0〇 (12) 特許協力条約に基づいて公開された国際出願 (19
Contents
1. WO 2011 068218 11 PCT JP2010 071727 0034 0035 0036 DNA Vo Imer RNA Evaluation of n ovel broad range real time PUR ass a for rapid detection of human pa thogenic fungi in various clinical Specimens J Clin Microbiol 2008 46 6 19 19 26 Epub 2008 Apr 2 DNA2. 1 DNA ITS 1 PCR 1 1 2 d ermaF dermaR 2 3 4 ermaF2 dermaR2 2 8 9
3. 5 5 CTCTCTTTAGTGGCTAAAC 3 6 5 CGCGCTCCCCCTGC 3 7 5 TTYAACAAYGGATCTCT 3 PCR PCR TaqMan TaqMan DNA 5 3 HHXEA BKLOMGB Minor Groove Bin der FAM VIC NED JOE MB TAMRA 3 ROX Texas Red C y _ 5 TaqMan
4. WO 2011 068218 12 PCT JP2010 071727 0037 0038 0039 ECM BEBO ENB IRBES 9060 3 4 5 6 1 2 PCR
5. Tr ichophyton rubrum DNA ITS 1 WO 2011 068218 9 PCT JP2010 071727 0029 0030 0031 6 Tr ichoph yton violaceum 1ITS 1 GeneBank Acces sion AB520840 AB194246 PCR CEQA Tr ichophyton violac eum DNA ITS 1 7
6. 2 3 4 5 6 WO 2011 068218 1 PCT JP2010 071727 0001 0002 0003 0004 HA PCR 9 0
7. 2 5 6 2 3 LZLTL0 01 0zaf 6 8890 00 C OAV INTERNATIONAL SEARCH REPORT International application No PCT JP2010 071727 A CLASSIFICATION OF SUBJECT MATTER c12Q1 68 2006 01 i c12N1 509 2006 01 According to International Patent Classification IPC or to both national classification and IPC B FIELDS SEARCHED Minimum documentation searched classification system followed by classification symbols C1201 68 C12N1 5 09 Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched Jitsuyo Shinan Koho 1922 1 996 Jitsuyo Shinan Toroku Koho 1996 2011 Kokai Jitsuyo Shinan Koho 1 971 2011 Toroku Jitsuyo Shinan Koho 1994 2011 Electronic data base consulted during the international search name of data base and where practicable search terms used CA
8. 8 amp 0 f amp BEES 2 GRAMM 1 KOHH
9. 1 2 Unive rsa 1 DNA ITS 1 350bp 3 4 Tr ichophyton rub rum Trichophyton mentagro phy tes DNA ITS 1 150 bp 5 DNA ITS 1 6 DNA ITS 1
10. 5 6 DNA DNA ITS 1 PCR DNA DNA ITS 1 DNA 1 2 3
11. DNA ITS 1 WO 2011 068218 3 PCT JP2010 071727 001 1 001 2 001 3 001 4 PCR PCR 1 2 3 4 5 KO EIES 6
12. WR THR L AKA 200mM Tris HCl pH 8 0 25mM E WO 2011 068218 18 PCT JP2010 071727 DTA 0 55 SDS 250mM NaCl F E100CT107 MA DNA 5 0 L DN A 2 5 DNA 1 PCR 0050 3 C PCR C C C C
13. KOHHH LEAR m RNA PCR 2 mRNA ZR WO 2011 068218 2 PCT JP2010 071727 0005 0006 0007 0008 0009 001 0 1 PC R nes tt ed_ PCR 1 1 2008 067605
14. PCR 1 2 3 4 5 6 PCR DNA d NTP PCR
15. WO 2011 068218 10 PCT JP2010 071727 0032 0033 PCR TaqMan DNA T a q DNA 5 293 Ta q Man SRL OLVF PCR DNA DNA gt 3 4 5
16. Tr ichophyton rubrum Trichophyton mentagrophytes WO 2011 068218 4 PCT JP2010 071727 001 5 001 6 001 7 DNA DNA ITS 1 PCR DNA DNA ITS 1 DNA 1 2
17. IT S 1 14 285 DNA Mo ecular Cloning A Laboratory Manual Grd Ed Cold S pring Harbor University Press DNA ITS 1 15 3 0 bp 18 2 5 bp GGC 40 60 50 Tm PCR 5 10 C lt 60 6 52C Tm 65 7 0eC WO 2011 068218 7 PCT JP2010 071727
18. WO 2011 068218 6 PCT JP2010 071727 0021 0022 0023 PCR Real t ime poly merase chain react cC amp ODN A 2 X 2mm 5 1Omg DNA 100 C 10 DNA DNA ITS1 internal transcribed spacer 1
19. Trichophy ton mentagrophytes 840 BAHU ric hophyton rubrum 100 2 PCR JC ES Od AED URU XJIDNAOITS 1 TOPO T A Cloning Kit pCR2 1 T rie hophyton rubrum Trichophyton menta grophytes Aspergillus fumigatus ITS 1 4 2 1 4 WO 2011 068218 17 PCT JP2010 071727 0048 0049 2 primer pairs dermaF dermaR dermaF2 dermaR2 p
20. DNA ITS 1 DNA A Tr ichophyton rubrum Trichophyton mentagrophytes Trichophyton viola c eum Tr icho phy toon tu ee FS SPO BT WR ND 5 Art hroderma vanbreuseghemi i NE A rthroderma bend am f are Microsporum canis M i cr osporu m gypseum floccosum gt 9 2
21. 6 1 2 5 6 2
22. 10 0 0052 A34 UU ARM LERMIC E OUR en E3 3 WO 2011 068218 19 PCT JP2010 071727 0053 1 00 15 13 2 10 0 3 9 100 16 end 7 3 T R Tr jchophyton rubrum TM Trtcho phyton mentagrophytes ND
23. 1 47 103 111 2006 2 57 5 94 97 2003 PCR PCR PCR DNA fT LAL PC R PCR
24. MS2 TM3 F MS2_ TM3_ R LE WO 2011 068218 13 PCT JP2010 071727 0040 0041 dermaF 5 TAACAAGGTTTCCGTAGGTGAACCT 3 dermaR 5 TCGCTGCGTTCTTCATCGA 3 dermaF2 5 SSCCCCATTCTTGTCTACMTYAC 3 dermaR2 5 AACGCTCAGACTGACAGCTCTTC 3 MS2 TM3 F 5 GGCTGCTCGCGGATACCC 3 MS2 TM3 R 5 TGAGGGAATGTGGGAACCG 3 1 5 5 FAM 3 NFQ MGB TaqMan TME_ ITS 1F 2 6 5 CV IC 3 NFQ MGB TaqMan TRU ITS1V 3 7 5 NED 5 3 NFQ MGB TaqMan FU IT S1N 3 4 10 5 Cy 5 3 BHQ3 TaqMan wuS2 TM2 Cy5 NFQ Non f luorescent Quencher
25. 1ITS 1 WO 2011 068218 20 PCT JP2010 071727 amp 3 dermaF dermaR dermaF2 dermaR2 TME IT TRU IT TME 2 TRU ins SIF S1V aj em 5250 25000 200000 400000 peo esr 391 3125 6250 3125 1563 12500 25000 8005 3125 125000 m pm 100000 195 781 125000 391 781 125000 jun 3125 6250 100000 ALI 781 12500 125000 50000 6250 20000 6250 EMI Does IAE d 20000 80000 5 6950 0 781 391 PEINE MN ESTE BERE ET 3125 3125 50000 100000 100000 100000 49 12 781 25000 100000 SE a eed 3125 3125 100000 391 50000 1563 EA 58 3125 ag Sm 50000 25000 25000 25000 25000 25000 100000 100000 100000 100000 100000 0054 4 WO 2011 068218 21 dermaF dermaR PCT JP2010 071727 dermaF2 dermaR2 49 t TR 49 FU ITSTN 50000 49 TME ITS 1F 125000 25000 TRU ITS 1V 100000 195 TME ITSTF 100000 100000 TRU ITS1V 400000 781 3125 1563 12500 200000 TR ND
26. dermaR2 DNA ITS 1 150bp Ar t hroderma v anbreuseghemii Arthroderma simii un iVer sal PCR 0026 1 5 TAACAAGGTTTCCGTAGGTGAACC T 3 WO 2011 068218 8 PCT JP2010 071727 0027 0028 2 5 TCGCTGCGTTCTTCATCGA 3 3 5 SSCCCCATTCTTGTCTACMTYAC 4 5 AACGCTCAGACTGACAGCTCTTC DNA ITS 1 HH Wootton Fede
27. 1 2 2 PCR 2 WO 2011 068218 5 PCT JP2010 071727 001 8 001 9 0020 KOH nes ted PCR DNA DNA ITS 1 PCR DNA
28. BHQ3 Black Hole Quenc her 3 TME 1751 5 FAM CTCTCTTTAGTGGCTAAAC NFQ MGB 3 TRU ITS1V 5 VIC CGCGCTCCCCCTGC NFQ MGB 3 FU ITS1 N 5 NED TTYAACAAYGGATCTCT NFQ MGB 3 MS2 TM2 Cy5 5 Cy5 ACCTCGGGTTTCCGTCTTGCTCGT BHQ3 3 50 DNA DNA Qubit WO 2011 068218 14 PCT JP2010 071727 0042 0043 0 10 0 D NA PCR 7 5 0 0Fast P CR 19LX50O 1 9 L DN
29. DNA 50 4 0 0 bp 1 5 0 bp 0024 DNA ITS 1 universal OY DNA ITS 1 1 d ermaF 2 d ermaR DNA IT S 1 350bp 0025 IK EEO S BE OD 9 EJ EL E Trichophyton rubrum BEL Tr ich mentagrophytes 3 d ermaF2 4
30. S MEDLINE STN JST Plus JME DPlus I JST 7580 JDreaml DOCUMENTS CONSIDERED TO BE RELEVANT Category Citation of document with indication where appropriate of the relevant passages Relevant to claim No sis Arabat zis M et al Diagno common dermatophyte infections by a novel mul tipl ex real time pol ymeras e chain react ion dete ct ion i dent if 1 10 n scheme Bri ti sh Journal of Dermato logy 2007 Vol 157 p 681 689 MAKIMURA Koi chi Specie S dent i f i cat ion System for Dermatophyte s Bas ed on the DNA Sequence s of Nuclear Ribo s omal nternal T rans cribed Space r 1 Japane Se Journal of Medi cal logy 2001 04 30 Vol 42 p 61 67 YOS HI DA Eri et al Rapid identi fi cati on of Tri chophyton tonsuran S by speci flc PCR bas ed on DNA s equence S of nud ear ribo S omal i nternal t rans cribed space r I TS 1 region Journal of Derma t o logi cal S cience 2006 Vol 42 p 225 230 Further documents are listed in the continuation of Box C L See patent family annex Special categories of cited documents later document published after the international filing date or priority document defining the general state of the art which is not considered date and not in conflict with the application but cited to understand to be of particular relevance the principle or theory underlying tiie invention earlier application or patent but published on or after the international X d
31. System for of Nuclear Ribosomal AA m 4 1 ROS OME 03 3581 110 1 3488 2009 7 PC JP2010 071727 C Y YOSHIDA Eri et al Rapid identification of Trichophyton 1 4 tonsurans by specific PCR based on DNA sequences of nuclear ribosomal interna L transcribed spacer ITS 1 region Journal of Derraatological Science 2006 Vo
32. 3 4 1 2 3 4 2 EDEKA ibh AE ARA Trichophyton rubr um 840 EX BER Trichophyton mentagrop hytes 2 5 6
33. TM TM t TM TM t ND t ITS1 TM TM TM TM 127 127 IHE HEINE R R M M R R M M M R T T T T T T T T T T 100000 25000 100000 781 125000 1563 1563 25000 20000 100000 143 Ift 143 391 3125 781 145 145 3125 3125 3125 50000 50000 400000 0055 100000 100000 AHBOMEAKIC KANE MABROHAREWR 100000 100000 100000 WO 2011 068218 22 PCT JP2010 071727 1 2 3 4 PCR 1 2 3 4
34. 10017 OS ARPO BW GH GM KE LR LS MW Hif saga uP Mz NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ T 05 CEEBIICOUCOdN BH AL AT BE BG CH CY CZ DE DK EE ES Fl FR fMAKIMURA KoichH JP JP 1920305 GB GR HR HU IE IS IT LT LU LV MC MK MT 3 5 9 NL NO PL PT RO RS SE SI SK SM TR OAPI toyo up iMyAJr BF BJ CF CG CM GA GN GQ GW ML MR M A Yoshiharu JP JP T1920395 T NE SN TD TG 3 5 9 mxq BEN tokyo QArANAgg Shinch T 1738606 2 RE Ro 1 Tokyo P 52a g 7M AsEeAwA Yoshiki eta T 1000008 1 54 Tite KIT AND METHOD FOR IDENTIFICATION OF CAUSATIVE BACTERIUM OF NAIL TINEA 54 JI ERE OO ES ERES OD S XE Fl P A KO 00 858 7 7 57 Abstract Disclosed are a kit and a method for laentiiying causative b
35. 14 Hasegawa Epider ophyton floccosum 5 22 Hasegawa Other pathogenic fungi MESES 111 MESE Candida albicans ATCC10231 Candida albicans TIMM1768 Candida albicans ATCC90028 j Candida glabrata ATCC90030 Candida glabrata CBS138 eds queas derum al esc e oes nn Candida tropicalis ATCC750 Candida tropicalis TLCS 5 9 1 Candida parapsilosis ATCC2209 Candida parapsi losis ATCC90018 Aspergillus fumigatus T NM0108 Aspergillus fumigatus JCM10253 Aspergillus fumigatus T1MM2920 Aspergillus flavus TIMMO059 Aspergillus flavus 2935 Aspergillus niger TINMO113 Aspergillus niger TIMM2915 Paecilomyces variotii TIMM3182 Pseudallescherichia boydii TIMMO886 Fusarium oxysporum TSY 0351 Fusarium solani 151 0403 Fusarium verticillioides TSY 0219 Chaetomium globosum TSY 0369 Exophiata jeanselmei TSY 0396 Cryptococcus neoformans ATCC90113 Cryptococcus neoformans TJane Trichosporon asahii BS2479 Rhizopus oryzae 1 0921 1 ITS 1 d e rma F WO 2011 068218 16 PCT JP2010 071727 0045 0046 0047 dermaR FU_ ITS 1N d ermaF dermaR gd ermaF2 de rmaR2
36. 157 identification 2007 detection Dermatology Vol MAKIMURA Koicm Dermatophytes Species Transcribed 2001 04 30 42 p 61 67 Internal Spacer 1 Y Y Cc 4 4 SA JP 100 89 15 4 3 PCT ISA 2 10 2 of common derraatopnyte polymerase p 681 689 Identification Based on the DNA Sequences 1 4 1 4 infections chain reaction British Journal of
37. A 1 NL S 357 307M X4 6 5 ROX Reference Dye I I 20 Hv 15 x4 20 X 4 Premt 500 uL 950 HL PCR MHA 9 5 0 PCR 9 52C 10 60 C 30 6 0 PCR 1 Git S WO 2011 068218 15 PCT JP2010 071727 1 primer pairs dermaF dermaR dermaF2 dermaR2 probes FU ITS TRU ITS TME ITS TUE ITS1F 1N 1V Dermatophytes e Trichophyton rubrum 199 Trichophyton rubrum 1108 Trichophyton rubrum 4 21 Hasegawa Trichophyton rubrum 4 23 Hasegawa Trichophyton rubrum 4 25 Hasegawa t Trichophyton rubrum 4 26 Hasegawa 0044 Trichophyton mentagrophytes TT Trichophyton mentagrophytes 19 Arthroderma vanbreuseghemi i T NM2789 Trichophyton tonsurans Arthroderma benhamiae SM103 Microsporum canis 1005945 Microsporum canis 10650222 Microsporum canis 10050223 Microsporum canis 10050269 Microsporum TDGS0009 Microsporum gypseum TDGS0012 Epider tophyton floccosum 5
38. PCR 100 C A PCR L inRegPCR Ruijte r OM Amplification efficiency Ii nking baseline and bias in the ana Iysis of quantitative PCR data Nuc leic Acids Res 2009 Apr 37 6 Epub 2009 Feb 22 C 0051 7 10 0 100
39. W 2 11 68218 A1 IMMATURE UT TINI 12 19 TOON CORR AH 10 d 43 Sy 2011 6 9 09 06 2011 PCT WO 2011 068218 A1 60 MY PLAZA C12Q 1 68 2006 01 C12N 15 09 2006 01 9 BR 21 PCT JP20 10 07 1727 ins B sp JIN 2010 12 122010 us a zr NM Ju b cue ABER d m obi o BB BG BH BR BW BY BZ CA CH CL CN CO CR CU CZ DE DK DM DO DZ EC EE EG ES Fl ee GB GD GE GH GM GT HN HR HU ID IL IN IS 30 JP KE KG KM KN KP KR KZ LA LC LK LR BH 2009 27671 12009 fF 12 4 04 12 2009 yp Ext iso meer Mc oM LAN ade Murat MX MY MZ NA NG NI NO NZ OM PE PG gc lt PL PT RO RS RU SC SD SE SG SK SL SM ST BOE AY KF UNIVERSITY JP JP SV SY TH TJ TM TN TR TT TZ UA UG US UZ 1736605 2 11 1 VC VN ZA ZM ZW Tokyo ARE ee HISAMITSU gi HER FUROR UIBU t INC JPAP
40. acterium of nail tinea which ldentiiy tne causative bacterium rapidly and accurately by a real time PCR method using primer set and a probe both specific to a bacterium Species Specifically disclosed isa kit for identiiying a causative bacterium of nail tinea which comprises primer set a probe and can identify acausative bacterium of nail tinea by a real time method wherein the primer set is at least one selected from the group consisting of a primer set comprising a primer having the nucleotide Sequence represented by SEQ ID NO and a primer having the nucleotide Sequence represented by SEQ ID NO 2 and a primer set comprising a primer having the nucleotide Sequence represented by SEQ ID NO 3 and a primer having the nucleotide Sequence represented by SEQ ID NO 4 and the prove is at least one selected group consisting of a probe having the nucleotide Sequence represented by SEQ ID NO 5 and a probe having the nucleotide sequence represented SEQ ID NO 6 co PCR PCR
41. l 42 p 225 230 Y MOCHIZUKI Takashi et al Identification of Several Clinical 1 4 Isolates of Dermatophytes Based on the Nucleotide Sequence of Internal Transcribed Spacer 1 ITS 1 in Nuclear Ribosomal DNA The Journal of Dermatology 1999 Vol 26 p 276 281 Y JP 2008 278871 2008 11 200 amp US 1 4 2009 0081666 PCT 1SA 210 2 2009 7
42. linical lsolate s of Dermatophyte S Bas ed on the Nucl eoti de Sequence of Trans cribed Space r 1 ITS 1 in Nucl ear Ribo somal DNA The Journal of Dermato logy 1999 Vol 26 p 276 281 JP 2008 278871 A Canon Inc 20 November 2008 20 11 2008 ent ire text amp US 2009 0081666 Al Form PCT ISA 2 10 continuation of second sheet July 2009 PC Int Cl C12QI68 2006 01 i C12N15 09 2006 01 i B C1201 68 C12N15709 PC Int Cl 922 1996 971 20 1 1 996 20 1 1 994 2011 CA BIOSIS MEDLINE STN JSTPlus JMEDPlus JST7580 JDreamll PCT JP20107 071727 Arabatzis M et al Diagnosis by a novel multiplex real time scheme
43. ocument of particular relevance the claimed invention cannot be filing date considered novel or cannot be considered to involve an inventive document which may throw doubts on priority claim s or which is step when the document istaken alone cited to establish the publication date of another citation or other Y document of particular relevance the claimed invention cannot be special reason as specified considered to involve an inventive step when the document is document referring to an oral disclosure use exhibition or other means combined with one or more other such documents such combination document published prior to the international filing date but later than being obvious to a person skilled in the art the priority date claimed document member of the same patent family Date of the actual completion of the international search Date of mailing of the international search report 01 February 2011 01 02 11 15 February 2011 15 02 11 Name and mailing address of the ISA Authorized officer Japane se Patent Office Facsimile No Telephone No Form PCT ISA 210 second sheet July 2009 INTERNATIONAL SEARCH REPORT International application No pea C C Continuation DOCUMENTS CONSIDERED TOBE RELEVANT DOCUMENTS CONSIDERED TO BE RELEVANT Category Citation of document with indication where appropriate of the relevant passages Relevant to claim No MOCHI ZUKI Takashi et al Identi fi cati on of 1 4 Several C
44. rhen S Ana lysis of compositionally biased re gions in sequence databases Method s Enzymo 1996 266 554 71 DNA ITS 1 GC Tm 10 50mer Tm Tm 10 C Tm MGB Minor Groove Binder BENZ Trichophyton mentagrophytes DNA ITS 1 5 tX Arthroderma vanbreuse 9 hem ii
45. robes FU ITSTN TRU ITS1V TME ITSTF TRU ITS1V TME ITSTF rDNA 400 444 z I 35588 73 o8 S C 83 UC 378 PR 7 RF PCR PCR 9 0 9 5 100 DNA 3 5 0 100 1 2 100 50 0 ne sted _ PCR 2 16 6 3
Download Pdf Manuals
Related Search