Home

V〇 (12) 特許協力条約に基づいて公開された国際出願 (19

image

Contents

1.
2.
3. ETE lt
4. I V
5. 4 RBP BEER
6. 1 3
7. 0031 SRE MCT D Mixed connect ive tissue disease
8. WO 2012 018115 13 PCT JP2011 067953 0032 0033 0034 AFA CS NT BREA MERE E REIER BREED AST IAEA
9. compound 861 MMP Matrix meta LLoprote inase 1 2 3 9 13 14 MMP
10. RNA i HSP Heat shock prote in 4 7 HSP4 7 RNA
11. Do DMS 0 3 WO 2012 018115 20 PCT JP2011 067953 Zhao and Le e Adv Drug DeLiv Rev 2004 56 8 1193 204 Temming et aL Drug Resi st Updat 2005 8 6 381 402
12. DaunoXome Dox Cae Lyx R Myocet
13. 001 0 1 2 2 _ SMA 3 3 DAP1I GFP 4 4 GFP 5 5 VA ip siRNAgp4 6 DAP GFP GFAP 200 5B 5B VA ip s iRNAgp4 6 DAP GFP GFAP
14. WO 2012 018115 2 PCT JP2011 067953 0004 0005 0006 0007 NASH 1 lssa et al Gast roentero logy 2004 126 7 1795 808 2 lreda Le J CLin Invest 2007 117 3 539 48 3 Sato et al Nat Biotechno L 2008 26 4 431 42
15. WO 2012 018115 18 PCT JP2011 067953 0044 0045 0 O1 1000nmol Il 0 1 100nmo1l 1 1OOOOng 10 1000ngZ 1 100000 0 M g k g 10 100000Mg kg
16. DMPC DPPC SPC WO 2012 018115 17 PCT JP2011 067953 0042 0043 DOPE DL PC N_ zZ D TMAG N N NS N MENN N N MTP S 2 3 N _ 2 N 1_ DOSPA N 1 2 3
17. CC 14 DMN MCDD A Con A BERK LK KOSH ES BLM TPO Leukemia Research 29 761 769 2005 23 UD SRE
18. 0059 0060 0061 1 VA
19. WO 2012 018115 16 PCT JP2011 067953 0040 0041 4 HPR A ERE K L
20. 9 5 10 FBS lscove s modified DuLbecco s medium IMDM 3 7 9 5 5 C0 2 VA ip siIRNAgp46_FAM pPSC 94 B Mi primary PSC Lab Tek 1X104 VA lip siRNAgp46 FAM L ip siIRNAgp46 FAM s iRNA 50 nM LK 10 FBS DMEM 3 0 3 0 2 PBS 3 4 25 15 PBS 3 ProLong Gold with DAPI Inv itrogen 12 HRE LTKRE LE FAM s iRNAgp46 WO 2012 018115 31 PCT JP2011 067953 0077 0078 00
21. FJ RE 8 1 1 4 4 1 1 2 WO 2012 018115 19 PCT JP2011 067953 0046 0047
22. WO 2012 018115 1 2 3 4 5 6 7 8 9 41 PCT JP2011 067953 1 1 2 3 1 4
23. Z lt HI T IMP Tissue inhibitor of meta LLoprote inase T IM P1 T IMP2 WO 2012 018115 11 PCT JP2011 067953 0027 0028 T IMP T IMP T IMP RNA i T IMP RNAi s i RNA smaLL interfer ing RNA m i RNA micro RNA sh RNA short hairpin RNA dd RNA DNA d irected RNA p i RNA Piwi interact ing RNA ras iR NA repeat assoc iated siRNA RNA RNA DNA PNA
24. 1 5 TG F HGF PPAR PDGF 2 6 2 6 T IMP 2 6 1 15 WO 2012 018115 PCT JP2011 067953 1 VA lip siRNAgp46
25. th Resolut ion of liver cirrhos is using vitamin Acoupl ed liposomes to del iver siRNA against col lagen spec if ic chaperone ITER 2008 08 28 Vol 57 No 2 p 299 304 2 p 300 304 SATO Y et al Reso lut ion of liver cirrhos is using vi tamin A coupl edliposomes to deliver siRNA against a col lagen spec ific chaperone NATURE BIOTECHNOLOGY 2008 04 Vol 26 No 4 p 43 1 442 RESULTS DISCUSS ION Hi UR Fi gure GEORGE J et al In vivo inhib ition of rat ste late cell act ivat ion by solub e transforming growth factor B type II receptor A potent ial new therapy for hepat ic fibros is Proceedings of the Nat ional Academy of Sciences of the Uni ted States of Ameri ca 1999 10 26 Vol 96 No 22 p 12719 12724 Materal s and Methods WR Resul ts 473 CB HE JP 7 300426 A PNM 1995 11 14 boo04 100141 R SRR 8 US 58403 11 A 8 US 6303 126 B1 amp EP 784980 Al amp EP 1776959 A2 8 EP 2163254 Al 8 W
26. A Ghiass i Nej ad et al Expert Rev Gastroentero L He pato L 2008 2 6 803 1 6 Gil WO 2012 018115 14 PCT JP2011 067953 0035 0036 Do
27. WO 2012 018115 8 PCT JP2011 067953 SMA FY v SMA 001 8 TGF 5 Transform ing growth factor beta HG F Hepatocyte growth factor PPAR Per oxisome pro Lif erator act ivated receptor gamma PDGF PLate Let der ved growth factor
28. 001 9 TGFZg TGFpg I Qi et al Proc Nat L Acad Sci US A 1999 96 5 2345 9 TGFj George et al Proc Nat L Acad Sci US A 1999 96 22 12719 24 TGFp TGFp TGF RNA TGF SRRBO HBRICHWUT TGF BMD TGFg1 0020 HGF HGF PPAR 1 5_ YHA 12 14 J 2 L D
29. o a PSC VA Iip siRNAgp4 6 WO 2012 018115 39 PCT JP2011 067953 2 01 007 5 a HSC FB 2 2 GFP aH SC SD HSC 1 a HSC
30. NASH
31. WO 2012 018115 22 PCT JP2011 067953 0054 0055 1 2 CD DVD
32. LTU WH B BR FE RA DE DE PE E SER 7E E Bm AR BES WO 2012 018115 12 PCT JP2011 067953 0029 LTI 0030 B C
33. mg 20500 300 N S DBTC 29 26300 700 N S DBTC sg7 25400 1000 B R SA 5 DBTC VA lip siRNAgp46 L ip siRNAgp4 6 DBTC 65 VA_ lip siRNAgp46 L ip siRNAgp4 6 19A VA_ lip siRN Agp46 DBTC 1 9B hig VA_ lip siIRNAgp4 6 s iRNAgp4 6 a PSC gp4 6 aPSC
34. CA REG STRY MEDL INE EMBASE B 1OSIS STN JSTPlus JMEDPlus JST7580 JDreaml c AFI X Wo 2006 068232 a1 2006 06 29 0005 0008 0011 0016 Y 0020 0028 amp JP 2008 50375 A 8 JP 4121537 B 8 JP 2010 138188 A amp US 2008 0193512 Al 8 EP 1842557 Al 8 wo 2006 068232 Al amp CA 2595517 A amp AU 2005320014 A amp KR 10 2007 0097495 A amp CN 101102795 A Y c TO TA re
35. GFP 8 VA ip siRNAgp4 6 DAP GF P CK19 200 CK19 CK 1 9 GFP 9 VA lip siRNAgp4 6 DAP G FP gt e_ CAD 9 A 2 00 9 B 4 00 ve_CAD GFP v e_CAD 10 VA Iip siRNAgp4 6 DAP GFP 2 0 0 GF P 0074 Vax GFP
36. WO 2012 018115 21 PCT JP2011 067953 0051 0052 0053 lt A RBA SERA BA BRA BARA PRA DEA BREA ULNA AA EREA NEN EXE ER SA 2003 REFICERS l BW
37. 2 SMA DAB SMA SMA w SMA VA Iip siRNA gp4 6 VA Iip siRNAsc ramb le 3 GFP DAPI GFP VA_ lip siRNAgp456 80 GFP VA Iip siRNAsc ramb le 4 GFP GFP VA ip siRNAscramb le VA_ ip siRNAgp4 6
38. VA ip s iRNAscramb le GF AD VA_ lip siRNAgp4 6 GFP 5 VA Iip siRNAgp46 DAP G FP GFAP A 5A 200 5B 4 00 GFAP WO 2012 018115 29 PCT JP2011 067953 0072 0073 GFAP GFP 6 VA ip siRNAgp4 6 DAP G FP gt _ SMA 2 0 0 w SMA GFP ho 5 6 7 VA ip siRNAgp4 6 DAP GF P 2 0 0
39. 0 Eb FRA BAN BT BA FA ESA FA SE A RBA SEXA R BRA DIRA PRA DEN BHA UYVNE A RAL REN REA SME ES AA 1 1 2 3 4 5 1 1 2 3 4 5 6 7 1 WO 2012 018115 24 PCT JP2011 067953 1 2 3 4 1 CS 2 3 4 0058 Do
40. B C HIV A ERAS NSA ID s IgA
41. VA_ lip siRNAgp4 6 P lt 0 01 17 B VA Iip siRNAgp 4 6 17C VA lip siRNAgp4 6 VA_ ip siRNAgp4 6 S MA L ip siRNAgp4 6 PBS w_ SMA 18A B VA lip siIRNAgp46 PSC PSC VA lip siRNAgp46 DBTC WO 2012 018115 38 PCT JP2011 067953 0097 0098 0099 1 1
42. VA lip siRNAgp4 6 WO 2012 018115 30 PCT JP2011 067953 0075 0076 VA Iip siRNAgp46 VA ip s iRNAscramb le M3 VA lip s iRNA gp4 6 613 VA 1 PSC OBR PSC Apte et a Gut 1998 43 128 1 33 VA 1 2 5 Dako
43. 0038 4 LFS RBP ret inoL binding prote in 4 4 wo 2006 0 68232 2009 221 164 201 0 591 24 0039 4 1 6 P Moss Biochemical N omenc Lature and Related Documents ls 2nd Ed Port Land Press pp 247 251 1992 A
44. WO 2012 018115 15 PCT JP2011 067953 y fff BRM FS RM FR BER 0037 HGF MMP T IMP TGFg
45. 4 14 0 0 0 9 3 0 EnzCheck CoLLagenase Assay Co LLagen Conj ugate kit MoLecuLar Probes mg 280nm s iRNAgp4 6 F ITC VA Iip siRNAgp46 FI TC SMA F ITC L ip s 1RNAgp46 FITC w SMA F ITC 15A B SMA F ITC
46. SMA 1 1000 Sigma Envision Kit Dako DAB Osaka Japan MA YU8kUG SMAKRKSRGMBOF EKEBOK 5 OB 6 X 100 Axi opLan 2 CarL Zeiss Inc TV Axiocam High Reso lut ion color Car L Zeiss Inc KS400 Car L Zeiss Inc amp SMA 5 k weidenbach et al Digest ion 1997 58 50 57 weidenbach SATC BE OHE 3000 rpm 15 6 N HC
47. 400 001 1 6 6 VA ip s iRNAgp4 6 DAPI GFP amp _ SMA 200 7 7 VA ip s IiIRNAgp4 6 DAP l GFP 20 0 8 8 VA ip s iRNAgp4 6 DAPI GFP CK19 200 9 9 VA ip s IRNAgp46 DAP WO 2012 018115 5 PCT JP2011 067953 001 2 001 3 GFP ve _ CAD 200 9B 9 B VA ip s iRNAgp46 DAP GFP ve_CAD 400 10 10 VA_ lip siRNAgp4 6 DAP GFP 200
48. A H MI N w 39 4 N w 5 10 25 50 100 200 300 400 500
49. 11 1 1 FAM s i RNAD 12 12 si S L ip siR NAgp46 FAM VA Iip siRNAgp46 FAM VA ip s iRNAgp46 FAM RBP Lip s iRNAgp46 FAM RBP 13 13 s IRNAgp46 gp4 6 A VA_ lip s iRNAgp46 B 14 1 4 VA _ ip siRNAgp4 6 VA ip s IRNArandom 7 2 15 15 DBTC VA lip s iRNA gp4 6 A B VA Iip siRNAgp46_FITC
50. Rene 15C DBTC WO 2012 018115 37 PCT JP2011 067953 0093 0094 0095 0096 CD6 8 F ITC M1506 E s iRNAgp46 FITC F 1TC M15F Z VA ip s iRNAgp46 FAM in vivo s iRNAgp4 6 gp4 6 3 16GAHKUB VA lip siIRNAgp46 10 DBTC 17A
51. X ry 1 re Ep r amp sa JP EH BEBS100 8915 4 35 03 3581 1101 AR 3452 pc sA 2 10o 2 60oo9 PC1 JP2011 067953 c
52. EPS T AAI 1 1 2 2 4 3 B
53. 1 1 2 0050 E 1 1 1 2 1 3 1 5 2 3
54. Oncogene Research P roduct Boston MA ECL Amersham Life Science ArLingto n Heights LE gp4 6 PSC VA ip s iRNAgp46 50 nM 3 0 24 4 8 Al 7 2 96 VA lip s iRNArandom 50nM 3 0 5 WO 2012 018115 32 PCT JP2011 067953 0081 0082 pPSC 6 10 FBS RDME M 5X 104 24 pP SC VA ip s iRNAgp46 50nM s iRNA VA lip siRNA random 50 nM s i RNA ho 10 FBS DMEM 3 0 7 2 PBS 3 w ams et aL Gut 2001 49 577
55. Envision Kit Dako DAB Osaka Japan 3 in vivo s iRNA gp4 6 VA Iip siRNAgp4 6 0 1 2 3 4 3 4 4 in vivo s RNA gp4 6 WO 2012 018115 35 PCT JP2011 067953 0090 3 1 n 6 DBT CR 4 3 PBS VA lip si RNA rand om VA ip s iRNAgp46 10 0 75mg k g s iRNA 1 3 1 1 g 10
56. 7 2 gp4 6 1 4 VA_ lip siRNAgp4 6 VA ip siIRNArandom 7 2 VA_ lip siRN Agp46 VA l ip siRNA random in vitro VA Iip siRNAgp4 6 RBP PSC gp46 VA Iip siRNAgp4 6ARRHE ICS 4 M EE KO AR WO 2012 018115 34 PCT JP2011 067953 0087 0088 0089 1 150 200g MHL ew is Charles River Inoue et aL Pancreas 2002 25 e64 70 pibuty Ltin d
57. 10 2 0 30 4 0 50 60 70 7 5 WO 2012 018115 23 PCT JP2011 067953 0056 0057 El in vitro
58. EF SDF EGTA ULB FMRE L LERMA LER ELA ABR100 Um H BSS 0 2 5 BSA 4 5 0 0 r pm 2 4 1300rpm 5 HBSS O 25 BSAKB Nycodenz 13 2 28 7 Nycodenz Axis Shield Oslo Norway HBSS 0 2 5 B SA LEB 40 14 0 0 x g 20 LT Dulbecco s Modified EagLe s medium DME M 10 F BS 5 5 01 01 h G RO 4 wm BD Falcon Frank lin Lakes NJ USA aHSC 5x 104 3 7 5 CO DMEM 10 FBS 4 8 RMB LE a HSC 2 IWAKI Tokyo Japan 24
59. Alk VA Iip siRNAgp 46 Lip siRNAgp46 PBS 10 DBTC B A 6 6 C 18 18 DBTC VA lip siRN Agp4 6 Al VA I ip siRNAgp 4 6 DBTC amp SMA B A SMA 6 6 L FHE WO 2012 018115 7 PCT JP2011 067953 001 6 001 7 19 19 VA
60. Lip s iRNAgp46 FAME VA ip siRN Agp46 FAM VA Iip siRNAgp46 FAM RBP L ip s iRNAgp46 FAM RBP FACS VA Iip siRNA gp46 FAM RBP VA Iip siRNAgp WO 2012 018115 33 PCT JP2011 067953 0083 0084 0085 0086 4 6 FAMLER CHR UT BHRMEAL ip siRNAgp46 F A M VA_ lip s iRNAgp46 PSC RBP 13 A VA Iip siRNAgp4 6 V A ip siRNAgp4 6 g p4 6 50 nM VA_ I ip SiRNArandom L ip s iRNAgp4 6 1 3 B VA Iip siRNAgp4 6 7 2 gp4 6
61. _ N_ a DC 6 1 4 DOPE 4 3 3 1 i poTrust Sapporo Japan DDW 1mM DC 6 14 V A DMSO 200nmol A Sigma USA DC 6 14 10 0 nmol 1 5m1l 25 s iRNAgp46 VA VA li p s iRNAgp46 s iRNAgp46 DD W 580 pmo 1 ml LE s i RNA DC 6 14 1 1 1 WO 2012 018115 26 PCT JP2011 067953 in vitro VA ip s iRN
62. o 1 2 CH ke d
63. P BS ProLong Gold with DAPI Inv itrogen SMA Dako DAB 0069 1 VA Iip siRNAscramb le WO 2012 018115 28 PCT JP2011 067953 0070 0071 VA_ ip siRNAgp4 6 VA Iip siRNA sc ramb le
64. 1 WO 2012 018115 3 PCT JP2011 067953 0008 0009 2 1 3 1 2 4 3 5 1 4 6 1 5 7
65. L ip sik NA gp46 F ITC 1 3 SMA F ITC a WO 2012 018115 6 PCT JP2011 067953 0014 001 5 d C VA lip siRNAgp46_ FITCTIAHAZER 3 d SMA F ITC D F VA Ii p siRNAgp46 FITC 24 CD6 8 F ITC LER 16 16 DB 14 VA Iip siRNAg p46 s RNA 0 75mg kg VA ip siRNAgp4 6RS 0 1 2 36404 ANI gp4 6 A B 8 17 17 DBTC VA ip siRN Agp4 6
66. Bio Rad Laborator ies Hercu Les CA USA 2 1 2 0 aHSC 2 1
67. N N N DOTMA DODAC DDAB 1 2 3 _ DOTAP 3B N N N DC_Chol 1 2 3 A DMRIE 0 0 N_ DC 6 14 BE 3 3
68. 1 6 96 pH 6 5 7 5 3 000rpm 15 25 1 60 1 2 m 50 2 0 0ml 0 56 chLoramine T Solut ion Sigma pH6 0 2 5 10 1 m 50 90 WO 2012 018115 36 PCT JP2011 067953 0091 0092 LE BHR 560 nm 6 Ireda Le et ab J CLin Invest 199 8 102 538 549 PMSF 0 1mM 10 MM NPABRBFYA 10MM FFOFIY25u g mi 0 1mM 50mM Tris p H7 6 0 25 Triton K 100 0 15M Nac 10 mM CaCl
69. 3 12 VA ip s iRNAgp46 2 4 52 GFP OCT 4 5 PBS PBS ASMA s igna GFAP sigma up BiomedicaLs CK19 Novocast ra ve CAD Vascu lar Endothe LiaL Cadh erin Santa cruz 4 PBS ALexa555 IgG ALexa555 IgG Inv itrogen 60
70. a SMA Activated HSCs SS 7 GFP tg BDL VA lip siRNAgp46 VA lip siRNAgp46 X 200 Albumin DAPI SEE SS PCT JP2011 067953 R E 5 15 WO 2012 018115 8 VA lip siRNAgp46 CK19 BDL lip siRNAgp46 200 GFP tg i ate sl H AM VA UU o 9A VA lip siRNAgp46 CAD BDL Ln HP lip siRNAgp46 lt 200 GFP tg7 Vt Ne 1 VA 6 15 WO 2012 018115 PCT JP2011 067953 9B GFP tg BDL VA lip siRNAgp46 VA lip siRNAgp46 X 400 ve CAD DAPI Ne NN B10 GFP tg BDL VA lip siRNAgp46 VA lip siRNAgp46 X 200 7115 WO 2012 018115 PCT JP2011 067953 11 VA lip sIRNAgp46 F AM Lio siR NAgp
71. SN SS SS SN SS SS SS N WN N 2 o SMA VA lip siRNAscramble SN SN WEEE SEE SENE VERS y SEE RRS SS NS 2 15 WO 2012 018115 PCT JP2011 067953 3 GFP tg BDL VA lip siRNAgp46 Animal BDL rats GFP tg siRNA siRNAgp46 siRNAscramble sIRNA ix SEX 128 DAPI GFP Merge RNAgp46 ip si VA iRNAscr ip si VA 4 VA lip siRNAgp46 VA lip siRNAscramble RNAgp46 ip si VA 3 15 WO 2012 018115 PCT JP2011 067953 5A GFP tg BDL VA lip siRNAgp46 VA lip siRNAgp46 X 200 GFAP Quiescent HSCs 5B GFP tg BDL VA lip siRNAgp46 VA lip siRNAgp46 400 GFAP Quiescent HSCs 4 15 WO 2012 018115 PCT JP2011 067953 6 GFP tg BDL VA lip siRNAgp46 VA lip siRNAgp46 X 200
72. TGF g HGF PPAR PDGF E MRAZ SBR ENS ERE 2 6 8 2 6 9 T IMP ESE 2 6 Y WO 2012 018115 4 PCT JP2011 067953
73. BD Falcon 1X 104 EE 5X 105 aHSC 24 WO 2012 018115 40 PCT JP2011 067953 01 02 01 03 3 7 5 C0O 10 MELT DME F 12 Du Lbecco s Modif ied Eag Le s Medium Nut rient F 12 Ham 10 FB S ITS 10mg MARIA 5 5mg 0 67 MY 1ELT 0 1 MM 10 mM 50 Mg m lg 2mM L_ Jn 5mM Hepes 10 Mp Biomed icaLs nikon 100 NIS E Lements software Nikon 2 0 10 Premix WST 1 CeLL Pro liferat ion Ass ay System Takara Tokyo Japan
74. HSP4 7 HSP4 7 WO 2012 018115 10 PCT JP2011 067953 0023 0024 0025 0026 7 C RANA K I
75. MACS Magnet ic Act ivat ing CeLL Sort ing lt ww teny Biotec Auburn CA USA F IT C C D4 5 gp Pharmingen C D 1 3 3 Abeam EpCAM Sant a Cruz MACS CD133 EpCAM CD 4 5 0067 3 1 2 GFP 200 1 DME F 12 2X10 24 A s iR Jn NAgp46 VA lip s iRNAg p46 mock WO 2012 018115 27 PCT JP2011 067953 VA ip s iRNA scramb le 1 12 s iRNA 0 75m g kg CHALE A ripoTrust Sapporo Japan s i 11 5 cita De Aes 0068 4
76. T et al Hepato cyte growth factor gene Y the rapy of live r cirrho sis in rat s Nature Medi cine 1999 02 Vol 5 No 2 p 226 230 parti cularl y abs tract Methods page s 226 to 228 each Figure X ANAN A et al Protea some I nhibiton nduce s Y Hepat ic Stellate Cell Apopto sis HEPATOLOGY 2006 02 Vol 43 No 2 p 335 344 part cul ary abs tract Material s and Methods Resul ts each Fig Form PCT ISA 2 10 continuation of second sheet July 2009 INTERNATIONAL SEARCH REPORT International application No PCT JP2011 067953 C Continuation DOCUMENTS CONSIDERED TO BE RELEVANT Category Citation of document with indication where appropriate of the relevant passages Relevant to claim No x BENEDETTI A et al Inhibit ion of the Na H Y Exchanger Reduce s Rat Hepati c Stel late Cel Act ivity and Live r Fibro sis An In Vit ro and In Vivo Study GASTROENTEROLOGY 2001 02 Vol 120 No 2 p 545 556 part i cularl y abs tract Material s and Methods Resul ts X GALLI A et al Ant idiabeti C Y Thi azol idinedione s nhibit Col lagen Synthe sis and Hepat ic Stellate Cell Activati on In Vivo and In Vitro GASTROENTEROLOGY 2002 Vol 122 No 7 p 1924 1940 part icularl y abstract Material s and Methods Resul ts each Figure Table X PARSONS C J et al Ant if ibroti c Effects of Y a Tissue Inhibi tor of Metal oprote inas e 1 Ant ibody on Establ ished Live r
77. WO 2012 018115 9 PCT JP2011 067953 0021 0022 L Low density Lipoprote in RE IL SS AFL SU 1 1V 1 AT 1 PDGF PDGF PDGF PDGF RNA i PDGF
78. 0048 ARB A FR 0049
79. 011 Kokai Shinan 1971 2011 Koho 1994 2011 Jitsuyo Shinan Toroku Jitsuyo Koho Toroku Jitsuyo Shinan Electronic data base consulted during the international search name of data base and where practicable CA REGI STRY MEDLINE EMBASE BIOSTS STN JST Plus JME DPIu s JST7580 JDreaml search terms used c DocuUMENTS CONSIDERED TOBEREEVANT eee CONSIDERED TO BE RELEVANT Citation of document with indication where appropriate of the relevant passages WO 2006 068232 Al Hokkaido Renomedix er Category Relevant to claim No Inc 2006 29 06 2006 y paragraph S 0020 Inst i tute 29 June parti cularl 0016 0005 0028 0008 example S 0011 to each to claim amp JP JP EP CA KR 2008 50375 A 2010 138188 A 1842557 Al 2595517 A 10 2007 0097495 JP US Wo AU CN 4121537 B 2008 0193512 Al 2006 068232 Al 2005320014 A 101102795 A 8 8 8 8 xj Further documents are listed in the continuation of Box C Special categories of cited documents document defining the general state of the art which isnot considered to be of particular relevance earlier application or patent but published on or after the international filing date document which may throw doubts on priority cited to establish the publication special reason as specified claim s or which is date of another citation or other or other means document referring to an oral disclosure use exhi
80. 46 FAM 8 15 WO 2012 018115 PCT JP2011 067953 B12 Rat pPSC 50 MF 4 85 No treatment 0 50 146 77 Lip siRNAgp46 FAM 227 52 VA lip siRNAgp46 FAM 50 VA lip sIRNAgp46 FAM 110 72 RBP Ab Lip siRNAgp46 FAM 110 10 RBP Ab 9 15 PCT JP2011 067953 WO 2012 018115 13 sf wa Bactin Auos jue 9bdByNdiS YA Wur LIOpLBJYNHIS d YA gpdBynNnis dr papanu 92 st pom oH Bactin 1496 JUZI gbdDVNHIS JH8 di VA pa WOPUBI YNHIS dH YA pareanun 10 15 PCT JP2011 067953 WO 2012 018115 14 IOAuQO WOPUBI VNHISdI VA 9bd6VNHiS di VA pajearufn WO 2012 018115 FITC FITC na LiD SIRNA FI EC N ES ES 11 15 Retina PCT JP2011 067953 12 15 WO 2012 018115 PCT JP2011 067953 16 A Days after treatment gp46 8 actin 1 0 0 5 gp46 protein expression gp46 actin 0 1 2 3 4 Days after treatment 13 15 WO 2012 018115 PCT JP2011 067953 a SS G 20 v 22 04 ES 15 1 s 107 on rs an pod q N a fi Mm tM 2 16 fisi E c 2 amp a i sx wx S 2 20 pe ANA gt 15 10 SS D o w O SN E 0 SP pe KG NNNN 5 E E ovr NN eX ip siRNAgp46 lt S a SN 14 15 WO 2012 018115 PCT JP2011 067953 19 A Lip siIRNAgp46 VA lip s
81. 583 miocoLor Belfast UK Lk 0 5 f 54 0nm ES 1 1 FAM siRNA 2 VA ip ss iRNAgp46 FAM PSC 2 L ip s iRNAgp46 FAM PSC 2 3 0 2 2 VA Iip siRNA 9 p4 6 _FAM 3 0D CMMANKIFAY I LERAARS FAM 2 L ip siRNAgp46 FAM 3 0 2 12 FACS
82. 79 0080 ok HH Keyence BZ 8000 3 VA lip siRNAgp46 FAM FACS pPSC 1X104H 10 FBS VA_ lip s RNAgp46 FAM 50nM s iRNA 3 0 VA ip s iRNAgp 4 6 FAM 1X 104 RBP 10 g m BD Pharmingen lg G 10ug ml Dak 3 0 VA ip siRN A g p4 6 _FAM MF l FACScalibur with Ce LLQuest software Becton Dickinson LE 4 s RNAgp46 VA ip s iRNAgp4 6 1nM 5nM 50nM VA Iip s iRNArandom 50 nM L ip s iRNAgp4 6 50nM 30 PSC 4 2 0 SDS_ HSP47 gp4 6 Stressgen ceLL Signa Ling
83. A PBS 0065 2 1 SD 150 200g SLcJ apan Shizuoka Japan 2 8 0066 2 GFP GFP 4 GFP sle Jap an GFP EGTA L RE AKR100UMm H BSS 0 25 BS A 4 500 rpm 2 4 1300 rpm 5
84. Fibro sis in Rats HEPATOLOGY 2004 11 Vol 40 No 5 p 1106 1115 parti cular y abstract Mate rials and Methods Resul ts each Fig X Yuj i IIMURO et al Kan Sen ika to Byotai 7 Y MMP 1 Tdenshi Donyu ni yoru Ki zon Kan Sen ika no Chi ryo BIO Clinica 10 Apri 2001 10 04 2001 vol 16 no 4 page s 330 to 334 parti cularl y 2 Hito MMP 1 lden shi Donyu 3 Ki zon Kan Sen ika no Kai zen X TIMURO Y et si Delive ry of Matrix Y Metal loprotei nase 1 Attenuate s Establ i shed Liver Fibro sis in the Rat GASTROENTEROLOGY 2003 02 Vol 124 No 2 p 445 458 parti cular y abs tract Mate rials and Methods Resul ts each Figure Form PCT ISA 2 10 continuation of second sheet July 2009 pc Jp2o11 067953 pc Int Cl A61K45 00 2006 01 i A61K31 713 2006 01 i A61K47 10 2006 01 i A61K47 12 2006 01 1 A61K48 00 2006 01 i A61P43 00 2006 01 i B pc Int Cl A61K45 00 A61K31 713 A61K47 10 A61K47 12 A61K48 00 A61P43 00 1 1 1 1
85. O 1995 029694 Al 8 DE 69535593 D 8 DE 69535593 T 8 AT 37278 1 T 8 ES 2289742 T UEKI T et al Hepatocyte growth factor gene therapy of iver cirrhos is in rat s Nature Medi cine 1999 02 Vol 5 No 2 p 226 230 Methods p 226 228 E Figure ANAN A et al Proteasorae Inni ton Induces Hepat ic Ste late Cell Apoptos is HEPATOLOGY 2006 02 Vol 43 No 2 p 335 344 Material s and Methods fj Resul ts fik Fio PCT 1SA 210 2 2009 7 PCT JP2011 067953 C BENEDETTI A et al Inhib tion of the Na H Exchanger Reduces Rat Hepat ic Ste l late Cell Act ivi ty and Liver Fibros is An In Vitro and In Vivo Study GASTROENTEROLOGY 2001 02 Vol 120 No 2 p 545 556 Material s and Methods ARM Resul ts fl Rk GALLI A et al Ant i diabet ic Thiazo I i dinediones Inhib it Col lagen Synthes is and Hepat ic Ste I late Cell Act ivat ion In Vivo and In Vitro GASTROENTEROLOGY 2002 Vol 122 No 7 p 1924 1940 Material s and Methods R Re
86. R KID VEY SOO RRO ILH R Nrrro DENKO CORPORA af HAN ARPO BW GH GM KE LR LS MW TION JP JP T5678680 AMA RAR TEE 1 MZ NA SD SL SZ TZ UG ZM ZW ae SR 1 2 osaa up AM AZ BY KG KZ MD RU TJ TM AL AT BE BG CH CY CZ DE DK EE ES Fl FR GB GR HR HU IE IS IT LT LU LV MC MK MT KARDUTO dB NL NO PL PT RO RS SE SI SK SM TR OAPI NIITSU Yoshiro JP JP 70640823 BF BJ CF CG Cl CM GA GN GQ GW ML MR 3 3 0 2 1 9 0 1 NE SN TD TG Hokkaido JP KR FH BR 5A YONEDA Akihiro JP JP s T 0600008 8 19 1 2 N8 FUJII MS 301 R R 21 3 Hokkaido JP AE 8 IsHIWATARI Hirot la sh Wapi T 0630049 4 a 2 MM 6 4 10 Hokkaido JP 74 MrsuHAsHi Motoki et al T 1600023 6 2 4 54 Tite COMPOSITION FOR REGENERATNG NORMAL TISSUE FROM FIBROTIC TISSUE 54 57 Abstract The invention pertains to a pharma
87. W 2012 018115 12 a 19 A A e LORA MON AO NO A TiN I AIA DD ANII LH 43 Sg 10 Ly A AA 2012 2 9 A 09 02 2012 PCT WO 2012 01811S Al 61 15 17 B 467 45 00 2006 01 A61K 47 12 2006 01 Tokyo UP A61K 31 713 2006 01 A61K 48 00 2006 01 mie sn WA ten ey HER BROBURU TORROBAR A61K 47 10 2006 01 A61P 43 00 2006 01 ra E E 7 TT F AE AG AL AM AO AT AU AZ BA cy PCTJP201 17067953 BB BG BH BR BW BY BZ CA CH CL CN CO CR CU CZ DE DK DM DO Dz EC EE EG ES Fl ca BAHAR 201 1 8 A 5 F 05 08 201 1 GB GD GE GH GM GT HN HR HU ID IL IN IS 25 KE KG KM KN KP KR KZ LA LC LK LR LS a Se i LT LU LY MA MD ME MG MK MN MW MX 26 MY MZ NA NG NI NO NZ OM PE PG PH PL co PT QA RO RS RU SC SD SE SG SK SL SM ST 48 FB 2010 175920 2010 s As E 05 08 2010 jp SV SY TH TJ TM TN TR TT TZ UA UG US UZ vc VN ZA ZM ZW 4 BA 2010 230020 2010 10 A 12 12 10 2010 JP 71 H
88. _ ip siRNAgp46 A DBTC VA lip siRNAgp46 L ip s iRNAgp46 E 10 FJ a b B DB TC 20 2 0 Sar 21 2 1
89. bition document published prior to the international the priority date claimed filing date but later than search 11 Date of the actual completion of the international 18 Augu st 2011 18 08 Name and mailing address of the ISA Japane se Patent Office Facsimile No Form PCT ISA 210 second sheet July 2009 EI See patent family annex T later document published after the international filing date or priority date and not in conflict with the application but cited to understand the principle or theory underlying tiie invention invention cannot be to involve an inventive document of particular relevance the claimed considered novel or cannot be considered step when the document is taken alone document of particular relevance the claimed invention cannot be considered to involve an inventive step when the document is combined with one or more other such documents such combination being obvious to aperson skilled in the art document member of the same patent family Date of mailing of the international 30 Augu 2011 search report st 30 08 11 Authorized officer Telephone No INTERNATIONAL SEARCH REPORT International application No PCT JP2011 067953 C Continuation DOCUMENTS CONSIDERED TO BE RELEVANT Category Citation of document with indication where appropriate of the relevant passages Relevant to claim No X Yasushi SATO et al Kan no Sen ika o Saguru Y Sen
90. ceutical composition and method ior regenerating normal tissue irom fibrotic tissue that comprise a collagen reducing substance The invention makes possible the therapeutic regeneration of normal tissue fi om fibrotic tissue 67 WO 2012 018115 1 PCT JP2011 067953 0001 0002 0003 E RE PR
91. i ka no Seigyo to Chi yo no Kano sei Col lagen Sei sei Yokus ei ni yoru Sen ika Chi ryo no Kano sei Resoluti on of iver cirrho sis using vitamin A coupl ed ipo somes to del iver siRNA again st col lagen speci fic chaperone 7 Kan Tan Sui 28 Augus t 2008 28 08 2008 vol 57 no 2 page s 299 to 304 parti cul arly page s 300 to 304 X SATO Y et al Resoluti on of live r cirrho sis Y usi ng vitamin A coupl ed lipo somes to del iver siRNA again st a col lagen specific chaperone NATURE BI OTECHNOLOGY 2008 04 Vol 26 No 4 p 431 442 part cul ary abs tract RESULTS DI SCUSSION each Fi gure X GEORGE J et al In vivo inhibi tion of rat Y stellate cell act ivat ion by solubl e trans forming growth factor B type IT recepto r A potenti al new the rapy for hepati c fibro sis Pro ceedings of the Nati onal Academy of Science s of the United State s of Ameri ca 1990 10 26 Vol 96 No 22 p 12719 12724 part icul arly abs tract Material s and Methods Resul ts X JP 7 300426 A Toshi kazu NAKAMURA Snow Y Brand Milk Product s Co Ltd Sumitomo Pharmaceuti cal s Co Ltd 14 November 1995 14 11 1995 parti cularl y each claim paragraphs 0004 to 0014 example s each table each figure amp US 5840311 A amp US 6303126 BI amp EP 784980 Al amp EP 1776959 A2 amp EP 2163254 Al amp WO 1995 029694 Al amp DE 69535593 D amp DE 69535593 T amp AT 372781 T amp ES 2289742 T X UEKI
92. iRNAgp46 mg g body weight oa o Sa nN Qu Bos Pancreas weight S 26 SIN AR NNE ND Si ANS SR NN NN NNNNA ND Ny NNN BR S A ARAN A SAA AA NA NN 12000 BAA AA WA WA AA MA NAA IA A A A A A A AA 10000 MONO A A A mw SANDS ANS ND NN NN NN DNR NN AN NN ND AN AN AME AMT AMT AM SRN MV AAN eB MMA a KI ANN RN RNA BN MAS AN AN NN AN AN A AN Area un of alburnin positive colony Low density aHSCs 15 15 WO 2012 018115 PCT JP2011 067953 21 Absorbance 4450 0 6 os 4 3 4 0 3 22 We es BA Beco ob gk NUN AE OS ALAN NS OD OE ENE OS AO LOE NE A SSS o A WA YAP AYA YAA AAA NE AP YA YAA AP NAY NS MG Low density Confluent Low density Confluant aHSCsi aHSCs INTERNATIONAL SEARCH REPORT International application No PCT JP2011 067953 A CLASSIFICATION OF SUBJECT MATTER A61K45 0 0 2006 01 i A61K31 713 2006 01 i 2006 01 i A61K48 0 0 2006 01 i A61K472 0 2006 01 i A61P43 0 0 2006 01 A61K4 7 1 2 According to International Patent Classification IPC or to both national classification and IPC FIELDS SEARCHED Minimum documentation searched classification A61K45 00 A61K3 1 713 system followed by classification symbols A61K4 7 10 A61K47 12 AG1K48 00 A61P43 00 Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched Jitsuyo Shinan Koho 1922 1996 Koho 1996 2
93. ichLoride DBTC 1 2 2 DMSO D BTC 5mg DBTC kg 2 VA lip siRNAgp4 6 F ITC in vivo DBTC 4 3 DBTC 1 1 9 VA_ ip siRNAgp4 6 F ITC L ip siRNAgp46 FITC 1 0 75mg kg siRN A 1 3 24 FR ff FERSK UGE 10 SMA 1 1000 Sigma CD6 8 1 500 Da ko F ITC 1 5 0 0 Abeam
94. ip siRNA 1 s iRNA 1 1V HSP4 7 gp4 6 GenBank Access ion No M69246 s iRNA Sapporo Japan A GUUCCACCAUAAGAUGGUAGACAACAG gp4 6 WO 2012 018115 25 PCT JP2011 067953 0062 0063 0064 7 5 7 s i RNA IS 1 B GUUGUCUACCAUCUUAUGGUGGAACAU s iRNA 2 si RNA random s iRNAscramb le C CGAUUCGCUAGACCGGCUUCAUUGCAG HR YAH s i RNA MABE 3 D GCAAUGAAGCCGGUCUAGCGAAUCGAU CAMS iRNA 4 6 6 F AM FITC 5 BLAST mRNA 2 VA ip s iRNA 0 0
95. sul ts fk Fi gure Table PARSONS C J et al Antifibrot ic Effect sof a Tissue Inhib i tor of Metal loprote inase 1 Ant ibody on Establ ished Liver Fibros is in Rats HEPATOLOGY 2004 11 Vol 40 No 5 p 1106 1115 Material s and Methods R Results B Fig INN th 7 MMp 1 FRR OA BIO Clini ca 2001 04 10 Vol 16 No 4 p 330 334 2 MMP 1 3 FE IMURO Y et al Delivery of Matrix Metal loprote inase 1 Attenuates Estab shed Liver Fibros is in the Rat GASTROENTEROLOGY 2003 02 Vol 124 No 2 p 445 458 Material s and Methods 8 Resul ts fk Fi gure PCT 1SA 210 2 2009 7

Download Pdf Manuals

image

Related Search

Related Contents

New Products Test - IEEE Computer Society  ESPAÑOL - aquaBazar  Documentación Específica del Programa  Jensen JiSS-120i(811) _IB (EN) Draft130109_  Troubleshooting Diagram Lentis  Projecta HomeScreen 140x236cm    MD5 - Deutsch Deutsch - MD5  

Copyright © All rights reserved.
Failed to retrieve file