service manual ps4 tray stacker
Contents
1. ee nth 59 SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 5 of 63 INTRODUCTION INTRODUCTION SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 7 of 63 INTRODUCTION p rinzen CAUTION This manual must be read by each person before that person adjusts the machine Using this service manual is at your own risk Prinzen cannot be held responsible for any consequential damages to the system caused after using this service manual ATTENCION Cualquier persona que ajusta esta m quina debe leer este manual de manejo antes de ajustar El uso de este manual de manejo es por su propio riesgo Prinzen no puede ser responsible por danos al sistema a causa del uso de este manual de manejo ATTENTION Chacun qui r gle cette machine doit lire le manuel en avant L usage de ce manuel est ses propres risques et p rils Prinzen n est pas responsable pour dommages sur le syst me cause d user de manuel VORSICHT Jeder der diese Maschine einstellen soll mu vorher diese Hinweise lesen Benutzung dieser Hinweise ist auf eigene Rechnung und Gefahr Prinzen ist nicht verantwortlich f r Folgschaden ans System nach Benutzung dieser Hinweise ATTENTIE Een ieder die deze machine afstelt dient vooraf deze handleiding te lezen Gebruik van deze service handleiding is voor uw eigen risico Prinzen kan niet verantwoordelijk worden gesteld voor en2. 40 000 35 000 Electrical cabinet Yes No No Amount of grippers in transfer lift 4 3 3 Infeed conveyor position Low High High Tray detection Retro reflective sensor Diffuse reflective sensor Flap Activate tray stacker Solenoid Solenoid Lever construction SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 33 of 63 CN TRAY STACKER p rinzen Construction The tray stacker consists of 1 Drive mechanism 4 Pusher 2 Transfer lift b Frame 3 Turn table Page 34 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 p rinzen TRAY STACKER 1 The drive mechanism consists of Frequency controlled drive motor Safety slipping clutch Main drive chain Chain tensioners Clutch pusher Clutch turn table transfer lift Start solenoid Turn table transfer lift activator Collision protection disk cam Contra weight Back stopper Turn table transfer lift drive chain Transfer lift drive shaft Transfer lift drive chain Turn table disk cam Pusher activator Pusher cam Pusher cam drive chain Pusher crankshaft flywheel sarpapoop t SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 35 of 63 TRAY STACKER rinzen The drive motor runs continuously The safety slipping clutch prevents damaging the tray stacker when for whatever reason parts of the tray stacke
3. A Prinzen BV system meets the demands mentioned in the European machine guideline CE 4 COPYRIGHT Prinzen BV s This document contains confidential information and information protected by FINZEN copyright of Prinzen BV Reproduction or transmission of any part of this document to third parties or the use thereof is only permitted after express written permission of Prinzen BV V na cM All rights rest with Prinzen BV Aalten The Netherlands Patina nona Written by Visser Machine Services SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 9 of 63 INTRODUCTION p rinzen GENERAL This manual contains important information concerning Safety Installation Adjustments Read and understand this total service manual before starting to adjust the system Beside this manual also knowledge about the operating maintaining and cleaning of the system is necessary for a safe and correct adjustment of the system Also read and understand the complete user manual of the system before starting to adjust it Never change the sequence of procedures as described in this manual SAFETY REGULATIONS Before starting to adjust the system first read this chapter and chapter Safety LEGAL REGULATIONS All safety directions stated in this manual must be observed Along with the safety regulations in this chapter the instructions of the qualified trade organization of your country must be observed to avoid accid
4. P rinzen TRAY STACKER TRAYSTACKER PS4C PSPC TRAYSTACKER PS4C PSPC CAM TIMING FOR 5 EGGS WIDE DISCHARGE CAM TIMING FOR 6 EGGS WIDE DISCHARGE FOR ALL SERIAL NOS FOR ALL SERIAL NOS KH HK HX 22 780 HIGH OUTFEED 780 HIGH OUTFEED GRIPPER POSITION GRIPPER POSITION ALIGN CAM FOLLOWER WITH HOLE 5 IN CAM USING 4mm ALLEN KEY mn AT 12 O CLOCK POSITION ALIGN CAM FOLLOWER WITH HOLE 6 IN CAM USING 4mm ALLEN KEY SHAFT KEYWAYS AT 12 O CLOCK POSITION HOLE 6 IN CAM HOLE 5 IN CAM 14 Attach the turn table transfer lift drive chain and replace its link 15 Replace the chain tensioner and tens up the turn table transfer lift drive chain 16 Remove the Allen key 17 Place the side covers back 18 Replace drive mechanism cover 19 Place the tray guide on the correct position on the turn table 20 Replace turn plate SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 53 of 63 TRAY STACKER rinzen 21 First make sure the turn plate tray guide is parallel with the transport direction of the tray stacker When this is not the case make a step Do this by manual control or by entering an empty tray into the tray stacker RN 22 Loosen up both setscrews of the pusher l cam drive chain sprocket 23 Turn the pusher cam drive chain until the distance between the pusher cam and the pusher activator is approximately 2 mm 24 Tighten up the setscrews of the pusher cam drive chain sp
5. may damage the system TIP After a frequency inverter has been controlled manually the system may have lost its sequence and a reboot of the system may be necessary power OFF and power ON TIP See the OMRON V1000 User manual for details about this frequency inverter Page 28 of 63 inverters make sure no persons are in danger SERVICE MANUAL PS4 TRAY STACKER FREQUENCY INVERTERS Changing parameter values Follow below procedure to change parameters values Press the up 1 or down 2 button until PAr is visualized on the display Press the enter key 3 to display the parameters Use the Reset button 4 to select a parameter digit Repeat this step and next step until the parameter you want to view is displayed Press the up 1 or down arrows 2 to change the parameter digit Repeat this step and previous step until the parameter you want to view is displayed Press the enter key 3 to display the parameter value Use the Reset button 4 to select a parameter digit Repeat this step and next step until the parameter value is changed Press the up 1 or down 2 button to change the parameter digit Repeat this step and previous step until the parameter is completely changed Confirm the change with the enter key 3 Press the escape key 5 until the DRV LED 6 is ON and F is visible on the display Manually controlling the inverter In
6. of information with a minimum amount of searching The key to easy reference is the Table of contents WHO SHOULD USE THIS MANUAL Dealer The dealer is the person concern that represents Prinzen BV The dealer must take care that its service engineers will read this manual Professional A professional is someone who can assess the duties appointed to him on account of his education knowledge and experience and who can assess the dangers attached thereby avoiding these dangers Service engineer The service engineer is a professional employed by Prinzen or its official dealers The service engineer must read the total manual Owner The owner contractor concern is the person that owns or hires the machine and puts this machine into production The owner must be aware that this service manual is intended to be used by service engineers from Prinzen and its official dealers Since this manual contains valuable information for communication with the Prinzen service department or dealer it is delivered as a part of the system Be aware that using this service manual for adjusting your system is at your own risk Prinzen cannot be held responsible for any consequential damages to the system caused after using this service manual MANUAL INFORMATION Machine type PS4 Tray stacker Manual revision 01 October 2012 SERIAL NUMBER Each machine has a unique serial number printed on its machine tag Note down this serial number to hav
7. starts while the grippers are not completely underneath the turn table plate turn the disk cam a little bit against the direction of rotation 4 Tighten up all 3 bolts of the turn table disk cam drive sprocket again SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 47 0f 63 TRAY STACKER p T zn DANGER Before starting to adjust the pusher timing make sure the tray stacker is switched OFF and protected against switching it on on The drive mechanism is factory set We advise you to consult Prinzen before starting to adjust the drive mechanism Normally this adjustment is only necessary after changing the push out method or after a broken chain or a loosened sprocket Occasionally this adjustment may be necessary after replacement of a broken pusher cam drive chain or its loosened sprocket Follow below steps to adjust the pusher timing 1 First make sure the turn plate tray guide is parallel with the transport direction of the tray stacker When this is not the case make a step Do this by manual control or by entering an empty tray into the tray stacker 2 Loosen up both setscrews of the pusher cam drive chain sprocket 3 Turn the pusher cam drive chain until the distance between the pusher cam and the pusher activator is approximately 2 mm 4 Tighten up the setscrews of the pusher cam drive chain sprocket again 5 Check and make sure tha
8. the pusher arm Lock the pusher arm to its shaft with the set screw Tighten the top side pusher plate Manually move the grippers until both the key of the transfer lift shaft and the key of the turntable transfer lift shaft are on 12 o clock Probably this is the marked gripper position Attach the main drive chain and replace its link Replace the chain tensioner and tens up the main drive chain Replace the turn table base plate on its marked position Replace the tray transfer plate Place the side covers back Replace drive mechanism cover Replace turn plate Make a test run In case of small sequence issues fine tune the start pusher timing or start turn table timing See fine tune drive mechanism timing to fine tune the synchronization of the drive mechanism SERVICE MANUAL PS4 TRAY STACKER Page 63 of 63
9. the tray from the infeed conveyor When a tray pushes against the infeed flap of the PSPC tray stacker via a lever construction the tray stacker is started to remove the tray from the infeed conveyor In the PSPC tray stacker with the manual activator it is possible to start the trays stacker manually Page 40 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 STACKER ADJUSTMENTS TRAY STACKER DANGER Before starting to adjust the tray stacker make sure the tray stacker is switched OFF and protected against switching it on ATTENTION Before starting to adjust any part of the tray stacker first contact the Prinzen service department SAFETY SLIPPING CLUTCH ATTENTION The safety slipping clutch is factory set We advise you to consult Prinzen before starting to adjust this clutch A hook spanner is delivered with the tray stacker for adjusting the slipping force of the safety clutch In case all the parts of the tray stacker are no longer moving but the drive motor is running it may be necessary to raise the slipping force of the safety clutch Before doing this first contact Prinzen Place the hook spanner 1 through the opening 2 on the slotted nut 3 When it is not possible to place the hook spanner on the slotted nut start and stop the tray stacker to change the position of the slotted nut Turn the slotted nut clockwise 4 to raise the slipping force Always d
10. 2 positions on the turn plate available for the tray guide A position for pushing out a stack with 5 eggs wide bottom tray 5 and a position for pushing out a stack with a 6 eggs wide bottom tray 6 Page 46 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 P rinzen TRAY STACKER FINE TUNE DRIVE MECHANISM TIMING DANGER Before starting to fine tune the driving mechanism make sure the tray stacker is switched OFF and protected against switching it on ATTENTION The drive mechanism is factory set We advise you to consult Prinzen before starting to adjust the drive mechanism In case the several movements of the drive mechanism are not properly synchronized it is possible to fine tune this easily When the drive mechanism is not properly synchronized the following occurs starts while the turn table is still rotating Turn table starts while the grippers are not yet completely underneath the turn plate Follow below steps to fine tune the drive mechanism timing 1 Mark the turn table disk cam and its drive sprocket before starting to loosen this connection This is just a precaution to know the initial positions 2 Loosen up all 3 bolts of the turn table disk cam drive sprocket 3 Turn the turn table disk cam a When the pusher starts while the turn table is still rotating turn the disk cam a little bit with the direction of rotation b When the turn table
11. HRONIZE GRIPPERS EET 43 44 TORN re oes 45 TURN 6 nn En nun nn nun nn En Hann ann nn nenn nun nn nn nenn nn nen nenn nn nn nenn nun nn nn nenn nn nn en nn ann n nun 45 THAY G NDE Hn 46 FINE TUNE DRIVE MECHANISM TIMING 0 2 4 44 4 4 4 4 4 4 1 424 1 1 47 PUSHER TIBI sentence Du MIL Sd m Md ML Mi EE 48 CONVERT TRAY STACKER 0 00000 0 0 49 CONVERT PUSH OUTMETHODD 50 REPLACEMENTS ccccccscscscccscccccacacacacavauauauauauauaunanananananatanatauaueueueueueuceeaueueueueuuauauanananavavavavavauaueuauaanenanes 55 TURN TABLE TRANSFER LIFT CLUTCH ze es nennen 56 PU TIER eee areca
12. Place the new pusher shaft in between the side plates Slide the bearing block back against the side plate Replace the rimmed bearing Align the shaft to the correct position The collision protection cam disk should be in line with the turn table transfer lift activator Tighten both bearings to the side plates Lock the shaft to the bearings with the setscrews Take note to tighten one setscrew into the notch in the shaft Replace the turn table transfer lift chain tensioner and tens up its drive chain Remove the tie rap to release the pusher activator Replace the flywheel crankshaft Make Sure it is completely on the pusher shaft The face side of the pusher shaft should be aligned with the face side of the flywheel crankshaft If this is not possible loosen up the bearing block push the flywheel crankshaft completely on the shaft and tighten the bearing block again Lock the flywheel crankshaft to the pusher shaft with the set screw P rinzen SM PS4 01 E 10 2012 33 34 35 36 37 38 39 TRAY STACKER Replace the pusher arm Make sure the bottom side is completely on the shaft The face side of the shaft should be aligned with the face side of the pusher arm Make sure the cam follower slides in the guide of the pusher arm Manually move the grippers to a position where you have easy access to the set screw at the bottom side of the pusher arm and the bolt on the topside of
13. RAYSTACKER PS4 SPEEDPACK CAM TIMING FOR 6 EGGS WIDE DISCHARGE FOR SERIAL NOS UP TO PS4 0040 900mm OUTFEED GRIPPER POSITION BOETES 0000 AT 12 O CLOCK H H HIHHH ROSITION Bam 900 HIGH OUTFEED ALIGN CAM FOLLOWER WITH HOLE 6 IN CAM USING 4mm ALLEN KEY HOLE 5 IN LW TRAYSTACKER PS4 SPEEDPACK CAM TIMING FOR 6 EGGS WIDE DISCHARGE FOR SERIAL NOS PS4 0040 amp UP 780mm OUTFEED GRIPPER POSITION AX X X XX KDS KX SHAFT KEYWAYS SHAFT KEYWAYS AT 12 O CLOCK AT 12 O CLOCK 6 HOH HX POSITION POSITION a atara 780 HIGH OUTFEED 780 HIGH OUTFEED ALIGN CAM FOLLOWER ALIGN CAM FOLLOWER WITH HOLE 5 IN WITH HOLE 6 IN CAM USING 4mm ALLEN KEY USING 4mm ALLEN KEY HOLE 6 IN CAM HOLE 5 IN CAM TRAYSTACKER PS4SM SMARTPACK TRAYSTACKER PS4SM SMARTPACK CAM TIMING FOR 5 EGGS WIDE DISCHARGE CAM TIMING FOR 6 EGGS WIDE DISCHARGE FOR ALL SERIAL NOS FOR ALL SERIAL NOS 16701607079 HK HKRX KH MOH HH HIHHH HH HHHH KOH HOK HHN KOR HK MMK HY HIN HM I 0701170787 0 RAAR _780 HGH OUTFFED EE d 0 LU En EE 0 ze GRIPPER POSITION GRIPPER POSITION SHAFT KEYWAYS ALIGN CAM FOLLOWER SHAFT KEYWAYS ALIGN CAM FOLLOWER AT 12 O CLOCK WITH HOLE 5 IN CAM AT 12 O CLOCK WITH HOLE 6 IN CAM POSITION USING ALLEN KEY POSITION USING 4mm ALLEN KEY HOLE 6 IN CAM SERVICE MANUAL Page 52 of 63 HOLE 5 IN CAM PS4 TRAY STACKER SM PS4 01 E 10 2012
14. S In case the grippers on both sides of the tray stacker are not running synchronized the tray is hanging skew in between both grippers it may be necessary to synchronize the grippers Before doing this first contact Prinzen Loosen up all 3 bolts 1 of one of the transfer lift drive chain sprocket 2 Now manually move the connected gripper 3 up or down 4 to change its position until it is at the same height as the corresponding gripper on the other side of the tray stacker 5 TRAY STACKER rinzen LEVEL GRIPPERS In case the grippers on one side of the tray stacker are not leveled on their vertical movement probably the 3 sprockets of the level chain the drive chain and the transport chain came loose from each other In that case it is necessary to level the grippers Before doing this first contact Prinzen Follow below steps to level the grippers 1 Mark a gripper and the position of this gripper 2 Loosen up the accessible fixing bolts of the 3 sprockets 3 Remove the drive chain from its tensioner 4 Remove the drive chain its link and detach the drive chain 5 Move the grippers until the other fixing bolts are accessible 6 Loosen up these fixing bolts 7 Level the grippers 8 Tighten up the accessible fixing bolts of the 3 sprockets firmly 9 Carefully move the grippers until the other fixing bolts are accessible 10 Tighten up these fixing bolts 11 Move the marked grippe
15. amage to the system Bb Page 16 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 P rinzen SAFETY SAFETY PROVISIONS Before operating the machine the safety devices must be checked for correct functioning Repair or replace safety devices before using the system if they do not work properly Never rely solely on safety devices Always switch off the system and lock up the power source 1 before working on the machine Safety devices are 2 Emergency stop buttons 3 Lockable doors 4 Protective covers Safety switches EMERGENCY STOP BUTTON To stop the machine in case of an emergency the system has one or more emergency stop buttons 2 Only use the emergency stop button in case of an emergency When the emergency stop button is pressed the system stops immediately The button stays mechanically locked so the machine cannot start until it is considered safe to do so Release the emergency stop button by turning it clockwise Do not release the emergency stop button when it is not certain why and by whom it was pressed Personnel working with the system must know the positions of the emergency stop buttons LOCKABLE DOOR Lockable doors are doors that can only be opened with a key 3 The key should only be in possession of a supervisor DANGER Lockable doors safeguard dangerous machine areas These doors are of utmost importance to operate the machine safely Never ope
16. ce the object you need to detect in front of the photo switch yellow LED should remain ON Turn the potentiometer counter clock wise until the yellow LED goes OFF A Set the potentiometer in between A and B position C Now the sensor is adjusted The yellow LED turns ON when an object is detected SM PS4 01 E 10 2012 COMPONENTS ADJUSTMENTS ON while detecting PA18 DIFFUSE REFLECTIVE Follow below procedure to adjust the sensor Align the sensor to its correct position without the object it has to detect The LED 4 should be OFF Turn the potentiometer 5 clockwise until the lt gt LED goes ON A CDD Place the object you need to detect in front of the photo switch LED should remain ON Pd nu Turn the potentiometer counter clock wise Mim until the LED goes OFF Set the potentiometer in between A and B position C Now the sensor is adjusted The LED turns ON when an object is detected SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 27 0f 63 COMPONENT ADJUSTMENTS ATTENTION The parameters of the frequency inverters are factory set We advise you to consult Prinzen before changing these parameters CAUTION Before manually controlling frequency Motors immediately start to move ATTENTION When frequency inverters are manually controlled parts of the system immediately start to move This may result in collision of parts which
17. covers Do not run the tray stacker anymore Switch it OFF and protect it against switching ON ATTENTION Running the system without the side covers will damage the grippers Page 56 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 CX I ea Ww 5 D rinzer STACKER gt In the turn table disk 2 holes present one with a 5 engraved near the hole and one with a 6 engraved near the hole Depending on the push out method the cam follower of the turn table drive arm is in front of one of the holes Push a 4 mm Allen key through the hole and by doing this secure the turn table drive arm to the turn table cam disk Remove the turn table transfer lift drive chain its tensioner Remove the turn table transfer lift drive chain its link and detach the chain Release the main drive chain its tensioner Remove the main drive chain its link and detach the chain Loosen up the setscrews that attach the bearings to the turntable transfer lift shaft Remove the mounting bolts of both bearings Remove the bearings from the side plates Remove the complete shaft with clutch D TRAY STACKER 16 Place the new turntable transfer lift shaft in between the side plates 17 While placing it make sure the back stopper lies on the shaft before replacing the bearings 18 Replace the bearings and tighten them to the side plate
18. e it available when contacting the Prinzen service department Type Tray Stacker Type Tray Stacker Type Tray Stacker Serial No 54 0098 Serial No 54 0106 SM Serial No PS4C 0152 D O M 2012 D O M 2012 D O M 2012 Capacity 40000 eph Capacity 40000 eph Capacity 35000 eph Voltage 380v 50Hz Voltage 380v 50Hz Voltage 380v 50Hz THIS MACHINE IS MANUFACTURED UNDER THIS MACHINE IS MANUFACTURED UNDER THIS MACHINE IS MANUFACTURED UNDER THE FOLLOWING PATENTS GRANTED THE FOLLOWING PATENTS GRANTED THE FOLLOWING PATENTS GRANTED UK 2404909 UK 2404909 UK 2404909 UK 2335177 UK 2335177 UK 2335177 US 09 146774 US 09 146774 US 09 146774 EP 0 937 668 EP 0 937 668 EP 0 937 668 SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 11 of 63 _ INTRODUCTION rinzen SYMBOLS Symbols are used in the manual when special attention caution is required while working on the system The special symbols and their meaning are depicted in the below table Meaning DANGER This symbol is used when instructions should be followed to the letter If not they may result in permanent personal injury or death CAUTION This symbol is used when instructions should be followed to the letter If not they may result in permanent personal injury ATTENTION This symbol is used when instructions should be followed to the letter If not they may cause damage to the system NOTE This symbol advises to use edible products and to work in a hygienicall
19. enenenenenenensnsnsnsnsnsnsnses 11 SERIAL NUMBER cccccccccccccccccccccccccauacauauauavaueucucucucucucucutanutatataneneueneneneueueuaueueuaueueuuuuuuuueueuuuuauauauauavananas 11 12 ADDRESS PRINZEN ccececececccccccccccececececececececeneneueueueuaueusuauausuauaeauauauauauauauauauauauauavauavavaveueuuueuauaenenenenss 12 1 13 elaia 14 SAFETY 5 DEDAL ase ese ese nenn nenn nenn nenn nenn nenn nr nn rennen rennen 15 SAFETY PROVISIONS 1 6 nene nn nenn nenn nenn esa ese ese nenn nenn re nenn nr sese sege gas anant 17 EMERGENGY STOP BUTTON Eam UR SEE een 17 das Se E Be ee 17 PROTE TNE COVER 18 en 18 SAFETY INSPECTION PROCEDURE 2 6 2 ese ese ese esesegege seges seges ss 19 WARNING LABELS ccccccececccccccccccccucucucccucauauauauauauauauaucucucucuusucununanenenaneneneteueueusueusuauauuuuuueuuuuauauavavavanas 20 2 COMPONENT ADJUSTMENTS eenen enen enenenenennnnnnenenenenenenenenenenenenenenenenenseokoesee 23 GENERAL ADJUSTMENTS cccccccccececececececececececeuecscu
20. ents Before starting to adjust the machine always consult the safety manager of the company to discuss if a work permit is required for this job All safety devices installed in the machine by the manufacturer and the indications mentioned in the manuals are conditions to control the machine safely Technical changes which influence the safety working of the machine may only be executed by the service department of Prinzen not change controls and or PLC programs without written permission from Prinzen because this may affect the safety of the machine Only use genuine Prinzen parts or CE certified parts for replacement Prinzen cannot be held responsible for any consequential damages to the system or other installations that were caused by technical changes unprofessional maintenance and repairs on our system which were executed by the dealer or the owner of the system Warranty becomes invalid when consequential damages to the system caused by technical changes unprofessional maintenance and repairs were executed by the dealer or the owner of the system DANGER Failure to obey legal regulations may result in permanent personal injury or death ATTENTION Failure to obey legal regulations may result in damage to the system Page 10 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 rinzen INTRODUCTION HOW TO USE THIS MANUAL The manual is constructed to provide a maximum amount
21. ige schade aan het systeem veroorzaakt door het gebruiken van deze service handleiding Page 8 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 o INTRODUCTION P rinzen Ale LIABILITY Prinzen BV cannot be held responsible for any costs damage or personal injury if its system is not used in accordance with the instructions as described in this manual The information provided in this manual is valid for the standard design of the system Parts of your system may differ from this standard design Since Prinzen BV is constantly improving its systems it may be possible that there are small differences between your system and this manual Though this manual has been put together with the utmost care Prinzen BV cannot accept any responsibility for costs damage or personal injury arising from any fault and or incompleteness in the content of this document GENERAL This manual is intended to be used by service engineers of Prinzen and its official dealers It contains important information concerning safety and adjustment of the Prinzen BV system For uncomplicated functioning of the system read this manual carefully and adjust according to the directions in this manual Beside the design and the used materials also the correct adjustment of the system has great impact on the functioning the life span and the operational costs of the system This manual will help you to gain knowledge for correct adjustment of the system
22. ld be ON 2 Press and hold the teach button for 3 seconds until both LEDs are flashing 3 Place the object you need to detect in between the sensor and the reflector 4 Press the teach button once Now the sensor is adjusted The yellow LED turns OFF when an object is detected SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 25 of 63 COMPONENT ADJUSTMENTS PD30 THROUGH BEAM Adjust the sensor according the below d 2 Push once 3 4 c B D I lim Should be ON ON while detecting Page 26 of 63 SERVICE MANUAL PS4 TRAY STACKER procedure 1 Align the transmitter and the receiver to their correct positions without the object it has to detect Both LEDs on the receiver should be ON Press and hold the teach button on the receiver for 3 seconds until both LEDs are flashing Place the object you need to detect in between the transmitter and the receiver Press the teach button once Now the sensor is adjusted The yellow LED turns OFF when an object is detected TIP Prinzen uses these through beam sensors with the supplier s factory settings Normally it is not necessary to teach new through beam sensors T18 DIFFUSE REFLECTIVE Follow below procedure to adjust the sensor Align the sensor to its correct position without the object it has to detect The green LED 1 should be ON Turn the potentiometer 2 clockwise until the yellow LED 3 goes ON B Pla
23. leased the pressure spring e pushes the clutch plate f against the rotation direction of the clutch housing forcing the 2 pawls g outwards into the ratchet The ratchet catches the pawls and as a result the clutch plate and thus the shaft h starts rotating As soon as the cam and thus the clutch housing is stopped again the ratchet pushes the clutch plate against the force of the pressure spring Now the pawls run against dowels and release the ratchet which starts to run free again The shaft stops rotating Page 36 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 P rinzen TRAY STACKER 2 The transfer lift consists of a Transfer lift drive chain f Gripper b Chain tensioner g Grippers down cam plate c Grippers transport chain h Gripper down cam follower d Grippers leveling chain i Gripper leveling arm e Chain guides When the turn table transfer lift clutch is released its shaft makes 1 revolution The turn table transfer lift drive chain starts running driving the transfer lift drive shaft Via transfer lift drive chains on both sides of this shaft the gripper transport chains and the gripper leveling chains are driven Grippers are attached to the transport chains and via leveling arms to the leveling chains After placing the tray on the turn table during the downward movement the grippers run against the frame and fold in Before picking up trays from the infeed conveyor during the upward mo
24. m cover 4 Check if the trays stacker made a normal stop The key of the transfer lift shaft and the key of the turntable transfer lift shaft should both on 12 o clock 5 Make sure the chain links of the main drive chain is reachable close to 2 clutches When this is not the case make a few steps Do this by manual control or by entering some empty trays into the tray stacker 6 Mark the position of one of the grippers before starting to loosen the connection between the turn table transfer lift shaft and the pusher shaft This is necessary for easy reconnection of the main drive chain at the end of this procedure 7 Remove the side covers Do not run the tray stacker anymore Switch it OFF and protect it against switching ON ATTENTION Running the system without the side covers will damage the grippers SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 59 of 63 10 11 12 p r nzan 1 azer Mark the turn table base plate and remove it This is necessary to create more space for removing the pusher shaft later on in this procedure Pull the spring loaded pusher activator towards the drive motor away from the pusher shaft with clutch and temporarily tighten it there with a tie rap This is necessary to create enough space for removing the pusher shaft later on in this procedure Remove the turn table transfer lift drive chain tensioner Again this is necessary for e
25. n sprocket c Clutch d Collision protection cam disk See the next pages for the replacement procedure of the turn table transfer lift clutch and the pusher clutch SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 55 of 63 TRAY STACKER p rinzen TURN TABLE TRANSFER LIFT CLUTCH For replacement of the turntable transfer lift clutch we deliver a complete new turntable transfer lift shaft including sprockets for the main drive chain and the turn table transfer lift drive chain Follow below steps to replace the turn table transfer lift clutch 1 Loosen up the setscrew and remove the turn plate from its shaft 2 Remove the drive mechanism cover 3 Check if the trays stacker made a normal stop The key of the transfer lift shaft and the key of the turntable transfer lift shaft should both on 12 o clock 4 Make sure the chain links of both chains turn table transfer lift drive chain and main drive chain are reachable close to the shafts When this is not the case make a few steps Do this by manual control or by entering some empty trays into the tray stacker 5 Mark the position of one of the grippers before starting to loosen the connection between the turn table transfer lift shaft and the transfer lift drive shaft This is necessary for easy reconnection of the turn table transfer lift drive chain at the end of this procedure 6 Remove the side
26. nough space to remove the pusher shaft later on in this procedure Release the main drive chain its tensioner Hemove the main drive chain its link and detach the chain CX FN I 5 n wa v LJ J r17Zor 13 Remove the pusher drive arm which is attached to the flywheel crankshaft Loosen the bottom setscrew and top bolt and nut 14 Remove the flywheel crankshaft Loosen up its set screw en slide it from the pusher shaft 15 Manually move the grippers to a position where the turn table drive arm is in its bottom position This is necessary to create enough space for removing the pusher shaft otherwise the turn table drive arm blocks the collision protection cam disk during removal of the pusher shaft 16 Loosen up the setscrews that attach the bearings to the pusher shaft 17 Remove the mounting bolts of both bearings 18 Remove the rimmed bearing from the side plate 19 Slide the bearing block as far as possible on the pusher shaft towards the collision protection cam disk 20 Now move the pusher shaft as far as possible to the bearing block side and remove the complete pusher shaft including the bearing block 21 22 23 24 25 26 27 28 29 30 31 32 Remove the bearing block and its key from the old shaft Place the key in the notch of the new shaft and slide the bearing block on it
27. o this in small steps only turn the slotted nut for a few mm and check if parts of the tray stacker are moving again when the motor is running 5 54 01 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 41 0f 63 TRAY STACKER P rinzen Prinzen advised to set the slipping force at approximately 22 kilo s You can use a spring balance to check this First place a metal bar 5 on the frame of the tray stacker Hang a spring balance 6 to the bar and connect it with a long S hook 7 to a gripper 8 Use a gripper that is moving downwards at the turn table position DANGER Make sure the safety cover and safety door are closed before starting the tray stacker Start the tray stacker When the gripper is moving down the slipping clutch should start slipping when the spring balance indicates approximately 22 kilo s When the coupling starts slipping at a lower indication raise the slipping force When the coupling starts slipping at a higher indication lower the slipping force Page 42 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 Pc gt PAS nr VF A r 2 F A 1 ai P rinzen GRIPPERS Before starting to adjust the grippers make sure the tray stacker is switched OFF and protected against switching it on ATTENTION The grippers are factory set We advise you to consult Prinzen before starting to adjust the grippers SYNCHRONIZE GRIPPER
28. pushed out 6 eggs wide Page 50 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 P rinzen STACKER 9 Rotate the turn table index cam disk until one of the holes in the cam disk is in front of the turn table drive arm In front of hole 5 when the bottom tray should be pushed out 5 eggs wide In front of hole 6 when the bottom tray should be pushed out 6 eggs wide 10 Push a 4 mm Allen key through the hole and by doing this secure the turn table drive arm to the turn table cam disk 11 When the 5 eggs wide push out method should be used push the Allen key through the hole with the 5 engraved 12 When the 6 eggs wide push out method should be used push the Allen key through the hole with the 6 engraved 13 Move the grippers to the correct position This depends on the required push out method and your tray stacker type See the picture on the next page for your specific gripper position SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 51 of 63 TRAY STACKER TRAYSTACKER PS4 SPEEDPACK CAM TIMING FOR 5 EGGS WIDE DISCHARGE FOR SERIAL NOS UP TO PS4 0040 900mm OUTFEED GRIPPER POSITION SHAFT KEYWAYS AT 12 O CLOCK 900 HIGH OUTFEED POSITION ALIGN CAM FOLLOWER WITH HOLE 5 CAM USING 4mm ALLEN KEY PN HOLE 6 CAM nn 4 TRAYSTACKER 54 SPEEDPACK CAM TIMING FOR 5 EGGS WIDE DISCHARGE FOR SERIAL NOS PS4 0040 amp UP 780mm OUTFEED GRIPPER POSITION T
29. r back to its marked position 12 Attach the drive chain and replace its link 13 Place the drive chain back on its tensioner Page 44 0f 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 P rinzen SM PS4 01 E 10 2012 TRAY STACKER TURN TABLE CAUTION Before starting to adjust the turn table make sure the tray stacker is switched OFF and protected against switching it on ATTENTION The turn table is factory set We advise you to consult Prinzen before starting to adjust the turn table TURN PLATE POSITION When the tray stacker is stopped the turn plate should be in line with the transport direction of the tray stacker Follow below steps to adjust this initial position 1 Loosen up the setscrew and remove the turn plate from its shaft 2 Loosen up both lock nuts 3 Turn the turnbuckle to change the shaft position 4 Replace the turn plate But do not yet tighten the setscrew Make sure the turn plate is in line to the transport direction of the tray stacker 5 When the turn plate is not in line to the transport direction of the tray stacker repeat the above step 3 until it is in line 6 When the turn plate is in line with the transport direction of the tray stacker first tighten up the lock nuts Then place the turn plate on its shaft and tighten the setscrew SERVICE MANUAL PS4 TRAY STACKER Page 45 of 63 TRAY STACKER P rinzen TRAY GUIDE There are
30. r jam or when a tray is blocking the mechanism When the solenoid is activated it will release the turn table transfer lift clutch via a lever The contra weight moves the activator up again to stop the clutch after 1 revolution The back stopper stops the reverse rotation of the clutch to prevent continuous decoupling of the clutch During the revolution the turntable transfer lift drive chain starts running Thereby the transfer lift makes 1 step and the turn table disk cam a 12 revolution resulting in a 90 rotation of the turn plate At the same time the pusher cam is driven making a 1 6 revolution After 6 revolutions of the turn table transfer lift clutch the pusher cam made 1 revolution and releases the pusher clutch Because the activator is spring loaded it is pulled backwards again and stops the clutch after 1 revolution Here the flywheel prevents the reverse rotation of the clutch During the revolution the crankshaft with flywheel starts rotating resulting in the forward and backward movement of the pusher plate During the revolution of the pusher clutch the collision protection disk cam disables the turn table transfer lift activator to prevent the possibility to start the turn table transfer lift clutch The clutch The sprocket a is driven by the main drive chain The toothed ratchet b is attached to this sprocket As long as the cam c on the clutch housing d is stopped the ratchet runs free When the cam is re
31. rate the machine when doors are open or not locked because serious injury or death may occur SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 17 of 63 SAFETY Page 18 of 63 p rinzen PROTECTIVE COVER Protective covers 4 shield off dangerous moving parts These covers cannot be removed without tools and should be attached to the system before starting to use it DANGER _ Protective covers safeguard dangerous machine areas These covers are of utmost importance to operate the machine safely Never operate the machine when protective covers are removed because serious injury or death may occur SAFETY SWITCH Safety switches 5 are provided on safety doors or safety covers to prevent the operation of the machine or to stop the machine immediately when this door or cover is opened DANGER Make sure the safety door or safety cover remains open and make sure the system is not able to start when you are inside the system SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 rinzen SAFETY SAFETY INSPECTION PROCEDURE Before starting the machine all protective covers must be in place and doors should be locked The emergency stop buttons and safety switches should be operating Trained personnel must check safety devices on a daily basis to assure proper operation Check emergency stop buttons 2 Start and stop the system Wait until the system has completel
32. rinzen SERVICE MANUAL PS4 TRAY STACKER Prinzen B V Weverij 18 7122 MS AALTEN Box 85 7120 AB AALTEN NEDERLAND Phone 31 0 543 490060 Fax 31 0 543 476205 e mail service prinzen com Website www prinzen com ex m BG SM PS4 01 E 10 2012 TABLE OF CONTENTS CHAPTER INTRODUCTION SAFETY COMPONENT ADJUSTMENTS TRAY STACKER SERVICE MANUAL PS4 TRAY STACKER TABLE OF CONTENTS BOOK Page 3 of 63 rinzen TABLE OF CONTENTS INTRODUCTION nn nn nn nn nn nn nn nn nn nn nn nn nnmnnn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn EEE EEE nn En uw 7 B nee ee 9 GENERAL 9 9 tz zs 10 SAFETY 65 41 6 nenn nn e ase ese ese ese eese ne ne nenn sese rennen 10 LEGAL 65 a agas aaa asa a ananas d d dada aan 10 HOW TO USE THIS 12 0 0 0 00 LAELAE LEARDE LEARDE APARLE ALAALA ADALARDA anaana nnna 11 WHO SHOULD USE THIS 2 0 000 essa ese ese LALEA sese e essa sese nennen 11 MANUAL INFORMATION ccccccecececececececececscccecucecucucacucacauauauaueuauauauavauauauauauauauausunenen
33. rive mechanism needs to be transposed See the next pages for the adjustment procedure to change the push out method SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 49 of 63 TRAY STACKER CONVERT PUSH OUT METHOD Follow below steps to change the push out method 1 Loosen up the setscrew and remove the turn plate from its shaft 2 Remove the drive mechanism cover Check if the trays stacker made a normal stop The key of the transfer lift shaft and the key of the turntable transfer lift shaft should both on 12 o clock 4 Make sure the chain link is reachable close to the shafts When this is not the case make a few steps Do this by manual control or by entering some empty trays into the tray stacker 5 Remove the side covers Do not run the tray stacker anymore Switch it OFF and protect it against switching ON ATTENTION Running the system without the side covers will damage the grippers 6 Remove the chain tensioner 7 Remove the turn table transfer lift drive chain its link and detach the drive chain 8 In the turn table disk cam 2 holes are present one with a 5 engraved near the hole and one with a 6 engraved near the hole Depending on the push out method position the cam follower of the turn table drive arm in front of one of the holes In front of hole 5 when the bottom tray should be pushed out 5 eggs wide In front of hole 6 when the bottom tray should be
34. rn for dangerous voltage inside a cabinet Contacting parts inside this cabinet may result in permanent personal injury or death This sign is used to warn for dangerous movements Keep a safe distance to those parts Disregarding this warning may result in permanent personal injury These signs are used to warn for the danger of limbs being pulled in Keep a safe distance to those parts Disregarding this warning may result in permanent personal injury SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 p rinzen SAFETY These signs are used to warn for crushing danger Keep a safe distance to those parts Disregarding this warning may result in permanent personal injury This sign is used to warn for dangerous movements of a lift Keep a safe distance to the lift Before entering the lift area lock the lift movement mechanically Disregarding this warning may result in permanent personal injury SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 21 of 63 COMPONENTS ADJUSTMENTS 2 COMPONENT ADJUSTMENTS SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 23 of 63 COMPONENTS ADJUSTMENTS GENERAL ADJUSTMENTS SAFETY REGULATIONS Before starting to adjust the system first read the chapters Introduction and Safety PROXIMITY SWITCHES In the Prinzen systems often Omron inductive sensors are used for controlling the positioning of moving parts The distance between the tip of
35. rocket again 25 Make a test run 26 In case of small sequence issues fine tune the start pusher timing or start turn table timing See fine tune drive mechanism timing to fine tune the synchronization of the drive mechanism Page 54 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 P rinzen STACKER REPLACEMENTS DANGER Before starting to replace parts of the tray stacker make sure the tray stacker is switched OFF and protected against switching it on ATTENTION Before starting to replace any part of the tray stacker first contact the Prinzen service department TIP For easier and faster replacement of parts perform the replacement of parts with 2 people Before starting to replace the turn table transfer lift clutch or the pusher clutch 2 first contact the Prinzen service department Only replace a clutch after approval of the Prinzen service department Turn table transfer lift clutch 1 To replace the turn table transfer lift clutch Prinzen delivers a complete new turntable transfer lift shaft This shaft includes Shaft Main drive chain sprocket Clutch Turn table transfer lift drive chain sprocket Back stopper bolt with flexible coupling Pusher clutch 2 To replace the turn table transfer lift clutch Prinzen delivers a complete new turntable transfer lift shaft This shaft includes a Shaft b Main drive chai
36. rsons are at risk Do not use water to clean electricity cabinets and other electronic components For save and easy adjustment keep the machine and the area and floor around the machine clean free of oil grease or obstacles When an extension cable is used for power supply make sure that the cable diameter in relation to the length of the cable is correct Make sure the cable is completely unrolled When the safety devices are put out of operation the machine must first be switched off and secured against accidental switching on Work inside the electrical cabinet may only be undertaken by skilled personnel like Prinzen service engineers or its dealer s service engineers Always switch off the main switch before opening electrical cabinets After switching off the main switch parts inside the electrical cabinet remain live for approximately 1 minute The frequency inverters may hold a high voltage charge during this time Do not touch parts inside the electrical cabinet as long as displays of frequency inverters are on SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 15 0f 63 SAFETY Several parts inside the electrical cabinet maintain voltage even when the main switch is turned off main switch main power supply terminals for egg collecting belts etcetera DANGER Failure to obey safety regulations may result in permanent personal injury or death ATTENTION Failure to obey safety regulations may result in d
37. s 19 Lock the shaft to the bearings with the setscrews Take note to tighten one setscrew into the notch in the shaft 20 Move the marked gripper back to its marked position 21 Make sure the key of the transfer lift shaft is on 12 o clock 22 Rotate the turn table transfer lift shaft until its key is also on 12 o clock 23 Attach the turn table transfer lift drive chain and replace its link 24 Replace the chain tensioner and tens up the turn table transfer lift drive chain 25 Attach the main drive chain and replace its link 26 Replace the chain tensioner and tens up the main drive chain 2 Remove the Allen key 28 Place the side covers back 29 Replace drive mechanism cover 30 Replace turn plate 31 Make a test run 32 In case of small sequence issues fine tune the start pusher timing or start turn table timing See fine tune drive mechanism timing to fine tune the synchronization of the drive mechanism Page 58 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 P rinzen TRAY STACKER PUSHER CLUTCH For replacement of the pusher clutch we deliver a complete new pusher shaft including the sprocket for the main drive chain and the collision protection cam disk Follow below steps to replace the pusher clutch 1 Loosen up the setscrew and remove the turn plate from its shaft 2 Remove the tray transfer plate 3 Remove the drive mechanis
38. se trays Construction The tray stacker consists of a transfer lift a turn table and a pusher Safety The tray stacker is equipped with protective covers and safety doors The entry for the trays and the exit of the stacks is protected by a cover The conveyors supplying the trays and removing the stacks are not completely protected Therefore be cautious with loosely hanging clothes and long hair do not come too close to the entry and the exit of the tray stacker and do not touch it when the system is running production The door above the entry and the cover above the exit of the tray stacker have safety switches Opening this door or cover stops the tray stacker immediately CAUTION Do not enter objects or body parts into the entry or the exit of the tray stacker when it is running production Keep distant to the tray stacker It makes unexpected fast and powerful movements ATTENTION Do not enter objects or body parts into the entry or exit of the tray stacker when it is running production Page 32 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 Executions TRAY STACKER There are 3 types of tray stackers available for stacking the trays coming from a PSPC PS4C a Smartpack PS4SM and Speedpack PS4 In general the design is the same for all 3 types of tray stacker Below table shows the differences Upstream system Speedpack 545 Smartpack PSPC Capacity eggs hour 40 000
39. some situations it is easy to be able to run one of the motors by directly controlling it with its frequency inverter Follow below procedure to manually control the inverter sure the system is stopped and no trays or eggs are on the part of the system that you want to control manually the inverter in the local controlled mode by pressing the LO RE button 7 until the LED inside this button turns ON Press the RUN button 8 to start the inverter The connected motor starts running now Press the STOP button 9 to stop the motor the inverter back in the remote controlled mode by pressing the LO RE button 7 until the LED inside this button turns OFF SM PS4 01 E 10 2012 COMPONENTS ADJUSTMENTS POWER SUPPLIES The power supply switch 10 must always be set to 230 Vac even when your local power supply has a different voltage The power supplies are factory set Do not change this setting 11 ATTENTION _ The power supplies are factory set Do not change the power supply switch and do not change setting of the potentiometer SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 29 0f 63 TRAY STACKER 3 TRAY STACKER SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 31 0f 63 TRAY STACKER p rinzen DESCRIPTION TRAY STACKER Use The automatic tray stacker receives full 30 cell trays from the packer and automatically stacks tho
40. t clutch is released its shaft makes 1 revolution The turn table transfer lift drive chain starts running driving the turn table drive shaft As a result the pusher cam makes a 1 6 revolution After 6 revolutions of the turn table transfer lift clutch the pusher cam made 1 revolution and releases the pusher clutch Now the pusher drive shaft makes 1 revolution Via the crankshaft this rotating movement is transferred into a forward and backward movement of the pusher drive arms and thus the pusher plate When the downstream system is full with stacks and a signal is received from the downstream system to stop the supply of trays the tray stacker stops immediately after the pusher arm moves forward and the pusher drive arm sensor proximity switch turns OFF Besides this for the speedpack and smartpack systems this sensor is used to disable the start solenoid when this sensor is OFF SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 39 of 63 TRAY STACKER rinzen 5 The frame consists of a Covers f Tray at infeed sensor PS4 b Safety cover g Tray at infeed sensor PS4SM c Safety door h Tray at infeed flap PS4C d Drip tray i Manual activator PS4C e Electrical cabinet PS4 The electrical cabinet is only present in the soeedpack tray stacker The infeed sensor detects the tray The controller of the speedpack or smartpack subsequently controls the solenoid that starts the tray stacker to remove
41. t the pusher moves forwards and backwards when the tray guide on the turn plate is in line with the transport direction of the tray stacker Page 48 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 rinzen TRAY STACKER CONVERT TRAY STACKER DANGER Before starting to convert the tray stacker make sure the tray stacker is switched OFF and protected against switching it on TIP For easier and faster conversion perform the conversion activities with 2 people With the tray stacker it is possible to push out the stack of trays with the bottom tray on the 5 eggs wide position or with the bottom tray on the 6 eggs wide position Bottom tray 5 eggs wide When the bottom tray of the stack should be 5 eggs wide the sequence of the tray stacker is Rotate the turn plate Receive the 1 bottom tray Bottom tray 6 eggs wide When the bottom tray of the stack should be 6 eggs wide the sequence of the tray stacker is Receive the 1 bottom tray Rotate the turn plate Since the tray stacker has 1 mechanical drive for all movements to change the push out method the mechanical connection between the turn table and the drive mechanism needs to be transposed Besides this also the mechanical connection between the transfer lift and the drive mechanism needs to be transposed In addition also the mechanical connection between the pusher cam and the d
42. the sensor and the detectable parts must be 1 mm Page 24 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 e COMPONENTS ADJUSTMENTS p rnnzen PHOTO SWITCHES There are 3 types of photo switches Diffuse reflective photo switch 1 This is a photo switch which transmits a light beam An object is detected when the photo switch receives the light beam back because it reflects on the object Retro reflective photo switch 2 This is s a photo switch which uses a reflector to receive its transmitted light beam back An object is detected when it interrupts the light beam Through beam photo switch 3 This photo switch consists of a transmitter and a receiver part The transmitter sends a light beam to the receiver An object is detected when it interrupts the light beam PD30 DIFFUSE REFLECTIVE Adjust the sensor according the below procedure 1 Align the sensor to its correct position without the object it has to detect The green LED should be ON 2 Press and hold the teach button for 3 seconds until both LEDs are flashing 3 Place the object you need to detect in front of the photo switch 4 Press the teach button once Now the sensor is adjusted The yellow LED turns ON when an object is detected PD30 RETRO REFLECTIVE Adjust the sensor according the below procedure 1 Align the sensor and the reflector to their correct positions without the object it has to detect Both LEDs shou
43. ty devices have been removed This system may contain sharp edged parts moving parts and rotating parts When protective covers are removed sharp edges and pinch points may be exposed Use extreme caution and avoid touching or striking these areas with your hands or body because they may cause injuries Do not enter parts of your body or objects into openings in the system This may lead to serious physical injury or damage to the system It is dangerous to be in on or under the system while it is operational Loosely hanging clothing wide sleeved clothing ties chains or rings are prohibited Long hair should be worn tied back sure that there is sufficient light around the machine Do not touch or come near moving or rotating parts Physical contact with these parts is dangerous Do not stand or walk on any of the system parts Do not work alone on the system At least one other person should be present Before starting to adjust the machine follow the steps mentioned below Switch off the machine and secure it against accidental switching on Post Do not switch on warning sign on the main switch Operate the nearest emergency stop button Make sure that no components are moving Before switching on the machine you must check the following All safety devices are in place and are functioning No other persons are in underneath or above the system No tools or objects are in the system No other pe
44. uauacacacacacauauauauauauaueuauauauauauaueunenenenenensnenensnensnsnsnsnsnsss 24 SAFETY REGULATIONS ccccececececececececcccuuuauauauauauauauauaeneneneneneneneneneneneueuensususususususuauauauseguauauauavauavananas 24 PROXIMITY SWITOBHES 24 PHOTO SVIT OH E O aa a bain warden Ser aad tnd ama ate 25 PD30 DIFFUSE REFLECTIVE 25 PD30 RETRO REFLECTIVE 1 1 1 621822202101 25 PDSO THROUGHSBEAM Sat esn de eN en 26 eS DIF ADA A Se 26 PATO DIEEUSE REFLECTIVE 27 FREQUENCY INVERTER S nee RT 28 POWER pe ee e tI bee ee ce tenance tet ee tate eke ae tee 29 3 TRAY STACKER ee ee 31 DESCRIPTION TRAY 5 4 4 nn nenn nenn nenn nenn ann ernennen rennen nenne rennen 32 ADJUSTMENTS TRAY 5 0 ne nenn nenn nenn esses ernennen ernennen esee Annana nnana 41 SAFEDYSEIPPING CEUTCH ee a ee rear 41 nn 43 SYNG
45. vement the cam follower on the grippers run against the cam plate and as a result fold out again SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 37 of 63 TRAY STACKER 3 The turn table consists of a Turn table drive shaft f Table base plate b Turn table disk cam 0 Turn plate c Cam follower h Tray guide 5 eggs wide position d Drive arm i Tray guide 6 eggs wide position e Connection rod When the turn table transfer lift clutch is released its shaft makes 1 revolution The turn table transfer lift drive chain starts running driving the turn table drive shaft As a result the turn table disk cam makes 12 revolution the cam follower this rotating movement is transferred into a forwards backwards movement of the drive arm Each time the drive arm moves forwards or backwards via the connection rod the turn plate turns 90 back and forth The tray guide avoids overturning the stack of trays on the turn plate during its rotating movements Its position is adjustable for pushing out the stack with a 5 eggs wide bottom tray or a 6 eggs wide bottom tray Page 38 of 63 SERVICE MANUAL PS4 TRAY STACKER 5 54 01 10 2012 o TRAY STACKER P rinzen iier 4 The pusher consists of Pusher cam f Pusher guide Pusher drive shaft g Pusher plate Crankshaft flywheel h Tray transfer plate l Cam follower Pusher drive arm sensor Pusher drive arms aop When the turn table transfer lif
46. y stopped and push an emergency stop button Push the start button the machine should not start Release the emergency stop button and reset the emergency circuit Repeat the above steps 2 3 and 4 for all emergency stop buttons Make sure that the machine does not start when any emergency stop button is pressed Check safety switches 5 otart and stop the system Wait until the system has completely stopped and open a safety door or safety cover Push the start button the machine should not start Close the door or cover and reset the emergency circuit Repeat the above steps 2 3 and 4 for all doors and covers Make sure that the machine does not start when a door or a cover is opened te If the machine operates when emergency stop button is pressed a door is opened a safety screen is interrupted or a trolley is removed this machine is not safe to operate Immediately call a qualified technician to repair this defective safety device SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 19 of 63 Page 20 of 63 rinzen WARNING LABELS The Prinzen system makes dangerous movements The system also contains dangerous parts when they contact the body The following labels are posted as a warning Understand and remember the meaning of the warning labels DANGER Keep the warning labels clean When labels become unclear replace them The flashlight label is used to wa
47. y way Disregarding this advice may cause illness TIP This symbol is used as a helpful hint to simplify the execution of certain tasks ADDRESS PRINZEN Prinzen BV Weverij 18 7122 MS AALTEN P O Box 85 7120 AB AALTEN The Netherlands Telephone 31 0 543 490060 Fax 31 0 543 476205 E mail info prinzen com Website www prinzen com Page 12 of 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 SAFETY 1 SAFETY SM PS4 01 E 10 2012 SERVICE MANUAL PS4 TRAY STACKER Page 13 0f 63 SAFETY OU GENERAL Only persons meeting the following requirements are authorized to work with the system These persons should be Skilled and specifically trained for their duties Familiar with the contents of this manual Familiar with the locations of the emergency stop buttons and other safety devices 18 years old or above Familiar with the national and regional regulations regarding safety These persons should have reached the minimum legal age required to perform this work These persons are NOT under influence of any drug medicine or alcoholic drink DANGER Keep children and incompetent persons away from the system The system is designed for packing eggs into specific packaging Any other use of the system is not permitted Page 14 0f 63 SERVICE MANUAL PS4 TRAY STACKER SM PS4 01 E 10 2012 rinzen SAFETY SAFETY REGULATIONS Do not use the system when safe
Download Pdf Manuals
Related Search