure Agarose 1000 Invitrogen 10975 035 3 Add 10X BlueJuice Gel Loading Buffer to the purified ligated DNA 1 uL of 10X Gel Loading Buffer for every
83. For fast and efficient blunt ended ligation End Polishing Enzyme 1 and End Polishing Enzyme 2 are used to convert DNA with damaged or incompatible 5 protruding and or 3 protruding ends to 5 phosphorylated blunt ended DNA The conversion to blunt end DNA is accomplished by exploiting the 5 to 3 polymerase and the 3 to 5 exonuclease activities of End Polishing Enzyme 2 End Polishing Enzyme 1 and ATP are also included for phosphorylation of the 5 ends of the blunt ended DNA for subsequent ligation Methylate the genomic DNA EcoP15l sites Methylation of the EcoP15I sites in the genomic DNA prevents digestion at the EcoP 15 sites EcoP15I is a type III restriction enzyme that recognizes the nucleotide sequence CAGCAG For effective cleavage of a DNA molecule EcoP15I needs two unmethylated inversely oriented EcoP151 recognition sites and cleaves the DNA 25 27 bp away from its binding site The restriction activity requires ATP and in its absence EcoP15I methylates only the fifth base adenine in its binding site CAGCAG This methylation is further boosted in the presence of exogenous S adenosylmethionine a methyl group donor After methylation of genomic DNA EcoP15I sites completion of methylation can be confirmed with a test digestion in the presence of ATP and its analysis on an agarose gel Ligate EcoP15l CAP Adaptors to the methylated DNA EcoP15I CAP ligation adds the EcoP15I CAP Adaptors to the sheared methyla
84. GCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTAAGTAATGTCCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 060 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGTGCCTCGGTCT GCTGTACGGCCAAGGCG 3 19 52 Barcode 061 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTAAGATTATCGCT GCTGTACGGCCAAGGCG 3 19 52 Barcode 062 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTAGGTGAGGGTCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 063 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGCGGGTTCGACTGCTGTACGGCCAAGGCG 3 19 52 Barcode 064 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGTGCTACACCCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 065 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGGGATCAAGCCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 066 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGATGTAATGTCTGCTGTACGGCCAAGGCG 3 19 52 SOLID 4 System Library Preparation Guide 211 gt o D 2 2 x U Q Li e 2 em e D fe ct o D n D 4e D 2 o D n Appendix D Oligonucleotide Sequences Library construction oligonucleotides Multiplex adaptor and barcode sequence Sequence bp Barcode 067 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGTCCTTAGGGCT GCTGTACGGCCAAGGCG 3 52 Barco
85. GGAGACGTTCTGCTGTACGGCCAAGGCG 3 52 Barcode 017 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGGCTCACCGCCTGCTGTACGGCCAAGGCG 3 52 Barcode 018 50 uM 5 CGCCTTGGCCGTACAGCAG3 19 5 CTGCCCCGGGTTCCTCATTCTCTAGGCGGATGACTGCTGTACGGCCAAGGCG 3 52 Barcode 019 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTATGGTAACTGCTGCTGTACGGCCAAGGCG 3 52 Barcode 020 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGTCAAGCTTTCTGCTGTACGGCCAAGGCG 3 52 Barcode 021 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGTGCGGTTCCCTGCTGTACGGCCAAGGCG 3 52 Barcode 022 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGAGAAGATGACTGCTGTACGGCCAAGGCG 3 52 Barcode 023 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGCGGTGCTTGCTGCT GTACGGCCAAGGCG 3 52 Barcode 024 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGGGTCGGTATCT GCT GTACGGCCAAGGCG 3 52 Barcode 025 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTAACATGATGACTGCTGTACGGCCAAGGCG 3 52 Barcode 026 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTCGGGAGCCCGCTGCTGTACGGCCAAGGCG 3 52 Barcode 027 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTCAGCAAACTTCTGCTGTACGGCCAAGGCG 3 52 208 SOLID 4 System Library Preparation Guide Appendix D Oligonucleotide Sequences Library
86. GGCCAAGGCOG 3 52 Barcode 039 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTTATCGTGAGTCTGCTGTACGGCCAAGGCG 3 52 Barcode 040 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTAAAAGGGTTACTGCTGTACGGCCAAGGCG 3 52 SOLiD 4 System Library Preparation Guide 209 Appendix D Oligonucleotide Sequences Library construction oligonucleotides Multiplex adaptor and barcode sequence Sequence bp Barcode 041 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTTGTGGGATTGCTGCTGTACGGCCAAGGCG 3 52 Barcode 042 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGAATGTACTACTGCTGTACGGCCAAGGCG 3 52 Barcode 043 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTCGCTAGGGTTCTGCTGTACGGCCAAGGCG 3 52 Barcode 044 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTAAGGATGATCCTGCTGTACGGCCAAGGCG 3 52 Barcode 045 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGTACTTGGCTCTGCTGTACGGCCAAGGCG 3 52 Barcode 046 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGGTCGTCGAACTGCT GTACGGCCAAGGCG 3 52 Barcode 047 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGAGGGATGGCCTGCTGTACGGCCAAGGCG 3 52 Barcode 048 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGCCGTAAGTGCTGCTGTACGGCCAAGGCG 3 52 Barcode 049
87. Imager 2 0 Blue Light Transilluminator Invitrogen G6600 or Safe Imager Blue Light Transilluminator Invitrogen 37102 Gel imaging system Major Laboratory Supplier MLS Tabletop Centrifuge MLS Gel boxes and power supplies for agarose MLS gels Vortexer MLS Picofuge MLS Incubator 37 C MLS Incubator 65 C MLS Scale MLS Pipettors 2 uL MLS Pipettors 20 uL MLS Pipettors 200 uL MLS Pipettors 1000 uL MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance For more information on HydroShear DNA Shearing Device and materials refer to the manufacturer s documentation Or equivalent but validation of the equipment for library preparation is required gt 9 o o 5 Q x gt ZU D Je s z a m D D 2 Table 75 Optional equipment Product name Vendor 2100 Bioanalyzer Agilent Technologies G2938C Qubit Fluorometer Invitrogen Q32857 t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance SOLID 4 System Library Preparation Guide 165 UN Appendix A Required Materials Prepare a 2 x 25 bp mate paired library 166 Table 76 Required consumables Item Source E Gel9 SizeSelect 2 Agarose optional Invitrogen G6610 02 E Gel EX Gel 2 10 Pak Invitrogen
88. L 70 ethanol to remove salts Ensure all the isopropanol is completely removed If the pellet is dispersed during the wash then centrifuge at 21 000 x g minimum 14 000 x g for 2 minutes 8 Completely remove the 70 ethanol by a short centrifugation step and a pipette tip 9 Air dry the sample for 2 to 5 minutes gt ke ko to 2 Q x 9 ie ie o je 3 D 2j a E D Q la om E I n SOLiD 4 System Library Preparation Guide 199 Appendix C Supplemental Procedures Confirm complete methylation of DNA fragments Confirm complete methylation of DNA fragments Materials and equipment required 200 To confirm complete methylation of DNA fragments the following is compared on a quality control gel 1 unmethylated unsheared genomic DNA 2 unmethylated unsheared EcoP 15I digested genomic DNA 3 methylated sheared genomic DNA and 4 methylated sheared EcoP15I digested DNA Table 103 Required kit Item Source Applied Biosystems 4443744 50 reactions SOLiD Library Column Purification Kit t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Table 104 Required equipment Item Source E Gel iBase and E Gel Safe Imager Combo Kit Invitrogen G6465 Microcentrifuge 5417R refrigerated without rotor Eppendorf 022621807 120 V 60 Hz e Eppendorf 022621840 23
89. Microcentrifuge Vortexer Picofuge 1 5 mL LoBind tubes Pipettors Filtered pipettor tips dNTP Mix 10 mM each DNA Polymerase 10 U pL Nick Translation B uffer Nuclease free Water SOLID Library Micro Column Purification Kit Isopropyl alcohol T7 exonuclease 10 U uL 10x Buffer 4 S1 Nuclease Dilution Buffer S1 Nuclease 25 U uL 3M Sodium chloride Nuclease free Water SOLIiD Library Micro Column Purification Kit Isopropyl alcohol Thaw dNTP Mix and Nick Translation Buffer on ice Thaw Buffer 4 and S1 Nuclease Dilution Buffer on ice OOOO 0000000 0000 20000000 000 m lce va O Vortexer 0 5 M EDTA Thaw end repair reagents 2 L Picofuge 5x End Polishing Buffer on ice 5 a O 1 5 mL LoBind tubes dNTP 10 mM Q 3 O Pipettors End Polishing Enzyme 1 5 o O Filtered pipettor tips End Polishing Enzyme 2 5 2 Bead Binding Buffer Nuclease free Water O Vortexer 100x BSA Thaw 100x BSA and 5x gt O Picofuge Dynabeads MyOne Ligase Buffer on ice S 9 O 6Tube Magnetic Rack Streptavidin C1 beads a O Rotator Bead Wash Buffer P O 1 5 mL LoBind tubes Bead Binding Buffer 29 O Pipettors 5x Ligase Buffer E 3 O Filtered pipettor tips Nuclease free Water o mo E SOLID 4 System Library Preparation Guide Appendix F Checklists and workflow tracking forms Workflow checklists prepare a 2 x 50 bp mate paired library Equipment Reagents Preparationsteps 5 L Vortexer T4 DNALiga
90. NA 02 02 ects 66 Nick translate the circularized DNA 2 0 0 0 0 cee ees 68 Digest the DNA with T7 exonuclease and S1 nuclease 4 71 End repair the digested DNA 0 ttt 73 Bind the library molecules to streptavidin beads 2 200 74 Ligate P1 and P2 Adaptors to the DNA slsleseeleese sese 76 Nick translate the library 0 0 77 Trial amplify the library 0 0 0 cc tenes 78 Amplify the library cesses eR er exar ea a Dw 80 Gel purify the library with a Size Selection gel lllsselussuun 82 Quantitate the library by performing quantitative PCR qPCR 87 Section 3 2 Prepare a 2 x 25 bp mate paired library 88 Materials and equipment required 00 cece eee eens 88 idu C 89 TIDS ee bx ERG pen eR SEU edades p DS PR DEEP CERE aa eh area 94 Shear tbe DNA ocpRPHReCRH PER UEU DU ene bU IUD mee E 94 End repair the sheared DNA llis 98 Methylate the genomic DNA EcoP15I sites 00 00 eee eee 99 Ligate EcoP151 CAP Adaptors to the methylated DNA 102 Size select the DNA 0 ete e 104 Circularize the DNA 2 1 eee nee eee nes 107 SOLiID 4 System Library Preparation Guide 41 Chapter 3 Mate Paired Library Preparation 42 Isolate the circularized DNA 0 00 cette nes 110 Digest the circularized DNA with EcoP15I 0 0 0 0 cece 112 End repair with Klenow 0 cece
91. NA 12 Centrifuge the column s at 14 000 x g for 1 minute 13 If necessary pool the eluted DNA D IMPORTANT Proceed directly without stopping to Isolate the circularized DNA on page 110 uoneJedeJd 9 D iei 3 gj oo lt 2 n U g 2 g E log E S a lt SOLID 4 System Library Preparation Guide 109 3 Chapter 3 Mate Paired Library Preparation Isolate the circularized DNA Isolate the circularized DNA Treat the DNA with Plasmid Safe ATP Dependent DNase 110 1 Combine and mix the following components where X is the volume in uL of DNA and Y is the number of micrograms of DNA used in the circularization reaction see Table 39 Table 39 Mix for DNase treatment of DNA Component Volume pL ATP 25 mM 5 10X Plasmid Safe Buffer 10 Plasmid Safe DNase 10 U uL Y 3 DNA X Nuclease free Water Variable Total 100 t Use 1 uL of Plasmid Safe DNase 10 U uL if Y lt 3 ug If X gt 80 uL adjust the total reaction volume accordingly The volume of ATP and 10X Plasmid Safe Buffer should be proportional to the total reaction volume Example For 2 ug DNA used in the circularization reaction Mix for DNase treatment of DNA Component Volume pL ATP 25 mM 5 10X Plasmid Safe Buffer 10 Plasmid Safe DNase 10 U uL 1 DNA 25 Nuclease free Water 59 Total 100 2 Incubate the reaction mixture at 37 C for 40 mi
92. Quality Testing Function Off Duty cycle 2 e Intensity 5 e Cycles burst 200 Time 10 seconds 1 to 2 kb HydroShear Standard Shearing e SC5t Assembly e 20 cycles 2 to 3 kb HydroShear Standard Shearing e SC9 Assembly e 20 cycles 3 to 4 kb HydroShear Standard Shearing e SC13 Assembly 20cycles 4 to 5 kb HydroShear Standard Shearing e SC15 Assembly 5cycles 5 to 6 kb HydroShear Standard Shearing e SC16 Assembly e 25 cycles t Speed code SO 5 D IMPORTANT If you are using the Covaris S2 System set the chiller temperature to between 2 to 5 C to ensure that the temperature reading in the water bath displays 5 C The circulated water chiller should be supplemented with 20 ethylene glycol 2 If the DNA source is not limiting ensure that the shearing conditions result in the desired insert sizes Shear 5 ug DNA and run 150 ng sheared DNA on a 1 E Gel EX Gel according to the manufacturer s specifications 54 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Shear the DNA Shear the DNA with 1 Inaround bottomed 13 mm x 65 mm borosilicate tube dilute 10 to 20 ug of the Covaris S2 DNA in 500 uL solution so that the final volume contains 20 glycerol in G System Nuclease free Water see Table 13 5 o hM Note To prepare a short insert 1 kb mate paired library from a small v E genome 25 ug of DNA is sufficient CES a p i Ta
93. R 2 into separate wells of a 2 E Gel EX Gel Load 20 uL of diluted 25 bp DNA Ladder in an adjacent well for reference You do not need to add loading buffer to the samples 3 Run the E Gel EX Gel on an E Gel iBase Power System according to the manufacturer s instructions for 10 minutes 118 SOLID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Trial amplify the library 4 Take a picture of the gel see Figure 17 The expected size of amplified library is 155 bp Choose a PCR cycle where amplified library products are just visible on the gel Based on the intensity of the products increase or reduce up to 2 cycles for final library amplification uoljesedald ie gt y D Ke vete 0 R 09 lt m pe i m ES 2 oO on um on g E lt Figure 17 2x25 bp mate paired library trial amplification sample run on a 2 E Gel EX gel M 25 bp DNA ladder Lane1 empty Lane 2 PCR 0 negative control Lane 3 PCR 1 10 cycles Lane 4 PCR 2 14 cycles Based on this picture 12 cycles should be used for final library amplification STOPPING POINT Store the DNA Bead complexes in Elution Buffer E1 at 4 C or proceed directly to Amplify the library on page 120 SOLiID 4 System Library Preparation Guide 119 3 Chapter 3 Mate Paired Library Preparation Amplify the library Amplify the library Perform 1 Prepare a master mix for amplification
94. SOLID 4 System Library Preparation Guide Appendix A Required Materials Prepare a 2 x 50 bp mate paired library Table 66 Required Applied Biosystems reagent kits Item part number Components Kit components used in SOLiD Long Mate Paired Library Enzyme Kit 2 Exo Nucleases e T7 Exonuclease Gap creation at a nicked 10 U uL site e 10X Buffer 4 e S1 Nuclease e 3M NaCl Digestion at gap sites to MV release mate paired e S1 Dilution Buffer fragments e 10X Plasmid Safe Buffer e Plasmid Safe DNase Uncircularized DNA removal e ATP 25 mM SOLiD Mate Paired Mate paired library capture Library Bead amp Buffer Kit e Dynabeads MyOne Streptavidin C1 Bead Wash Buffer Bead Binding Buffer SOLID Library Column DNA purification Purification Kit SOLiD Library Micro Column Purification Kit SOLiD Library Quick Gel DNA size selection Extraction Kit SOLiD Library Size Selection Gels t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Forthe SDS of any chemical not distributed by Applied Biosystems or Invitrogen contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions Invitrogen products can be ordered at www invitrogen com 9 o D 5 2 x gt ZU D Je s a m
95. UT LIMITATION ANY TRADE PRACTICE UNFAIR COMPETITION OR OTHER STATUTE OF SIMILAR IMPORT OR ON ANY OTHER BASIS FOR DIRECT INDIRECT PUNITIVE INCIDENTAL MULTIPLE CONSEQUENTIAL OR SPECIAL DAMAGES SUSTAINED BY THE BUYER OR ANY OTHER PERSON OR ENTITY WHETHER OR NOT FORESEEABLE AND WHETHER OR NOT APPLIED BIOSYSTEMS IS ADVISED OF THE POSSIBILITY OF SUCH DAMAGES INCLUDING WITHOUT LIMITATION DAMAGES ARISING FROM OR RELATED TO LOSS OF USE LOSS OF DATA FAILURE OR INTERRUPTION IN THE OPERATION OF ANY EQUIPMENT OR SOFTWARE DELAY IN REPAIR OR REPLACEMENT OR FOR LOSS OF REVENUE OR PROFITS LOSS OF GOOD WILL LOSS OF BUSINESS OR OTHER FINANCIAL LOSS OR PERSONAL INJURY OR PROPERTY DAMAGE NO AGENT EMPLOYEE OR REPRESENTATIVE OF APPLIED BIOSYSTEMS HAS ANY AUTHORITY TO MODIFY THE TERMS OF THIS LIMITED WARRANTY STATEMENT OR TO BIND APPLIED BIOSYSTEMS TO ANY AFFIRMATION REPRESENTATION OR WARRANTY CONCERNING THE PRODUCT THAT IS NOT CONTAINED IN THIS LIMITED WARRANTY STATEMENT AND ANY SUCH MODIFICATION AFFIRMATION SOLID 4 System Library Preparation Guide Appendix H Instrument Warranty Information Damages claims and returns REPRESENTATION OR WARRANTY MADE BY ANY AGENT EMPLOYEE OR REPRESENTATIVE OF APPLIED BIOSYSTEMS WILL NOT BE BINDING ON APPLIED BIOSYSTEMS UNLESS IN A WRITING SIGNED BY AN EXECUTIVE OFFICER OF APPLIED BIOSYSTEMS THIS WARRANTY IS LIMITED TO THE BUYER OF THE PRODUCT FROM APPLIED BIOSYSTEMS AND IS NOT TRANSFERABLE
96. X x 1 5 uL X x 0 9 uL X x 0 65 uL X x 0 5 uL X x 0 4 uL Adaptor ds 2 uM T4 DNA X x 6 uL X x 6 75 uL X x 9 uL X x 12 5 uL X x 14 uL X x 15 6 uL X x 18 uL Ligase 5 U uL Total X x 235 uL X x 270 uL X x 365 uL X x 500 uL X x 560 uL X x 625 uL X x 720 uL Example For 2 ug of DNA in 1 to 2 kb size range to be circularized Mix for DNA circularization by insert size Components Amount Nuclease free Variable Water DNA 2 ug 5X Ligase 146 uL Buffer Internal 3 uL Adaptor ds 2 uM T4 DNA 18 uL Ligase 5 U uL Total 730 uL 2 Incubate the reaction at room temperature 20 to 25 C for 30 minutes SOLID 4 System Library Preparation Guide 107 3 Chapter 3 Mate Paired Library Preparation Circularize the DNA Purify the DNA with the SOLiD Library Micro Column Purification Kit 108 D 10 11 IMPORTANT If gt 6 ug DNA was used in the circularization reaction use the SOLiD Library Column Purification Kit then follow the steps in Purify the DNA with the SOLiD Library Column Purification Kit on page 103 Make these changes to the procedure Use 1 column per 5 mL of sample in Binding Buffer B2 L with isopropanol 40 Load lt 800 uL sample in Binding Buffer each time onto the column s Spin the column s for 15 seconds at 10 000 x g except for the last loading After the last loading spin the column s for 1 minute e Use 40 uL
97. a Shear the DNA with Covaris S2 System or HydroShear _ Purify the DNA with the he SOLID Library Column Purification Kit Repair the DNA ends with the End Polishing Reaction Purify the DNA with the SOLID Library Column Purification Kit Ligate the LMP CAP Adaptors to the DNA Purify the DNA with the SOLID Library Column Purification Kit Size select the DNA with an agarose gel Elute the DNA with the SOLID Library Quick Gel Extraction Kit Circularize the DNA with the Internal Adaptor Purify the DNA with the SOLID Library Micro Column Purification Kit Treat the DNA with Plasmid Safe ATP Dependent DNase Purify the DNA with the SOLID Library Micro Column Purification Kit Nick translate the circularized DNA Digest the ONA with T7 exoanutdesss Digest tt the DNA with 1 nuclease Purify the DNA with the e SOLID Library Micro Column Purification Kit Purify the DNA with the SOLID Library Micro Column Purification Kit Q mullum S ee 48 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Workflow t End repair the digested DHA Bind the library molecules to streptavidin beads Prewash the beads Bind the library DNA molecules tothe beads Wash the bead DN amp complex Ligate P1 and P2 Adaptors to the DH A Hicktranslate the library Trial arrplify the librany Perfonn trial PCR on the library C
98. a Aldrich D 19516 j Ethylene glycol American Bioanalytical AB00455 01000 50 bp ladder Invitrogen 10416 014 0 5 mL LoBind Tubes Eppendorf 022431005 1 5 mL LoBind Tubes Eppendorf 022431021 CF 1 Calibration Fluid Kit Thermo Scientific CF 1 SOLiID 4 System Library Preparation Guide 171 A Appendix A Required Materials Prepare a barcoded fragment library Table 81 Required consumables Item Source PR 1 Conditioning Kit Thermo Scientific PR 1 Filtered pipettor tips Major Laboratory Supplier MLS PCR strip tubes MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance 8 The NanoDrop Conditioning Kit is useful for reconditioning the sample measurement pedestals to a hydrophobic state if they become unconditioned refer to the Nanodrop Conditioning Kit user s manual for more information The PR 1 kit consists of a container of specially formulated polishing compound and a supply of convenient applicators Table 82 Optional consumables Product name Vendor Agilent DNA 1000 Kit Agilent Technologies 5067 1504 t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance 172 SOLID 4 System Library Preparation Guide Appendix B SOLiD 4 System Library Quantitation with the SOLiD Library TagMan Quantita
99. able 3 Mix for end repair of DNA Component Volume pL Sheared DNA 100 5X End Polishing Buffer 40 dNTP Mix 10 mM 8 End Polishing Enzyme 1 10 U uL 4 End Polishing Enzyme 2 5 U uL 16 Nuclease free Water 32 Tota 200 Incubate the mixture at room temperature for 30 minutes Add 4 volumes of Binding Buffer B2 S with 55 isopropanol to the end repaired DNA Apply approximately 700 uL of end repaired DNA in the binding buffer to the column s The maximum yield of DNA can be achieved if the amount of DNA loaded to a PureLink column is lt 5 ug Use more columns if necessary Let the column s stand for 2 minutes at room temperature Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute and discard the flow through Repeat steps 2 and 4 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s Add 650 uL of Wash Buffer W1 to wash the column s Centrifuge the column s at 210 000 x g 13 000 rpm for 2 minutes then discard the flow through Repeat to remove residual wash buffer Air dry the column s for 2 minutes to evaporate residual alcohol Transfer the column s to clean 1 5 mL LoBind tube s Add 50 uL of Elution Buffer E1 to the column s to elute the DNA then let the column s stand for 2 minutes Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute Add the eluate from step 10
100. agment libraries Quantitation Starting Amount SOLiD Library Oligos Kit 1 End Repair P1 Adaptor Quantitative PCR P2 Adaptor Library PCR Primer 1 Library PCR Primer 2 Quantitation Starting Amount SOLiD Library Oligos Kit 1 End Repair P1 Adaptor Quantitative PCR P2 Adaptor Library PCR Primer 1 o Library PCR Primer 2 Quantitation Quantity of DNA Step temembe SOLiD Library Oligos Kit 1 P1 Adaptor P2 Adaptor Step Starting Amount End Repair Quantitative PCR Library PCR Primer 1 Library PCR Primer 2 Quantitation Starting Amount Le SOLiD Library Oligos Kit 1 End Repair P1 Adaptor Quantitative PCR P2 Adaptor Library PCR Primer 1 Library PCR Primer 2 224 SOLID 4 System Library Preparation Guide Workflow checklists prepare a 2 x 50 bp mate paired library Preparation steps Appendix F Checklists and workflow tracking forms Workflow checklists prepare a 2 x 50 bp mate paired library Filtered pipettor tips O Covaris S2 System 1M Tris pH 8 0 O Degas the water in the g A O Covaris Tubes and Caps Nuclease free Water Covaris S2 System 30 ar E O Microcentrifuge Ethylene glycol minutes prior to use 2 S9 O NanoDrop amp ND 1000 UltraPure Glycerol O Supplement the circulated 8 a Spectrophotometer SOLID Library Colum
101. amplify the library 1 Prepare a master mix for the number of reactions needed based on the amount of starting input DNA plus one additional reaction for the negative control see Table 5 Table 5 Suspend the gel eluate according to starting input DNA If the gel eluate DNA is gt 100 uL lt 100 pL Volume pL Component Volume pL F volume of eluate 100 Platinum PCR 380 x F 380 Amplification Mix Library PCR Primer 1 10x F 10 50 uM Library PCR Primer 2 10x F 10 50 uM Total 400 x F 400 2 Ifthe volume of the eluate is e lt 100 uL add 400 uL of master mix to the gel eluate then distribute in 4 PCR reaction tubes e gt 100 uL add 400 uL of master mix to every 100 uL of eluate then distribute in 125 uL aliquots to PCR reaction tubes 3 Run the PCR Table 6 on page 28 IMPORTANT Minimize the number of cycles to avoid overamplification and production of redundant molecules Determine the number of cycles based on the amount of starting input DNA SOLID 4 System Library Preparation Guide 27 o F 5 xe et vA N TI EM 5 Ke 3 D E lop E e lt 0 o amp Ei E e 2 Chapter 2 Fragment Library Preparation Nick translate then amplify the library Purify the DNA with 1 the SOLiD Library Column Purification 9 Kit 10 28 Table 6 PCR conditions to nick translate and amplify the library Stag
102. arized DNA 2 6 eee 68 Digest the DNA with T7 exonuclease and S1 nuclease 0000 c eee ee 71 End repair the digested DNA 2 00 e eee 73 Bind the library molecules to streptavidin beads saanunna aeaa 74 Ligate P1 and P2 Adaptors to the DNA 2 eee ee 76 Nick translate the library 0 0 0 ee teens 77 Trial amplify the library 2 tees 78 Armiplify the library 2 2teeie og 2 ge pated ela epi aenclodies nepluisled peau be wbene 80 Gel purify the library with a Size Selection gel 0 0 0 ees 82 Quantitate the library by performing quantitative PCR qPCR 0 87 Section 3 2 Prepare a 2 x 25 bp mate paired library 88 Materials and equipment required liliis 88 WOFKTOW dints use iioc aos sf c a ek ep te e pd pde Minted Dp 89 TIS ua cis uast eher orta a a C rice ntfs tc rc testa ele erecto terae ToO amp 94 Shear the DNA iet dept Ree RR REEL TUS REIR Bine wie et i as BY eae 94 End repair the sheared DNA 000 cee er 98 Methylate the genomic DNA EcoP15l sites nannaa eee ee 99 Ligate EcoP15l CAP Adaptors to the methylated DNA 000 cee eee 102 size select the DNA neema ne heed a eo a ea RUP ude wo ee 104 Gircularize the DNAs e vist ote otic ane a ern RE aaah a as Ne RE 107 Isolate the circularized DNA 1 tees 110 Digest the circularized DNA with EcoP151 2 0 cee ee 112 End repair with Klenow
103. ate Paired Library Preparation Materials and equipment required Section 3 2 Prepare a 2 x 25 bp mate paired library Materials and equipment required See Appendix A on page 145 for a list of equipment kits and consumables necessary for this procedure 88 SOLID 4 System Library Preparation Guide Workflow Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Workflow Shear the DNA with Covaris S2 System or HydroShear Purify the DNA with the SOLID Library Column Purification Kit Repair the DNA ends with the End Polishing Reaction Purify the DNA with the SOLID Library Column Purification Kit Methylate the genomic DNA EcoP 151 sites Purify the DNA with the SOLID Library Column Purification Kit Ligate adaptors to the DNA Purify the DNA with the SOLID Library Column Purification Kit Size select the DNA with an agarose gel Purify the DNA with the SOLID Library Quick Gel Extraction Kit Circularize the DNA with the Internal Adaptor Purify the DNA with the SOLID Library Micro Column Purification Kit the ci ized DNA Treat the DNA with Plasmid Safe ATP Dependent DNase Purify the DNA with the SOLID Library Micro Column Purification Kit uoneJedojgg SOLID 4 System Library Preparation Guide 89 ie D g Sg o R km 2m 9 d D 3 oO on um oH e o 5 lt 3 Chapter 3 Mate Paired Library Preparation Workflow Work
104. aterial to the address designated by the Applied Biosystems representative uoneuuoju gt ke Ke o 5 2 x E 5 7 ct e 3 o 2j D 3 9 3 EI lt SOLID 4 System Library Preparation Guide 243 H Appendix H Instrument Warranty Information Damages claims and returns 244 SOLiID 4 System Library Preparation Guide Appendix Safety This appendix covers B Instrumentation safety 0 0 0 en 246 General instrument safety 0 20 0 ccc 246 Physical hazard safety 0 0 ccc eee e nee nees 247 B Chenmucalsafety dieses eR RR RERO CARE RR REN UHR eu iad 248 General chemical safety 0 ccc cee eens 248 p UIT 249 Chemical waste safety 0 ccc cece cnet enna 250 Biological hazard safety 0 0 0 teens 252 SOLID 4 System Library Preparation Guide 245 Appendix Safety Instrumentation safety Instrumentation safety N Note For important instrument safety information refer to the Applied Biosystems SOLiD 4 System Instrument Operation Guide PN 4448379 and the Covaris S2 System manual For general safety information see the Preface on page 9 General instrument safety Operating the Ensure that anyone who operates the instrument has instrument ar f Received instructions in both general safety practices for laboratories and specific safety practices for the instrument Read and understood all applicable Safety Data Sheets
105. ation Digest the DNA with T7 exonuclease and S1 nuclease Digest the LR circularized DNA with S1 nuclease 5 Purify the DNA with 1 the SOLiD Library Micro Column Purification Kit 2 72 Freshly dilute 1 uL of S1 Nuclease to 25 U uL with S1 Nuclease Dilution Buffer Combine see Table 21 Table 21 S1 nuclease reaction mix Component Amount T7 exonuclease digested DNA X 2 uL 3 M NaCl X 60 uL S1 nuclease 25 U uL X 50 uL Example For T7 exonuclease digested DNA from 200 ng of circularized DNA Component Amount T7 exonuclease digested DNA 100 uL 3 M NaCI 3 3 uL S1 nuclease 25 U uL 4 uL Incubate the reaction mixture at 37 C for 30 minutes mmediately proceed to the next step Purify the DNA with the SOLiD Library Micro Column Purification Kit Pre spin empty PureLink Micro columns in collection tubes at 10 000 x g for 1 minute before use Add 4 volumes of Binding Buffer B2 S with isopropanol 55 to 1 volume of sample Mix well Apply the sample in the binding buffer to the PureLink Micro column s in collection tube s Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA 1s bound to the column Repeat steps 3 and 4 until the entire sample has been loaded onto the column s Place the PureLink Micro column s back into the same collection tube s Add 650 uL of Wash Buffer W1 with ethanol to wash the
106. ble 13 Dilute the DNA for shearing 5 3 Component Amount E UltraPure Glycerol 100 pL 5 DNA 10 to 20 ug Nuclease free Water Variable Total 500 uL 2 Shear the DNA using the Covaris S2 System shearing program described in Table 12 on page 54 3 Transfer 500 uL of sheared DNA into a clean 1 5 mL LoBind tube 4 Wash the borosilicate tube with 100 uL of Nuclease free Water and transfer the wash to the 1 5 mL LoBind tube Mix by vortexing and then proceed to Purify the DNA with the SOLiD Library Column Purification Kit on page 56 Shear the DNA with 1 In 1 5 mL LoBind Tubes dilute 10 to 20 ug of DNA to 150 uL with Nuclease free the Hyd roShear Water If you are starting with an input 720 ug split the DNA into lt 20 ug aliquots DNA bed and shear each aliquot in 150 uL volume For better coverage of large and complex genomes more DNA should be used if it is available 2 Onthe Edit Wash Scheme tab specify the solution and cycles 2cycles of WS1 0 2 N HCl 2cycles of WS2 0 2 N NaOH 3 cycles of Nuclease free Water 3 Run the wash scheme on the HydroShear DNA Shearing Device 4 Adjust the speed code SC and number of cycles according to Table 12 on page 54 and adjust the volume setting to 150 uL 5 Begin shearing Repeat the shearing for the other aliquot of DNA if applicable It is not necessary to run the wash cycle if both tubes contain the same DNA 6 Run the wash scheme after DNA shearing
107. ble 23 on page 73 to the pre washed beads then vortex Rotate the solution at room temperature 20 to 25 C for 30 minutes then pulse spin SOLiID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Bind the library molecules to streptavidin beads Wash the bead 1 Combine see Table 25 2 Place the tube with the bead DNA complex in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant DNA complex s EINE Table 25 Prepare 1X Ligase Buffer Q Component Volume pL E 5X Ligase Buffer 120 v os Nuclease free Water 480 3 Ri Total 600 E vU O D 3 SH r oH 9 lt 3 Resuspend the beads in 500 uL of Bead Wash Buffer then transfer the beads to a new 1 5 mL LoBind tube Vortex the beads for 15 seconds then pulse spin 4 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 5 Resuspend the beads in 500 uL of Bead Wash Buffer Vortex the beads for 15 seconds then pulse spin 6 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 7 Repeat steps 5 and 6 once 8 Resuspend the beads in 500 uL of 1X Ligase Buffer Vortex the beads for 15 seconds then pulse spin 9 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard t
108. cal manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions 150 SOLID 4 System Library Preparation Guide Table 62 Required Applied Biosystems reagent kits Appendix A Required Materials Prepare an express fragment library Prepare an express fragment library Item part number Components Kit components used in SOLID Fragment Library Oligos Kit 4401151 SOLiD Library Oligos Kit 1 P1 Adaptor ds SOLiD Library Oligos Kit 1 P2 Adaptor ds Ligation of adaptors SOLiD Library Oligos Kit 1 Library PCR Primer 1 SOLiD Library Oligos Kit 1 Library PCR Primer 2 Library amplification SOLiD Fragment Library Construction Kit 4443473 5 SOLiD Fragment Library Enzyme Core Kit e 5X End Polishing Buffer e dNTP 10 mM e End Polishing Enzyme 1 e End Polishing Enzyme 2 DNA end repair e 5X Ligase Buffer e T4 DNA Ligase Ligation of P1 and P2 Adaptors Platinum PCR Amplification Mix Nick translation library amplification SOLID Library Column Purification Kit DNA end repair ligation of P1 and P2 Adaptors and nick translation library amplification Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance For the SDS of any chemical not distributed by Applied Biosystems
109. column s Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at 14 000 x g to remove residual wash buffer Transfer the column s to clean 1 5 mL LoBind tube s Add 25 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 End repair the digested DNA 10 Centrifuge the column s at 14 000 x g for 1 minute 11 Add the eluate from step 10 back to the column s then let the column s stand for 1 minute at room temperature 12 Centrifuge the column s at 14 000 x g for 1 minute uoljyesedaid 13 Ifnecessary pool the eluted DNA into one 1 5 mL LoBind tube STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to End repair the digested DNA 9 D iei 3 gj oo lt 2 n U g 2 ki um ed E S a lt End repair the digested DNA 1 Combine see Table 22 Table 22 Reaction mix Component Amount S1 digested DNA Xng 5X End Polishing Buffer 20 uL dNTP 10 mM 2 5 uL End Polishing Enzyme 1 10 U uL 1 uL End Polishing Enzyme 2 5 U uL 2 uL Nuclease free Water Variable Total 100 uL 2 Incubate the reaction mix at room temperature 20 to 25 C for 30 minutes 3 Stop the reaction by combini
110. column s stand for 1 minute at room temperature 9 D iei 3 gj oo lt a n U D 2 ki um ed E S S lt 5 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column 6 Add 500 uL of additional Binding Buffer B2 S with isopropanol 55 to wash the column s 7 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column 8 Add 650 uL of Wash Buffer W1 with ethanol to wash the column s 9 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at 14 000 x g to remove residual wash buffer 10 Transfer the column s to clean 1 5 mL LoBind tube s 11 Add 25 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature 12 Centrifuge the column s at 14 000 x g for 1 minute 13 Add the eluate from step 12 back to the column s then let the column s stand for 1 minute at room temperature 14 Centrifuge the column s at 14 000 x g for 1 minute 15 If necessary pool the eluted DNA into one 1 5 mL LoBind tube 16 Quantitate the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer see Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer on page 189 SOLID 4 System Library Preparation Guide 67 3 Chapter
111. column stand for 1 minute at room temperature Centrifuge the column s at 14 000 x g for 1 minute Add the eluate from step 10 back to the column s then let the column stand for 1 minute at room temperature Centrifuge the column s at 14 000 x g for 1 minute If necessary pool the eluted DNA STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C for short term storage or at 20 C for long term storage Or proceed to Quantitate the library by performing quantitative PCR qPCR on page 87 86 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Quantitate the library by performing quantitative PCR qPCR Quantitate the library by performing quantitative PCR qPCR For accurate library quantitation quantitative PCR is strongly recommended For a protocol using the SOLiD Library TaqMan Quantitation Kit PN 4449639 see Appendix B SOLiD 4 System Library Quantitation with the SOLiD Library TaqMan Quantitation Kit on page 173 0 6 o amp EX E e zi STOPPING POINT Store the purified DNA in Elution Buffer E1 at 20 C or proceed to emulsion PCR in the Applied Biosystems SOLiD 4 System Templated Bead Preparation Guide PN 4448378 or the Applied Biosystems SOLiD EZ Bead Emulsifier Getting Started Guide PN 4441486 Aeq peureq eie N seideyo SOLID 4 System Library Preparation Guide 87 3 Chapter 3 M
112. construction oligonucleotides Multiplex adaptor and barcode sequence Sequence bp Barcode 028 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTAGCTTACTACCTGCTGTACGGCCAAGGCOG 3 52 Barcode 029 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGAATCTAGGGCTGCTGTACGGCCAAGGCG 3 52 Barcode 030 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGTAGCGAAGACTGCTGTACGGCCAAGGCG 3 52 Barcode 031 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGCTGGTGCGTCTGCTGTACGGCCAAGGCG 3 52 Barcode 032 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGGTTGGGTGCCTGCTGTACGGCCAAGGCG 3 52 Barcode 033 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTCGTTGGATACCTGCTGTACGGCCAAGGCG 3 52 Barcode 034 50 uM o 5 CGCCTTGGCCGTACAGCAG3 19 3 5 CTGCCCCGGGTTCCTCATTCTCTTCGTTAAAGGCTGCTGTACGGCCAAGGCG 3 52 a Barcode 035 50 uM al 5 CGCCTTGGCCGTACAGCAG 3 19 E 5 CTGCCCCGGGTTCCTCATTCTCTAAGCGTAGGACTGCTGTACGGCCAAGGCG 3 52 gt Barcode 036 50 uM S 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGTTCTCACATCTGCTGTACGGCCAAGGCG 3 52 o Barcode 037 50 uM c 5 CGCCTTGGCCGTACAGCAG 3 19 3 5 CTGCCCCGGGTTCCTCATTCTCTCTGTTATACCCTGCTGTACGGCCAAGGCG 3 52 E Barcode 038 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGTCGTCTTAGCTGCTGTAC
113. contaminated by nucleic acids DNA cDNA Some spurious amplification may occur in NTCs at high CTs for example 30 This is above the CT range for actual template and thus has no effect on quantitation Take standard precautions to avoid contamination when preparing your PCR reactions Ideally amplification reactions should be assembled in a DNA free environment We recommend using aerosol resistant barrier tips No PCR product is evident either in the qPCR graph or on a gel The protocol was not followed correctly Verify that all steps have been followed and the correct reagents dilutions volumes and cycling parameters have been used Template contains inhibitors nucleases or proteases or has otherwise been degraded Purify or re purify your template PCR product is evident on a gel but not in the qPCR graph qPCR instrument settings are incorrect Confirm that you are using the correct instrument settings dye selection reference dye filters and acquisition points There are problems with your specific qPCR instrument See your instrument manual for tips and troubleshooting PCR efficiency is above 110 Template contains inhibitors nucleases or proteases or has otherwise been Purify or re purify your template Inhibitors in the template may result in changes in PCR efficiency between dilutions degraded Nonspecific Run the PCR products on a 4
114. covered by the warranty on the HydroShear DNA Shearing Device shearing assembly syringes syringe adapters syringe shields and output tubing Applied Biosystems reserves the right to use new repaired or refurbished instruments or components for warranty and post warranty service agreement replacements Repair or replacement of products or components that are under warranty does not extend the original warranty period Applied Biosystems warrants that all optional accessories supplied with its SOLiD 4 Analyzer such as peripherals printers and special monitors will be free of defects in materials and workmanship for a period of ninety 90 days from the date the warranty begins Applied Biosystems will repair or replace at its discretion defective accessories during this warranty period After this warranty period Applied Biosystems will pass on to the buyer to the extent that it is permitted to do so the warranty of the original manufacturer for such accessories With the exception of consumable replaceable products or components used on or in the instrument are themselves warranted to be free of defects in materials and workmanship for a period of ninety 90 days Applied Biosystems warrants that chemicals and other consumable products will be free of defects in materials and workmanship when received by the buyer but not thereafter unless otherwise specified in documentation accompanying such product SOLID 4 System Library
115. d 2 with the Platinum PCR Amplification Mix which includes a proofreading enzyme for high fidelity amplification to determine the number of PCR cycles so that the amplified library is just visible on 2 E Gel EX Gel uolyeredaid Amplify the library The library is amplified using Library PCR Primers 1 and 2 with the Platinum PCR Amplification Mix which includes a proofreading enzyme for high fidelity amplification Reduce the number of cycles as much as possible and use the entire nick translated product for amplification to get maximum representation of the library and to avoid PCR related biases due to differential amplification of library molecules Qo F RV go et D a Co m U a E o on o o s lt Gel purify the library with a Size Selection gel The library is run on an SOLiD Library Size Selection gel The library band 154 to 156 bp can be extracted and desalted using the SOLiD Library Micro Column Purification Kit Quantitate the library by performing quantitative qPCR Quantitate the library by using the SOLiD Library TaqMan Quantitation Kit PN 4449639 described in Appendix B SOLiD 4 System Library Quantitation with the SOLiD Library TaqMan Quantitation Kit on page 173 SOLID 4 System Library Preparation Guide 93 Chapter 3 Mate Paired Library Preparation Tips Tips Adjust microcentrifuge speeds and times according to the g forces specified in the protoc
116. d DNA 5 Blank 6 Methylated sheared genomic DNA 7 Methylated sheared EcoP15l digested DNA Figure 31 Methylation confirmation gel 204 SOLID 4 System Library Preparation Guide Appendix D Oligonucleotide Sequences This appendix covers E Library construction oligonucleotides 00 cece eee ee 206 Adaptor S6quences o resio rreren eetes bho EE EE EE EEEO EEEE 206 Multiplex adaptor and barcode sequences 00 0 0 cece eee ee 206 gt 5 o D 2 x g Q E s o D Ea ei D n D D o 7 SOLID 4 System Library Preparation Guide 205 D Appendix D Oligonucleotide Sequences Library construction oligonucleotides Library construction oligonucleotides Adaptor sequences Multiplex adaptor and barcode sequence Sequence bp P1 Adaptor 50 uM 5 CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT 3 41 5 ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTT 3 43 P2 Adaptor 50 uM 5 AGAGAATGAGGAACCCGGGGCAGTT 3 25 5 CTGCCCCGGGTTCCTCATTCTCT 3 23 Library PCR Primer 1 50 uM 5 CCACTACGCCTCCGCTTTCCTCTCTATG 3 28 Library PCR Primer 2 50 uM 5 CTGCCCCGGGTTCCTCATTCT 3 21 EcoP15l CAP Adaptor 50 uM 5 Phos CTGCTGTAC 3 9 5 Phos ACAGCAG 3 7 LMP CAP Adaptor 50 uM 5 Phos CTGCTGTAC 3 9 5 ACAGCAG 3 7 Internal Adaptor 2 uM Biotin v 5 Phos CGTACATCCGCCTTGGCCGT 3 20 5 Ph
117. d Tubes Eppendorf 022431005 SOLiID 4 System Library Preparation Guide 149 A Appendix A Required Materials Prepare a standard fragment library Table 60 Required consumables Item Source 1 5 mL LoBind Tubes Eppendorf 022431021 CF 1 Calibration Fluid Kit Thermo Scientific CF 1 PR 1 Conditioning Kit Thermo Scientific PR 1 Filtered pipettor tips Major Laboratory Supplier MLS PCR strip tubes MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance 8 The NanoDrop Conditioning Kit is useful for reconditioning the sample measurement pedestals to a hydrophobic state if they become unconditioned refer to the Nanodrop user s manual for more information The PR 1 kit consists of a container of specially formulated polishing compound and a supply of convenient applicators For the SDS of any chemical not distributed by Applied Biosystems contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions Table 61 Optional consumables Item Source Agilent DNA 1000 Kit Agilent Technologies 5067 1504 t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance For the SDS of any chemical not distributed by Applied Biosystems contact the chemi
118. d for 2 minutes Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute SOLID 4 System Library Preparation Guide Section 2 1 Prepare a standard fragment library 2 Quantitate the library by performing quantitative PCR qPCR 11 Add the eluate from step 10 back to the column s then let the column s stand for 2 minutes Repeat step 10 12 If necessary pool the eluted DNA STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C for short term storage or at 220 C for long term storage or proceed directly to Quantitate the library by performing quantitative PCR qPCR Quantitate the library by performing quantitative PCR qPCR For accurate library quantitation quantitative PCR 1s strongly recommended For a protocol using the SOLiD Library TaqMan Quantitation Kit PN 4449639 see Appendix B SOLiD 4 System Library Quantitation with the SOLiD Library TaqMan Quantitation Kit on page 173 STOPPING POINT Store the purified DNA in Elution Buffer E1 at 20 C or proceed directly to emulsion PCR in the Applied Biosystems SOLiD 4 System Templated Bead Preparation Guide PN 4448378 or the Applied Biosystems SOLiD EZ Bead Emulsifier Getting Started Guide PN 4441486 o F 5 xe E N TI EM o Ke zi E o ES e lt 0 xe amp E fe 2j SOLID 4 System Library Preparation Guide 29 2 Chapter 2 Fragment Library
119. d observe all relevant precautions WARNING CHEMICAL HAZARD All chemicals in the instrument including liquid in the lines are potentially hazardous Always determine what chemicals have been used in the instrument before changing reagents or instrument components Wear appropriate eyewear protective clothing and gloves when working on the instrument WARNING CHEMICAL HAZARD Four liter reagent and waste bottles can crack and leak Each 4 liter bottle should be secured in a low density polyethylene safety container with the cover fastened and the handles locked in the upright position Wear appropriate eyewear clothing and gloves when handling reagent and waste bottles A WARNING CHEMICAL STORAGE HAZARD Never collect or store waste in a glass container because of the risk of breaking or shattering Reagent and waste bottles can crack and leak Each waste bottle should be secured in a low density polyethylene safety container with the cover fastened and the handles locked in the upright position Wear appropriate eyewear clothing and gloves when handling reagent and waste bottles Chemical safety To minimize the hazards of chemicals guidelines Read and understand the Safety Data Sheets SDSs provided by the chemical manufacturer before you store handle or work with any chemicals or hazardous materials See About SDSs on page 249 Minimize contact with chemicals Wear appropriate personal pro
120. d sequencing SOLID 4 System Library Preparation Guide Related documentation Documentation Part Document number Description Applied Biosystems 4445674 Provides brief step by step procedures for SOLID 4 System Library preparing libraries Preparation Quick Reference Card Applied Biosystems 4448378 Describes how to prepare templated beads by SOLiD 4 System emulsion PCR ePCR required before Templated Bead sequencing on the SOLiD 4 System Preparation Guide Applied Biosystems 4448329 Provides brief step by step procedures for SOLiD 4 System preparing templated beads by emulsion PCR Templated Bead ePCR required before sequencing on the Preparation Quick SOLiD 4 System Reference Card Applied Biosystems 4448379 Describes how to load and run the SOLiD 4 SOLiD 4 System System for sequencing Instrument Operation Guide Applied Biosystems 4448380 Provides brief step by step procedures for SOLiD 4 System loading and running the SOLiD 4 System Instrument Operation Quick Reference Card Applied Biosystems 4448639 Provides all the information that you need to set SOLiD 4 System Site up the SOLiD 4 System Preparation Guide Applied Biosystems 4448411 Provides an alternate platform to monitor runs SOLiD 4 System SETS modify settings and reanalyze previous runs that Software User Guide are performed on the SOLID System Applied Biosystems
121. daid 9 D iei 3 gj oo z 2 n U 2 E Ei m ed E S a lt 800 to Covaris shearing in 20 glycerol e Number of Cycles 30 tee 13 mm x 65 mm borosilicate tube Bath Temperature 5 C Bath Temperature Limit 12 C Mode Frequency sweeping Water Quality Testing Function Off e Duty cycle 2 e Intensity 5 e Cycles burst 200 Time 10 seconds 1 to 2 kb HydroShear Standard Shearing e SC5t Assembly e 20 cycles 2 to 3 kb HydroShear Standard Shearing e SC9 Assembly e 20 cycles 3 to 4 kb HydroShear Standard Shearing e SC13 Assembly e 20 cycles 4 to 5 kb HydroShear Standard Shearing e SC15 Assembly 5cycles 5 to 6 kb HydroShear Standard Shearing e SC16 Assembly e 25 cycles t Speed code SC 5 D IMPORTANT If you are using the Covaris S2 System set the chiller temperature to between 2 to 5 C to ensure that the temperature reading in the water bath displays 5 C The circulated water chiller should be supplemented with 20 ethylene glycol 2 If the DNA source is not limiting ensure that the shearing conditions result in the desired insert sizes Shear 5 ug DNA and run 150 ng sheared DNA on a 196 E Gel EX Gel according to the manufacturer s specifications SOLID 4 System Library Preparation Guide 95 3 Chapter 3 Mate Paired Library Preparation Shear the DNA Shear the DNA with 1 the Covaris S2 System In a round bottomed 13 mm
122. de 068 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGCATTGACGACTGCTGTACGGCCAAGGCG 3 52 Barcode 069 50 uM 5 CGCCTTGGCCGTACAGCAGS 19 5 CTGCCCCGGGTTCCTCATTCTCTGATATGCTTTCT GCTGTACGGCCAAGGCG 3 52 Barcode 070 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGCCCTACAGACTGCTGTACGGCCAAGGCG 3 52 Barcode 071 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTACAGGGAACGCT GCTGTACGGCCAAGGCG 3 52 Barcode 072 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTAAGTGAATACCTGCTGTACGGCCAAGGCG 3 52 Barcode 073 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGCAATGACGTCTGCTGTACGGCCAAGGCG 3 52 Barcode 074 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTAGGACGCTGACTGCTGTACGGCCAAGGCG 3 52 Barcode 075 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGTATCTGGGCCTGCTGTACGGCCAAGGCG 3 52 Barcode 076 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTAAGTTTTAGGCT GCT GTACGGCCAAGGCG 3 52 Barcode 077 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTATCTGGTCTTCTGCTGTACGGCCAAGGCG 3 52 Barcode 078 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGGCAATCATCCTGCTGTACGGCCAAGGCG 3 52 Barcode 079 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTAGTAGAATTACTGCTGTACGGCCAAGGCG 3 52 212 SOLID 4 S
123. detailed instructions on each step of the workflow see The qPCR protocol on page 179 oS c o 95 25 zac m cm Ex ow 2 lt O SE U AR ep on rx EU Oo 3 d 9a E lt lt SOLID 4 System Library Preparation Guide 177 ei Appendix B SOLID 4 System Library Quantitation with the SOLID Library TagMan9 Quantitation Kit Tips Kit components and storage Reaction setup and conditions 384 well plate volumes ROX reference dye concentration 178 All components are shipped on dry ice Store all components at 20 C for long term storage The SOLiD Library qPCR Mix may be stored at 4 8 C for up to one month Maintain a sterile environment when handling SOLiD libraries and the qPCR standard to avoid any contamination from DNases Ensure that all equipment that comes in contact with DNA is sterile including pipette tips and microcentrifuge tubes qPCR reaction volumes can be scaled from 5 uL to 100 uL depending on the plate size and instrument for example the 7500 Fast Real Time PCR System uses 20 uL per well in both standard and fast mode Set up all samples including no template control NTC in triplicate to increase accuracy Perform all steps requiring 0 5 mL and 1 5 mL tubes with Eppendorf LoBind Tubes Avoid multiple thaws of samples For 384 well plates we recommend a maximum reaction volume of 10 uL per well ROX dye is recommended for fluorescence norma
124. e EX Ligate Multiplex P1 and Multiplex P2 Adaptors to the DNA Aeq juswbes4 pepooueg p Jeideuo Ligate Multiplex P1 1 Calculate the amount of adaptor needed Y for the reaction based on the amount of and Multiplex P2 DNA from the last purification step for calculation details see Ligation of P1 Adaptors NE and P2 Adaptors on page 216 If DNA fragments were sheared using the standard protocol for fragment library preparation the average insert size should be approximately 165 bp before adaptor ligation 7 10 pg 1 pmol Xpmol ug DNA 1ugDNA x 1ug 660pg Average insert size X pmol 1 uL adaptor needed Y uL adaptor needed ug DNA x iugDNA x 30 x 50pmor Example For 1 ug of purified end repaired DNA with an average insert size of 165 bp E 10 pg 1pmo 1 X pmol ug DNA 140g DNA 1 ug s 660 pg x 165 9 2 pmol ug DNA _ 9 2 pmol 1 uL adaptor needed Y uL adaptor needed 1yugDNA x Tig DNA x 30 x 50 pmol 5 5 uL adaptor needed SOLID 4 System Library Preparation Guide 137 Purify the DNA with the SOLiD Library Column Purification 138 Chapter 4 Barcoded Fragment Library Preparation Ligate Multiplex P1 and Multiplex P2 Adaptors to the DNA IMPORTANT For each multiplexed sequencing run use at least one of the following full sets of four barcodes Barcodes 1 4 5 8 9 12 13 16 17 20 21 24 25 28 29 32 33 36 37 40 41 44 45 48 49 52 53 56 57 60 61 64
125. e Covaris 5 to 10 C Higher shearing temperatures can be harmful to DNA S2 System 9 1 Dilute the desired amount of DNA to 100 uL in 1X Low TE Buffer in a LoBind 8 tube see Table 51 T w Table 51 Dilute the DNA for shearing 3 3 Component Amount E DNA 500 ng to 5 ug 9 B 1X Low TE Buffer Variable 3 Total 100 uL E E lt 2 Place a Covaris microTUBE into the loading station Keep the cap on the tube and use a tapered pipette tip to slowly transfer the 100 uL of DNA sample through the pre split septa Be careful not to introduce a bubble into the bottom ofthe tube hy Note To load and unload the Covaris microTUBE correctly from the m microTUBE holder see Load and unload Covaris microTUBE vials from the Covaris microTUBE holder on page 186 3 Shear the DNA using the following Covaris S2 System conditions Number of Cycles 6 Bath Temperature 5 C Bath Temperature Limit 30 9C Mode Frequency sweeping Water Quality Testing Function Off Duty cycle 10 Intensity 5 e Cycles burst 100 Time 60 seconds D IMPORTANT Make sure that the water in the Covaris S2 tank is filled with fresh deionized water to fill line level 12 on the graduated fill line label The water should cover the visible glass part of the tube Set the chiller temperature to between 2 to 5 C to ensure that the temperature reading in the water bath displays 5 C The circulated water chiller should be supplemented with 20
126. e PCR qPCR Shear the DNA This step involves sonicating the input DNA into small fragments with a mean fragment size of 165 bp and a fragment size range of 150 to 180 bp before adaptor ligation using the Covaris S2 System The conditions have been tested for shearing 10 ng to 5 ug DNA in a total volume of 100 uL For certain DNA samples optimizing the shearing protocol may be necessary End repair the DNA End Polishing Enzyme 1 and End Polishing Enzyme 2 are used to convert DNA that has damaged or incompatible 5 protruding and or 3 protruding ends to 5 phosphorylated blunt ended DNA The conversion to blunt ended DNA results from 5 to 3 polymerase and the 3 to 5 exonuclease activities of End Polishing Enzyme 2 End Polishing Enzyme 1 and ATP are also included for phosphorylation of the 5 ends of the blunt ended DNA to allow for subsequent ligation Purify the DNA with the SOLiD Library Column Purification Kit Sample purification is recommended with the PureLink columns supplied in the SOLiD Library Column Purification Kit PureLink columns have a 40 ug capacity but it may be necessary to use multiple columns during a purification step for higher yields SOLID 4 System Library Preparation Guide Tips Section 2 2 Prepare an express fragment library 2 Tips Ligate P1 and P2 Adaptors to the DNA P1 and P2 Adaptors are ligated to the ends of the end repaired DNA The P1 and P2 Adaptors ar
127. e Step Temp Time Holding Nick translation 72 C 20 min Holding Denature 95 C 5 min Cycling Denature 95 C 15 sec Evo Meyda Anneal 62 C 15 sec Extend 70 C 1 min Holding Extend 70 C 5 min Holding 4 C co t Starting amount of DNA number of cycles 10 ng to 100 ng 10 cycles 100 ng to 1 yg 6 to 8 cycles 1 ug to 2 ug 4 to 6 cycles 2 ug to 5 ug 2 to 3 cycles Pool all four of the PCR tubes into a new 1 5 mL LoBind tube Add 4 volumes of Binding Buffer B2 L with 40 isopropanol to the sample Apply approximately 700 uL of PCR product in the binding buffer to the column s The maximum yield of DNA can be achieved if the amount of DNA loaded to a PureLink column is lt 5 ug Use more columns if necessary Let the column s stand for 2 minutes at room temperature Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute and discard the flow through Repeat steps 2 and 4 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s Add 650 uL of Wash Buffer W1 to wash the column s Centrifuge the column s at 210 000 x g 13 000 rpm for 2 minutes then discard the flow through Repeat to remove residual wash buffer Air dry the column s for 2 minutes to evaporate residual alcohol Transfer the column s to clean 1 5 mL LoBind tube s Add 50 uL of Elution Buffer E1 to the column s to elute the DNA then let the column s stan
128. e Water in a SOLiD Library Size Selection gel to size select the DNA 3 Run the gel iBase program Run SizeSelect 2 Runtime 11 40 11 minutes and 40 seconds Monitor the gel in real time with the E Gel Safe Imager Real time Transilluminator 4 If needed during the run fill the middle collection wells with Nuclease free Water 5 When the 200 bp band from the marker ladder lane is at the bottom but still within the collection well stop the run if the run has not already stopped see Figure 6 on page 26 6 Collect the solution from the wells and pool according to samples 7 Wash each collection well with 25 uL of Nuclease free Water then retrieve the wash solution with the solution collected in Step 6 8 Optional Concentrate the DNA with a SOLiD Library Column Purification Kit No concentration of the DNA 1s needed however if the DNA will be nick translated or amplified according to the procedures below SOLID 4 System Library Preparation Guide 25 2 Chapter 2 Fragment Library Preparation Size select the DNA 350 300 250 200 150 100 50 Figure 6 Elution of 200 to 230 bp region from a SOLiD Library Size Selection gel 26 SOLiID 4 System Library Preparation Guide Nick translate then amplify the library Section 2 1 Prepare a standard fragment library Nick translate then amplify the library Nick translate then
129. e included in double stranded form in the SOLiD Fragment Library Oligos Kit Nick translate then amplify the library The adaptor ligated purified DNA undergoes nick translation then amplification using Library PCR Primer 1 Library PCR Primer 2 and Platinum PCR Amplification Mix After amplification the PCR samples are purified with the SOLiD Library Column Purification Kit Quantitate the library by performing quantitative PCR qPCR The library is quantitated by using the SOLiD Library TaqMan Quantitation Kit PN 4449639 described in Appendix B SOLiD 4 System Library Quantitation with the SOLiD Library TaqMan Quantitation Kit on page 173 Adjust microcentrifuge speeds and times according to the g forces specified in the protocols Applied Biosystems recommends the Eppendorf 5417R tabletop microcentrifuge Perform all steps requiring 0 5 mL and 1 5 mL tubes with Eppendorf LoBind Tubes Thaw reagents on ice before use SOLID 4 System Library Preparation Guide 33 le F hy xe 0 N Tm x o Ke 3 D Ee E o lt e lt 2e 0 xe amp fe 2j 2 Chapter 2 Fragment Library Preparation Shear the DNA Shear the DNA Shear the DNA n IMPORTANT Ensure that the bath temperature during shearing is between using the Covaris 5 to 10 C Higher shearing temperatures can be harmful to DNA S2 System 1 Dilute the desired amount of DNA in 10
130. e insert size Z X pmol 1 pL adaptor needed Y uL adaptor needed ugDNA x Ts DNA x 100 x 50 pmol Example For 12 ug of purified end repaired DNA with an average insert size of 1 5 kb 6 1 10 pg x lpmol x 1 0 pmol ug DNA X pmol ug DNA 1gg DNA 1 ug 660 pg 1500 Y uL adaptor needed 12 pg DNA x x 100 x LHL M 24 uL adaptor needed 2 Combine and mix the following components see Table 36 If a larger reaction volume is required to incorporate all of the methylated DNA scale up the T4 DNA Ligase and 5X Ligase Buffer Add 1 uL of T4 DNA Ligase per 20 uL of reaction volume Add 1 uL of 5X Ligase Buffer per 5 uL of reaction volume Table 36 Ligation mix Component Volume pL EcoP15l CAP Adaptor ds 50 pmol uL Y 5X Ligase Buffer 20 T4 DNA Ligase 5 U uL 5 0 DNA Variable Nuclease free Water Variable Total 100 3 Incubate at room temperature 20 to 25 C for 15 minutes 102 SOLiID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Ligate EcoP15l CAP Adaptors to the methylated DNA Purify the DNA with 1 Add 4 volumes of Binding Buffer B2 S with isopropanol 55 to 1 volume of the SOLID Library sample Mix well Column Purification Kit 2 Apply about 700 uL of the sample in the binding buffer to the PureLink column s in collection tube s 3 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow
131. e is required to incorporate all of the DNA scale up the T4 DNA Ligase and 5X Ligase Buffer Add 1 uL of T4 DNA Ligase per 20 uL of reaction volume Add 1 uL of 5X Ligase Buffer per 5 uL of reaction volume Table 15 Ligation mix Component Volume pL LMP CAP Adaptor ds 50 uM Y 5X Ligase Buffer 40 T4 DNA Ligase 10 DNA Variable Nuclease free Water Variable Total 200 3 Incubate the reaction mixture at room temperature 20 to 25 C for 15 minutes SOLiID 4 System Library Preparation Guide 59 3 Chapter 3 Mate Paired Library Preparation Ligate LMP CAP Adaptors to the DNA Purify the DNA with 1 Add 4 volumes of Binding Buffer B2 S with isopropanol 55 to the SOLiD Library 1 volume of sample Mix well Column Purification Kt 5 Apply about 700 uL of the sample in the binding buffer to the PureLink column s in collection tube s 3 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column 4 Repeat steps 2 and 3 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s 5 Add 650 uL of Wash Buffer W1 with ethanol to wash the column s 6 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at maximum speed to remove residual wash buffer 7 Transfer the column s to clean 1 5 mL LoBind tube s 8 Add 50 uL of
132. e ladder bands and the ruler for reference excise the band of the gel corresponding to the insert size range of interest with a clean razor blade see Figure 16 on page 105 If desired take a tighter cut for a tighter size selection If the gel piece is large slice it into smaller pieces SOLiID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Size select the DNA E o 1 6 kb Excision of S 1 1 6kb band 3 Es 9 D iei 3 2 oo lt 2 n U D 2 Ei um ed E S a lt Figure 16 Excision of 1 1 6 kb range in a 1 0 agarose gel Purify the DNA 1 Weigh the gel slice in a 15 mL polypropylene conical colorless tube using the SOLiD Library Quick Gel 2 Add 30 uL of Gel Solubilization Buffer L3 for every 10 mg of gel Extraction Kit 3 Dissolve the gel slice by vortexing the tube at room temperature until the gel slice has dissolved completely 15 minutes D IMPORTANT Do not heat the gel to dissolve the gel slice When heated the DNA denatures and short insert libraries form heteroduplexes Heteroduplexes are deleterious to the library 4 Add 1 gel volume of isopropanol to the dissolved gel slice For example add 10 uL of isopropanol to 10 mg of gel Mix well 5 Apply the dissolved gel mixture to the Quick Gel Extraction column s in Wash Tube s Use one column per 400 mg agarose or load lt 2000 uL of dissolved gel mixture per column Use
133. e rotor 24 x 1 5 2 mL including aluminum lid aerosol tight Eppendorf 022636006 96 well GeneAmp PCR System 9700 Applied Biosystems thermal cycler N8050200 Base Applied Biosystems 4314443 Block NanoDrop ND 1000 Spectrophotometer Thermo Scientific computer required ND 1000 E Gel iBase and E Gel Safe Imager Invitrogen Combo Kit G6465 Vortexer MLS SOLID 4 System Library Preparation Guide Appendix A Required Materials Prepare a barcoded fragment library Table 79 Required equipment Item Source Picofuge MLS Pipettors 2 uL MLS Pipettors 20 uL MLS Pipettors 200 uL MLS Pipettors 1000 uL MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Or equivalent but validation of the equipment for library preparation is required Table 80 Optional equipment Item Source 2100 Bioanalyzer Agilent Technologies G2938C Qubit Quantitation Starter Kit Invitrogen Q32860 t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Table 81 Required consumables Item Source 1X Low TE Buffer Applied Biosystems zi 4389764 s Nuclease free Water 1 L Applied Biosystems P AM9932 E Covaris microTUBEs Covaris amp 520045 3 Isopropyl alcohol Sigm
134. e the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer see Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer on page 189 STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Circularize the DNA on page 107 SOLID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Circularize the DNA Circularize the DNA Circularize the DNA 1 Prepare a circularization reaction by mixing the following components listed with the Internal in order based on the desired insert size where X is the number of micrograms Adaptor of DNA to be circularized see Table 38 If a larger reaction volume is required scale up the T4 DNA Ligase and 5X Ligase Buffer Add 1 uL of TA DNA Ligase per 40 uL of reaction volume Add 1 uL of 5X Ligase Buffer per 5 uL of reaction volume uonejedojg Qo F RV pel a Co m U Er E I Sb o e s lt Table 38 Mix for DNA circularization by insert size 600 to 800 to Components 800 bp 1000 bp 1 to 2 kb 2 to 3 kb 3 to 4 kb 4 to 5 kb 5 to 6 kb Nuclease Variable Variable Variable Variable Variable Variable Variable free Water DNA X ug X ug X ug X ug X ug X ug X ug 5X Ligase X x 47 UL X x 54 uL X x 73 UL X x 100 uL X x 112 uL X x 125 UL X x 144 uL Buffer Internal X x 3 75 uL X x 2 84 uL
135. eLink Micro column s in collection tube s 4 Centrifuge the column s at 10 000 x g for 15 seconds except for the last loading After each spin discard the flow through After the last loading spin the column s for 1 minute dsDNA is bound to the column 5 Repeat steps 3 and 4 until the entire sample has been loaded onto the column s Place the PureLink Micro column s back into the same collection tube s 6 Add 650 uL of Wash Buffer W1 with ethanol to wash the column s 7T Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at 14 000 x g to remove residual wash buffer 8 Transfer the column s to clean 1 5 mL LoBind tube s 9 Add 25 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature 10 Centrifuge the column s at 14 000 x g for 1 minute 11 Add the eluate from step 10 back to the column s then let the column s stand for 1 minute at room temperature 12 Centrifuge the column s at 14 000 x g for 1 minute SOLiID 4 System Library Preparation Guide 65 3 Chapter 3 Mate Paired Library Preparation Isolate the circularized DNA 13 Ifnecessary pool the eluted DNA IMPORTANT Proceed directly without stopping to Isolate the circularized DNA Isolate the circularized DNA Treat the DNA with Plasmid Safe ATP Dependent DNase 66 1 Combine and mi
136. ed DNA is purified using the SOLiD Library Micro Column Purification Kit the amount of circularized product is quantified A 2100 ng of circularized product is recommended to proceed with library construction For more complex genomes more circularized DNA is recommended for a high complexity library Digest the DNA with EcoP151l In the presence of sinefungin EcoP15I digests the circularized DNA 25 to 27 bp away from the CAGCAG recognition site The digestion creates two genomic DNA tags 25 to 27 bp long connected with an internal adaptor between tags End repair with Klenow The Klenow fragment is used to convert 5 protruding and or 3 protruding ends to 5 phosphorylated blunt ended DNA for blunt end ligation Bind the DNA molecules to the streptavidin beads Dynabeads MyOne Streptavidin C1 specifically bind to the biotin labeled Internal Adaptor in the library molecules to purify the library from side products Ligate P1 and P2 Adaptors to the DNA P1 and P2 adaptors are ligated to the ends of the end repaired DNA The P1 and P2 Adaptors are included in double stranded form in the SOLiD Mate Paired Library Oligos Kit Nick translate the library The ligated purified DNA undergoes nick translation with DNA polymerase I SOLiID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Workflow Trial amplify the library The library is trial amplified using Library PCR Primers 1 an
137. eee nen nen 113 Bind the library molecules to streptavidin beads 0 00005 114 Ligate P1 and P2 Adaptors to the DNA 00 cee eee eee 116 Nick translate the library 0 0 cee ees 117 Trial amplify the library 0 0 0 cette eens 118 Amplify the library 0 0 keene ene ene 120 Gel purify the library with a Size Selection gel 0 0000005 122 Quantitate the library by performing quantitative PCR qPCR 126 SOLID 4 System Library Preparation Guide Chapter 3 Mate Paired Library Preparation 3 Overview Overview This chapter describes the method to make a mate paired library with insert sizes ranging from 600 bp to 6 kb A mate paired library consists of pairs of DNA fragments that are mates because they originated from the two ends of the same genomic DNA fragment CAP adaptors connect the DNA mate pair together through an internal adaptor uonejedajg For 2 x 50 bp mate paired libraries size selected genomic DNA fragments are ligated to LMP CAP Adaptors and circularized with internal adaptors see Figure 7 The resulting DNA circle has one nick in each strand because the LMP CAP Adaptor does not have the 5 phosphate in one of its oligonucleotides Nick translation using E coli DNA polymerase I pushes the nick into the genomic DNA region in 5 to 3 direction The length of nick translated DNA can be controlled by adjusting reaction temperature and time T7 ex
138. efficiency J Final concentration of DNA for circularization Example For an insert size of 1 to 2 kb 63 4 J 5 518 1 5 51 8 Ing yuL 095 51 8 2 74 ng uL The final concentration of DNA required for circularization can be calculated using the formula above The circularization reaction volume per ug of DNA can then be calculated see Table 108 on page 220 gt ke o D 3 Q x m T fe En 3 a D a o E ot Q D Q amp E e 5 a SOLiID 4 System Library Preparation Guide 219 Appendix E Formulas and calculations 2 x 25 bp mate paired library Table 108 Circularization reaction volumes Final concentration of Circularization Insert Size DNA for Calculation reaction volume per circularization 1 ug DNA 600 to 800 bp 4 3 ng uL 1000 ng 4 3 ng uL 235 uL 800 to 1000 bp 3 75 ng uL 1000 ng 3 75 ng uL 270 uL 1 to 2 kb 2 74 ng uL 1000 ng 2 74 ng uL 365 uL 2 to 3 kb 2 1 ng uL 1000 ng 2 1 ng uL 500 uL 3 to 4 kb 1 8 ng uL 1000 ng 1 8 ng uL 560 uL 4 to 5 kb 1 6 ng uL 1000 ng 1 6 ng uL 625 uL 5 to 6 kb 1 4 ng uL 1000 ng 1 4 ng uL 720 uL The amount of Internal Adaptor ds needed for circularization can be calculated as follows Ligation of P1 and 220 P2 Adaptors 10 pg _1 pmol tt Xpmol ug DNA 1 yug DNA Tis 660pg Average insert size x pmol DNA for adaptor ligation pgDNA x Pmol__ 1 ug DNA x2 pmol
139. em performance Procedure 1 Add an equal volume of cold phenol chloroform isoamyl alcohol to the sample and vortex 2 Centrifuge at room temperature at 21 000 x g minimum 14 000 x g for 5 minutes 3 Transfer the upper aqueous layer to a new tube 4 Discard the phenol chloroform isoamyl alcohol layer in hazardous waste gt 15 o D 2 x 9 ie el 1e D 3 o Ej amp I o o o 9 oO 5 Proceed to Isopropanol precipitation on page 198 SOLiID 4 System Library Preparation Guide 193 amp Appendix C Supplemental Procedures Phenol chloroform isoamyl alcohol extraction with MaXtract Phenol chloroform isoamyl alcohol extraction with MaXtract Phenol chloroform isoamyl alcohol extraction can be used to isolate DNA Qiagen MaxXtract High Density Tubes can be used for increased recovery Materials and equipment required Table 97 Required equipment Item Source Microcentrifuge 5417R refrigerated without rotor e Eppendorf 022621807 120 V 60 Hz e Eppendorf 022621840 230 V 50 Hz FA 45 24 11 fixed angle rotor 24 x 1 5 2 mL including Eppendorf aluminum lid aerosol tight 022636006 Pipettors Major Laboratory Supplier MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Or equivalent but validation of the equipment for library preparation is required Table
140. en ligated to the ends of the mate paired library for subsequent amplification by PCR see Figure 9 on page 45 ap o a eS ES Sheared EcoP15l CAP Sonera DNA ener DNA oes Adaptors ligated methylated DNA to sheared methylated DNA oe o pup z Sof z mE c a amm 2h m ean h oe m h m P1 P2 Ligated Biotinylated Library Molech internal adaptors Circularized DNA with 25 27 bp with biotinylated genomic DNA tags internal adaptors Figure 8 Basic 2 x 25 bp mate paired library preparation workflow 44 SOLID 4 System Library Preparation Guide Chapter 3 Mate Paired Library Preparation 3 Overview P1 Adaptor ds 41443 bp Jil A aA a A a a aA Bre IBESEBEEITIBIEITSE A e pner A 9319 19 E e IN P 3 18 16 3 8 LI A ITE E IE I8 1 E IS 8 IE EE PT IS I7 DT D 0 Ke pe EX 5 ER e E Aeq paued ayey e Je1deuos eer re NT A En te I AT UA I6 6 a 16 63 l A 69 ULT TECTBIDUDBBpUB Og P 999m OYnTmsbs germ pDEBIUUEEI E IEEIIISIEEIBETmEEBSIBENSE SH abl cal bed al 6 09 0119 109 05 ad 1 09 P7 cd 9 19 09 9 a lf od 109 19 05 8 E 19 IP 8 8 LL IE Figure 9 Mate paired library design After P1 and P2 Adaptors are ligated to the sheared DNA the library is amplified using primers specific to the P1 and P2 Adaptors see Figure 10 on page 46 Library PCR Primer 1 is a 3 truncated version of the 5 strand sequence of P1 while Library PCR Primer 2 is a 3
141. ert size x1 pmol DNA for adaptor ligation ug DNA Tug DNA x2 pmol adaptor needed x pmol 3 7 x L Y uL adaptor needed x2pmol 2 pmol Example For 20 ug of DNA with an insert size of 1 to 2 kb 1 i 10 pg 1 pmol ra t X pmol ug DNA 1 ug DNA 1 Ug x 660 pg 71500 1 0 pmol ug DNA _ 1 0 pmol 1 pL adaptor needed Y uL adaptor needed 20 pg DNA R ug DNA 3 x as i ne pmol 30 pL adaptor needed 1 Xpmol ugDNA 1pgDNA x 0P9 x pmo Tug 660 pg Circularized DNA size x1 pmol DNA for adaptor ligation ug DNA x PMO 1 ug DNA x2 pmol adaptor needed x pmol x 30 Y uL adaptor needed xzpmol x E 50 pmol SOLiID 4 System Library Preparation Guide Appendix E Formulas and calculations 2 x 25 bp mate paired library 2 x 25 bp mate paired library Ligation of EcoP15l 10 1 pmol _ LL CAP Adaptors Xpmol igDNA 1 yg DNA a Average insert size X pmol x1 pmol DNA for adaptor ligation ug DNA x 1 ug DNA x2 pmol adaptor needed x pmol x 100 L 1 Y uL adaptor needed xzpmol 57 pmol DNA circularization The formula to determine dilution of ligation reaction and achieve intramolecular ligation Francis S Collins and Sherman M Weissman Directional Cloning of DNA Fragments at a Large Distance from an Initial Probe A Circularization method PNAS 81 1984 6812 6816 is 63 4 J Si DNA size in kb IngluL J gpt Targeted circularization
142. esedald Isolate the circularized DNA i F RV go et D a Co m U Er E o on o o s lt Plasmid Safe ATP Dependent DNase is used to eliminate uncircularized DNA After the Plasmid Safe DNase treated DNA is purified using the SOLiD Library Micro Column Purification Kit the amount of circularized product is quantified To proceed with library construction a minimum of 100 ng of circularized product based on NanoDrop Instrument s nucleic acid measurement is recommended For more complex genomes more circularized DNA is recommended for a high complexity library Nick translate the circularized DNA Nick translation using E coli DNA polymerase I translates the nick into the genomic DNA region The size of the mate paired tags to be produced can be controlled by adjusting the reaction temperature and time Digest the DNA with T7 exonuclease and S1 nuclease T7 exonuclease recognizes the nicks within the circularized DNA With its 5 to 3 exonuclease activity T7 exonuclease digests the unligated strand away from the tags creating a gap in the sequence This gap creates an exposed single stranded region that is more easily recognized by S1 nuclease so the library molecule can be cleaved from the circularized template End repair the DNA For fast and efficient blunt ended ligation End Polishing Enzyme 1 and End Polishing Enzyme 2 are used to convert DNA with damaged or incompatible 5 prot
143. ettors L1 Isopropyl alcohol g O Scale 9 O NanoDrop amp ND 1000 o Spectrophotometer O Razor blades O 15 mL conical polypropylene tubes L 1 5 mL LoBind tubes O Microcentrifuge O 5xLigase Buffer O Thaw Internal Adaptor on O NanoDrop ND 1000 O T4 DNA Ligase ice Spectrophotometer O Intemal Adaptor ds O Thaw ligation reagents on N s O Vortexer O Nuclease free Water ice 3 a O Picofuge O SOLiD Library Micro e O 1 5 mL LoBind tubes Column Kit o O Pipettors oO SOLiID 4 System Library Preparation Guide 225 gt Ke Ke v S 2 x T o 59 Zz oO s a x g a 5 a s E A s F 226 Appendix F Checklists and workflow tracking forms Workflow checklists prepare a 2 x 50 bp mate paired library Isolate the circularized DNA Microcentrifuge NanoDrop ND 1000 Spectrophotometer Incubator 37 C Vortexer Picofuge 1 5 mL LoBind tubes Pipettors Filtered pipettor tips Reagents ATP 25 mM 10x Plasmid Safe Buffer Nuclease free water SOLiD Library Micro Column Purification Kit Preparation steps Thaw Plasmid Safe ATP Dependent DNase reagents on ice o 5 7 c LE x 2 z Digest the DNA with gt i 2 o E T7 exonuclease and S1 nuclease QOOOOOQO00 O0000000 000000 00 Microcentrifuge Vortexer Picofuge Pipettors Thermal cycler Timer 1 5 mL LoBind tubes Filtered pipettor tips Incubator 37 C Incubator 70 C
144. f 50 C and higher and will not degrade amplicons following qPCR thus enabling their use for downstream applications such as cloning SOLiID 4 System Library Preparation Guide 175 Appendix B SOLID 4 System Library Quantitation with the SOLID Library TagMan9 Quantitation Kit Materials and equipment required Instrument The SOLiD Library TaqMan Quantitation Kit can be used with a wide range of real capability time instruments including the Applied Biosystems 7900HT 7300 7500 StepOne and StepOnePlus Instruments Materials and equipment required Table 83 Required Applied Biosystems reagent kits Item Part number Components SOLID Library TaqMan Quantitation Kit SOLiD Library TagMan qPCR Module d e SOLID Library qPCR Mix e ROX Reference Dye e Ac00010015a1 TaqMan Assay SOLiD Library qPCR Standard t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Note The Certificate of Analysis CofA provides detailed quality control information for each product The CofA is available on the Invitrogen website Go to www invitrogen com cofa The CofA is searchable by product lot number which is printed on each box Table 84 Required equipment Item Source Applied Biosystems 7900HT 7300 7500 Applied Biosystems StepOne StepOnePlus PRISM 7000 or PRISM 7700 Instruments Microcentrifu
145. f Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature 9 Centrifuge the column s at maximum speed for 1 minute 10 Add the eluate from step 9 back to the column s then let the column s stand for 1 minute at room temperature 11 Centrifuge the column s at maximum speed for 1 minute 12 Ifnecessary pool the eluted DNA STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Confirm DNA methylation on a gel Confirm DNA 1 Mix 1 pL of 1 Kb Plus DNA Ladder and 19 uL of Nuclease free Water methylation on a gel 2 Load the diluted ladder onto a 1 E Gel EX Gel Load 20 uL of sample per well There should be at least one lane between the ladder well and the sample wells to avoid contamination of the sample with ladder 3 Run the gel and confirm that the sheared methylated DNA is the expected size relative to the controls see Figure 31 on page 204 4 Proceed directly to Ligate EcoP15I CAP Adaptors to the methylated DNA on page 102 gt xe o 0 Q x 9 ie fem ke je 3 o E E av e 9 2 fo n SOLiID 4 System Library Preparation Guide 203 C Appendix C Supplemental Procedures Confirm complete methylation of DNA fragments Lane Assignments 1 1 kb ladder 2 Blank 3 Unmethylated unsheared genomic DNA 4 Unmethylated unsheared EcoP15l digeste
146. fe Imager Blue Light O Gel Loading Solution e 2 Transilluminator O Nuclease free Water P O Gelimaging system O SOLiD Library Micro 9 2 O Microcentrifuge Column Purification Kit 2 2 O Vortexer ak a 3 O Scale oR 2 O Picofuge 3 m 5 O Pipettors EI O 1 5 mL LoBind tubes E O Filtered pipettor tips Q O Real time PCR system O SOLiD Library TagMan amp a 5 Quantitation Kit 2 z T 3 o SOLID 4 System Library Preparation Guide 227 F Appendix F Checklists and workflow tracking forms Workflow tracking prepare a 2 x 50 bp mate paired library Workflow tracking prepare a 2 x 50 bp mate paired library 228 Starting Amount Shearing the DNA End Repair Size Selection Sample Quantitation Lot number Step Quantity of DNA Step Lot number Starting Amount SOLiD Library Oligos Kit 1 Shearing the DNA P1 Adaptor End Repair Size Selection Plasmid Safe DNase Treatment Quantitative PCR SOLiD Library Oligos Kit 2 LMP CAP Adaptor Internal Adaptor Sample Quantitation Lot number Step Quantity of DNA Step Lot number Starting Amount SOLiD Library Oligos Kit 1 Shearing the DNA P1 Adaptor End Repair P2 Adaptor Size Selection Plasmid Safe DNase Library PCR Primer 2 Treatment Quantitative PCR LMP CAP Adaptor Internal Adaptor Library PCR Master Mix Sample Quantitation Lot number Step Quantity
147. fied DNA in Elution Buffer E1 at 4 C for short term storage or at 220 C for long term storage or proceed directly to Quantitate the library by performing quantitative PCR qPCR Quantitate the library by performing quantitative PCR qPCR 40 Quantitate your library by using the SOLiD Library TagMan Quantitation Kit PN 4449639 described in Appendix B SOLiD 4 System Library Quantitation with the SOLiD Library TaqMan Quantitation Kit on page 173 STOPPING POINT Store the DNA in Elution Buffer E1 at 220 C or proceed directly to emulsion PCR in the Applied Biosystems SOLiD 4 System Templated Bead Preparation Guide PN 4448378 or the Applied Biosystems SOLiD EZ Bead Emulsifier Getting Started Guide PN 4441486 SOLID 4 System Library Preparation Guide Chapter 3 Mate Paired Library Preparation Q E T This chapter covers a u B OVetVieW epe teete eR hr SER IRR Re REA HARE nt hie RU ene ROO te 5 E Section 3 1 Prepare a 2 x 50 bp mate paired library 47 z Materials and equipment required nunnan annaa 47 E WOK MOW Li sr pert d Beale RR Ro eR c uc Bh ne a Ry 48 MAPS DP RAMTM 52 Shear the DNA sree io oerecie Serer is dete ie s 53 End repair the sheared DNA 2 2 teen nee 57 Ligate LMP CAP Adaptors to the DNA 59 Size select the DNA 2 0 cece eee e eens 61 Circularize the DNA 2 2 eee eee een eeae 64 Isolate the circularized D
148. flow overview 90 Bind the library molecules to streptavidin beads Prewash the beads Bind the library DNA molecules to the beads Wash the bead DN A complex Perform trial PCR on the library Confirm library purification with a 2 E Geli E X Gel Perform PCR onthe library Purify the DNA wth SOLID Library Micro Column Purificaiton Kit he library with a Size Selection gd Load the library Run the SOLID Library Size Selection gel and collect the library fragment Optional Purify the DNA with the SOLID Library Micro Column Purification Kit ming quantitative PCR qPCR Shear the DNA The genomic DNA is sheared to yield 600 bp to 6 kb fragments To shear for a mate paired library with insert sizes between 600 bp and 1 kb the Covaris S2 System is recommended To shear for a mate paired library with insert sizes between 1 kb and 6 kb the HydroShear DNA Shearing Device is recommended HydroShear DNA Shearing Device uses hydrodynamic shearing forces to fragment DNA strands The DNA in solution flows through a tube with an abrupt contraction As it approaches the contraction the fluid accelerates to maintain the volumetric flow rate through the smaller area of the contraction During this acceleration drag forces stretch the DNA until it snaps and until the pieces are too short for the shearing forces to break the chemical bonds The flow rate of the fluid and the size of the contraction determine SOLiID 4 Sy
149. for this procedure 16 SOLID 4 System Library Preparation Guide Workflow Workflow overview Section 2 1 Prepare a standard fragment library 2 Workflow Repair the DNA ends with End Polishing Enzymes 1 and 2 Purify the DNA with the SOLID Library Column Purification Kit Lipete F P1 and P2 Adaptors to the DNA Purify the DNA with the SOLID Library Column Purification Kit Nick translate then amplify the library Nick translate then amplify the library Purify the DNA with the SOLID Library Column Purification Kit by performing quantitative PCR qPCR Shear the DNA This step involves sonicating the input DNA into small fragments with a mean fragment size of 165 bp and a fragment size range of 150 to 180 bp before adaptor ligation by using a Covaris S2 System The conditions have been tested for shearing 10 ng to 5 ug DNA in a total volume of 100 uL For certain DNA samples optimizing the shearing protocol may be necessary End repair the DNA End Polishing Enzyme 1 and End Polishing Enzyme 2 are used to convert DNA that has damaged or incompatible 5 protruding and or 3 protruding ends to 5 phosphorylated blunt ended DNA The conversion to blunt ended DNA results from 5 to 3 polymerase and the 3 to 5 exonuclease activities of End Polishing Enzyme 2 End Polishing Enzyme 1 and ATP are also included for phosphorylation of the 5 ends of the blunt ended DNA to allow for subsequent l
150. formation on preparing the SOLiD Library qPCR Standard for ePCR refer to the Applied Biosystems SOLiD 4 System Templated Bead Preparation Guide PN 4448378 or the Applied Biosystems SOLiD EZ Bead Emulsifier Getting Started Guide PN 4441486 For information on performing and analyzing a WFA run refer to the Applied Biosystems SOLiD 4 System Instrument Operation Guide PN 4448379 1 Perform ePCR and prepare templated beads from the SOLiD Library qPCR Standard A 3 point titration of the standard is recommended to find the optimal titration point We suggest using final ePCR library concentrations of 0 1 0 3 and 0 5 pM as starting points however you may choose your own titrations if you have historical data that supports a different range 2 Perform WFA runs on the titrated templated beads The titration point that provides the best results is the titration point to use for your unknown libraries Because the concentrations used in ePCR are in picomolar pM units there is no conversion necessary for library size oS c o 2 o 35 zo Ex ow Zo Ee Sc Zg AR ep on 67 O o 3 Ez d Sg a m lt 3 SOLID 4 System Library Preparation Guide 183 Appendix B SOLID 4 System Library Quantitation with the SOLID Library TagMan9 Quantitation Kit Troubleshooting Troubleshooting Problem Cause Solution Signal appears in no template controls NTCs Template or reagents may be
151. fter gel purification Proceed to Gel purify the libraries Pool libraries of similar size To pool for multiplexed libraries mix equal molar amounts of each barcoded library together in a single tube Vortex the tube STOPPING POINT Store the library DNA in Elution Buffer E1 at 4 C or proceed directly to Gel purify the libraries Gel purify the libraries 1 Remove a SOLiD Library Size Selection gel from its package Remove the combs from top sample loading wells and middle collection wells Set the SOLiD Library Size Selection gel on the E Gel iBase system linked with the E Gel Safe Imager Real Time Transilluminator 2 Load the gel as follows for exact fill volumes of the wells refer to the Invitrogen E Gel SizeSelect Agarose Gels Quick Reference Card a 142 Load 20 uL of the pooled library DNA into each well of the top row of wells If the sample volume is lt 20 uL add Nuclease free Water to the well for a total volume of 20 uL Skip the center well smaller well in the top center of the gel for the ladder and skip a single well to the right and left of the center top well Skip the two outermost wells to avoid edge effects Do not load more than 1 ug of DNA per lane see Figure 23 on page 143 Load 10 uL of 50 bp ladder at 0 1 ug L to the center top well Add 7 uL of water to fill the well see Figure 23 on page 143 Fill the empty wells in the top row with 20 uL of Nuclease free
152. g a shearing double stranded DNA specific fluorescence assay Assays recommended are the Invitrogen Quant iT PicoGreen dsDNA Assay Kit Invitrogen P7589 the Invitrogen Quant iT dsDNA HS Assay Kit Invitrogen Q32851 or Q32854 or the Invitrogen Quant iT dsDNA BR Assay Kit Invitrogen Q32850 or Q32853 uonejedojg 9 D iei 3 gj oo lt 2 n U D 2 g um ed E S a lt 1 Choose the appropriate shearing method based on the desired insert size of the mate paired library see Table 12 on page 54 amp Note These conditions are guidelines A shearing trial prior to large scale m shearing is recommended if additional DNA is available SOLID 4 System Library Preparation Guide 53 3 Chapter 3 Mate Paired Library Preparation Shear the DNA Table 12 Recommended shearing conditions for mate paired library insert sizes Insert size Shearing method Shearing conditions 600 to Covaris S2 shearing in e Number of Cycles 75 800 bp 2096 glycerol e Bath Temperature 5 C 13 mm x 65 mm borosilicate tube e Bath Temperature Limit 12 C Mode Frequency sweeping e Water Quality Testing Function Off Duty cycle 2 e Intensity 7 e Cycles burst 200 e Time 10 seconds 800 to Covaris S2 shearing in e Number of Cycles 30 1000 bp 20 glycerol Bath Temperature 5 C 13 mm x 65 mm borosilicate tube e Bath Temperature Limit 12 C Mode Frequency sweeping Water
153. g your first library preparation is highly recommended Sample purification is performed with PureLink columns supplied in the SOLiD Library Column Purification Kit and the SOLiD Library Micro Column Purification Kit PureLink columns have a 40 ug capacity and PureLink Micro columns have a 5 ug capacity For maximum recovery load 30 ug of DNA onto one PureLink column Use multiple columns if necessary All columns can be loaded multiple times if the volume of initial DNA and binding buffer mixture exceeds the volume capacity of the column For more detailed information on purification of DNA with PureLink columns see the manufacturer s instructions If you have larger amounts of DNA for library construction you can substitute this step with phenol chloroform isoamyl alcohol extraction and isopropyl alcohol precipitation see Appendix C Supplemental Procedures on page 185 End repair the DNA For fast and efficient blunt ended ligation End Polishing Enzyme 1 and End Polishing Enzyme 2 are used to convert DNA with damaged or incompatible 5 protruding and or 3 protruding ends to 5 phosphorylated blunt ended DNA The conversion to blunt end DNA is accomplished by exploiting the 5 to 3 polymerase and the 3 to 5 exonuclease activities of End Polishing Enzyme 2 End Polishing Enzyme 1 and ATP are also included for phosphorylation of the 5 ends of the blunt ended DNA for subsequent ligation Ligate LMP CAP
154. ge 5417R refrigerated without Eppendorf rotor 022621807 120 V 60 Hz e Eppendorf 022621840 230 V 50 Hz FA 45 24 11 fixed angle rotor Eppendorf 24 x 1 5 2 mL including aluminum lid aerosol tight BEPGIEEUUS Vortexer MLS Major Laboratory Supplier Picofuge MLS Pipettors 20 uL MLS Pipettors 200 uL MLS Pipettors 1000 uL MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Or equivalent but validation of the equipment for library preparation is required 176 SOLID 4 System Library Preparation Guide Appendix B SOLID 4 System Library Quantitation with the SOLID Library TaqMan Quantitation Kit Workflow Table 85 Required consumables Item Source MicroAmp Fast Optical 96 well reaction Applied Biosystems plate with barcode 0 1 mL 4346906 MicroAmp Optical Adhesive Film Applied Biosystems 4360954 0 5 mL LoBind Tubes Eppendorf 022431005 1 5 mL LoBind Tubes Eppendorf 022431021 Filtered pipettor tips Major Laboratory Supplier MLS DEPC treated water MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Workflow Dilute the unknown library Prepare a serial dilution of the qPCR standard Program the thermal cycler Perform qPCR Collect the data and analyze the results For
155. gment library Nick translate then amplify the library Nick translate then amplify the library Nick translate then 1 Prepare a PCR reaction mix see Table 10 amplify the library Table 10 PCR reaction mix a mix for nick translation and amplification of the library Component Volume pL Platinum PCR 400 Amplification Mix Q e Library PCR Primer 1 10 g 50 uM N Library PCR Primer 2 10 RU 50 uM amp Adaptor ligated purified 48 to 50 3 DNA Nuclease free Water Variable 3 lt Total 500 2 Pipet 125 uL of the PCR reaction mix into each of four PCR tubes S 3 Run the PCR Table 11 IMPORTANT Minimize the number of cycles to avoid overamplification and production of redundant molecules Determine the number of cycles based on the amount of starting input DNA Table 11 PCR conditions to nick translate and amplify the library Stage Step Temp Time Holding Nick translation 72 C 20 min Holding Denature 95 C 5 min Cycling Denature 95 C 15 sec Cue Opec Anneal 62 C 15 sec Extend 70 C 1 min Holding Extend 70 C 5 min Holding 4 9 co t Starting amount of DNA number of cycles 10 ng to 100 ng 10 cycles 100 ng to 1 ug 6 to 8 cycles 1 ug to 2 ug 4 to 6 cycles 2 ug to 5 ug 2 to 3 cycles 4 Pool all four of the PCR tubes into a new 1 5 mL LoBind tube SOLID 4 System Library Preparation Guide 39 2 Chapter 2 Fragment L
156. he standard for qPCR standard 1 Thaw the SOLiD Library qPCR Standard on ice 2 Dilute 1 uL of the standard in 49 uL of DEPC treated water to a concentration of 100 pM then prepare four sequential 10 fold dilutions from the 100 pM dilution see Table 87 Prepare sufficient volume of each dilution for the number and size of qPCR reactions for example for a 20 uL qPCR reaction volume you will need 5 uL of diluted standard per well or 15 uL per triplicate plus a small overage for pipetting errors Table 87 Example dilutions of standard scale for your qPCR reaction volumes replicates Dilution from Final 5 nM stock Components concentration Standard 1 1 50 1 uL of stock 49 uL of 100 pM DEPC treated water Standard 2 1 500 5 uL of Standard 1 45 uL 10 pM of DEPC treated water Standard 3 1 5 000 5 uL of Standard 2 45 uL 1 pM of DEPC treated water Standard 4 1 50 000 5 uL of Standard 3 45 uL 0 1 pM of DEPC treated water Standard 5 1 500 000 5 uL of Standard 4 45 uL 0 01 pM of DEPC treated water Program the Program your thermal cycler according to the instructions provided with the thermal cycler instrument Enter the quantities for the 5 dilutions of the qPCR Standard from 100 to 0 01 pM The quantity for the unknown will be calculated in pM SOLID 4 System Library Preparation Guide 179 9 V gets E E E F o ep jo E sj E Ez ST I
157. he supernatant 10 Resuspend the beads in 94 uL of 1X Ligase Buffer SOLID 4 System Library Preparation Guide 75 Chapter 3 Mate Paired Library Preparation Ligate P1 and P2 Adaptors to the DNA Ligate P1 and P2 Adaptors to the DNA 76 1 Calculate the amount of P1 and P2 Adaptors needed for the ligation reaction based on the amount of circularized DNA from Isolate the circularized DNA on page 66 and the calculation below For calculation details see Appendix E Formulas and calculations on page 215 10 pg_ t1pmol 1 Xpmollug DNA 1 yug DNA Tig X 660pg Circularized DNA size Y uL adaptor needed ygDNA x DNA x 30 x Le a Example For 1 yg of purified circularized DNA with an average size of 1536 1500 bp insert 36 bp internal adaptor 6 1 d 10 pg i 1 pmol s X pmol ug DNA 1 ug DNA 1 ug 660 pg 1536 1 pmol ug DNA 1 pmol p 1 uL adaptor needed Y uL adaptor needed 1 ug DNA u ug DNA 30 smod pmol 0 6 pL adaptor needed 2 Combine see Table 26 Table 26 Combine for ligation of end repaired DNA to P1 and P2 Adaptors Component Volume pL DNA bead complex 94 P1 Adaptor ds 50 uM Y P2 Adaptor ds 50 uM Y T4 DNA Ligase 5 U uL 5 Total Variable 100 3 Incubate the reaction mixture at room temperature 20 to 25 C on a rotator for 15 minutes 4 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard t
158. he supernatant 5 Resuspend the beads in 500 uL of Bead Wash Buffer and transfer the beads to a new 1 5 mL LoBind tube Vortex the beads for 15 seconds then pulse spin 6 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 7 Resuspend the beads in 500 uL of Bead Wash Buffer Vortex the beads for 15 seconds then pulse spin SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Nick translate the library 8 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 9 Repeat steps 7 and 8 once Nick translate the library U 6 o amp EX E e 1 Combine see Table 27 Table 27 Combine for nick translation Aeq paueg e1eyy seldeyo Component Volume pL Nuclease free Water 83 Nick Translation Buffer 10 dNTP 10 mM 5 DNA Polymerase I 10 U uL 2 Total 100 2 Add the mix for nick translation to the washed beads 3 Incubate the mixture at room temperature 20 to 25 C for 15 minutes 4 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 5 Resuspend the beads in 500 uL of Elution Buffer E1 from the SOLiD Library Column Purification Kit Vortex then pulse spin the beads 6 Place the tube in a magnetic rack for at least 1 min
159. hybridize single stranded oligonucleotides to create double stranded oligonucleotides Materials and Table 90 Required equipment equipment required Item Source 96 well GeneAmp PCR System 9700 thermal cycler Applied Biosystems N8050200 base Applied Biosystems 4314443 block Pipettors Major Laboratory Supplier MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Table 91 Required consumables Item Source 5X T4 DNA Ligase Buffer Invitrogen Corporation 46300 018 SOLiD Buffer Kit 1X Low TE Buffer Applied Biosystems 43897648 Oligonucleotides Major Laboratory Supplier MLS PCR strip tubes MLS Filtered pipettor tips MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance 8 The part number for the complete SOLID Buffer Kit is 4387918 For the SDS of any chemical not distributed by Applied Biosystems contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions Procedure 1 Prepare 125 uM stock of individual oligonucleotides in 1X Low TE Buffer 2 Mix equal volumes of 125 uM oligonucleotide A and B 3 Add 1 part of 5X Ligase Buffer to 4 parts of the oligonucleotide mixture for a final concentration of 50
160. i Figure 15 Collection of the of 250 to 325 bp library band from the SOLiD Library Size Selection gel SOLID 4 System Library Preparation Guide 85 3 Chapter 3 Mate Paired Library Preparation Gel purify the library with a Size Selection gel Optional Purify the NS DNA with the SOLiD Library Micro Column Purification Kit 10 11 12 13 Note If a concentrated sample is not necessary skip this purification step then proceed to Quantitate the library by performing quantitative PCR qPCR on page 87 Pre spin empty PureLink Micro column s in collection tube s at 10 000 x g for 1 minute before use Add 4 volumes of Binding Buffer B2 S with isopropanol 5596 to 1 volume of sample Apply the sample in the binding buffer to the PureLink Micro column s in a collection tube s Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column Repeat steps 3 and 4 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube Add 650 uL of Wash Buffer W1 with ethanol to wash the column s Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at 14 000 x g to remove residual wash buffer Transfer the column s to clean 1 5 mL LoBind tube s Add 20 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the
161. ibrary page 126 Micro Column Purification Kit 1 Pre spin empty PureLink Micro column in collection tube s at 10 000 x g for 1 minute before use uomnejedoug 2 Add4 volumes of Binding Buffer B2 S with isopropanol 5596 to 1 volume of sample 9 D iei 3 gj oo lt a n U D 2 E um ed E S S lt 3 Apply the sample in the binding buffer to the PureLink Micro column s in collection tube s 4 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column 5 Repeat steps 3 and 4 until the entire sample has been loaded onto the column s Place the PureLink Micro column s back into the same collection tube 6 Add 650 uL of Wash Buffer W1 with ethanol to wash the column 7T Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at 14 000 x g to remove residual wash buffer 8 Transfer the column s to clean 1 5 mL LoBind tube s 9 Add 20 uL of Elution Buffer E1 to the center of the column to elute the DNA then let the column stand for 1 minute at room temperature 10 Centrifuge the column s at 14 000 x g for 1 minute 11 Add the eluate from step 10 back to the column s then let the column stand for 1 minute at room temperature 12 Centrifuge the column s at 14 000 x g for 1 minute 13 If necessary pool the eluted DNA STOPPING POINT Store the purified DNA i
162. ibrary Preparation Quantitate the library by performing quantitative PCR qPCR Purify the DNA with the SOLiD Library Column Purification Kit 10 11 12 Add 4 volumes of Binding Buffer B2 L with 40 isopropanol to the sample Apply approximately 700 uL of PCR product in the binding buffer to the column s The maximum yield of DNA can be achieved 1f the amount of DNA loaded to a PureLink column is lt 5 ug Use more columns if necessary Keep for now Let the column s stand for 2 minutes at room temperature Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute and discard the flow through Repeat steps 2 and 4 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s Add 650 uL of Wash Buffer W1 to wash the column s Centrifuge the column s at 210 000 x g 13 000 rpm for 2 minutes then discard the flow through Repeat to remove residual wash buffer Air dry the column s for 2 minutes to evaporate any residual alcohol Transfer the column s to clean 1 5 mL LoBind tube s Add 50 uL of Elution Buffer E1 to the column s to elute the DNA then let the column s stand for 2 minutes Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute Add the eluate from step 10 back to the column s then let the column s stand for 2 minutes Repeat step 10 If necessary pool the eluted DNA STOPPING POINT Store the puri
163. ibrary Preparation Guide 145 Appendix A Required Materials Prepare a standard fragment library Prepare a standard fragment library Table 56 Required Applied Biosystems reagent kits Item part number Components Kit components used in SOLiD Fragment Library SOLiD Library Oligos Kit1 Ligation of adaptors Oligos Kit P1 Adaptor ds 4401151 SOLID Library Oligos Kit 1 P2 Adaptor ds SOLiD Library Oligos Kit1 Library amplification Library PCR Primer 1 SOLiD Library Oligos Kit 1 Library PCR Primer 2 SOLiD Fragment Library SOLID Fragment Library DNA end repair Construction Kit with Size Enzyme Core Kit Selection Gels 4443471 8 FEE Bni Pelisi Buia dNTP 10 mM e End Polishing Enzyme 1 e End Polishing Enzyme 2 e 5X Ligase Buffer Ligation of P1 and P2 T4 DNA Ligase Adaptors Platinum PCR Nick translation library Amplification Mix amplification SOLiD Library Column DNA end repair ligation of Purification Kit P1 and P2 Adaptors and nick translation library amplification SOLID Library Size Size selection Selection Gels 10 gels t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance For the SDS of any chemical not distributed by Applied Biosystems contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer a
164. ific primers with a TaqMan fluorogenic probe labeled with FAM dye and a dye quencher A fluorescent signal is generated by the FAM dye when it detaches from the probe as the DNA polymerase in the SOLiD Library qPCR Mix extends the 3 strand see Figure 26 on page 175 SOLID 4 System Library Preparation Guide Appendix B SOLID 4 System Library Quantitation with the SOLID Library TagMan Quantitation Kit Overview Minar Groove ndor porymerase ram aye Quenchor Probe DNA a Forward vier Figure 26 Generation of the FAM dye signal during 3 extension Platinum Tag DNA Platinum Taq DNA Polymerase included in the qPCR mix is recombinant Zag DNA Polymerase polymerase complexed with proprietary antibodies that block polymerase activity at ambient temperatures Activity is restored after the initial denaturation step in PCR cycling providing an automatic hot start in qPCR for increased sensitivity specificity and yield Uracil DNA Heat labile UDG and dUTP in the qPCR mix prevent the reamplification of carryover Glycosylase UDG products between qPCR reactions dUTP ensures that any amplified DNA will contain uracil while heat labile UDG removes uracil residues from single or double stranded DNA oS c o D o i3 zb eL LU CL Ex Oo W PET Ma O D ep on rx EU Oo 3 d 9a E lt lt The heat labile form of UDG used in this kit is completely inactivated at temperatures o
165. igate P1 and P2 Adaptors to the DNA Ligate P1 and P2 1 Calculate the amount of adaptor needed Y for the reaction based on the amount of Adaptors to the DNA from the last purification step for calculation details see Ligation of P1 DNA and P2 Adaptors on page 216 If DNA fragments were sheared using the standard protocol for fragment library preparation the average insert size should be approximately 165 bp before adaptor ligation E 10 pg 1 pmol 1 o Xpmollug DNA 1ugDNA no 660pg Average insert size B e X pmol 1 uL adaptor needed S Y uL adaptor needed ug DNA x Tg DNA x 30 x 50 pmol Example 3 For 1 ug of purified end repaired DNA with an average insert size of 165 bp XpmolugDNA tyg DNA x PO x pmol y T 99 pmolug DNA 5 9 2 pmol 1 uL adaptor needed 8 Y uL adaptor needed 1yugDNA x Tg DNA x 30 x b pmo 5 5 uL adaptor needed S 2 Combine see Table 9 Table9 Ligation mix Component Volume pL P1 Adaptor ds 50 pmol uL Y P2 Adaptor ds 50 pmol uL Y 5X T4 Ligase Buffer 40 DNA 48 to 50 T4 Ligase 5 U uL 10 Nuclease free Water Variable Total 200 3 Incubate at room temperature for 15 minutes Purify the DNA with 1 Add4 volumes 800 uL of Binding Buffer B2 L with 40 isopropanol to the the SOLiD Library sample Column Purification Kit 2 Apply approximately 700 uL of the ligated DNA in the binding buffer to the column s The max
166. igation Purify the DNA with the SOLiD Library Column Purification Kit Sample purification is recommended with the PureLink columns supplied in the SOLiD Library Column Purification Kit PureLink columns have a 40 ug capacity but it may be necessary to use multiple columns during a purification step for higher yields SOLID 4 System Library Preparation Guide 17 F 5 xe 0 i N TI o Ke 3 D E ler o lt ao 0 ge o EN fe Tips 18 Chapter 2 Fragment Library Preparation Tips Ligate P1 and P2 Adaptors to the DNA P1 and P2 Adaptors are ligated to the ends of the end repaired DNA The P1 and P2 Adaptors are included in double stranded form in the SOLiD Fragment Library Oligos Kit Size select the DNA The ligated purified DNA is run on a SOLiD Library Size Selection gel The correctly sized ligation products 200 to 230 bp are electrophoresed to the collection wells of the Size Selection gel The eluate in each collection well can be transferred directly to the nick translation reaction Nick translate then amplify the library The eluates from the SOLID Library Size Selection gel undergo nick translation and subsequently amplification using Library PCR Primers 1 and 2 and Platinum PCR Amplification Mix After amplification PCR samples are purified with the SOLiD Library Column Purification Kit Quantitate the library by performing quantitati
167. igation of LMP CAP Adaptors 1 0 2 0 0 216 DNA circularization 1 02 e eee ee 217 Ligation of P1 and P2 Adaptors 0 0 0 cece eee eee 218 E 2 x 25 bp mate paired library 2 eee 219 Ligation of EcoP15I CAP Adaptors 00 0 cece eee eee 219 DNA circularization llle 219 Ligation of Pl and P2 Adaptors 00 eee eeee 220 gt ke o D 3 Q x m fe En 3 a D o E ot Q D Q amp E e 5 a SOLID 4 System Library Preparation Guide 215 E Appendix E Formulas and calculations Fragment library Fragment library Ligation of P1 and 10 1 pmol ee P P2 Adaptors Xpmol igDNA 1g DNA Soo Average insert size c X pmol x1 pmol DNA for adaptor ligation ug DNA 1 ug DNA x2 pmol adaptor needed x pmol x 30 Y uL adaptor needed x2pmol ur H P XP 50 pmol 2 x 50 bp mate paired library Ligation of LMP 10 pg 4 pmo 1 CAP Adaptors Xpmol ug DNA 1pg DNA x oo Average insert size x1 pmol DNA for adaptor ligation ug DNA 7 ug DNA x2 pmol adaptor needed x pmol x 100 1 uL Y uL adaptor needed xzpmol 5S pmo 216 SOLID 4 System Library Preparation Guide Appendix E Formulas and calculations 2 x 50 bp mate paired library DNA circularization The formula to determine dilution of ligation reaction and achieve intramolecular ligation Francis S Collins and Sherman M Weissman Directional Cloning of DNA Fragments at a Large
168. imum yield of DNA can be achieved if the amount of DNA loaded to a PureLink column is lt 5 ug Use more columns if necessary SOLID 4 System Library Preparation Guide 37 38 Chapter 2 Fragment Library Preparation Ligate P1 and P2 Adaptors to the DNA 10 11 12 Let the column s stand for 2 minutes at room temperature Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute then discard the flow through Repeat steps 2 and 4 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s Add 650 uL of Wash Buffer W1 to wash the column s Centrifuge the column s at 210 000 x g 13 000 rpm for 2 minutes then discard the flow through Repeat to remove residual wash buffer Air dry the column s for 2 minutes to evaporate any residual alcohol Transfer the column s to clean 1 5 mL LoBind tube s Add 50 uL of Elution Buffer E1 to the column s to elute the DNA then let the column s stand for 2 minutes Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute Add the eluate from step 10 back to the column s then let the column stand for 2 minutes Repeat step 10 If necessary pool the eluted DNA STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Nick translate then amplify the library on page 39 SOLID 4 System Library Preparation Guide Section 2 2 Prepare an express fra
169. in SOLiD Mate Paired Library Bead amp Buffer Kit e Dynabeads MyOne Streptavidin C1 Bead Wash Buffer Bead Binding Buffer Mate paired library capture t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance For the SDS of any chemical not distributed by Applied Biosystems or Invitrogen contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions Invitrogen products can be ordered at www invitrogen com SOLID 4 System Library Preparation Guide 157 gt 9 o o 5 2 x gt D D fe s a m D D 2 158 Appendix A Required Materials Prepare a 2 x 50 bp mate paired library Table 68 Required equipment Product Name Vendor HydroShear DNA Shearing Device from Genomic Solutions9 Applied Biosystems 4392889 115 V Applied Biosystems 4392890 230 V Covaris S2 System Applied Biosystems 4387833 110 V 110 V for U S customers Applied Biosystems 220 V for international customers 4392718 220 V or The system includes Covaris e Covaris S2 sonicator e Latitude laptop from Dell Inc MultiTemp III Thermostatic Circulator e Covaris 2 series Machine Holder for one 1 5 mL microcentrifuge tube e Covaris 2 series Machine Holder for one 0 65 mL microcentrif
170. iod under these sections begins on the earlier of the date of installation or ninety 90 days from the date of shipment for hardware and software installed by Applied Biosystems personnel For all hardware and software installed by the buyer or anyone other than Applied Biosystems and for all other products the applicable warranty period begins the date the product is delivered to the buyer uoneuuoJu Warranty claims Warranty claims must be made within the applicable warranty period or for chemicals or other consumable products within thirty 30 days after receipt by the buyer unless otherwise specified in the documentation accompanying the product gt ke Ke o 5 2 x E 3 7 ct e 3 o 2j S 3 9 3 EI lt Warranty exceptions The above warranties do not apply to defects resulting from misuse neglect or accident including without limitation operation with incompatible solvents or samples in the system operation outside of the environmental or use specifications or not in conformance with the instructions for the instrument system software or accessories improper or inadequate maintenance by the user installation of software or interfacing or use in combination with software or products not supplied or authorized by Applied Biosystems modification or repair of the product not authorized by Applied SOLiID 4 System Library Preparation Guide 241 Appendix H Instrument Warranty Information Wa
171. ion Documentation Changes Applied Biosystems 4449773 Provides a checklist to ensure that all necessary SOLiD 4 Upgrade Checklist preparations are made before upgrading to the SOLiD 4 System and provides a list of orderable consumables Note For additional documentation see How to obtain support on page 10 Send us your comments 256 Applied Biosystems welcomes your comments and suggestions for improving its user documents You can e mail your comments to techpubs appliedbiosystems com D IMPORTANT The e mail address above is for submitting comments and suggestions relating only to documentation To order documents download PDF files or for help with a technical question see How to obtain support on page 10 SOLID 4 System Library Preparation Guide A Applied Biosystems customer feedback on documentation 256 Information Development department 256 B barcoded fragment library preparation 127 biohazardous waste handling 252 bold text when to use 10 C CAUTION description 9 checklists and workflow tracking forms 221 chemical hazard warning 248 chemical safety 248 chemical waste safety 250 conventions bold text 10 for describing menu commands 10 IMPORTANTS 10 inthis guide 10 italic text 10 Notes 10 user attention words 10 Covaris TM S2 System 235 customer feedback on Applied Biosystems documents 256 D DANGER description 9 documentation 255 related 255 documentatio
172. ion studies where tighter size selection of fragments is required perform an additional size selection see Size select the DNA on page 104 After size selection and purification proceed to Methylate the genomic DNA EcoP151 sites If tight insert size distribution is not critical proceed directly toMethylate the genomic DNA EcoP151l sites uonejedojg 9 D iei 3 2 oo lt m R U D 2 Ei um ed 2 S 2 lt STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Methylate the genomic DNA EcoP151 sites Methylate the genomic DNA EcoP15l sites Methylate the 1 Combine and mix the following components where X indicates the number of genomic DNA micrograms of end repaired DNA Use a final concentration of at least 360 uM EcoP15l sites S adenosylmethionine and 10 U of EcoP15I enzyme per 1 ug of end repaired DNA see Table 35 Table 35 Combine components for methylation of DNA Component Amount Sheared end repaired DNA X ug 10X NEBuffer 3 X ul 100x BSA X 10 uL EcoP15l 10 U uL X uL S adenosylmethionine 32 mM X x 3 25 uL Nuclease free Water Variable Total X x 10 uL Example For 12 5 ug of sheared end repaired DNA SOLID 4 System Library Preparation Guide 99 3 Chapter 3 Mate Paired Library Preparation Methylate the genomic DNA EcoP15l sites Combine components for methylation of DNA
173. iosystems thermal cycler N8050200 Base Applied Biosystems 4314443 Block NanoDrop ND 1000 Spectrophotometer Thermo Scientific computer required ND 1000 E Gel iBase and E Gel Safe Imager Invitrogen Combo Kit G6465 Vortexer Major Laboratory Supplier MLS SOLID 4 System Library Preparation Guide Appendix A Required Materials Prepare a standard fragment library Table 58 Required equipment Item Source Picofuge MLS Pipettors 2 uL MLS Pipettors 20 uL MLS Pipettors 200 uL MLS Pipettors 1000 uL MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Or equivalent but validation of the equipment for library preparation is required Table 59 Optional equipment Item Source 2100 Bioanalyzer Agilent Technologies G2938C Qubit Quantitation Starter Kit Invitrogen Q32860 t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance Table 60 Required consumables Item Source 1X Low TE Buffer Applied Biosystems zi 4389764 s Nuclease free Water 1 L Applied Biosystems P AM9932 E Covaris microTUBEs Covaris amp 520045 3 Isopropyl alcohol Sigma Aldrich D 19516 i Ethylene glycol American Bioanalytical AB00455 01000 50 bp ladder Invitrogen 10416 014 0 5 mL LoBin
174. ized DNA with EcoP15l Component Volume pL EcoP15l digested DNA 100 10 mM Sinefungin 1 10x ATP 2 EcoP15l 10 U uL 1 Total 104 5 Incubate the reaction mixture at 37 C for 1 hour 6 Denature the enzyme at 65 C for 20 minutes and chill on ice for 5 minutes 112 SOLID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 End repair with Klenow End repair with Klenow 1 Combine see Table 42 e 5 uc 9 Table 42 Combine to end repair EcoP15l digested DNA 3 O g Component Volume pL 5 p U EcoP15l digested DNA 104 S dNTP 10 mM 4 E Klenow Fragment 1 S Total 109 b 2 Incubate the reaction mixture at room temperature 20 to 25 C for 15 minutes 3 Add 2 2 uL of Stop Buffer 4 Denature the enzyme at 65 C for 20 minutes then chill on ice for 5 minutes 5 Add Nuclease free Water 90 uL to the stopped end repair reaction to reach a final volume of 200 uL 6 Put the tube of DNA on ice until you incubate the DNA with the pre washed streptavidin beads see Prewash the beads on page 114 SOLID 4 System Library Preparation Guide 113 3 Chapter 3 Mate Paired Library Preparation Bind the library molecules to streptavidin beads Bind the library molecules to streptavidin beads Prewash the beads Bind the library DNA molecules to the beads 114 1 Combine see Table 43 Table 43 P
175. klists and workflow tracking forms Workflow tracking prepare a barcoded fragment library Workflow tracking prepare a barcoded fragment library 234 Sample Step Starting Amount Quantitation Quantity of DNA Barcode Step Lot number Multiplex Library P1 Adaptor End Repair Multiplex Library PCR 1 Quantitative PCR Sample Multiplex Library PCR 2 Barcode 0XX Barcode Step Starting Amount End Repair Quantitation Quantity of DNA Lot number Step Lot number Multiplex Library P1 Adaptor Multiplex Library PCR 1 Quantitative PCR Multiplex Library PCR 2 Sample Barcode 0XX Barcode Step Starting Amount End Repair Quantitative PCR Quantitation Quantity of DNA Lot number Barcode 0XX Sample Quantitation Lot number Barcode Step Quantity of DNA Step Lot number Starting Amount End Repair Quantitative PCR Sample Step Quantitation Quantity of DNA Multiplex Library P1 Adaptor Multiplex Library PCR 1 Multiplex Library PCR 2 Barcode OXX Step Barcode Lot Number Lot number Starting Amount Multiplex Library P1 Adaptor End Repair Quantitative PCR Multiplex Library PCR 1 Multiplex Library PCR 2 Barcode 0XX SOLID 4 System Library Preparation Guide Appendix G Covaris S2 System This appendix covers M Operation Do
176. le It is not necessary to run the wash cycle if both tubes contain the same DNA Run the wash scheme after DNA shearing is complete Pool the aliquots of sheared DNA if applicable SOLID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Shear the DNA Purify the DNA with 1 Add 4 volumes of Binding Buffer B2 S with isopropanol 55 to 1 volume of the SOLID Library sample Mix well Column Purification Kt 5 Apply about 700 uL of the sample in the binding buffer to the PureLink column s in collection tube s 3 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through uolyeredaid 4 Repeat steps 2 and 3 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s 9 D iei 3 gj oo lt a n U g 2 ki um ed E S a lt 5 Add 650 uL of Wash Buffer W1 with ethanol to wash the column s 6 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at maximum speed to remove residual wash buffer 7 Transfer the column s to clean 1 5 mL LoBind tube s 8 Add 50 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature 9 Centrifuge the column s at maximum speed for 1 minute 10 Add the eluate from step 9 back to the column s
177. lization on Applied Biosystems instruments ROX dye is composed of a glycine conjugate of 5 carboxy X rhodamine succinimidyl ester and is supplied at a concentration of 25 uM Determine the amount of 25 uM ROX to use with a particular instrument see Table 86 Table 86 Amount of 25 uL ROX to use according to instrument ROX amount per Final ROX iitmument 20 uL reaction concentration AB 7300 7900HT StepOne 0 4 uL 500 nM StepOnePlus and ABI PRISM 7000 and 7700 Instruments AB 7500 0 04 uL 50 nM SOLID 4 System Library Preparation Guide Appendix B SOLID 4 System Library Quantitation with the SOLID Library TagMan9 Quantitation Kit The qPCR protocol The qPCR protocol Dilute the unknown 1 Dilute aliquots of your unknown library to a target concentration of 50 pg uL in library DEPC treated water in LoBind Tubes on ice The concentration may be determined by a method other than qPCR such as a NanoDrop spectrophotometer Prepare enough diluted sample for both qPCR quantification and subsequent ePCR reactions These aliquots may be stored at 20 C 2 Prior to qPCR further dilute the diluted library 1 1000 in DEPC treated water in a LoBind tube on ice to target a range within the standard curve For a standard 20 uL qPCR reaction you will need 5 uL of diluted unknown per well Prepare a serial The SOLiD Library qPCR Standard is supplied in a volume of 10 uL at 5 nM To dilution of qPCR prepare t
178. mber or other information that appears in the SDS of interest Select the language of your choice then click Search 3 Find the document of interest right click the document title then select any of the following Open To view the document Print Target To print the document Save Target As To download a PDF version of the document to a destination that you choose Note For the SDSs of chemicals not distributed by Applied Biosystems contact the chemical manufacturer SOLID 4 System Library Preparation Guide 249 Appendix Safety Chemical safety Chemical waste safety Chemical waste CAUTION HAZARDOUS WASTE Refer to Safety Data Sheets and local hazards regulations for handling and disposal WARNING CHEMICAL WASTE HAZARD Wastes produced by Applied Biosystems instruments are potentially hazardous and can cause injury ilIness or death WARNING CHEMICAL STORAGE HAZARD Never collect or store waste in a glass container because of the risk of breaking or shattering Reagent and waste bottles can crack and leak Each waste bottle should be secured in a low density polyethylene safety container with the cover fastened and the handles locked in the upright position Wear appropriate eyewear clothing and gloves when handling reagent and waste bottles Chemical waste To minimize the hazards of chemical waste safety guidelines y9 Read and understand the Safety Data Sheets SDSs pr
179. meter Vortexer Picofuge 1 5 mL LoBind tubes Pipettors Filtered pipettor tips Microcentrifuge Vortexer Picofuge 1 5 mL LoBind tubes Pipettors Filtered pipettor tips Thermal cycler Microcentrifuge Vortexer Picofuge 1 5 mL LoBind tubes Pipettors PCR strip tubes Filtered pipettor tips O uuu 000000 5x End Polishing Buffer dNTP Mix End Polishing Enzyme 1 End Polishing Enzyme 2 Nuclease free Water SOLiD Library Column Purification Kit P1 Adaptor ds 50 uM P2 Adaptor ds 50 uM 5x T4 Ligase Buffer T4 Ligase Nuclease free Water SOLiD Library Column Purification Kit Library PCR Primer 1 Library PCR Primer 2 Platinum amp PCR Amplification Mix SOLiD Library Column Purification Kit Thaw 5x End Polishing Buffer and dNTP Mix on ice O Thaw P1 and P2 Adaptors on ice O Thaw 5x T4 Ligase Buffer on ice O Thaw Library PCR Primers 1 and 2 on ice Thaw Platinum PCR Amplification Mix on ice Quantitate O O O O O O O O O O O O O O O O O O O O O O O O O O O O O Real time PCR system SOLID 4 System Library Preparation Guide SOLiD Library TaqMan Quantitation Kit 223 gt Ke Ke v S 2 x T o 59 Zz oO s a x g a 5 a s E A s F Appendix F Checklists and workflow tracking forms Workflow tracking prepare standard and express fragment libraries Workflow tracking prepare standard and express fr
180. minute before use Micro Column Purification Kit 2 Add 4 volumes of Binding Buffer B2 L with isopropanol 40 to 1 volume of sample 3 Apply 750 uL of the PCR product in the binding buffer to the PureLink Micro column in a collection tube U0 0 ge o lt e E 4 Centrifuge the column at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column Aeq peureq eie N Je1deuo 5 Repeat steps 3 and 4 until the entire sample has been loaded onto the column Place the PureLink Micro column s back into the same collection tube 6 Add 650 uL of Wash Buffer W1 with ethanol to wash the column 7T Centrifuge the column at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at 14 000 x g to remove residual wash buffer 8 Transfer the column to a clean 1 5 mL LoBind tube 9 Add 25 uL of Elution Buffer E1 to the center of the column to elute the DNA then let the column stand for 1 minute at room temperature 10 Centrifuge the column at 14 000 x g for 1 minute 11 Add the eluate from step 10 back to the column then let the column stand for 1 minute at room temperature 20 to 25 C 12 Centrifuge the column at 14 000 x g for 1 minute STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Gel purify the library with a Size Selection gel on page 122 SOLID 4 System Library Preparation Guide 121 Chapter
181. mn s back into the same collection tube s 6 Add 650 uL of Wash Buffer W1 to wash the column s 7 Centrifuge the column s at 210 000 x g 13 000 rpm for 2 minutes then discard the flow through Repeat to remove residual wash buffer 8 Air dry the column s for 2 minutes to evaporate any residual alcohol Transfer the column s to clean 1 5 mL LoBind tube s 9 Add 50 uL of Elution Buffer E1 to the column s to elute the DNA then let the column s stand for 2 minutes 10 Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute 11 Add the eluate from step 10 back to the column s then let the column s stand for 2 minutes Repeat step 10 SOLID 4 System Library Preparation Guide 35 2 Chapter 2 Fragment Library Preparation End repair the DNA 12 If necessary pool the eluted DNA 13 Ifthe starting DNA input amount is 2500 ng quantitate the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer see Appendix C Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer on page 189 If the starting DNA input amount is lt 500 ng assume 70 recovery of input material after shearing STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Ligate P1 and P2 Adaptors to the DNA on page 37 36 SOLID 4 System Library Preparation Guide Section 2 2 Prepare an express fragment library Ligate P1 and P2 Adaptors to the DNA L
182. more columns if necessary 6 Centrifuge the column s at gt 12 000 x g for 1 minute then discard the flow through and place the column back on the Wash Tube s 7 Add 700 uL of Wash Buffer W1 with ethanol to the Quick Gel Extraction column s 8 Centrifuge the column s at gt 12 000 x g for 1 minute then discard the flow through 9 Centrifuge the Quick Gel Extraction column s again at maximum speed for 2 minutes to remove any residual Wash Buffer 10 Transfer the Quick Gel Extraction column s to clean 1 5 mL LoBind tube s SOLID 4 System Library Preparation Guide 105 106 Chapter 3 Mate Paired Library Preparation Size select the DNA 11 12 13 14 15 16 Add 50 uL of Elution Buffer E1 from the SOLID Library Column Purification Kit not Buffer E5 from the SOLID Library Quick Gel Extraction Kit to the center of the column s to elute the DNA then let the column s stand for 5 minutes at room temperature Centrifuge the column s at gt 12 000 x g for 1 minute The 1 5 mL LoBind tube s contain the purified DNA IMPORTANT For large fragments increasing the incubation time to 10 minutes will increase the yield Add the eluate from step 12 back to the Quick Gel Extraction column s then let the column s stand for 1 minute at room temperature Centrifuge the column s at gt 12 000 x g for 1 minute If necessary pool the eluted DNA into one 1 5 mL LoBind tube Quantitat
183. mpty wells in the top row Load 25 uL of Nuclease free Water into wells 1 to 8 in the middle of the gel and 10 uL of Nuclease free Water in the middle marker well of the bottom row see Figure 18 on page 123 SOLID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Gel purify the library with a Size Selection gel Nuclease Nuclease Nuclease Nuclease free free free free Water DNA Water Ladder water DNA Water U 0 xe e EN e E 25 uL 10 uL 25 uL Nuclease Nuclease Nuclease free free free Water Water Water Aeq paueg ereyy seldeyo Figure 18 Where to load DNA ladder and Nuclease free Water on a SOLiD Library Size Selection gel to size select the DNA Run the SOLiD 1 Place the E Gel iBase Power System over a Safe Imager Real Time Sel yip Ai Transilluminator Use the orange cover or orange goggles to view the bands and to ollect the librar i f to the blue light collect the library avoid overexposure of your eyes to the blue lig fragment 2 Run the gel On the iBase system a Select SizeSelect 2 refer to the iBase Power System manual for instructions b Press Go The red light turns green 3 Monitor the gel At the end ofa run the iBase system flashes a red light and beeps rapidly Ifthe 155 bp band has not reached the reference line run the gel for about 1 to 2 more minutes until the band reaches the line When the band of interest
184. n related 255 F formulas and calculations 215 Fragment Library Preparation express 31 standard 16 fragment library preparation 13 G glossary 253 guidelines SOLID 4 System Library Preparation Guide Index chemical safety 248 chemical waste disposal 250 chemical waste safety 250 H hazard warning chemical 248 hazards See safety hybridization of oligonucleotides 187 IMPORTANT description 9 Information Development department contacting 256 instrument operation safety 246 instrument warranty information for the Covaris TM S2 System 239 isopropanol precipitation 198 italic text when to use 10 L Library preparation fragment 13 M mate paired library preparation 41 2x25 bp 88 2x50 bp 47 menu commands conventions for describing 10 methylation of DNA fragments 200 MSDS See SDS N NanoDrop ND 1000 Spectrophotometer 189 O oligonucleotide sequences 205 P PAGE gel DNA elution 196 phenol chloroform isoamyl alcohol extraction 193 phenol chloroform isoamyl alcohol extraction with MaxXtract 194 physical hazard safety 247 257 Index Preface 9 pressurized fluids safety 247 Q Quick Ligase 22 R radioactive waste handling 251 required materials 145 S safety 245 before operating the instrument 246 biological hazards 252 chemical 248 chemical waste 250 guidelines 248 250 instrument operation 246 physical hazard 247 pressurized fluids See also compressed gases
185. n Elution Buffer E1 at 4 C for short term storage or at 20 C for long term storage Or proceed to Quantitate the library by performing quantitative PCR qPCR on page 126 SOLID 4 System Library Preparation Guide 125 3 Chapter 3 Mate Paired Library Preparation Quantitate the library by performing quantitative PCR qPCR Quantitate the library by performing quantitative PCR qPCR For accurate library quantitation quantitative PCR is strongly recommended For a protocol using the SOLiD Library TaqMan Quantitation Kit PN 4449639 see Appendix B SOLiD 4 System Library Quantitation with the SOLiD Library TaqMan Quantitation Kit on page 173 STOPPING POINT Store the purified DNA in Elution Buffer E1 at 20 C or proceed to emulsion PCR in the Applied Biosystems SOLiD 4 System Templated Bead Preparation Guide PN 4448378 or the Applied Biosystems SOLiD EZ Bead Emulsifier Getting Started Guide PN 4441486 126 SOLID 4 System Library Preparation Guide Chapter 4 4 Barcoded Fragment Library Preparation This chapter covers B OVeLVieW is esu eer Ro A TRE ROO E E E BUR EEE RR eoi AOT oe 128 E Prepare a barcoded fragment library 0 00 0 eee 131 BW Materials and equipment required slsleseeseees eee eee 131 s ves LETT 132 E LL MN 134 is IB iro Nas os ca scenes ah roe ero ME pns EE E End repair the DNA i esse e eene 36 EE E Ligate Multiplex P1 and M
186. n Mix After amplification the PCR samples are purified with the SOLiD Library Column Purification Kit Before column purification of the nick translated libraries you can pool equivalent amounts of barcoded libraries of similar size or you can purify each barcoded library separately RU o 2 K e ES Aeq yuswbes4 pepooueg p Je1deuo Quantitate the library by performing quantitative PCR qPCR Quantitate the library by using the SOLiD Library TaqMan Quantitation Kit PN 4449639 described in Appendix B SOLiD 4 System Library Quantitation with the SOLiD Library TaqMan Quantitation Kit on page 173 Pool the barcoded libraries Note If libraries are not of similar size but will be gel purified then gel purify the libraries first before pooling the libraries see Gel purify the libraries on page 142 Equal molar amounts of each barcoded library are mixed together This sample of combined barcoded libraries can be processed together through templated bead preparation refer to the Applied Biosystems SOLiD 4 System Templated Bead Preparation Guide PN 4448378 or the Applied Biosystems SOLiD EZ Bead Emulsifier Getting Started Guide PN 4441486 If you want to perform fewer steps and accurate quantitation of each barcoded library is not critical then you can pool barcoded libraries at an earlier step just prior to nick translation and amplification Gel purify the libraries The library is
187. n reaction by mixing the following components listed with the Internal in order based on the desired insert size where X is the number of micrograms Adaptor of DNA to be circularized see Table 17 If a larger reaction volume is required scale up the T4 DNA Ligase and 5X Ligase Buffer Add 1 uL of T4 DNA Ligase per 40 uL of reaction volume Add 1 uL of 5X Ligase Buffer per 5 uL of reaction volume Table 17 Mix for DNA circularization by insert size 600 to 800 to Components 800 bp 1000 bp 1 to 2 kb 2 to 3 kb 3 to 4 kb 4 to 5 kb 5 to 6 kb Nuclease Variable Variable Variable Variable Variable Variable Variable free Water DNA X ug X ug X ug X ug X ug X ug X ug 5X Ligase X x 47 uL X x 54 uL X x 73 uL X x 100 uL X x 112 uL X x 125 uL X x 144 uL Buffer Internal X x 3 75 uL Xx2 84 pL X x 1 5 uL X x 0 9 uL X x 0 65 uL Xx0 5 uL X x 0 4 uL Adaptor ds 2 uM T4 DNA X x 6 uL Xx6 75 pgL Xx9 UL X x 12 5 uL Xx14 uL X x 15 6 uL Xx 18 uL Ligase 5 U uL Total X x 235 uL X x 270 uL X x 365 uL X x 500 uL X x 560 uL X x 625 uL X x 720 uL Example For 2 ug of DNA in 1 to 2 kb size range to be circularized Mix for DNA circularization by insert size Components Amount Nuclease free Variable Water DNA 2 ug 5X Ligase 146 uL Buffer Internal 3 uL Adaptor ds 2 uM T4 DNA 18 uL Ligase 5 U uL Total 730 uL 2 I
188. n water chiller with 2096 8 O 1 5 mL LoBind tubes Purification Kit ethylene glycol os O Pipettors O Filtered pipettor tips O HydroShear amp DNA Shearing Nuclease free Water eg Device 0 2 N HCI Q d O Microcentrifuge 0 2 N NaOH 2 4 oO NanoDrop8 ND 1000 1 5 mL LoBind tubes T3004 Spectrophotometer SOLID Library Column 3 S310 Pipettors Purification Kit IO O Filtered pipettor tips O Microcentrifuge O 5x End Polishing Buffer End repair reagents on ice 2 O NanoDrop ND 1000 O dNTP 10 mM t Spectrophotometer O End Polishing Enzyme 1 as O Vortexer O End Polishing Enzyme 2 La O Picofuge O Nuclease free Water ke O 1 5 mL LoBind tubes O SOLID Library Column O Pipettors Purification Kit O Filtered pipettor tips a g O Microcentrifuge O LMP CAP Adaptor ds 50 uM O Thaw LMP CAP Adaptor on os O Vortexer O 5x Ligase Buffer ice A a 6 O Picofuge O T4 DNA Ligase m Thaw ligation reagents on tO B 2 O 1 5 mL LoBind tubes O Nuclease free Water ice 2 27 O Pipettors O SOLID Library Column O Filtered pipettor tips Purification Kit O Gelbox and power supply for O 1x TAE buffer O Prepare 1x TAE buffer agarose gel O Agarose O Prepare a 0 8 or 1 0 O Safe Imager Blue Light O BlueJuice Gel Loading Buffer agarose gel Transilluminator O 1 Kb Plus DNA Ladder g O Gel imaging system O SYBR Safe gel stain a O Microcentrifuge L1 Nuclease free Water 2 O Vortexer O SOLiD Library Quick Gel z O Picofuge Extraction Kit O Pip
189. ncubate the reaction at room temperature 20 to 25 C for 30 minutes 64 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Circularize the DNA Purify the DNA with D IMPORTANT If gt 6 ug DNA was used in the circularization reaction use a the SOLID Library SOLiD Library Column Purification Kit then follow the steps in Purify the Micro Column DNA with the SOLiD Library Column Purification Kit on page 60 Make Purification Kit these changes to the procedure Use 1 column per 5 mL of sample in Binding Buffer B2 L with isopropanol 40 Load lt 800 uL sample in Binding Buffer each time onto the column s Spin the column s for 15 seconds at 10 000 x g except for the last loading After the last loading spin the column s for 1 minute e Use 40 uL of Elution Buffer E1 to elute DNA from the column s Unless specified otherwise use the SOLiD Library Micro Column Purification Kit for all other steps after circularization uolyeredaid 9 D iei 2 oo lt a R U 2 2 Ei um ed E S S lt 1 Pre spin empty PureLink Micro columns in collection tubes at 10 000 x g for 1 minute before use 2 Add4 volumes of Binding Buffer B2 L with isopropanol 4096 to 1 volume of sample Mix well Use one PureLink Micro column per 4 to 5 mL of sample in Binding Buffer B2 L 3 Apply X800 uL of sample in the binding buffer to the Pur
190. nd observe all relevant precautions 146 SOLID 4 System Library Preparation Guide Appendix A Required Materials Prepare a standard fragment library Table 57 Optional Applied Biosystems reagent kits Item part number Components Kit components used in SOLiD Fragment Library Construction Kit 4443473 SOLiD Fragment Library Enzyme Core Kit e 5X End Polishing Buffer e dNTP 10 mM e End Polishing Enzyme 1 e End Polishing Enzyme 2 DNA end repair e 5X Ligase Buffer e T4 DNA Ligase Ligation of P1 and P2 Adaptors Platinum PCR Amplification Mix Nick translation library amplification SOLiD Library Column Purification Kit DNA end repair ligation of P1 and P2 Adaptors and nick translation library amplification SOLiD Fragment Library Construction Kit Reagents 4443713 SOLiD Fragment Library Enzyme Core Kit e 5X End Polishing Buffer e dNTP 10 mM e End Polishing Enzyme 1 e End Polishing Enzyme 2 DNA end repair e 5X Ligase Buffer e T4 DNA Ligase Ligation of P1 and P2 Adaptors Platinum PCR Amplification Mix Nick translation library amplification Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance For the SDS of any chemical not distributed by Applied Biosystems contact the chemical manufacturer Before handling any chemicals refer to the
191. ng and mixing see Table 23 Table 23 Stop end repair mix Component Volume pL End repaired DNA 100 0 5 M EDTA 5 Bead Binding Buffer 200 Nuclease free Water 95 Total 400 SOLID 4 System Library Preparation Guide 73 3 Chapter 3 Mate Paired Library Preparation Bind the library molecules to streptavidin beads Bind the library molecules to streptavidin beads Prewash the beads 1 Bind the library 1 DNA molecules to the beads 74 Combine see Table 24 Table 24 Prepare 1x BSA solution Component Volume pL 100x BSA 5 Nuclease free Water 495 Total 500 Vortex the tube of Dynabeads MyOne Streptavidin C1 then transfer 90 uL of the beads into a 1 5 mL LoBind Tube Add 500 uL of Bead Wash Buffer to the 90 uL of solution of beads vortex the beads for 15 seconds then pulse spin Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant Add 500 uL of 1X BSA and vortex for 15 seconds then pulse spin the tube Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant Add 500 uL of Bead Binding Buffer Vortex the beads for 15 seconds then pulse spin Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant Add the entire 400 uL of solution of library DNA in Bead Binding Buffer see Ta
192. not distributed by Applied Biosystems contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions SOLID 4 System Library Preparation Guide Appendix A Required Materials Prepare a barcoded fragment library Table 78 Optional Applied Biosystems reagent kits Item part number Components Kit components used in SOLiD Fragment Library Construction Kit 4443473 SOLiD Fragment Library Enzyme Core Kit e 5X End Polishing Buffer e dNTP 10 mM e End Polishing Enzyme 1 e End Polishing Enzyme 2 DNA end repair e 5X Ligase Buffer e T4 DNA Ligase Ligation of P1 and P2 Adaptors Platinum PCR Amplification Mix Nick translation library amplification SOLiD Library Column Purification Kit DNA end repair ligation of P1 and P2 Adaptors and nick translation library amplification SOLiD Fragment Library Construction Kit Reagents 4443713 SOLiD Fragment Library Enzyme Core Kit e 5X End Polishing Buffer e dNTP 10 mM e End Polishing Enzyme 1 e End Polishing Enzyme 2 DNA end repair e 5X Ligase Buffer e T4 DNA Ligase Ligation of P1 and P2 Adaptors Platinum PCR Amplification Mix Nick translation library amplification Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance
193. nt Volume pL SOLiD Library qPCR Mix 10 Ac0001001 5 al TaqMan Assay 20X 1 mix ROX Reference Dye 25 uM 0 4 uL 0 04 uL DEPC treated water to 15 pL final volume t SeeTable 86 on page 178 for the amount concentration of ROX to use for your specific instrument 2 Fora 20 uL reaction pipet 15 uL of the master mix into each well of the PCR plate 3 Add 5 uL of diluted standard or unknown library to each appropriate well Add 5 uL of sterile water to the no template control NTC 4 Sealthe plate Make sure that all components are at the bottom of the well Centrifuge the plate briefly 1f needed 5 Place reactions in a real time instrument programmed as described previously Collect data and analyze results 180 SOLID 4 System Library Preparation Guide Appendix B SOLID 4 System Library Quantitation with the SOLID Library TaqMan Quantitation Kit Example data Example data Amplification plot Below are an amplification plot and standard curve generated using the reagents and standard curve supplied in this kit Dilutions of the SOLiD Library qPCR Standard and multiple SOLiD libraries were prepared in triplicate and the reactions were run on the Applied Biosystems StepOnePlus Real Time PCR System Amplification plot Amplification Plot 10 ARn 0 1 0 01 os c o 95 25 gt gi me cm Ex Oo Ww PET Ee E eni U AR ep lon rx EU Oo 3 d 9a E lt lt
194. nt library 0 cee eee Prepare an express fragment library 0 2 0 eee Prepare a 2 x 50 bp mate paired library 000 cee eee Prepare a 2 x 25 bp mate paired library 000 cee eee Prepare a barcoded fragment library llli SOLiD 4 System Library Quantitation with the SOLiD Library TaqMan Quantitation Kit 2 0 0 eee eee OVEIVIEW Sas ise es A cee Nin Gee aaa ae ew Re eae he ae eR M na eae Materials and equipment required lille WorkTlOW LEM Dc beige a E aE ds gab ns ect Aegean tics E kandi oes woh cet ee UI The qgPGR protocol sais pan bade nas ee ena EEG of bd oo x eite ug is Example data 2s edu ve M eet eae Ace quere eal ee heu qus Determine the optimal library concentration for ePCR 00 eee eee Troubleshooting nee eX ES E ered Eee WiCQCEXGG T REPE xo Supplemental Procedures 0000 c cece eee eee ees Load and unload Covaris microTUBE vials from the Covaris microTUBE holder Hybridize oligonucleotides eo irai noer eaae ne a tees Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer Phenol chloroform isoamyl alcohol extraction llle Phenol chloroform isoamyl alcohol extraction with MaXtract lssuss PAGE gel DNA elution xi assas arrra iana EAn i teens Isopropanol precipitation terased aritna ERRORES ES ERG UE A E E A e eee Be Confirm complete methylation of DNA fragments
195. ntrifuge tube e Covaris 2 series Machine Holder for one 13 mm x 65 mm tube e Covaris 2 Series Machine Holder for one microTUBE e Covaris microTUBE Prep Station e Covaris Water Tank Label Kit e Covaris microTUBEs 1 pack of 25 For system materials summary refer to Covaris S2 System Materials Summary SOLiD 4 System Site Preparation Guide PN 4448639 Applied Biosystems 4387833 110 V Applied Biosystems 4392718 220 V or Covaris Microcentrifuge 5417R refrigerated without rotor e Eppendorf 022621807 120 V 60 Hz e Eppendorf 022621840 230 V 50 Hz FA 45 24 11 fixed angle rotor 24 x 1 5 2 mL including aluminum lid aerosol tight Eppendorf 022636006 96 well GeneAmp PCR System 9700 Applied Biosystems thermal cycler N8050200 Base Applied Biosystems 4314443 Block NanoDrop ND 1000 Spectrophotometer Thermo Scientific computer required ND 1000 E Gel iBase and E Gel Safe Imager Invitrogen Combo Kit 6465 Vortexer Major Laboratory Supplier MLS SOLID 4 System Library Preparation Guide Appendix A Required Materials Prepare an express fragment library Table 64 Required equipment Item Source Picofuge MLS Pipettors 2 uL MLS Pipettors 20 uL MLS Pipettors 200 uL MLS Pipettors 1000 uL MLS t Applied Biosystems has validated this protocol using this specific material Substitution
196. nutes SOLiID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Isolate the circularized DNA Purify the DNA with 1 Pre spin empty PureLink Micro columns in collection tubes at 10 000 x g for the SOLiD Library 1 minute before use Micro Column Purification Kit Add 4 volumes of Binding Buffer B2 S with isopropanol 55 to 1 volume of sample Mix well 3 Apply the sample in the binding buffer to the PureLink Micro column s in collection tube s 0 0 ge o E e E 4 Letthe column s stand for 1 minute at room temperature Aeq peureq eie N 4e1deuo 5 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column 6 Add 500 uL of additional Binding Buffer B2 S with isopropanol 5596 to wash the column s 7T Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column 8 Add 650 uL of Wash Buffer W1 with ethanol to wash the column s 9 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at 14 000 x g to remove residual wash buffer 10 Transfer the column s to clean 1 5 mL LoBind tube s 11 Add 25 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature 12 Centrifuge the column s at 14 000 x g fo
197. of DNA ss Step Lot number Starting Amount Shearing the DNA End Repair P2 Adaptor Size Selection Library PCR Primer 1 Plasmid Salem DNase Library PCR Primer 2 Treatment Quantitative PCR Library PCR Master Mix Sample Quantitation Lot number Step Lot number SOLiD Library Oligos Kit 1 P1 Adaptor P2 Adaptor Library PCR Primer 1 Plasmid Safe DNase Treatment Library PCR Primer 2 Quantitative PCR SOLiD Library Oligos Kit 2 LMP CAP Adaptor Internal Adaptor Library PCR Master Mix SOLID 4 System Library Preparation Guide Workflow checklists prepare a 2 x 25 bp mate paired library Shear the DNA with Covaris S2 System q D a SE o oo 220225 2300 gs gt Z To End repair the DNA Methylate the genomic EcoP15l sites 2 99 oo o pr iod 62952 DPIBEG Ad Go go qE Size select the DNA OO 00000 0000 O0 0 00000000000 00000000 0000 OOF uius 0000 Equipment Covaris S2 System Covaris Tubes and Caps Microcentrifuge NanoDrop ND 1000 Spectrophotometer 1 5 mL LoBind tubes Pipettors Filtered pipettor tips HydroShear DNA Shearing Device Microcentrifuge NanoDrop ND 1000 Spectrophotometer Pipettors Filtered pipettor tips Microcentrifuge NanoDrop ND 1000 Spectrophotometer Vortexer Picofuge 1 5 mL LoBind tubes Pipettors Filtered pipettor tips Incubator 37 C Microcentrifuge NanoDrop ND 1000 Spectrophotomete
198. of Elution Buffer E1 to elute DNA from the column s Unless specified otherwise use the SOLiD Library Micro Column Purification Kit for all other steps after circularization Pre spin empty PureLink Micro columns in collection tubes at 10 000 x g for 1 minute before use Add 4 volumes of Binding Buffer B2 L with isopropanol 40 to 1 volume of sample Mix well Apply the sample in the binding buffer to the PureLink Micro column s in collection tube s Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column Repeat steps 3 and 4 until the entire sample has been loaded onto the column s Place the PureLink Micro column s back into the same collection tube s Add 650 uL of Wash Buffer W1 with ethanol to wash the column s Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at 14 000 x g to remove residual wash buffer Transfer the column s to clean 1 5 mL LoBind tube s Add 25 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature Centrifuge the column s at 14 000 x g for 1 minute Add the eluate from step 10 back to the column s then let the column s stand for 1 minute at room temperature SOLiID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Circularize the D
199. ols Applied Biosystems recommends the Eppendorf 5417R tabletop microcentrifuge Perform all steps requiring 0 5 mL 1 5 mL and 2 mL tubes with Eppendorf LoBind Tubes Thaw reagents on ice before use Shear the DNA Prepare for D IMPORTANT For accuracy determine sample DNA concentration using a shearing double stranded DNA specific fluorescence assay Assays recommended are the Invitrogen Quant iT PicoGreen dsDNA Assay Kit Invitrogen P7589 the Invitrogen Quant iT dsDNA HS Assay Kit Invitrogen Q32851 or Q32854 or the Invitrogen Quant iT dsDNA BR Assay Kit Invitrogen Q32850 or Q32853 1 Choose the appropriate shearing method based on the desired insert size of the mate paired library see Table 32 on page 95 hM Note These conditions are guidelines A shearing trial prior to large scale o shearing is recommended if additional DNA is available 94 SOLID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Shear the DNA Table 32 Recommended shearing conditions for mate paired library insert sizes Insert size Shearing method Shearing conditions 600 to Covaris shearing in 20 glycerol Number of Cycles 75 BUDE 13 mm x 65 mm borosilicate tube Bath Temperature 5 C e Bath Temperature Limit 12 C Mode Frequency sweeping Water Quality Testing Function Off Duty cycle 2 e Intensity 7 e Cycles burst 200 Time 10 seconds uolyere
200. on the NanoDrop ND 1000 Spectrophotometer see Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer on page 189 STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to End repair the sheared DNA on page 57 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 End repair the sheared DNA End repair the sheared DNA Repair the DNA Note This reaction is optimal for lt 20 ug of starting material If gt 20 ug of ends with the end J A Starting material is used for shearing scale up the reaction as needed polishing reaction 1 Combine and mix the following components in a LoBind tube see Table 14 uolyesedaid Table 14 Combine components for end repair of DNA i F RV pel et D Co m U E E I Sb Es o A o lt Component Amount Sheared DNA 48 uL 5X End Polishing Buffer 20 uL dNTP 10 mM 2 5 uL End Polishing Enzyme 1 10 U uL 3 uL End Polishing Enzyme 2 5 U uL 8 uL Nuclease free Water 18 5 uL Total 100 uL 2 Incubate the mixture at room temperature 20 to 25 C for 30 minutes Purify the DNA with 1 Add 4 volumes of Binding Buffer B2 S with isopropanol 55 to the SOLiD Library 1 volume of sample Mix well Column Purification Kit 5 Apply about 700 uL of the sample in the binding buffer to the PureLink column s in collection tube s
201. onfirm library amplification with a 2 E Gel amp E X Gel ii Amplify the library Perform PCR on the library Purify the DNA with the SOLID Library Micro Column Purification Kit Gel punify the library with a Size S dection gel Load the library Run the SOLID Library Size Selection gel and collect the library fragnent Optional Purify the DNA with the SOLID Library Micro Column Purification Kit Quartitate the library by performing quantitative PCR qPCR Workflow overview Shear the DNA The genomic DNA is sheared to yield 600 bp to 6 kb fragments To shear for a mate paired library with insert sizes between 600 bp and 1 kb the Covaris S2 System is recommended To shear for a mate paired library with insert sizes between 1 kb and 6 kb the HydroShear DNA Shearing Device is recommended The Covaris S2 System shears the DNA into fragments through sonication Follow the manufacturer s guidelines and test the recommended shearing conditions SOLiID 4 System Library Preparation Guide 49 uonejedojg Q F o pel D a oo z i T v en E D Sb o ei o s lt 50 Chapter 3 Mate Paired Library Preparation Workflow The HydroShear DNA Shearing Device uses hydrodynamic shearing forces to fragment DNA strands Perform an initial standard run and adjust for DNA from different organisms as needed Note A calibration run to assess the shearing efficacy of your device prior to startin
202. onuclease and S1 nuclease digestion cuts the DNA at the position opposite to the nick and releases the DNA mate pair P1 and P2 Adaptors are then ligated to the ends of the mate paired library for subsequent amplification by PCR see Figure 9 on page 45 ie o ma i 2 oo lt fab i T U 2 E E e um en o lt Genomic DNA Sheared DNA Adaptors ligated Circularized DNA to sheared DNA with biotinylated internal adaptors emm rr t c ee mean SE aS Lm ao c QO QQ n aurcm P1 P2 Ligated i Biotinylated Library Molecule internal adaptors Nick translated with genomic DNA circularized DNA tags with biotinylated internal adaptors Figure 7 Basic 2 x 50 bp mate paired library preparation workflow SOLiID 4 System Library Preparation Guide A 3 3 Chapter 3 Mate Paired Library Preparation Overview For 2 x 25 bp mate paired libraries EcoP15I CAP Adaptors are ligated to sheared methylated DNA see Figure 8 The EcoP15I restriction enzyme sites in the genomic DNA are methylated prior to EcoP15I CAP Adaptor ligation to ensure that only the unmethylated enzyme recognition sites in the CAP adaptor are recognized by EcoP 151 during the restriction enzyme step As a result EcoP15I cleaves 25 to 27 bp away from the unmethylated enzyme recognition sites in the CAP linker yielding mate paired genomic DNA attached to either side of the internal adaptor P1 and P2 Adaptors are th
203. onucleotide used in library amplification and corresponding to the P1 Adaptor sequence Single stranded oligonucleotide used in library amplification and corresponding to the P2 Adaptor sequence Double stranded oligonucleotide 7 to 9 bases long with a phosphate missing from one of the ends The adaptor is ligated to a sheared DNA insert during 2 x 25 bp mate paired library construction Library consisting of two DNA tags a known distance apart linked by an internal adaptor with P1 and P2 Adaptors ligated to the 5 end and 3 end respectively Single stranded oligonucleotide used in barcoded fragment library amplification and corresponding to the Multiplex P1 Adaptor sequence Double stranded oligonucleotide ligated at the 5 end of the barcoded fragment library Double stranded oligonucleotide ligated at the 3 end of the barcoded fragment library contains the barcode sequence 253 Glossary multiplexing P1 Adaptor P2 Adaptor tag templated bead preparation 254 Method to analyze multiple biological samples in a single spot using barcodes Double stranded oligonucleotide ligated at the 5 end of the library Double stranded oligonucleotide ligated at the 3 end of the library A length of DNA to be sequenced Process of adding library template to beads by emulsion PCR enriching the beads to remove beads without template and modifying the 3 end of the template on the beads to prepare for bead deposition an
204. ore pooling 2 Apply about 700 uL of the individual or pooled barcoded library DNA in the binding buffer to the column s The maximum yield of DNA can be achieved when the amount of DNA loaded to a PureLink column is lt 5 ug Use more columns if necessary SOLID 4 System Library Preparation Guide Chapter 4 Barcoded Fragment Library Preparation 4 Ligate Multiplex P1 and Multiplex P2 Adaptors to the DNA 3 Let the column stand for 2 minutes at room temperature 4 Centrifuge the column at 210 000 x g 13 000 rpm for 1 minute then discard the flow through 5 Repeat steps 2 and 4 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s 6 Add 650 uL of Wash Buffer W1 to wash the column s 7 Centrifuge the column s at 210 000 x g 13 000 rpm for 2 minutes then discard the flow through Repeat to remove residual wash buffer 8 Air dry the column s for 2 minutes to evaporate any residual alcohol Transfer the column s to clean 1 5 mL LoBind tube s 9 Add 50 uL of Elution Buffer E1 to the column s to elute the DNA then let the column s stand for 2 minutes RU Eo o 2 K e ES 10 Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute 11 Add the eluate from step 10 back to the column s then let the column s stand for 2 minutes Repeat step 10 Aeq 1ueuu6e44 pepooueg p Je1deuo 12 If necessary pool the eluted DNA
205. ors Tube Magnetic Rack Rotator 1 5 mL LoBind tubes iltered pipettor tips Tube Magnetic Rack ortexer icofuge 1 5 mL LoBind tubes ipettors Itered pipettor tips P F V P 6 P F V P P 6 E 6 V P P Fi Dmornmrr ommm000 ommm0000 OOOOOO00 ag 000 nur ooo Reagents 5x Ligase Buffer T4 DNA Ligase 5 U uL Internal Adaptor ds Nuclease free Water 1 5 mL LoBind tubes SOLID Library Micro Column Purification Kit ATP 25 mM 10x Plasmid Safe TM Buffer Plasmid Safe TM DNase Nuclease free Water SOLID Library Micro Column Purification Kit 10x NEBuffer 3 100x BSA Sinefungin 10x ATP EcoP15I Enzyme 10 U uL Nuclease free Water Ice dNTP Mix 10 mM DNA polymerase Klenow large fragment Stop Buffer Nuclease free Water Ice 100x BSA Dynabeads MyOne Streptavidin C1 beads 5x Ligase Buffer Bead Wash Buffer Bead Binding Buffer Nuclease free Water T4 DNA Ligase 5 U uL P1 Adaptor ds P2 Adaptor ds Bead Wash Buffer Nuclease free Water dNTP Mix 10 mM DNA Polymerase 10 U uL Nick Translation Buffer SOLID 4 System Library Preparation Guide oo oo Preparation Steps Thaw Internal Adaptor on ice Thaw ligation reagents on ice Thaw Plasmid Safe ATP Dependent DNase reagents on ice Prepare 10 mM Sinefungin Thaw 10x NEBuffer 3 100x BSA 10x ATP onice Thaw dNTP Mix on ice Thaw 100x BSA and 5x Ligase Buffer on ice Thaw P1 Adaptor
206. os GGCCAAGGCGGATGTACGGT 3 20 Multiplex adaptor and barcode sequences Multiplex adaptor and barcode sequence Sequence bp Multiplex Library P1 Adaptor 50 uM 5 ATCACCGACTGCCCATAGAGAGGTT 3 25 5 CCTCTCTATGGGCAGTCGGTGAT 3 23 Multiplex Library PCR 1 50 uM 5 CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT 3 41 Multiplex Library PCR 2 50 uM 5 CTGCCCCGGGTTCCTCATTCT 3 21 Barcode 001 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGTGTAAGAGGCT GCT GTACGGCCAAGGCG 3 52 206 SOLID 4 System Library Preparation Guide Appendix D Oligonucleotide Sequences Library construction oligonucleotides Multiplex adaptor and barcode sequence Sequence bp Barcode 002 50 uM 5 CGCCTTGGCCGTACAGCAG3 5 CTGCCCCGGGTTCCTCATTCTCTAGGGAGTGGTCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 003 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTATAGGTTATACTGCTGTACGGCCAAGGCG 3 19 52 Barcode 004 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGGATGCGGTCCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 005 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGTGGTGTAAGCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 006 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGCGAGGGACACTGCTGTACGGCCAAGGCG 3 19 52 Barcode 007 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGGGTTATGCCCTGCTGTACGGCC
207. ovided by the manufacturers of the chemicals in the waste container before you store handle or dispose of chemical waste Provide primary and secondary waste containers A primary waste container holds the immediate waste A secondary container contains spills or leaks from the primary container Both containers must be compatible with the waste material and meet federal state and local requirements for container storage Minimize contact with chemicals Wear appropriate personal protective equipment when handling chemicals for example safety glasses gloves or protective clothing For additional safety guidelines consult the SDS Minimize the inhalation of chemicals Do not leave chemical containers open Use only with adequate ventilation for example fume hood For additional safety guidelines consult the SDS Handle chemical wastes in a fume hood After emptying a waste container seal it with the cap provided e Dispose ofthe contents of the waste tray and waste bottle in accordance with good laboratory practices and local state provincial or national environmental and health regulations Waste disposal Ifpotentially hazardous waste is generated when you operate the instrument you must e Characterize by analysis if necessary the waste generated by the particular applications reagents and substrates used in your laboratory Ensure the health and safety of all personnel in your laboratory 250 SOLID
208. ow to use this guide How to use this guide Text conventions This guide uses the following conventions Bold text indicates user action For example Type 0 then press Enter for each of the remaining fields e Italic text indicates new or important words and is also used for emphasis For example Before analyzing always prepare fresh matrix A right arrow symbol gt separates successive commands you select from a drop down or shortcut menu For example Select File Open gt Spot Set Right click the sample row then select View Filter gt View All Runs User attention Two user attention words appear in Applied Biosystems user documentation Each words word implies a particular level of observation or action as described below X Note Provides information that may be of interest or help but is not critical to the use of the product D IMPORTANT Provides information that is necessary for proper instrument operation accurate chemistry kit use or safe use of a chemical How to obtain support For the latest services and support information for all locations go to www appliedbiosystems com At the Applied Biosystems web site you can Access worldwide telephone and fax numbers to contact Applied Biosystems Technical Support and Sales facilities Search through frequently asked questions FAQs Submit a question directly to Technical Support Order Applied Biosystems user documents SDSs ce
209. page 110 and the calculation below For calculation details see Appendix E Formulas and calculations on page 215 5 108pg pmo J X pmol ug DNA 1 yg DNA iug 660 pg Circularized DNA size _Xpmol 7 1 uL adaptor needed Y uL adaptor needed 4 ug DNA x Ug DNA 30 x 50 pmol Example For 1 ug of purified circularized DNA with an average size of 1536 1500 bp insert 36 bp internal adaptor 6 1 x 10 Pg d1pmo X pmol ug DNA 1 ug DNA 1 ug 660 pg 1536 1 pmol ug DNA x 1 pmol E s 1 uL adaptor needed Y uL adaptor needed 1ug DNA x Tig DNA ug DNA 30 gt 50 pmol 0 6 uL adaptor needed 2 Combine see Table 45 Table 45 Combine for ligation of end repaired DNA to P1 and P2 Adaptors Component Volume pL DNA bead complex 94 P1 Adaptor ds 50 uM Y P2 Adaptor ds 50 uM Y T4 DNA Ligase 5 U uL 5 Total Variable 100 3 Incubate the reaction mixture at room temperature 20 to 25 C on a rotator for 15 minutes 4 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 5 Resuspend the beads in 500 uL of Bead Wash Buffer and transfer the beads to a new 1 5 mL LoBind tube Vortex the beads for 15 seconds then pulse spin 6 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 7 Resuspend the beads in 500 uL of Bead Wash
210. phosphorylated blunt ended DNA The conversion to blunt ended DNA results from 5 to 3 polymerase and the 3 to 5 exonuclease activities of End Polishing Enzyme 2 End Polishing Enzyme 1 and ATP are also included for phosphorylation of the 5 ends of the blunt ended DNA to allow for subsequent ligation 132 SOLID 4 System Library Preparation Guide Chapter 4 Barcoded Fragment Library Preparation 4 Workflow Purify the DNA with the SOLiD Library Column Purification Kit Sample purification is recommended with the PureLink columns supplied in the SOLiD Library Column Purification Kit PureLink columns have a 40 ug capacity but it may be necessary to use multiple columns during a purification step for higher yields Ligate Multiplex P1 and Multiplex P2 Adaptors to the DNA Multiplex P1 and Multiplex P2 Adaptors are ligated to the ends of the end repaired DNA You can design experiments to use as few as 4 barcodes for color balance as long as at least one of the following full sets of four barcodes are used Barcodes 1 4 5 8 9 12 13 16 17 20 21 24 25 28 29 32 33 36 37 40 41 44 45 48 49 52 53 56 57 60 61 64 65 68 69 72 73 76 77 80 81 84 85 88 89 92 or 93 96 Nick translate then amplify the library The adaptor ligated purified DNA undergoes nick translation then amplification using Multiplex Library PCR 1 and Multiplex Library PCR 2 primers and Platinum PCR Amplificatio
211. plied Biosystems contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions Table 94 Required consumables Item Source Nuclease free Water 1 L Applied Biosystems AM9932 CF 1 Calibration Fluid Kit Thermo Scientific CF 1 PR Conditioning Kit Thermo Scientific PR 1 Filtered pipettor tips Major Laboratory Supplier MLS t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance 8 The NanoDrop Conditioning Kit is useful for reconditioning the sample measurement pedestals to a hydrophobic state if they become unconditioned Refer to the NanoDrop Conditioning Kit user s manual for more information The PR 1 kit consists of a container of specially formulated polishing compound and a supply of convenient applicators Procedure 1 Ensure that the NanoDrop ND 1000 Spectrophotometer is properly calibrated Use the CF 1 Calibration Fluid Kit if necessary 2 Open the NanoDrop ND 1000 Spectrophotometer software to display a dialog box see Figure 28 on page 190 gt o 0 Q x 9 ie fem ke je 3 D E m av fe 9 o o I n SOLiID 4 System Library Preparation Guide 189 G Appendix C Supplemental Procedures Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer Figure 28 NanoDrop ND 1000
212. ppendix A on page 145 for a list of equipment kits and consumables necessary for this procedure ay Eo o 2 K e ES Aeq yuswbes4 pepooueg p Jeideuo SOLID 4 System Library Preparation Guide 131 4 Chapter 4 Barcoded Fragment Library Preparation Workflow Workflow Shear the DHA End repair the D Repairthe DNA ends wth End P olishing Enzymes 1 and 2 Purify the DM A with the PureLink PCR Purification Kit Ligate Multiplex P1 and Multiplex P2 AdaptorstotheDH A Ligate Multiplex P 1 and Multiplex P2 Adaptorsto the DNA P urify the DN A with the PureLirnk P CR Purification Kit Wicktranslat He WIpM the rar Nick translate then amplify the library P urify the DNA with the PureLink P CR Purification Kit Quantitate the library by performing quantitative PCR qPCR Pool the barcoded libraries Gel purify the libraries Workflow overview Shear the DNA This step involves sonicating the input DNA into small fragments with a mean fragment size of 165 bp and a fragment size range of 150 to 180 bp before adaptor ligation using the Covaris S2 System The conditions have been tested for shearing 500 ng to 5 ug DNA in a total volume of 100 uL For certain DNA samples optimizing the shearing protocol may be necessary End repair the DNA End Polishing Enzyme 1 and End Polishing Enzyme 2 are used to convert DNA that has damaged or incompatible 5 protruding and or 3 protruding ends to 5
213. r Vortexer Picofuge 1 5 mL LoBind tubes Pipettors Filtered pipettor tips Microcentrifuge Vortexer Picofuge 1 5 mL LoBind tubes Pipettors Filtered pipettor tips Gel box and power supply for agarose gel Safe Imager Blue Light Transilluminator Gel imaging system Microcentrifuge Vortexer Picofuge Pipettors Scale Razor blades 15 mL conical polypropylene tubes 1 5 mL LoBind tubes NanoDro ND 1000 Spectrophotometer SOLiID 4 System Library Preparation Guide OOoooo OOOO uum 02000 rm Appendix F Checklists and workflow tracking forms Workflow checklists prepare a 2 x 25 bp mate paired library Reagents 1M Tris pH 8 0 Nuclease free Water Ethylene glycol UltraPure Glycerol SOLiD Library Column Purification Kit Nuclease free Water 0 2 N HCI 0 2 N NaOH 1 5 mL LoBind tubes SOLID Library Column Purification Kit 5x End Polishing Buffer dNTP 10 mM End Polishing Enzyme 1 End Polishing Enzyme 2 Nuclease free water SOLID Library Column Purification Kit 10x NEBuffer 3 100x BSA EcoP15l 10 U uL S adenosylmethionine Nuclease free Water SOLID Library Column Purification Kit EcoP15l CAP Adaptor ds 50 uM 5x Ligase Buffer T4 DNALigase Nuclease free Water SOLiD Library Column Purification Kit 1x TAE buffer Agarose 10x BlueJuice Gel Loading Buffer 1 Kb Plus DNA Ladder SYBR gel stain Nuclease free Water SOLID Library Quick Gel Extraction Kit
214. r 1 minute 13 Add the eluate from step 12 back to the column s then let the column s stand for 1 minute at room temperature 14 Centrifuge the column s at 14 000 x g for 1 minute 15 If necessary pool the eluted DNA into one 1 5 mL LoBind tube 16 Quantitate the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer see Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer on page 189 D IMPORTANT Proceed directly without stopping to Digest the circularized DNA with EcoP15I on page 112 SOLID 4 System Library Preparation Guide 111 Chapter 3 Mate Paired Library Preparation Digest the circularized DNA with EcoP151 Digest the circularized DNA with EcoP15l 1 Using 10 units of EcoP15I per 100 ng circularized DNA calculate the amount of EcoP151 enzyme X needed to digest the circularized DNA 10U tL X uL EcoP151 ngDNA 00nd ONA ngDNA Example For 1000 ng circularized DNA 10 U 1 uL X pL EcoP151 1000 ng DNA 700 ng DNA 10U 10 pL EcoP15I 2 Combine in a LoBind tube see Table 40 Table 40 Mix to digest circularized DNA with EcoP15l Component Volume pL Circularized DNA Variable 10x NEBuffer 3 10 100X BSA 1 Sinefungin 10 mM 1 10x ATP 10 EcoP15l 10 U uL X Nuclease free Water Variable Total 100 3 Incubate the reaction mixtures at 37 C overnight 4 Combine see Table 41 Table41 Mix to digest circular
215. rcode 090 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGTGACCTACTCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 091 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGCGTATTGGGCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 092 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTAAGGGATTACCTGCTGTACGGCCAAGGCG 3 19 52 SOLiD 4 System Library Preparation Guide 213 gt o D 2 2 x U Q Li e 2 em e D fe ct o D n D 4e D 2 o D n Appendix D Oligonucleotide Sequences Library construction oligonucleotides Multiplex adaptor and barcode sequence Sequence bp Barcode 093 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGTTACGATGCCTGCTGTACGGCCAAGGCG 3 52 Barcode 094 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTATGGGTGTTTCTGCT GTACGGCCAAGGCG 3 52 Barcode 095 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTGAGTCCGGCACTGCTGTACGGCCAAGGCG 3 52 Barcode 096 50 uM 5 CGCCTTGGCCGTACAGCAG 3 19 5 CTGCCCCGGGTTCCTCATTCTCTAATCGAAGAGCTGCTGTACGGCCAAGGCG 3 52 214 SOLID 4 System Library Preparation Guide Appendix E Formulas and calculations This appendix covers B Fragment library 2 0 ce een th hn 216 Ligation of P1 and P2 Adaptors 2 0 0 eee cee eee 216 E 2 x 50 bp mate paired library 2 cette 216 L
216. reactions see Table 49 PCR on the library Table 49 PCR master mix for amplification of the library Component Volume pL Platinum PCR Amplification Mix 350 Library PCR Primer 1 50 uM 7 Library PCR Primer 2 50 uM 7 Total 364 t Platinum PCR Amplification Mix contains a proofreading enzyme for high fidelity amplification 2 For the negative control aliquot 50 uL of PCR master mix to a PCR tube Add 5 uL of Nuclease free Water to the tube 3 Add 26 uL of DNA bead complex solution to the remaining 314 uL of PCR master mix Vortex to mix then divide evenly 784 uL among four PCR tubes 4 Run see Table 50 Table 50 PCR conditions to amplify the library Stage Step Temp Time Holding Denature 94 C 3 min Cycling Denature 94 C 15 sec Anneal 62 C 15 sec Extend 70 C 1 min Holding Extend 70 C 5min Holding 4 C oo t Oycling number determined by trial amplification See Trial amplify the library on page 118 5 Pool all of the PCR samples into a 1 5 mL LoBind tube 6 Place the tube of beads in a magnetic rack then transfer the supernatant to a fresh 2 mL LoBind tube Discard the tube containing the beads 120 SOLID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Amplify the library Purify the DNA with 1 Pre spin empty PureLink Micro column in collection tubes at 10 000 x g for the SOLID Library 1
217. red DNA Transfer the sheared DNA into a new 1 5 mL LoBind tube 34 SOLID 4 System Library Preparation Guide Section 2 2 Prepare an express fragment library 2 End repair the DNA End repair the DNA Repair the DNA 1 Combine and mix the following components in a 1 5 mL LoBind tube see ends with End Table 8 Polishing Enzyme 1 and Table8 Mix for end repair of DNA End Polishing Vol L Enzyme 2 Component olume uL Sheared DNA 100 5X End Polishing Buffer 40 dNTP Mix 10 mM 8 End Polishing Enzyme 1 10 U uL 4 End Polishing Enzyme 2 5 U uL 16 Nuclease free Water 32 Total 200 2 Incubate the mixture at room temperature for 30 minutes Purify the DNA with 1 Add4 volumes of Binding Buffer B2 S with 55 isopropanol to the end Cy F 5 xe et S N TI EM 5 Ke zi E lop ES lt 0 o Sg E fe SOLiD Library repaired DNA Column Purification Kit 2 Apply approximately 700 uL of end repaired DNA in the binding buffer to the column s The maximum yield of DNA can be achieved if the amount of DNA loaded to a PureLink column is lt 5 ug Use more columns if necessary 3 Let the column s stand for 2 minutes at room temperature 4 Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute and discard the flow through 5 Repeat steps 2 and 4 until the entire sample has been loaded onto the column s Place the colu
218. repare 1x BSA solution Component Volume pL 100X BSA 5 Nuclease free Water 495 Total 500 A component of the EcoP15l Enzyme Kit from New England Biolabs Inc Vortex the bottle of Dynabeads MyOne Streptavidin C1 then transfer 90 uL of the beads into a 1 5 mL LoBind Tube Add 500 uL of Bead Wash Buffer to the 90 uL of solution of beads vortex the beads for 15 seconds then pulse spin Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant Add 500 uL of 1X BSA and vortex for 15 seconds then pulse spin the tube Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant Add 500 uL of Bead Binding Buffer Vortex the beads for 15 seconds then pulse spin Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant Resuspend the beads in 200 uL of Bead Binding Buffer Add the entire 200 uL of solution of library DNA in Bead Binding Buffer to the 200 uL of pre washed beads then vortex Rotate the solution at room temperature 20 to 25 C for 30 minutes then pulse spin SOLID 4 System Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Bind the library molecules to streptavidin beads Wash the bead 1 Combine see Table 44 2 Place the tube with the bead DNA complex in a magne
219. ris 2 series Machine Holder for one 1 5 mL microcentrifuge tube e Covaris 2 series Machine Holder for one 0 65 mL microcentrifuge tube e Covaris 2 series Machine Holder for one 13 mm x 65 mm tube e Covaris 2 Series Machine Holder for one microTUBE e Covaris microTUBE Prep Station e Covaris Water Tank Label Kit e Covaris microTUBEs 1 pack of 25 For system materials summary refer to Covaris S2 System Materials Summary SOLiD 4 System Site Preparation Guide PN 4448639 Microcentrifuge 5417R refrigerated without rotor Eppendorf 022621807 120 V 60 Hz e Eppendorf 022621840 230 V 50 Hz FA 45 24 11 fixed angle rotor 24 x 1 5 2 mL including aluminum lid aerosol tight EppendorfS 022636006 96 well GeneAmp PCR System 9700 Applied Biosystems thermal cycler N8050200 Base Applied Biosystems 4314443 Block NanoDrop ND 1000 Spectrophotometer Thermo Scientific computer required ND 1000 Labquake Rotisserie Rotator WR Barnstead Thermolyne 56264 312 SOLID 4 System Library Preparation Guide Appendix A Required Materials Prepare a 2 x 25 bp mate paired library Table 74 Required equipment Product Name Vendor 6 Tube Magnetic Stand Applied Biosystems or AM10055 DynaMag 2 Magnet Invitrogen 123 21D E Gel iBase and E Gel Safe Imager Invitrogen Combo Kit G6465 Safe
220. rmation see this Preface and Appendix I Safety on page 245 When a hazard symbol and hazard type appear by a chemical name or instrument hazard see the Safety Appendix for the complete alert on the chemical or instrument Four safety alert words appear in Applied Biosystems user documentation at points in the document where you need to be aware of relevant hazards Each alert word IMPORTANT CAUTION WARNING DANGER implies a particular level of observation or action as defined below IMPORTANT Indicates information that is necessary for proper instrument operation accurate chemistry kit use or safe use of a chemical CAUTION Indicates a potentially hazardous situation that 1f not avoided may result in minor or moderate injury It may also be used to alert against unsafe practices WARNING Indicates a potentially hazardous situation that if not avoided could result in death or serious injury DANGER Indicates an imminently hazardous situation that if not avoided results in death or serious injury This signal word is to be limited to the most extreme situations The Safety Data Sheets SDSs for any chemicals supplied by Applied Biosystems or Ambion are available to you free 24 hours a day For instructions on obtaining SDSs see SDSs on page 249 D IMPORTANT For the SDSs of chemicals not distributed by Applied Biosystems or Ambion contact the chemical manufacturer Preface H
221. rop Conditioning Kit is useful for reconditioning the sample measurement pedestals to a hydrophobic state if they become unconditioned refer to the Nanodrop user s manual for more information The PR 1 kit consists of a container of specially formulated polishing compound and a supply of convenient applicators For the SDS of any chemical not distributed by Applied Biosystems contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions Table 77 Optional consumables S Product name Vendor g Agilent DNA 1000 Kit Agilent Technologies x 5067 1504 2 196 E Gel EX Gel Invitrogen G401001 gt Quanti iT PicoGreen dsDNA Assay Kit Invitrogen z P7589 p Quant iT dsDNA HS Assay Kit Invitrogen Q32851 or Q32854 Quant iT dsDNA BR Assay Kit Invitrogen Q32850 or Q32853 t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance SOLiID 4 System Library Preparation Guide 167 Appendix A Required Materials Prepare a barcoded fragment library Prepare a barcoded fragment library Table 25 Required Applied Biosystems reagent kits Item part number Components Kit components used in SOLiD Fragment Library Barcoding Kit 1 96 4449637 Multiplex Library P1 Adaptor 50 uM Multiplex Library PCR 1 50 uM Multiple
222. rop Conditioning Kit user s manual for more information The PR 1 kit consists of a container of specially formulated polishing compound and a supply of convenient applicators For the SDS of any chemical not distributed by Applied Biosystems contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions Table 71 Optional consumables Product name Vendor Agilent DNA 1000 Kit Agilent Technologies 5067 1504 2 1 E Gel EX Gel Invitrogen i G401001 D Quanti iT PicoGreen dsDNA Assay Kit Invitrogen E P7589 gt Quant iT dsDNA HS Assay Kit Invitrogen z Q32851 or Q32854 p Quant iT dsDNA BR Assay Kit Invitrogen Q32850 or Q32853 t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance SOLID 4 System Library Preparation Guide 161 Appendix A Required Materials Prepare a 2 x 25 bp mate paired library Prepare a 2 x 25 bp mate paired library Table 72 Required Applied Biosystems reagent kits Item part number Components Kit components used in SOLiD Mate Paired Library Oligos Kit 4400468 SOLiD Library Oligos Kit 1 P1 Adaptor ds SOLiD Library Oligos Kit 1 P2 Adaptor ds Ligation of adaptors SOLiD Library Oligos Kit 1 Library PCR Primer 1 SOLiD Library Oligos Kit 1
223. rranty limitations Biosystems relocation or movement of the instrument by buyer or by any third party not acting on behalf of Applied Biosystems or intrusive activity including without limitation computer viruses hackers or other unauthorized interactions with instrument or software that detrimentally affects normal operations Parts in contact with any liquid are considered wetted and may be deemed user replaceable and not be covered by the above warranties including but not limited to seals filters gaskets shearing assemblies valves syringes syringe adapters syringe shields and output tubing Warranty limitations 242 THE FOREGOING PROVISIONS SET FORTH APPLIED BIOSYSTEMS SOLE AND EXCLUSIVE REPRESENTATIONS WARRANTIES AND OBLIGATIONS WITH RESPECT TO THE PRODUCTS WARRANTIED HEREIN AND APPLIED BIOSYSTEMS MAKES NO OTHER WARRANTY OF ANY KIND WHATSOEVER EXPRESSED OR IMPLIED INCLUDING WITHOUT LIMITATION WARRANTIES OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE OR NON INFRINGEMENT OF INTELLECTUAL PROPERTY WHETHER ARISING FROM A STATUTE OR OTHERWISE IN LAW OR FROM A COURSE OF DEALING OR USAGE OF TRADE ALL OF WHICH ARE EXPRESSLY DISCLAIMED THE REMEDIES PROVIDED HEREIN ARE THE BUYER S SOLE AND EXCLUSIVE REMEDIES WITHOUT LIMITING THE GENERALITY OF THE FOREGOING TO THE FULL EXTENT ALLOWED BY LAW IN NO EVENT SHALL APPLIED BIOSYSTEMS BE LIABLE WHETHER IN CONTRACT TORT WARRANTY OR UNDER ANY STATUTE INCLUDING WITHO
224. rtificates of analysis and other related documents Download PDF documents Obtain information about customer training Download software updates and patches 10 SOLID 4 System Library Preparation Guide Chapter 1 1 Introduction Library preparation overview Q 0 xe D 2i gt o en Q E le E s Note If you are performing standard DNA sequencing analysis prepare the library according to the procedures in this guide For other applications of the SOLiD System go to http solid appliedbiosystems com then select your area of interest On the selected page click the library preparation step under Experimental Workflow to find application specific information and protocols Library preparation is the first step in which samples are adapted for SOLiD System sequencing During library preparation forward and reverse adaptors are added to the ends of DNA inserts see Figure 1 Fragment Library gt Sequence up to 50 bp Sequence up to 25 bp ea P1 Adaptor DNA Fragment ptor Mate Paired Library um Sequence up to 50 bp um Sequence up to 50 bp Bead P1 Adaptor Mate pair tag cM Mate pair tag 12 Adaptor Barcoded Fragment Library uu Sequence up to 50 bp Sequence up to 25 bpa Sequence 5 or 10 bp P1 Adaptor DNA Fragment E de 2 Adaptor Figure 1 Fragment and mate paired library construction SOLID 4 System Library Preparation Guide 1
225. rty of Life Technologies Corporation or their respective owners Covaris is a trademark of Covaris Inc TaqMan is a registered trademark of Roche Molecular Systems Inc NanoDrop is a registered trademark of NanoDrop Technologies HydroShear is a registered trademark of Genomic Solutions Inc All other trademarks are the sole property of their respective owners Copyright 2010 Life Technologies Corporation All rights reserved 4445673 Rev B 04 2010 Protocol Chapter 1 Chapter 2 Contents uos rn 9 Safety informatlon 22 0524 ee pig GERA fe dee ee SKENA ARREA babi Yee seeds Paes 9 How to use this guide o cerei sors eh gga dees uox ioe Dd ale TA doe ee 10 How to obtain support 0 00 ee eee 10 INIGOUCHON TT 11 Library preparation overview 00 000 3 nn 11 Choose the appropriate library type 0 02 ee 12 Fragment Library Preparation 000c eee eee eee 13 eI ADD DTMT 14 Section 2 1 Prepare a standard fragment library LL 16 Materials and equipment required lesen 16 WOrFKIloW REGE RR E RERO HORSES E RES Ae Re EE EEG SOSA SESE Pes 17 TIDS oc ioe ee a Soe Maia atenta d a PARE pected ai Pune wed he dca Sv enit Bethea tu ar S eh Stee 18 Shear the DNA T 19 End repair the DNA 0 0 2 0 0 00 eee 20 Ligate P1 and P2 Adaptors to the DNA 0 eee eee 22 Size select the DNA 0 00 hh 24 Nick translate
226. ructural variation studies where tighter size selection of fragments is required perform an additional size selection see Size select the DNA on page 61 After size selection and purification proceed to Ligate LMP CAP Adaptors to the DNA on page 59 An additional size selection will reduce the yield significantly If a narrow insert size distribution is not critical proceed directly to Ligate LMP CAP Adaptors to the DNA on page 59 58 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Ligate LMP CAP Adaptors to the DNA Ligate LMP CAP Adaptors to the DNA 9 7 Ligate the LMP 1 Calculate the amount of adaptor needed Y for the reaction based on the amount CAP adaptors to of DNA from the last purification step see Ligation of LMP CAP Adaptors on v the DNA page 216 5 D g Example E v O D 7g 6 1 _ 10 pg 1 pmol eee eee ee Cc Xpmollug DNA Tug DNA x ug i 660 pg Average insert size m lt z X pmol 1 uL adaptor needed Y uL adaptor needed yug DNA x iugDNA x 100 x a0 pmol Example For 12 ug of purified end repaired DNA with an average insert size of 1 5 kb 10 pg 1pmod 1 _ X pmol ug DNA 1 gg DNA 1 ug 5 660 pg x 4500 1 0 pmol ug DNA _ 1 0 pmol 1 uL adaptor needed Y uL adaptor needed 12 ug DNA x Tg DNA x 100 x 50 pmol 24 uL adaptor needed 2 Combine and mix the components below see Table 15 If a larger reaction volum
227. ruding and or 3 protruding ends to 5 phosphorylated blunt ended DNA The conversion to blunt end DNA is accomplished by exploiting the 5 to 3 polymerase and the 3 to 5 exonuclease activities of End Polishing Enzyme 2 End Polishing Enzyme 1 and ATP are also included for phosphorylation of the 5 ends of the blunt ended DNA for subsequent ligation Bind the DNA molecules to the streptavidin beads Dynabeads MyOne Streptavidin C1 specifically bind to the biotin labeled Internal Adaptor in the library molecules to purify the library from side products SOLID 4 System Library Preparation Guide 51 Tips 52 Chapter 3 Mate Paired Library Preparation Tips Ligate P1 and P2 Adaptors to the DNA P1 and P2 adaptors are ligated to the ends of the end repaired DNA The P1 and P2 Adaptors are included in double stranded form in the SOLiD Mate Paired Library Oligos Kit Wash the DNA bound streptavidin beads Library molecules bound to streptavidin beads are washed and purified from ligation side products Nick translate the library The ligated purified DNA undergoes nick translation with DNA polymerase I Trial amplify the library The library is trial amplified using Library PCR Primers 1 and 2 with the Platinum PCR Amplification Mix The mix includes a proofreading enzyme for high fidelity amplification to determine the number of PCR cycles so that the amplified library is just visible on 2 E Gel EX Gel
228. run on an SOLiD Library Size Selection gel The correctly sized amplification products 240 to 270 bp are electrophoresed to the collection wells of the SOLID Library Size Selection gel If needed the eluate can be concentrated using the SOLiD Library Column Purification Kit Pool any remaining libraries that will be combined into a single emulsion SOLID 4 System Library Preparation Guide 133 Chapter 4 Barcoded Fragment Library Preparation Tips Tips Use good laboratory practices change gloves frequently to minimize cross contamination of products Adjust microcentrifuge speeds and times according to the g forces specified in the protocols Applied Biosystems recommends the Eppendorf 5417R tabletop microcentrifuge Perform all steps requiring 0 5 mL and 1 5 mL tubes with Eppendorf LoBind Tubes Thaw reagents on ice before use 134 SOLID 4 System Library Preparation Guide Chapter 4 Barcoded Fragment Library Preparation 4 Shear the DNA Shear the DNA Experiments should be designed so that for each multiplexed sequencing run at least one of the following full sets of four barcodes should be used Barcodes 1 4 5 8 9 12 13 16 17 20 21 24 25 28 29 32 33 36 37 40 41 44 45 48 49 52 53 56 57 60 61 64 65 68 69 72 73 76 77 80 81 84 85 88 89 92 or 93 96 Shear the DNA D IMPORTANT Ensure that the bath temperature during shearing is between using th
229. ry products has not reached the reference line run the gel for about to 2 more minutes until the band reaches the line The ideal size of a library is from 275 to 325 bp but a library ranging from 250 to 350 bp is acceptable When the front line of library products reaches the reference line press Go to stop the run Proceed to step 4 4 When the front line of library products reaches the reference line refill the bottom row again with Nuclease free Water until each well is full Some pre filled water is lost during the run 5 Press Go to run the gel until the library products enter the collection well For optimal results monitor the run in a darkened room 6 Collect all of the DNA from the collection well using a 20 uL pipette fitted with a tip see Figure 15 on page 85 Do not perforate the bottom of the agarose collection well Due to migration of the DNA into the bottom of the well some residual DNA remains underneath the well IMPORTANT If the library products overrun the collection well and reenter the gel select REVERSE E Gel on the iBase Power System to run the library products backward into the collection well Collect all of the DNA 84 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library Gel purify the library with a Size Selection gel 9 ms Oo ad o ini oo D TE id pt e o O D gt 6 ex IE oR ES ied lt I1 Lond Loi L
230. s 1 Combine and mix the following components in two separate microcentrifuge tubes one for unmethylated unsheared DNA and one for methylated sheared DNA see Table 106 Table 106 Mix to digest circularized DNA with EcoP151 Component Amount DNA 0 5 ug 10X NEBuffer 3 10 100X BSA 1 10 mM Sinefungin 1 10x ATP 20 EcoP15l Enzyme 10 U uL 1 Nuclease free Water Variable Total 100 2 Incubate the digestion reaction mixtures at 37 C for 2 hours SOLID 4 System Library Preparation Guide Appendix C Supplemental Procedures Confirm complete methylation of DNA fragments Purify the DNA with 1 Add 4 volumes of Binding Buffer B2 S with isopropanol 55 to 1 volume of the SOLID Library sample Mix well Column Purification Kit 2 Apply about 700 uL of the sample in the binding buffer to the PureLink column s in collection tube s 3 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through dsDNA is bound to the column 4 Repeat steps 2 and 3 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s 5 Add 650 uL of Wash Buffer W1 with ethanol to wash the column s 6 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at maximum speed to remove residual wash buffer 7 Transfer the column s to clean 1 5 mL LoBind tube s 8 Add 50 uL o
231. safety solvents 247 SDSs about 9 description 249 obtaining 10 249 SOLiD 3 Plus System Library Quantitation 173 SOLiD 3 System template quantitation 173 solvents safety 247 supplemental procedures 185 confirm complete methylation of DNA fragments 200 hybridization of oligonucleotides 187 isopropanol precipitation 198 PAGE gel DNA elution 196 phenol chloroform isoamyl alcohol extraction 193 phenol chloroform isoamyl alcohol extraction with MaxXtract 194 quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer 189 T text conventions 10 training information on 10 U user attention words described 10 W WARNING description 9 waste disposal guidelines 250 waste profiles description 250 258 SOLID 4 System Library Preparation Guide Part Number 4445673 Rev B 04 2010 444567398 applied A biosystems part ot Life technologies Applied Biosystems 850 Lincoln Centre Drive Foster City CA 94404 USA Phone 650 638 5800 Toll Free 800 345 5224 www appliedbiosystems com Technical Resources and Support For the latest technical resources and support information for all locations please refer to our Web site at www appliedbiosystems com support
232. se 5 U uL O Thaw P1 Adaptor ds and P2 4 O Picofuge P1 Adaptor ds Adaptor ds on ice raz O Pipettors P2 Adaptor ds P so O Rotator Bead Wash Buffer t i O 6 Tube Magnetic Rack Nuclease free Water 52 O 1 5 mL LoBind tubes O Filtered pipettor tips O 6 Tube Magnetic Rack dNTP Mix 10 mM Thaw end repair reagents on 2 O Vortexer DNA Polymerase I ice x25 O Picofuge 10 U uL S O 1 5 mL LoBind tubes Elution Buffer E1 A O Pipettors O Filtered pipettor tips O Thermal cycler O Library PCR Primer 1 Thaw Library PCR Primers 1 E a O E Gel iBase Power O Library PCR Primer 2 and 2 on ice S System O Platinum amp PCR Amplification Thaw Platinum PCR E O Gelimaging system Mix Amplification Mix on ice T g O PCR strip tubes O 2 E Gel EX Gel EU O Pipettors O 100 bp DNA ladder O Filtered pipettor tips O Nuclease free Water O Thermal cycler O Library PCR Primer 1 Thaw Library PCR Primers 1 2 O E Gel iBase Power O Library PCR Primer 2 and 2 on ice g System O Platinum PCR Amplification Thaw Platinum PCR 2 O Microcentrifuge Mix Amplification Mix on ice i O 6 Tube Magnetic Rack O Nuclease free Water Thaw DNA 1000 kit reagents O 2100 Bioanalyzer O 1 5 mL LoBind tubes on ice O PCR strip tubes O 2 0 mL LoBind tubes E O Pipettors O DNA 1000 Chip O Filtered pipettor tips O SOLiD Library Micro gt Column Purification Kit L O E Gel iBase Power O E Gel SizeSelect 296 Gel E System O 100 bp DNA ladder Q O Sa
233. silluminator Load the gel as follows for exact fill volumes of the wells refer to the Invitrogen E Gel SizeSelect Agarose Gels Quick Reference Card a Load 20 uL of the ligated purified DNA into each well of the top row of wells If the sample volume 20 uL add Nuclease free Water to the well for a total volume of 20 uL Skip the center well smaller well in the top center of the gel for the ladder and skip a single well to the right and left of the center top well Skip the two outermost wells to avoid edge effects Do not load more than 1 ug of DNA per lane see Figure 5 on page 25 b Load 10 uL of 50 bp ladder at 0 1 ug uL to the center top well Add 7 uL of water to fill the well see Figure 5 on page 25 c Fill empty wells in the top row with 20 uL of Nuclease free Water d Fill each of the collection wells in the middle of the gel with 25 uL of Nuclease free Water Add 20 uL of Nuclease free Water to the middle center well see Figure 5 on page 25 SOLID 4 System Library Preparation Guide Section 2 1 Prepare a standard fragment library 2 Size select the DNA Nuclease Nuclease Nuclease Nuclease free free free free Water DNA Water Ladder water DNA Water 25 uL 20 uL 25 uL Nuclease Nuclease Nuclease free free Water Water o F hy xe et 0 N TI EM o Ke zi 0 E o ES lt 0 xe E e 2 Figure 5 Where to load DNA ladder and Nuclease fre
234. sired insert size Agarose gel needed 96 600 to 3000 bp 1 0 8 to 6 kb 0 8 Prepare the appropriate percentage agarose gel in 1X TAE buffer with 10 uL of 1 10 000 SYBR Safe gel stain Invitrogen S33102 per 100 mL gel volume To prepare the gels use either Agarose LE Applied Biosystems AM9040 or UltraPure Agarose 1000 Invitrogen 10975 035 Add 10X Blue Juice Gel Loading Buffer to the purified ligated DNA 1 uL of 10X Gel Loading Buffer for every 10 uL of mate paired library Load the 1 Kb Plus DNA Ladder Invitrogen 10787 018 to one well Load dye mixed sample per well according to the well capacity into remaining wells Use the minimum number of wells possible There should be at least one lane in between the ladder well and the sample wells to avoid contamination of the sample with ladder Run the gel at the appropriate voltage to achieve optimal separation of the size of interest D IMPORTANT To obtain maximum resolution of DNA fragments agarose gels should be run at lt 5 V cm The distance is measured as the shortest path between the electrodes not the agarose gel length itself 6 Visualize the gel on a Safe Imager Blue Light Transilluminator with a ruler lying on top of the transilluminator IMPORTANT Exposing DNA to UV light may damage the DNA Using SYBR Safe gel stain and the Safe Imager Blue Light Transilluminator eliminates the risk of UV damage to DNA during size selection 7 Using th
235. stem Library Preparation Guide Section 3 2 Prepare a 2 x 25 bp mate paired library 3 Workflow the final DNA fragment sizes While basic guidelines are given for shearing DNA using a HydroShear DNA Shearing Device every HydroShear instrument may need an initial standard run and speed codes may need adjusting for DNA from different organisms Note A calibration run to assess the shearing efficacy of your device prior to starting your first library preparation is highly recommended uonejedajg Sample purification is performed with PureLink columns supplied in the SOLiD Library Column Purification Kit and the SOLiD Library Micro Column Purification Kit PureLink columns have a 40 ug capacity and PureLink Micro columns have a 5 ug capacity For maximum recovery load 30 ug of DNA onto one PureLink column Use multiple columns if necessary All columns can be loaded multiple times if the volume of initial DNA and binding buffer mixture exceeds the volume capacity of the column For more detailed information on purification of DNA with PureLink columns see the manufacturer s instructions If you have larger amounts of DNA for library construction you can substitute this step with phenol chloroform isoamyl alcohol extraction and isopropyl alcohol precipitation see Appendix C Supplemental Procedures on page 185 9 D iei 3 gj oo lt 2 n U g 2 ki um ed E S a lt End repair the DNA
236. t Mate paired library capture e Dynabeads MyOne Streptavidin C1 Bead Wash Buffer Bead Binding Buffer SOLiD Library Column DNA purification Purification Kit SOLiD Library Micro Column Purification Kit SOLiD Library Quick Gel DNA size selection Extraction Kit SOLiD Library Size Selection Gels gt 9 o D 5 2 x gt ZU D fe s a m D D 2 t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance For the SDS of any chemical not distributed by Applied Biosystems contact the chemical manufacturer Before handling any chemicals refer to the SDS provided by the manufacturer and observe all relevant precautions Invitrogen products can be ordered at www invitrogen com SOLID 4 System Library Preparation Guide 163 164 Appendix A Required Materials Prepare a 2 x 25 bp mate paired library Table 74 Required equipment Product Name Vendor HydroShear DNA Shearing Device from Genomic Solutions9 Applied Biosystems 4392889 115 V Applied Biosystems 4392890 230 V Covaris S2 System Applied Biosystems 4387833 110 V 110 V for U S customers Applied Biosystems 220 V for international customers 4392718 220 V or The system includes Covaris e Covaris S2 sonicator e Latitude laptop from Dell Inc MultiTemp III Thermostatic Circulator e Cova
237. t specific applications go to the SOLiD System website http solid appliedbiosystems com or contact your field applications specialist 12 SOLID 4 System Library Preparation Guide Chapter 2 Fragment Library Preparation This chapter covers OVEIVIEW epe ea i are ee eA eh nh oe Re ee eek bee en een 14 Section 2 1 Prepare a standard fragment library 16 Materials and equipment required 0 0 00 cece cece ene 16 T WotktloW uses gue RR ER ERR ER IER nA et es A RR RUP Ree RAS 17 9 WAS DRM 18 x Shear the DNA crecio 00 0 ccc dere tiea hh Ea 19 E End repair the DNA eaccdss ecce e stin etk Rr RE HER Ss 20 Ligate P1 and P2 Adaptors to the DNA 00 cece eee eens 22 3 bize select the DNA 4s cessas porrecto ia rie deve wae Sade wads E SR NRES 24 E Nick translate then amplify the library llli esee 27 E Quantitate the library by performing quantitative PCR qPCR 29 5 Section 2 2 Prepare an express fragment library eese 31 Materials and equipment required 00 ccc nen 31 WOrK low 5 26 cane n chewy Caw ea bw eae a be Rade be bade Taw CAE Y eel die 32 TIPS 242 844 s eoa duse eset dede kd e o eme adu eub ded 33 Shear the DNA ia eseceovevr e RARO E PG ESTER AE AREE RR eae 34 End repair the DNA 0 nanenane 35 Ligate P1 and P2 Adaptors to the DNA 0 cece eens 37 Nick translate then amplify the library 0 0
238. tain configurations of computer hardware software and peripherals for use with its instrumentation Applied Biosystems reserves the right to decline support for or impose extra charges for supporting nonstandard computer configurations or components that have not been supplied or recommended by Applied Biosystems Applied Biosystems also reserves the right to require that computer hardware and software be restored to the standard configuration prior to providing service or technical support For systems that have built in computers or processing units installing unauthorized hardware or software may void the Warranty or Service Plan Limited product warranty 240 Applied Biosystems warrants that all standard components of the SOLiD 4 Analyzer IKA ULTRA TURRAX Tube Drive the Covaris S2 System APC UPS and the recirculating chiller will be free of defects in materials and workmanship for a period of one 1 year from the date the warranty period begins Applied Biosystems will repair or replace at its discretion all defective components during this warranty period Applied Biosystems warrants the Genomic Solutions HydroShear DNA Shearing Device will be free of defects in materials and workmanship for a period of one 1 year from the date the warranty period begins Applied Biosystems will replace a defective Hydroshear DNA Shearing Device during the warranty period The following parts of the Hydroshear are user replaceable and not
239. tective equipment when handling chemicals for example safety glasses gloves or protective clothing For additional safety guidelines consult the SDS Minimize the inhalation of chemicals Do not leave chemical containers open Use only with adequate ventilation for example fume hood For additional safety guidelines consult the SDS Check regularly for chemical leaks or spills If a leak or spill occurs follow the manufacturer s cleanup procedures as recommended in the SDS Comply with all local state provincial or national laws and regulations related to chemical storage handling and disposal SOLID 4 System Library Preparation Guide Appendix Safety Chemical safety SDSs About SDSs Chemical manufacturers supply current Safety Data Sheets SDSs with shipments of hazardous chemicals to new customers They also provide SDSs with the first shipment of a hazardous chemical to a customer after an SDS has been updated SDSs provide the safety information you need to store handle transport and dispose of the chemicals safely Each time you receive a new SDS packaged with a hazardous chemical be sure to replace the appropriate SDS in your files Obtaining The SDS for any chemical supplied by Applied Biosystems is available to you free 24 SDSs hours a day To obtain SDSs 1 Go to www appliedbiosystems com click Support then select SDS 2 In the Keyword Search field enter the chemical name product name SDS part nu
240. ted DNA The adaptors contain the EcoP151 restriction site that ultimately is used to make 25 to 27 bp genomic DNA mate paired tags The EcoP151 CAP Adaptors are included in double stranded form in the SOLiD Mate Paired Library Oligos Kit SOLID 4 System Library Preparation Guide 91 92 Chapter 3 Mate Paired Library Preparation Workflow Size select the DNA Depending on the desired insert size range the ligated purified DNA is run on a 0 8 or 1 agarose gel The correctly sized ligation products are excised and purified using the SOLiD Library Quick Gel Extraction Kit Size selection after CAP adaptor ligation removes unbound CAP adaptors Size selection should not be skipped under any circumstances Contamination of unbound CAP adaptors can compromise the circularization reaction in the next step Circularize the DNA Sheared methylated DNA ligated to EcoP151 CAP Adaptors is circularized with a biotinylated internal adaptor To increase the chances that ligation will occur between two ends of one DNA molecule versus two different DNA molecules a very dilute reaction is used The circularization reaction products are purified using the SOLiD Library Micro Column Purification Kit The Internal Adaptor is included in double stranded form in the SOLiD Mate Paired Library Oligos Kit Isolate the circularized DNA Plasmid Safe ATP Dependent DNase is used to eliminate uncircularized DNA After the Plasmid Safe DNase treat
241. tes eser enera nee eE EEA EE ete nen enn teens 236 Iallb rcu c P 236 Degas the Waterers vaste ek ree rex an A HR Ro eR aes e RS 236 Set the chiller sers ie s mh sest tka SERT Ron Ba RR e EO es 236 Perform required maintenance of the Covaris S2 System 236 E Covaris S2 System Programs sse cece cece eens 237 Fragment library preparation standard express and barcoded 237 Mate paired library preparation 0 00 cece ccc eee 237 gt kel ke o 2 x 0 e fe lt A 7 E op N a lt n a 3 SOLID 4 System Library Preparation Guide 235 e Appendix G Covaris S2 System Operation notes Operation notes W Note For important instrument safety information refer to the Covaris S2 System manual Fill the tank Fill the tank with fresh deionized water to the proper fill line The water should cover the visible part of the tube Degas the water Degas the water for 30 minutes To maintain degassed water keep the pump continuously on during operation and sample processing Set the chiller Set the chiller temperature to between 2 to 5 C to ensure that the temperature reading in the water bath displays 5 C The circulated water chiller should be supplemented with 2096 ethylene glycol Perform required The Covaris S2 System requires regular maintenance to work properly Perform the maintenance of the tasks in the table
242. the DNA with a SOLiD Library purification column SOLID 4 System Library Preparation Guide 143 RU Eo o 2 K e ES Aeq yuswbes4 pepooueg p 19 deyo 4 Chapter 4 Barcoded Fragment Library Preparation Gel purify the libraries 9 Pool any remaining libraries that will be combined into a single emulsion refer to the SOLiD 4 System Templated Bead Preparation Guide PN 4448378 or the Applied Biosystems SOLiD EZ Bead Emulsifier Getting Started Guide PN 4441486 Sample wells EM 250 bp marker Collection wells Figure 24 Elution of 240 to 270 bp region from a SOLiD Library Size Selection gel STOPPING POINT Store the purified DNA in Elution Buffer E1 at 20 C or proceed directly to the Applied Biosystems SOLiD 4 System Templated Bead Preparation Guide PN 4448378 or the Applied Biosystems SOLiD EZ Bead Emulsifier Getting Started Guide PN 4441486 144 SOLID 4 System Library Preparation Guide Appendix A Required Materials This appendix covers E Prepare a standard fragment library 0 0 0 0 0c cee eee 146 E Prepare an express fragment library 0000 c eee eee 151 E Prepare a2 x 50 bp mate paired library 0 0 ccc eee 154 E Prepare a2 x 25 bp mate paired library 0 2 0 0 cee eee eee 162 E Prepare a barcoded fragment library 00 0 168 gt o o o 2 2 x gt D D a m D D o SOLID 4 System L
243. the column s to elute the DNA then let the column s stand for 2 minutes 10 Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute 11 Add the eluate from step 10 back to the column s then let the column s stand for 2 minutes Repeat step 10 12 If necessary pool the eluted DNA STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C for short term storage or at 20 C for long term storage or proceed directly to Quantitate the library by performing quantitative PCR qPCR Quantitate the library by performing quantitative PCR qPCR Quantitate your library by quantitative PCR For a protocol using the SOLiD Library TaqMan Quantitation Kit PN 4449639 see Appendix B SOLiD 4 System Library Quantitation with the SOLiD Library TaqMan Quantitation Kit on page 173 STOPPING POINT Store the DNA in Elution Buffer E1 at 4 C for short term storage or at 20 C for long term storage or proceed directly to Pool the barcoded libraries on page 142 SOLiID 4 System Library Preparation Guide 141 4 Chapter 4 Barcoded Fragment Library Preparation Pool the barcoded libraries Pool the barcoded libraries Q IMPORTANT If you Pooled the libraries after ligation of the Multiplex P1 and Multiplex P2 Adaptors then skip this step and proceed to Gel purify the libraries Are working with libraries of dissimilar sizes then do not pool the libraries until a
244. the high level of specificity required by ePCR and can accurately measure extremely low quantities of DNA allowing the user to dilute SOLiD libraries to very low concentrations for quantitation The SOLiD Library TaqMan Quantitation Kit contains the following validated reagents for qPCR SOLiD Library qPCR Mix an optimized master mix of qPCR reagents including DNA polymerase and dNTPs TaqMan Assay for SOLiD Library Quantification Ac00010015a1 a fluorogenic probe based qPCR detection assay SOLiD Library qPCR Standard a validated pre quantified ready to use standard specifically designed for quantifying SOLiD libraries in qPCR The kit is designed to quantify libraries accurately regardless of size can be used on any real time instrument and is compatible with both fast and standard cycling programs The TaqMan Assay Ac00010015a1 provides more specificity and accuracy in detecting amplifiable templates over non probe based quantitation methods The validated ready to use qPCR standard requires only a simple serial dilution for use in qPCR It can also be used to determine the optimal concentration of template to use in ePCR The highly robust qPCR mix can accommodate a wide range of cycling conditions and reaction volumes and combines highly sensitive detection with a broad quantification range In qPCR the qPCR Standard and unknown library template are amplified using two sequence spec
245. through dsDNA is bound to the column Uu 0 ge o E e E 4 Repeat steps 2 and 3 until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s Aeq peureq eie N 4e1deuo 5 Add 650 uL of Wash Buffer W1 with ethanol to wash the column s 6 Centrifuge the column s at 10 000 x g for 1 minute then discard the flow through Repeat centrifugation at maximum speed to remove residual wash buffer 7 Transfer the column s to clean 1 5 mL LoBind tube s 8 Add 50 uL of Elution Buffer E1 to the center of the column s to elute the DNA then let the column s stand for 1 minute at room temperature 9 Centrifuge the column s at maximum speed for 1 minute 10 Add the eluate from step 9 back to the column s then let the column s stand for 1 minute at room temperature 11 Centrifuge the column s at maximum speed for 1 minute 12 Ifnecessary pool the eluted DNA STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Size select the DNA on page 104 SOLID 4 System Library Preparation Guide 103 3 Chapter 3 Mate Paired Library Preparation Size select the DNA Size select the DNA Size select the DNA with an agarose gel 104 1 Determine the appropriate percentage of agarose gel needed to size select DNA see Table 37 Table 37 Percent agarose gel needed to size select DNA De
246. tic rack for at least 1 minute After the solution clears remove and discard the supernatant DNA complex CONRES Table 44 Prepare 1x Ligase Buffer e Component Volume pL E 5X Ligase Buffer 120 v os Nuclease free Water 480 3 Ri Total 600 B vU O D zm SH E on g lt 3 Resuspend the beads in 500 uL of Bead Wash Buffer then transfer the beads to a new 1 5 mL LoBind tube Vortex the beads for 15 seconds then pulse spin 4 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 5 Resuspend the beads in 500 uL of Bead Wash Buffer Vortex the beads for 15 seconds then pulse spin 6 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 7 Repeat steps 5 and 6 once 8 Resuspend the beads in 500 uL of 1X Ligase Buffer Vortex the beads for 15 seconds then pulse spin 9 Place the tube in a magnetic rack for at least 1 minute After the solution clears remove and discard the supernatant 10 Resuspend the beads in 94 uL of 1X Ligase Buffer SOLID 4 System Library Preparation Guide 115 Chapter 3 Mate Paired Library Preparation Ligate P1 and P2 Adaptors to the DNA Ligate P1 and P2 Adaptors to the DNA 116 1 Calculate the amount of P1 and P2 Adaptors needed for the ligation reaction based on the amount of circularized DNA from Isolate the circularized DNA on
247. tion Kit This appendix covers OE a i ee Roe eh e EAA HARE RRL APOE RES OAS nhs aA e ede 174 B Materials and equipment required 00 0 eee eee eee eee 176 B Workflow cesso Ghia a eed odd nade ad eee IRE eet GERE 177 Bib 4 045 04 nin ate nindseei tio heiidas 4 sodas dea Ghedat ideas 178 B The qPCR protocol 1 0 0 0 cece I 179 B Example data 0 2 0 cence A n eens 181 E Determine the optimal library concentration for ePCR 4 183 E Troubleshooting sc cese seme e eet e c ees EXER gen e s 184 oS c o 95 25 zac m cm B x ow 2 0 Ee 5 dE U 2 ep lon EU Oo 23 d 9a E lt 3 SOLID 4 System Library Preparation Guide 173 3 Appendix B SOLID 4 System Library Quantitation with the SOLID Library TaqMan Quantitation Kit Overview Overview Purpose of the kit Advantages of the kit The TaqMan Assay 174 A key component of SOLID system sequencing is emulsion PCR ePCR which involves monoclonal amplification of individual species of template DNA from a complex library pool During ePCR multiple copies of a single DNA sequence are coated onto a single 1 um magnetic bead within a water in oil emulsion droplet For optimal monoclonal amplification precise quantification of the input library is critical Quantitative PCR qPCR is the preferred method for determining the amount of amplifiable template ina SOLiD library Quantitative PCR provides
248. tion of DNA Component Amount 9 5 Ke dNTP 10 mM X 80 uL o Nick Translation Buffer 10 uL 2 Ss DNA Xng E z Nuclease free Water Variable 2 y a Total 100 Y uL m t If X lt 400 ng use 5 uL je 8 If X 1 ug divide the DNA into 1 ug aliquots then set up parallel nick translation reactions g lt Example For 200 ng of circularized DNA because X 400 ng 4 uL DNA polymerase I 10 U LL is required Mix the reaction mix components Component Amount dNTP 10 mM 5 uL Nick Translation Buffer 10 uL DNA 200 ng Nuclease free Water Variable Total 96 uL 3 Incubate the mix without DNA polymerase I at 5 C in a thermocycler for for approximately 5 minutes 4 In a 0 2 mL tube add Y uL of DNA polymerase I then pulse spin 5 Incubate the DNA polymerase I at 5 C in a thermocycler for at least 1 minute 6 Set the timer to 9 minutes hM Note Incubating the nick translation reaction for 8 to 10 minutes at 5 C E on a calibrated thermocycler generates a final library with the desired size 7300 bp If necessary adjust the reaction time on the same thermocycler according to the results from the first library 7 Transfer all of the reaction mix to the tube containing the DNA polymerase I incubating at 5 C then pipet up and down the total reaction mix 5 times to mix 8 Start the timer 9 Prepare 400 uL of Binding Buffer B2 S with isopropanol 5
249. toc htm Occupational Safety and Health Standards Bloodborne Pathogens 29 CFR 1910 1030 www access gpo gov nara cfr waisidx 01 29cfr1910a 01 html e Your company s institution s Biosafety Program protocols for working with handling potentially infectious materials Additional information about biohazard guidelines is available at www cdc gov 252 SOLID 4 System Library Preparation Guide barcode barcoded fragment library EcoP15I CAP Adaptor fragment library Internal Adaptor library Library PCR Primer 1 Library PCR Primer 2 LMP CAP Adaptor mate paired library Multiplex Library PCR Primer 1 Multiplex P1 Adaptor Multiplex P2 Adaptor SOLiID 4 System Library Preparation Guide Glossary Unique sequence identifier added to the sample during library construction Fragment library with a barcode sequence appended to the 3 end of the sheared DNA fragments Double stranded oligonucleotide 7 to 9 bases long containing the EcoP15I restriction sequence that is ligated to a sheared DNA insert during 2 x 25 bp mate paired library construction Library consisting of a sheared DNA fragment with P1 and P2 Adaptors ligated to the 5 end and 3 end respectively Double stranded oligonucleotide 20 bases long used to circularize DNA during mate paired library construction Set of DNA tags prepared from the same biological sample to be sequenced on the SOLiD System Single stranded olig
250. uM oligonucleotide A and 50 uM oligonucleotide B in 1X Ligase Buffer 4 Hybridize the oligonucleotides by running the following program on a PCR machine see Table 92 on page 188 SOLID 4 System Library Preparation Guide 187 gt ko ge 0 a x O ep iS ko E v E o 3 D I 9 e 0 Q S o 2 C Appendix C Supplemental Procedures Hybridize oligonucleotides Table 92 Hybridization protocol Temperature C Time minutes 95 5 72 60 50 40 30 20 10 4 w l 0 0 o a Oi 8 STOPPING POINT After hybridization store the 50 uM hybridized oligonucleotides at 20 C until ready for use in library construction 188 SOLID 4 System Library Preparation Guide Appendix C Supplemental Procedures Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer The Thermo Scientific NanoDrop 1000 Spectrophotometer measures nucleic acid samples up to 3700 ng uL without dilution Materials and Table 93 Required equipment equipment required Item Source NanoDrop ND 1000 Spectrophotometer computer required Thermo Scientific ND 1000 Pipettors 20 uL Sub ple MESS upplier t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance For the SDS of any chemical not distributed by Ap
251. uction adaptor design as they do not have 3 sequences compatible with the sequencing primers MITTERET MENDES rimiersimienwmisiiismissPsmEESdSBPsmSE mEBgBPBpuiPBPEpSg cd Mil od BD AL dh ad LAL ob cd Ladd dh cd LBL ad ad LiL id LOM LBL OBL ad ad DT ad LAB Nad LBL od LAM Lk ad bd fk Lad A dL Ob EU 9 F ied xe ot 0 N TI o Ke 3 D E o f z lt ae y 0 o ied 9 el JOUDOULILIDOUDDUPUDSBIB5EDPDDDDUD D JOEESEUOUDOUBSDDSSOUDUISBEBDEESUOPBDUDU Figure 4 Fragment library amplification design This chapter is organized into two sections Section 2 1 describes how to generate a fragment library using gel based size selection Section 2 2 describes how to generate a fragment library without gel based size selection SOLID 4 System Library Preparation Guide 15 2 Chapter 2 Fragment Library Preparation Materials and equipment required Section 2 1 Prepare a standard fragment library This protocol is designed for 10 ng to 5 ug of genomic DNA or ligated PCR product You should modify the protocol with any change in the starting amount of DNA If you are constructing a targeted resequencing library with small sized PCR products S500 bp then you must perform a PCR product ligation step For a concatenation protocol contact your field applications specialist Materials and equipment required See Appendix A on page 145 for a list of equipment kits and consumables necessary
252. uge tube e Covaris 2 series Machine Holder for one 13 mm x 65 mm tube e Covaris 2 Series Machine Holder for one microTUBE e Covaris microTUBE Prep Station e Covaris Water Tank Label Kit e Covaris microTUBEs 1 pack of 25 For system materials summary refer to Covaris S2 System Materials Summary SOLiD 4 System Site Preparation Guide PN 4448639 Microcentrifuge 5417R refrigerated without rotor Eppendorf 022621807 120 V 60 Hz e Eppendorf 022621840 230 V 50 Hz FA 45 24 11 fixed angle rotor 24 x 1 5 2 mL including aluminum lid aerosol tight EppendorfS 022636006 96 well GeneAmp PCR System 9700 Applied Biosystems thermal cycler N8050200 Base Applied Biosystems 4314443 Block NanoDrop ND 1000 Spectrophotometer Thermo Scientific computer required ND 1000 Labquake Rotisserie Rotator WR Barnstead Thermolyne 56264 312 SOLID 4 System Library Preparation Guide Appendix A Required Materials Prepare a 2 x 50 bp mate paired library Table 68 Required equipment Product Name Vendor 6 Tube Magnetic Stand Applied Biosystems or AM10055 DynaMag 2 Magnet Invitrogen 123 21D E Gel iBase and E Gel9 Safe Imager Invitrogen Combo Kit G6465 Safe Imager 2 0 Blue Light Transilluminator Invitrogen or G6600 Safe Imager Blue Light Transilluminator Invitrogen 37102 Gel
253. uld be approximately 165 bp before adaptor ligation 7 10 pg 1 pmol 1 Xpmol ug DNA 1 gg DNA x dug i 660 pg Average insert size X pmol 1 uL adaptor needed Y uL adaptor needed ug DNA x Ta DNA ug DNA x 30 x 50 pmol Example For 1 ug of purified end repaired DNA with an average insert size of 165 bp 2 10 pg 1 pmol 1 E X pmol ug DNA 1pgDNA 1 ug i 660 pg 165 9 2 pmol ug DNA E 9 2 pmol 1 uL adaptor needed Y uL adaptor needed 1ggDNA x Tig DNA x 30 x B pmo 5 5 uL adaptor needed 2 Combine and mix the following components see Table 4 Table4 Ligation mix Component Volume pL P1 Adaptor ds 50 pmol uL Y P2 Adaptor ds 50 pmol uL Y 5X T4 Ligase Buffer 40 DNA 48 to 50 TA Ligase 5 U uL 10 Nuclease free Water Variable Total 200 3 Incubate the mixture at room temperature for 15 minutes 1 Add 4 volumes 800 uL of Binding Buffer B2 L with 40 isopropanol to the sample 2 Apply approximately 700 uL of the ligated DNA in the binding buffer to the column s The maximum yield of DNA can be achieved if the amount of DNA loaded to a PureLink column is lt 5 ug Use more columns if necessary SOLID 4 System Library Preparation Guide Section 2 1 Prepare a standard fragment library 2 Ligate P1 and P2 Adaptors to the DNA 3 Let the column s stand for 2 minutes at room temperature 4 Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute then discard the
254. ultiplex P2 Adaptors to the DNA 137 S B B Nick translate then amplify the library 0 0 00 cece ee eee 140 3 B Quantitate the library by performing quantitative PCR qPCR 141 E Pool the barcoded libraries liiis 142 5 B Gel purify the libraries lise 142 SOLID 4 System Library Preparation Guide 127 A Chapter 4 Barcoded Fragment Library Preparation Overview Overview 128 Genomic DNA Sheared DNA This chapter describes the method to generate a fragment library 150 to 180 bp before adaptor ligation tagged with a unique sequence identifier or barcode to enable multiplexed sequencing analysis This method involves shearing DNA into small fragments and ligating Multiplex P1 and Multiplex P2 Adaptors specific for barcoded library preparation see Figure 20 TL P1 P2 Ligated Library Molecule Figure 20 Basic barcoded fragment library preparation workflow overview The Multiplex P2 Adaptor consists of 3 segments of sequence 1 Internal adaptor sequence which is necessary for sequencing the barcode 2 Barcode sequence 3 P2 adaptor sequence which is used for library amplification and emulsion PCR The Multiplex P1 Adaptor is a truncated version of the standard P1 Adaptor The Multiplex P1 Adaptor is shorter to make up for the increased length of the Multiplex P2 Adaptor Different libraries to be multiplexed in the same sequencing run are ligated to Multiplex P
255. until the entire sample has been loaded onto the column s Place the column s back into the same collection tube s Add 650 uL of Wash Buffer W1 to wash the column s Centrifuge the column s at 210 000 x g 13 000 rpm for 2 minutes then discard the flow through Repeat to remove residual wash buffer Air dry the column s for 2 minutes to evaporate any residual alcohol Transfer the column s to clean 1 5 mL LoBind tube s Add 50 uL of Elution Buffer E1 to the column s to elute the DNA then let the column s stand for 2 minutes SOLID 4 System Library Preparation Guide Chapter 4 Barcoded Fragment Library Preparation 4 Ligate Multiplex P1 and Multiplex P2 Adaptors to the DNA 10 Centrifuge the column s at 210 000 x g 13 000 rpm for 1 minute 11 Add the eluate from step 10 back to the column s then let the column s stand for 2 minutes Repeat step 10 12 If necessary pool the eluted DNA 13 Ifthe starting DNA input amount is 2500 ng quantitate the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer see Quantitate the DNA with the NanoDrop ND 1000 Spectrophotometer on page 189 Ifthe starting DNA input amount is lt 500 ng assume 70 recovery of input material after shearing STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Ligate Multiplex P1 and Multiplex P2 Adaptors to the DNA RU Eo o 2 K
256. ute After the solution clears remove and discard the supernatant 7 Resuspend the beads in 30 uL of Elution Buffer E1 STOPPING POINT Store the DNA Bead complexes in Elution Buffer E1 at 4 C or proceed directly to Trial amplify the library on page 78 SOLiID 4 System Library Preparation Guide 77 3 Chapter 3 Mate Paired Library Preparation Trial amplify the library Trial amplify the library Perform 1 Prepare a PCR master mix for amplification reactions see Table 28 Trial PCR on the library Table 28 PCR master mix for amplification of the library Component Volume pL Platinum PCR Amplification Mix 70 Library PCR Primer 1 50 uM 1 4 Library PCR Primer 2 50 uM 1 4 Total 72 8 t Platinum PCR Amplification Mix contains a proofreading enzyme for high fidelity amplification 2 Vortex the master mix For the negative control transfer 23 uL of the PCR master mix to a PCR tube Label the tube PCR 0 3 Add 4 uL of DNA bead complex solution to the remaining 49 8 uL of PCR master mix Vortex the mix then divide evenly 25uL between two PCR tubes labelled PCR 1 and PCR 2 4 Run see Table 29 Table 29 PCR conditions to amplify the library Stage Step Temp Time Holding Denature 94 C 3 min Cycling Denature 94 C 15 sec Anneal 62 C 15 sec Extend 70 C 1 min Holding Extend 70 C 5 min Holding 4 C co t Tube 1 10 c
257. ve PCR qPCR The library is quantitated by using the SOLiD Library TaqMan Quantitation Kit PN 4449639 described in Appendix B SOLiD 4 System Library Quantitation with the SOLiD Library TaqMan Quantitation Kit on page 173 Adjust microcentrifuge speeds and times according to the g forces specified in the protocols Applied Biosystems recommends the Eppendorf 5417R tabletop microcentrifuge Perform all steps requiring 0 5 mL and 1 5 mL tubes with Eppendorf LoBind Tubes Thaw reagents on ice before use SOLID 4 System Library Preparation Guide Section 2 1 Prepare a standard fragment library 2 Shear the DNA Shear the DNA D IMPORTANT Ensure that the bath temperature during shearing is between 5 to 10 C Higher shearing temperatures can be harmful to DNA 1 Dilute the desired amount of DNA to 100 uL in 1X Low TE Buffer in a LoBind tube see Table 2 Table 2 Dilute the DNA for shearing Component Amount DNA 10 ng to 5 ug 1X Low TE Buffer Variable Total 100 uL 2 Place a Covaris microTUBE into the loading station Keep the cap on the tube and use a tapered pipette tip to slowly transfer the 100 uL of DNA sample through the pre split septa Be careful not to introduce a bubble into the bottom ofthe tube o F 5 xe et vA N TI o Ke zi 2 E lop ES 5 lt 0 ge Sy E fe 3 Shear the DNA using the following Covaris S2 System
258. with the sequencing primers SOLID 4 System Library Preparation Guide 129 4 Chapter 4 Barcoded Fragment Library Preparation Overview P 3319131 41a 31911 a lA A aa 3 ae 3 3 4 a af 2560750 tM SIMI ad bd id od TT A a Figure 22 Barcoded fragment library amplification design This chapter describes how to generate a barcoded fragment DNA library For RNA applications an alternative method to generate barcoded libraries is described in the protocols for the SOLiD RNA Barcode Module 1 16 PN 4427046 SOLiD RNA Barcode Module 17 32 PN 4453189 and SOLiD RNA Barcode Module 33 48 PN 4453191 130 SOLID 4 System Library Preparation Guide Chapter 4 Barcoded Fragment Library Preparation 4 Prepare a barcoded fragment library Prepare a barcoded fragment library The protocol is designed for 500 ng to 5 ug of genomic DNA or ligated PCR product If the starting amount of genomic DNA is outside the range of 500 ng to 5 ug you should modify the protocol For technical assistance contact your local field application specialist If you are trying to construct a targeted resequencing library with small sized PCR products lt 500 bp then you must first perform a PCR product ligation step For a concatenation protocol contact your field application specialist Materials and equipment required The SOLID Fragment Library Barcoding Kit should be used together with a SOLID Fragment Library Construction Kit See A
259. x 65 mm borosilicate tube dilute 5 to 20 ug of DNA in 500 uL so that the final volume contains 20 glycerol in Nuclease free Water see Table 33 Table 33 Dilute the DNA for shearing Component Amount UltraPure Glycerol 100 uL DNA 5 to 20 ug Nuclease free Water Variable Total 500 uL 2 Shear the DNA with 1 the HydroShear DNA Shearing Device 96 Shear the DNA using the Covaris S2 System shearing program described Table 32 on page 95 Transfer 500 uL of sheared DNA into a clean 1 5 mL LoBind tube Wash the borosilicate tube with 100 uL of Nuclease free Water and transfer the wash to the 1 5 mL LoBind tube Mix by vortexing and then proceed to Purify the DNA with the SOLID Library Column Purification Kit on page 97 In 1 5 mL LoBind Tubes dilute 5 to 20 ug of DNA to 150 uL with Nuclease free Water If you are starting with gt 20 pg split the DNA into lt 20 pg aliquots and shear each aliquot in 150 uL volume For better coverage of large and complex genomes more DNA should be used if it is available On the Edit Wash Scheme tab specify the solution and cycles 2cycles WS1 0 2 N HCl 2cycles WS2 0 2 N NaOH 3 cycles Nuclease free Water Run the wash scheme on the HydroShear Adjust the speed code SC and number of cycles according to Table 32 on page 95 and adjust the volume setting to 150 uL Begin shearing Repeat the shearing for the other aliquot of DNA if applicab
260. x Library PCR 2 50 uM e Barcodes 001 096 50 uM Preparation of 96 barcoded fragment libraries SOLID Fragment Library Barcoding Kit Module 1 16 4444837 SOLiD Fragment Library Barcoding Module 17 32 4449636 SOLiD Fragment Library Barcoding Module 33 48 4449635 SOLiD Fragment Library Barcoding Module 49 64 4449641 SOLiD Fragment Library Barcoding Module 65 80 4449642 SOLiD Fragment Library Barcoding Module 81 96 4449643 Multiplex Library P1 Adaptor 50 uM Multiplex Library PCR 1 50 uM Multiplex Library PCR 2 50 uM o Barcodes 0XX 50 uM Preparation of 16 barcoded fragment libraries SOLiD Fragment Library Construction Kit with Size Selection Gels 4443471 8 SOLiD Fragment Library Enzyme Core Kit e 5X End Polishing Buffer e dNTP 10 mM e End Polishing Enzyme 1 e End Polishing Enzyme 2 DNA end repair e 5X Ligase Buffer e T4 DNA Ligase Ligation of P1 and P2 Adaptors Platinum PCR Amplification Mix Nick translation library amplification SOLID Library Column Purification Kit DNA end repair ligation of P1 and P2 Adaptors and nick translation library amplification SOLiD Library Size Selection Gels 10 gels Size selection t Applied Biosystems has validated this protocol using this specific material Substitution may adversely affect system performance For the SDS of any chemical
261. x the following components where X is the volume in uL of DNA and Y is the number of micrograms of DNA used in the circularization reaction see Table 18 Table 18 Mix for DNase treatment of DNA Component Volume pL ATP 25 mM 5 10X Plasmid Safe Buffer 10 Plasmid Safe DNase 10 U uL Y 3 DNA X Nuclease free Water Variable Total 100 Use 1 uL of Plasmid Safe DNase 10 U uL if Y lt 3 ug If X gt 80 uL adjust the total reaction volume accordingly The volume of ATP and 10X Plasmid Safe Buffer should be proportional to the total reaction volume Example For 2 ug DNA used in the circularization reaction Mix for DNase treatment of DNA Component Volume pL ATP 25 mM 5 10X Plasmid Safe Buffer 10 Plasmid Safe DNase 10 U uL 1 DNA 25 Nuclease free Water 59 Total 100 2 Incubate the reaction mixture at 37 C for 40 minutes SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Isolate the circularized DNA Purify the DNA with 1 Pre spin empty PureLink Micro columns in collection tubes at 10 000 x g for the SOLiD Library 1 minute before use Micro Column Purification Kit 2 Add 4 volumes of Binding Buffer B2 S with isopropanol 55 to 1 volume of sample Mix well 3 Apply the sample in the binding buffer to the PureLink Micro column s in collection tube s uolyesedaid 4 Let the
262. ycles Tubes 0 and 2 14 cycles Confirm library 1 Mix 0 5 uL of 1 ug uL 100 bp DNA Ladder Invitrogen 10628 050 with 40 uL amplification with a of Nuclease free Water 296 E Gel9 EX Gel 2 Load 20 uL of PCR 0 PCR 1 and PCR 2 into separate wells of a 2 E Gel EX Gel Load 20 uL of diluted 100 bp DNA Ladder in an adjacent well for reference Do not add any loading dye to the samples or DNA Ladder 3 Run the E Gel EX Gel on an E Gel iBase Power System according to the manufacturer s instructions for 10 minutes 78 SOLID 4 System Library Preparation Guide Section 3 1 Prepare a 2 x 50 bp mate paired library 3 Trial amplify the library 4 Take a picture of the gel see Figure 12 Ideally the size of amplified library should be between 275 and 325 bp but any size of amplified library ranging from 250 to 350 bp is acceptable Choose a PCR cycle where amplified library products are just visible on the gel Based on the intensity of the products increase or reduce up to 2 cycles for final library amplification U 6 o o EX E e E Aeq peureq eie N 4e1deuo Figure 12 Mate paired library trial amplification sample run on a 296 E Gel EX Gel M 100 bp DNA Ladder Lane 1 PCR 1 10 cycles Lane 2 PCR 2 14 cycles Lane 3 PCR 0 negative control Based on this picture use 10 cycles for final library amplification STOPPING POINT Store the DNA Bead complexes in Elution Buffer E1 at 4
263. ystem Library Preparation Guide Appendix D Oligonucleotide Sequences Library construction oligonucleotides Multiplex adaptor and barcode sequence Sequence bp Barcode 080 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGTTTACGGTGCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 081 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGAACGTCATTCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 082 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGTGAAGGGAGCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 083 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGGATGGCGTACTGCTGTACGGCCAAGGCG 3 19 52 Barcode 084 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGCGGATGAACCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 085 50 uM 5 CGCCTTGGCCGTACAGCAG3 5 CTGCCCCGGGTTCCTCATTCTCTGGAAAGCGTTCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 086 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTAGTACCAGGACTGCTGTACGGCCAAGGCG 3 19 52 Barcode 087 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTATAGCAAAGCCT GCT GTACGGCCAAGGCG 3 19 52 Barcode 088 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTGTTGATCATGCTGCTGTACGGCCAAGGCG 3 19 52 Barcode 089 50 uM 5 CGCCTTGGCCGTACAGCAG 3 5 CTGCCCCGGGTTCCTCATTCTCTAGGCTGTCTACTGCTGTACGGCCAAGGCG 3 19 52 Ba

SOLiD 4 System Library Preparation Guide

Contents

Download Pdf Manuals

Related Search

Related Contents