Home

チオラーゼスーパーファミリーにおけるミッシングリンクの発見と機能解明

1. gt gt 2 5 2 1 E 2 eo O 16 18 20 22 24 26 28 30 32 34 1000 2000 3000 Retention time min m z M 5H 5 2258 9 400 UV at 220 nm ei lt gt 200 Gi H 16 18 20 22 24 26 28 30 32 34 1000 2000 3000 Retention time min m z 1 1 3 LC MS 0 0 000 malonyl ACP 0 0 D 0 O ADTotal ion 0000000 O 0220 nm 00000000 UY DD DD DD 0 0000 1 000000 21200000 2000000 2150 0000080000100 20 Men 00 UD OOO M 5H 1L E E deconvolution E E 0 00000 011377 4 1 11289 7 220 MO 000000000000 Omalonyl ACPQ DO holo ACPO 0000000000 0000 11375 6 Da 11289 3 Daf E 00 LI 25 NphT7 OT KAS III FabH ACP derivatives Autoradiogram Coomassie stained O O KASIIO O HS CoA PA atte ben S ACP 1 1 4 KAS IIn fu IU DDD SDS PAGE 18 0 000000000 0000000000000000000000000000 1 Rainbow maker 2 NphT7T U O USUKAS II O O positive control j4 I 0 E E E E L D D negative contro 0 D 00 000 00 KAS IN DO 0000000000000 f 0 Coo 0000000000 26 UO Acetoacetyl CoA E 1 LIU L 000000 UU NphT7 KAS 10 0 00d 000000 0 00 00000000 0 U U DU malonyl CoA 10 UNphT7 O DU D L HPLC EC MS 0 UDO O UO acetoacetyl CoA UU E ELE E DLE E UO 0000000 1 2 1 50 wl IS ug O O O 0 3 mg mL O NphT7 0 E UU 30 C 20 UU 0 UU 0000 0 1160790 Y 000000 S aed E 000000 0000 DI M MESH UU cpHe o 100 UU 0 00 000 115 000 grj4 CL 101
2. A Predicted hydroiases or acyltransferases molybdopterin dehydrogenase FAD binding protein 2Fe 25 binding protein C TetR family transcriptional regulator amino acid permease amine oxidase O globin penplasmic binding protein crotonyl CoA reductase nan ribasomal peptide synthase a 1 kb hydroxybutyryl CoA reductase Y g E 8 3 E lt CD D EA 2 pa un e gt a zi la 2 22B CoA 1 LH DH D NphT7 D D 2 00000 NphT7U 00000 CoA Td 0000000 0000 ORFOD 00 00 00 0 000 LU UUUUUUUU ilL 86 putative secreted glycosyl hydrolase Fungal alpha L arabinofuranosidase Poly 3 hydroxybutyrate depolymerase secreted glycosyl hydrolase Glucose sorbasone dehydrogenases r chitin binding domain 3 protein Phage related replication protein Poly 3 hydroxybutyrate depolymerase B ta 1 4 xylanase ado ig Alpha N arabinofuranosidase HrpA Bke helicases g Ketosterold Bomerase homolog crotonyi CoA reductase 3J hydroxybutyryl CoA dehydrogenase j amine oxidase 3J hydroxyisobutyrate dehydrogenase and related beta hydroxyacid baal it ceri 6 phosphoglu conate dehydrogenase NAD binding protein hydroxyisobutyrate dehydrogenase and related D bela hydroxyacid dehydrogenases putative dehydrogenase D Predicted nucleoside diphosphais sugar epimerases acyl CoA dehydrogenase type 2 domain protein 3 hydroxyisabutyrate dehydrogenase and related beta hydroxyacid DATO short chain dehydrogenase conserved prot
3. HOUUUUUUUUUUUUUUUUUUUUU UU Lin vivo 4000000 00 UO E E UN Streptomyces coelicolor M511 U U L E UL KAS O Hj JU E 00 UE coli 0 L KAS BILE LE UL DOLO DE OL D MaIIUDUDUDUDUUDDUUDUU D E coli nd 000000000000000000000 Q000KAsS mp 0000000000000 0000000000000 gun dug dt 19 Escherichia coli O O oO Z er sh j ora acetyl CoA C2 Streptomyces glaucescnse O O O AA G CR butyryl CoA C4 Staphylococcus aureus O G o0 D o0 EG PMN i HS CoA prs es SA dar o eg op x S ACP butyryl CoA C4 o o o o o EE A LEE pw A HS CoA S CoA ne sie S ACP hexanoyl CoA C6 O O O O HS CoA sch sua Se See isobutyryl CoA C4 Bacillus subtilis O O O O Q m HS CoA E RT PR SI SON Pad Sookie acetyl CoA C2 O o o o 9 E ___ HS CoA uereg T A E SY sone isobutyryl CoA C4 HS CoA S CoA ue SA eno S ACP isovaleryl CoA C5 Mycobacterium tuberculosis O o o Di Ze m HS CoA TTT elena ea lauroyl CoA C12 3 KAS II LL DO D D LU U L KAS ME EIER H HIER EET DR DR ER EK ERR TERI EE A n noh B ketoacyl ACP type I PKS OO type II PKS OO BD 0000 00000000 0 00 000 UU UStreptomyces coelicolor A32 L O UU UU UU UU UU 00 000 undecylprodiginine 7 DDT Rede s peucetius doxorubicin 00000 000000000 Dpsc QS roseofulvus Y frenolicin 0000000 Fmil Streptomyces sp R1128 0 0 R1128 0000000900 ZhuH KAs DD 0000
4. Revill WP Bibb MJ Scheu AK Kieser HJ Hopwood DA 2001 Beta ketoacyl acyl carrier protein synthase III FabH is essential for fatty acid biosynthesis in Streptomyces coelicolor A3 2 J Bacteriol 183 11 3526 3530 Lai CY Cronan JE 2003 Beta ketoacyl acyl carrier protein synthase III FabH is essential for bacterial fatty acid synthesis J Biol Chem 278 51 51494 51503 Cerdeno AM Bibb MJ Challis GL 2001 Analysis of the prodiginine biosynthesis gene cluster of Streptomyces coelicolor A3 2 new mechanisms for chain initiation and termination in modular multienzymes Chem Biol 8 8 817 829 Mo S Kim BS Reynolds KA 2005 Production of branched chain alkylprodiginines in S coelicolor by replacement of the 3 ketoacyl ACP synthase III initiation enzyme RedP Chem Biol 12 2 191 200 Grimm A Madduri K Ali A Hutchinson CR 1994 Characterization of the Streptomyces peucetius ATCC 29050 genes encoding doxorubicin polyketide synthase Gene 151 1 2 1 10 Bao W Sheldon PJ Wendt Pienkowski E Hutchinson CR 1999 The Streptomyces peucetius dpsC gene determines the choice of starter unit in biosynthesis of the daunorubicin polyketide J Bacteriol 181 15 4690 4695 Bao W Sheldon PJ Hutchinson CR 1999 Purification and properties of the Streptomyces peucetius DpsC beta ketoacyl acyl carrier protein synthase III that specifies the propionate starter unit for type II polyketide biosynthesis Biochemistry 38 30 9752 9757 Bibb MJ Sherman DH
5. UI IUL HL LL QUO Du LIO Lulu tul p7 00000 NphT7 in vivo 0000000 U DUDU Llacetoacetyl CoA 000000 00 HOO BL E EIE E U U Ll 3 hydroxy 3 methylglutaryl HMG CoA synthase nphT6 LIL HMG CoA reductase U O nphT5 nphT7 UUU S albus L EL UUU U UU 00000 000000000000 0000000000000 UO Streptomyces sp CLI90 O LU LE DU DEC U DU O O QUOTO 00000000 0000000000 pUMVI81 nhT710 E l D LE U LE UD Acei ET LI UL LT UU 00000000000 0 Une T6 0 0 0 00 Sses387EL I 0 0 DU O 00 Unph76 Y Cond dg 000 7700 000 21 kb DNATILD III d0 D 00 L D 0000000 0000 000 pSE101 thiostrepton 0 D 0000 TO nens 0 nphT6 D 00000 000000000 pSEMV25 pSE101 0 0 0 0 O Hindui 00000000000 000 0000 sses387I E 0 0000 0 00 8 7 kb DNA UU UU 00pSE101 0 0 000 UU OnpaT7 0 00 nphT6 NUUUUUUUUY 000000 21 kb 00000000 00000 linsphTS DU nphT7 DL 000 pSEMV40 PU DUO U SAD U U UL pSEMV40 lpsEMv25U 00 0 0 UUU UU U pSEIOT E 000 LE LI Streptomyces albus G153 UU 000 0000 0000 000000000000 EE LI thiostrepton O U UU npAT6 nphT70 E B E B L 0 34 D O E U colony directed PCR EIE E LUG E UO U E E UI U YEME thiostrepton O 10 mL DU thiostrepton O 30 pg mL 30 C 3 UD UU DO DUO D LI L KG thiostrepton 10 mL U U thiostrepton O 30 ug mL 194 U USO CUP Ecc ELLE iO PI ill TL D uu mutui utu t UUO GOOD UG Lu uu ULUI ut uttututtututulLi 0000 Imc 4000000 00 eR 2 00 UU ULUI UL EE U2 mE TT E CI LE LI Cl 0
6. 000000000 00 000 D Umalonyl CoA NphT7 00 0 300000000 UU D DD malony CoA O O acetoacetyl CoA O O O 00 0000 0 0 Y 00 60 Intensity mAU Intensity mAU 1004 Thiolactomycin T Heat denatured NphT7 H No Inhibitor N Cn e I 9 10 11 12 Retention time min 1004 Cerulenin C Heat denatured NphT7 H No Inhibitor N C O 9 10 11 12 Retention time min 2 5 2 Thiolactomycin A O cerulenin B L EL L L ODO Neht7 WO D D L BUENO EON malonyl CoA CoA acetoacetyl CoA 3 1 2 4 malonyl CoA 3 malonyl CoA 1 CoA 2 acetoacetyl CoA 4 acetyl CoA 70 uM acetyl CoA 30 uM malony CoA HL 00 000001 mM EL ILL OLEO D BUD D L 00000000000 CoA IU II 259 nmgoo000000 000000 000 00 O UUUUUUIUU IUL UUUUU UI U 0000000 Npehr7 DEO UO D D UU 000 malonyl CoA UU 00 0000000000 CoaAQGOOOOOOD000000U00000000 DO Badoo nod 00000000 CoA 000000 1010C0A 2 Jacetoacetyl CoA 131 malonyl CoA 4 Jacetyl CoA Hoh i ENEE KASIU UEH U GGE B EE ER PTT ET GE O EE UBE 00000000000 ONT D00 D0000000000000000 O0 QHEDUULDSSLULULULLD 2 4 4 JacetyI CoA 00000000000 0000 ANAIS DI E Eee AAN JOAO UO UO BL EE OO EE D DL EE DL CE ULUI UU UI acyl CoA JO EL EE G A EI Te BED 1 E 00000000000000 a tuberculosis 0 D 0 KAS III mtKAS IDO E coli O O KAS III ecKAS IDOS aureus O KAS M saKAS mM GO 00000000 U 26 000 0 0 U Lacy 0000000000 0 0 2 6 1110 MIM tub
7. 0000000000 deconvolution 9 D O O OO 11377 4 11289 7 MIU UL U UUU U Llmalonyl CoA holo ACP YU DOO DU OOO E E E E 11375 6 Dal 11289 3 Da UU UL O JU malonyl ACP M Ca00H773N 1350168PS3 11375 6 holo ACP M C4g7H776N1350165PS3 11289 3 YU O UU DU UUmalonyl ACP OU UU U DLE LI KAS min DODO KAS WI UU D HB D EE OU 1 1 40 0 0 00 0 EE U positive control KAS HU Ll ACPHOUUUUUUUU UL 0 00 U Unegative control UI se Eu ER TEO O UO TACE EEE EB E EI NphT7 U ACP U negative contro UL O IU O OE UL DE DO D UE EIL U UU O OO BE BEE UNphT7 LU G EOU UUUUUU LU ULUI 00000000 0000000 acetyl Coa 0 0 O D 1 C acetate NphT7 Cyst DD 00000 ud LU LU IUL UUUUU LU db d LU LI U LILINphT7 malonyl ACP UumudgiuiitlilikAS m 000000000000 00000 23 A scKASIII NphT7 Da LMW 1 2 3 4 5 LMW 1 2 3 4 5 97 0 66 0 45 0 30 0 B C kDa LMW FabD kDa PM ACP ACPS 97 0 16 9 ep 66 0 14 4 10 7 8 1 45 0 6 2 30 0 1 1 2 SDS PAGE I AUNphT7 L scKAS III QU 00000000 SDS PAGE 10 DD 000 0 000 O UBU FabD Hd B HEBHLE LU O SDS PAGE JC JACPS JACP TQ 000000 00 0 SDS PAGE 18 00 400 0000 0 00 OD OO D EE OGG D HE DE DO EE U ULMWI Low molecular weight marker PM Peptide marker 100 O O O O O 0200 000 GSUNI NTA D BU d D400 000 0500 UDO D FabDrE EabD 00000000 00 DACPEIACP 000000 00 00 QACPSUACPSU 0000000 DUU 24 6 T M 5H 5 2276 5 TIC All MS e 2 6 O x
8. 100 0 UNphT7 H256AD 0000 SD ELO UO ODE 0000 000000000000 01 1CoA 121 acetoacetyl CoA 3 malonyl CoA 4 acetyl CoA LL III CoA D II ET E 000 259 nm D ELO UGO UO CL EE OE ELLE LI 44 HOU 00000600 acetoacetyl CoA UUUUUUUUU OU UUUNpar TY Cys His Asn HUUUUUUUUUUU UO UUUUUUU Ub O UO O Ueys His Asn DO O O UU O UUKAS IN UO UU UU Dacyl Co Al EL E IILI ULUI ol malonyl ACPY O 0000000 acetyl AcPo 00 000000000000 0000000 type M PKSI O 2 PS Jaeetyl CoAL 00400000000 0 0 U U Ll l malonyl CoAll U DU LI Li E Llacetyl CoAll DE UO UTE UL D UE D UO DI CE ELO EE LEE CECI LI CI 6 methyl 4 hydroxy 2 pyrone CAL OD 0 0 00 0 000 000000000000 UTANSO UU U U U EE E malonyl CoA U 1 3 6 8 tetrahydroxynaphthalene THN 00 000900 00 0 B D CONphTTO acetyl CoAD 000000000 UU U LI LI UU malonyl CoA DU Jacetoacetyl CoAL U U 000 0000000 D00 O OUUU 00 O LILI U 2 220 45 O Q LL HS CoA S CoA acetoacetyl CoA O O S 3xHS CoA OH OH OH 5x HS CoA HO OH ox CO THN 2 2 1 NphI7 UL UU O malonyl CoA O O L L acetoacetyl CoA O U QOQQUQONphT7 000 2PSODOD 0d 0000000000000 00000000 00 DO AB ODO DO DO DO UUUUULU 46 UO 1 mM malonyl CoA U 7 E U UL U 1 2 1 1 50 uL 30 ug NphT7 L O 0 6 mg mL UO 0 80 40 O LI 0301 601 901 120 O 100 O Q00 00 UU SCUO UO UOG O UI O UO 000 0 0 00 0 0 LI 0 APLCO TOO O 00 00 HU UUUUUUUUUUU UU UU tl ili NphT7L DIDI DEC D
9. 11 12 13 Heath RJ Rock CO 2002 The Claisen condensation in biology Nat Prod Rep 19 5 581 596 Haapalainen AM Merilainen G Wierenga RK 2006 The thiolase superfamily condensing enzymes with diverse reaction specificities Trends Biochem Sci 31 1 64 71 White SW Zheng J Zhang YM Rock 2005 The structural biology of type II fatty acid biosynthesis Annu Rev Biochem 74 791 831 Blacklock BJ Jaworski JG 2006 Substrate specificity of Arabidopsis 3 ketoacyl CoA synthases Biochem Biophys Res Commun 346 2 583 590 Ghanevati M Jaworski JG 2002 Engineering and mechanistic studies of the Arabidopsis FAEI beta ketoacyl CoA synthase FAE1 KCS Eur J Biochem 269 14 3531 3539 Austin MB Noel JP 2003 The chalcone synthase superfamily of type III polyketide synthases Nat Prod Rep 20 1 79 110 Jiang C Kim SY Suh DY 2008 Divergent evolution of the thiolase superfamily and chalcone synthase family Mol Phylogenet Evol 49 3 691 701 Modis Y Wierenga RK 2000 Crystallographic analysis of the reaction pathway of Zoogloea ramigera biosynthetic thiolase J Mol Biol 297 5 1171 1182 Davies C Heath RJ White SW Rock CO 2000 The 1 8 A crystal structure and active site architecture of beta ketoacyl acyl carrier protein synthase III FabH from escherichia coli Structure 8 2 185 195 Qiu X Janson CA Konstantinidis AK Nwagwu S Silverman C Smith WW Khandekar S Lonsdale J Abdel Meguid SS 1999 Crystal structure of beta ketoacyl a
10. 2 pyrone 00 0 0 06 0000 1 3 6 8 tetrahydroxynaphthalene THN U 0 UO U E UGO UG DIE nao UU U UU U type HI PEST UU THN synthase U D DU III U ULL 000 D 0 0 malonyl CoA 0 00 4000000 TANDO D D 040000 type HI PKS OUUU GOO UU chalcone synthase p cumaroyl CoA JH O E E DELE oso 0 E malonyl CoA LILI O chalcone LU 0 LU UUD U IULIU O DU UELLE UI EL 000000000000000000000000 0 5000 000 type m PKS DL EE UO DEO BDO ELO U UUU GOT ADO DDD ODO OE EE OE H 440 0101100141400 EET ETE O Pg O O 2 PS x uM era malonyl CoA On 3x HS CoA acetyl CoA 2x CO TAL THNS e al e AA ON 5x HS CoA HO S CoA malonyl CoA CO Ho OH sasa THN udi HO O 0 BAS Me A 2x HS CoA HO S CoA N S CoA malonyl CoA O p cumaroyl CoA 2 902 benzalacetone HO CHS H 3x o O 4x HS CoA S CoA ETE p cumaroyl CoA malonyl CoA 3x CO2 chalcone 5 Type Ill PKSUUUUUUUL QUO Td TU TTTTIIIOIOO00 2 PS 2 pyrone synthase THNS THN synthase BAS benzalacetone synthase CHS chalcone synthase 12 000000 00000 000000 000000000000 naphterpin 00 UU LI O D C 000 Ostreptomyces sp CL190 0 00 0 00 D nic 190 0 D 000 0 000 IDD E LE LE E isopentenyl diphosphate IPP dimethylallyl diphosphate DMAPP 000000 0000MEPO D 000 000 0000 000 09Onaphterpin 0 0 0 00000 0000 000 D 0 000 0 0 0Naphterpin 000000000000 000000000000 0000 000 0000000000000 000 DD 00 UO OO 0000000000000 ut Llacetoacetyl CoA IPP DM
11. 3 DUDU DO acetyl CoA methylmalonyl CoA U U UUU 00000000 U 2 methyl 3 oxo butanoyl CoA m z U O U ULI E E E IM C2eH42N7018P3S H 864 1442 M C36Ha4 N7Na01gP3S Na 2H 886 1261 O LI LI LI 54 A n propionyl CoA 5 malonyl CoA D butyryl CoA 11 malonyl CoA 150 150 2 2 100 4 100 E E 2 504 2 50 e 2 04 0 3 8 9 40 4 12 43 14 Retention time min Retention time min B isobutyryl CoA 7 malonyl CoA E isovaleryl CoA 12 malonyl CoA 150 2 2 E E gt gt p 12 n T i s Jh E E i n 0 1 i uh E d 8 9 10 11 12 13 14 Retention time min Retention time min C acetyl CoA methylmalonyl CoA 9 150 1 CoA x 2 acetoacetyl CoA gt 3 malonyl CoA X 100 degt E 4 acetyl CoA D 5 n propionyl CoA 50 6 3 oxo pentanoyl CoA t 7 isobutyryl CoA 8 4 methyl 3 oxo pentanoyl CoA 9 methylmalonyl CoA gi oM SR ME 10 2 methyl 3 oxo butanoyl CoA Retention time min 11 butyryl CoA 12 isovaleryl CoA 2 4 2 IULIU HPLC O OO LI L mM T0 00000 Td ooo 0000000 000000000000 0000000000 DEI BIZ ETE TEL H a EE ET EET EET ETE EET EE HL Edo DE EE BEE EEE HE 0000000000000000 0 24 30 00 0 00000000000 55 gt 864 1450 100 O O q c C ho EA SS eck E D 3 6 2 50 6 3 oxo pentanoyl CoA calcd M Na 2H 886 1261 x 0 500 1000 1500 2000 m z B 878 1589 100 O O O o Y s cos TATTO Y s con 7 3 8 B 50 lt 8 4 methyl 3 oxo pentanoyl
12. CoA gt 900 1401 calcd M H 878 1598 calcd M Na 2H 900 1418 0 500 1000 1500 2000 m z C mn 822 1340 T n o YSs coa As CoA 3 9 5 2 50 5 n propionyl CoA 844 1139 calcd M H 822 1336 2 calcd M Na 2H 844 1155 x 0 500 1000 1500 2000 m z D 864 1436 100 O o 0 o 0 9 A Wa m S S CoA HO S CoA S CoA E 4 9 10 a DO lt 10 2 methyl 3 oxo butanoyl CoA 886 1239 calcd M H 864 1442 s 9 calcd M Na 2H 886 1261 0 500 1000 1500 2000 m z 0 2 4 3 000000 LC MS ULD DI DADO BDO Od O OT OT GU Ud Td gg dd dd DO TTT OT TOO DDD ODO l 2 4 20 00000000000000000 56 n propionyl CoA isobutyryl CoA OO LH LE HE UTO BL BLU UU OU LI OL LU U LU UUU LUI DO OO DO UUU DO DO ODO DD OO DO UI UULU UU 000 Umethylmalonyl CoA T O DU E DacetylCoA D D O O UUDO OOO UI 000000 00 DUDU U lacetyl CoA malonyl CoA 0 ET HE JII 00000 00 O O UUUNphT7 acetyl CoA malonyl CoA UU D EO TEL O D 000000000 0000414 249000 00000 000 0 O DO 3 oxo pentanoyl CoA OU 2 methyl 3 oxo butanoyl CoA UO UUW UOC UUUUUUUU UL UUUUULU NMR DLE UUUUU 0000000 OU 2 42 WUUUOUUUUUU NehnrZ 000000 B n Re HERE HE TE umol min mg n propionyl CoA malonyl CoA 0 012 isobutyryl CoA malonyl CoA 0 009 acetyl CoA methylmalonyl CoA 0 012 acetyl CoA malonyl CoA 8 906 UUUUULUUULUUZ2I OO malonyl CoA UU O UU L acetoacetyl CoA HOO OU KONDO acetyl CoA O ET ELE EL ULL acetyl CoA malonyl CoA uuu uL o anion D D
13. CoA TI UI 00000000000 UUmalonyl CoA O O Ll acetyl CoA D UO IUL 00 O 00 UU DBis Asn D 00000000000 malonyl CoA O O O O UU a anion O O UD UU 000000000 UDO UU O acetyl CoA O O O DD UO DUO OOO 000 NphT7 Cys UD ai UTO UU 00000 00 000 NphT7 H256A U CoA acetoacetyl CoA TU OU D HB E DB E EHE EL DI U UL Asn286 LI UU UO DL D CE CL DI OE EE DOCE C Ulo amon O 0 0 JII IU L 000000000 0000000000000 KAS HE TOTEUO D UO CE L U UUO 0000000000000 0 2 umol min mg 40 Y 00 00 000 UO 0 241 2000 0 0 0 0 0NpT70 0 8 9 umol min mg 00000060 3200000 1 3 10 0 00000 00000 aeety CoA O E DE D UU DD OU 440 UL EE UL l 2 122 0000000000 NenT7 00 NpnT7 H256A 0 0 TT BERTA A RIF H amp TE umol min mg NphT7 H256A 1 mM acetyl CoA 1 mM malonyl CoA 0 2 NphT7 1 mM acetyl CoA 1 mM malonyl CoA 8 9 000 0 0 UNphT7 L B256 D DL UO HELD B UD ELO CE EE CU HE 000000 UD UU LU ULUI N286A O 0O 00 LLIB25eA UU OC CO HELD UO UTO OLI DU O00 U UG 000000 UO O NphT7 O Cys His Asn catalytic triad O U UO UU UO D D DEB ECL D OO 0000 00 43 A NphT7 C115A 150 100 50 Intensity mAU 9 10 11 12 Retention time min B NphT7 H2564A 150 50 Intensity mAU 9 10 11 12 Retention time min O 2 1 3 NphT7 C115A O0 H25s6A QU O00000 HPECTI O O l A NphT7 C115A 0000 HPLC O O O O OBONphT7 H256A 00000 HPLC B1 DD D D mM acetyl CoA 1 mM malonyl CoA 00 0 0 0 0000000 D I FINphT7 C 115A 1 0000
14. DO DU O DIOE OE EEUU DE OE EE ODE LE LI UO UUUUU UU UUUUUUUUUUUU 000000000000 acetyl CoA HOUUUUUUUUNphAT7 UUUUUUUUUUUUUU UL UL OULU LI UL O OO OOO DUO OOO DU UU UU butyryl CoA isovaleryl CoA DADO UUUUU ULUI ULUI LILI acetyl CoA ULUI 0000 DI 00204000000 NphT7 LE LI DE LI D DU Limalonyl CoA 00000000 0000 acetyl CoA 0000000000000 000 00000 0000000 NphT7 000000000000 00000 0 000 0000 l D butyryl CoA malonyl CoA U U LU U U D U 3 oxo hexanoyl CoA isovaleryl CoA malonyl CoA OU U U UULU 5 methyl 3 oxo hexanoyl CoA 1 LIU EL UU 6 0000 2 4 4 F ey d B d d B OO OTO OO GUDO D DELE OELELEE C UO ULUI UCG UO UTO I UL 000 UU UNphT7 0000 L 27 IUUUUL SUL UI mutui tLiuttLitutibilitLLi 00 O 0000 000 UU 2 4 40A DOV nui I III sut uL UUUUUUUUUUUUeUI ULUI DOOU UH UULU D acetyl CoA methylmalonyl CoA Hj HH B O O U U methylmalonyl CoA H OU H UUU U UU D m propionyl CoA methylmalonyl CoA O EL LH EIL U UU U 2 methyl 3 oxo pentanoyl CoA U UU 5 UUUUUUUUUUUUUUU 1 2 4 2 COI 2 4 4 EJ A O A O oO 8 9 O O See PE AA acetyl CoA malonyl CoA acetoacetyl CoA B O EE E 0 012 o o GE HO S CoA S CoA acetyl CoA methylmalonyl CoA 2 methyl 3 oxo butanoyl CoA o o 0 0 012 o o C she PESATA As CoA IRIS malonyl CoA 3 oxo pentanoyl CoA D O I Li 0 009 EE d S CoA HO S CoA SMA seo PORRE SA malonyl CoA 4 methyl 3 oxo pentanoyl CoA O O oO O 9 E A S CoA HO S CoA S CoA
15. LEO LE UL UO DEO L Protein assay kit Bradford OU UU 94 000 00000000 PCR 100000000000 ACP acpl holo ACP synthase acps malonyl ACP transferase fabD D UU UUUUUUUUUUUUUUUUO UD O UO OLI Streptomyces coelicolor AO UU UDO OD UO D l HD B ELE E BJ EE LULU Genome Information Broker http gib genes nig ac jp U LL EL EL E E BJ E BJ OU E acp SCO2389 apes SCO4744 fabD SCO2378 Acp Streptomyces sp CL190 UUU DNAU D TL DO DE PCRTI TIU DEC DU UI D Acps fabD Streptomyces coelicolor A3 2 U U U DNA U LH EL UL PCR UUUUUUUUUPCRUUU UI DO IT O LTD UO DEO CE LE UT CI C 4000000 000000000 0 O H H EE GUU 0d 0000000 UI UUUPCRUO UI UU ULUI 000 0 goo0oD000000000000 00 MiniElute Gel Extraction Kit QIAGEN D DO 000000000000 pr Blue Vector J J JJI UUUUULU Novagen UDO DOD 000000 0000 000 OODE coli DAS O LH LU LU UU HEBE E LU 50 mg IPTG 20 mg X Gal 50 ug mL ampicillin 37 CT 2000000000000 000 000 0 M13 M4900 M13 RVELEELU EE D U D JUDO 00 DU colony direct PERO O 000000 000 000000000000 0000000 0LB0 50 ug mE ampieillin O 0003702000000 O 00 000000 y OO 00 DO 000 000 0 0000 00000 000 DOO UU DI APENAS A EP E SE P AAA ER EIE V WU DNA 00000000000 DIU pHissQ9X H 1 000000000 000 pETISb LU U UIDI E 000 UU UNovagey 1E DO U B U UL U UL 7 DLL I L 0000000000 O 000000000000 00 0 00 0 O U O Molecular cloning 3rd Edition GO 0000000 au D0OD0000 000060 E coli BL21 D
16. Malonyl ACP 0 1 1 20 0 UL LL 100 LU 2520 1220000 00 D apo ACPl holo LL 1 1 2 Holo II U D D L 100 mM Tris HCI pH 8 0 1 mM CoA 5 mM MgCl 6H O 1 mM Dithiothreitol 76 uM ACPS 100 nM ACP O U ULUI DEO D FabD malonyl CoAQQ UU InMU UU EmMTIT DUU Q 00030 y 2040004000000 000 000000 000 0000 0 LC MS JUL O UU malonyl Ace O O UU D UBL EE D Umalonyl ACP O O UU DD UU UU O UU 00000000000 00000 0 KAS UNO E ERE NENE BSE SEE PE EEE SEE KAS III L L L HOUUUUUUUO lOnL U 1 1 3 O 03 ug 01 OU 30 ug mL O KAS IH HOU 3 9 ug 1 0 O 390 ug mD O NphT7 TO 00000 00 0 00 037C 2 00 000000000000 1 Clacetyl CoA 00 0000000000000 negative control O0 UU U UU U UUUU UO U CO a O UU SDS PAGE 18 00 000 00000 00000 000000000060 ACP I LDO D DU D DO OU DO DD LE DEO C AS 00 0 0070 100 mM Tris HCI pH 8 0 84 7 uM 1 C acetyl CoA 13 5 uM Malonyl ACP 1 mM Dithiothreitol 22 UO O ELO TIBI DOCE ET LT T 0p0000000 His DD OU 000000000000 O0 141 2400 00 0 Uim O O UUU O UO UU TOT D D NphT7 38 kDa KAS IIT 37kDa ACPS 16 kDa ACP 10 9 kDa FabD 36 kDa OU UL EIE ET DO ET UU EJ BL EL E B EL EE E UU O UNphT7 63 kDal 0 000 0 U 000000 0 Ustrepromyces sp CL190 DU acp UODO DS coelicolor 00 HHLDUUUULUGLULULUUDULUUL LU DUDU ap i UUUUUUUULU Malonyl ACP L U Malonyl JU UNI LC MS TOO III CDD CEU 2120 1 O 21 5 0 0000 200000000000 X 114 9000600 10200000 22765 D 00 22589 0 MesHP 0 00
17. UTI UO UE 0000000600000 10 8MU 0 4 0000 00 0 000 000 0 0 0 1040 2D 0 00 U 2 4 2 AO UD OO UDO 0 00 LC MS 7 UDO DU UD 000 00864 1450 UU 886 1252 mz 000000 0 2 43 A000 DU D 0 L L Lin propionyl CoA malonyl CoA 0 0 0 O O OU O 3 oxo pentanoyl CoA O mz 000000000 M C26H42N7018P3S H 864 1442 M CosH42N7NaO sP3S Na 2H 886 1261 0 0 00 UD Uisobutyryl CoA 0000000000000 BLUE 0400 0 OL 11 60 UO 0 000 0 00 0 000 000 00 0 11 20000 D 00 0 U 2 4 2 BL 00 UU 00 00 0878 1589 1 UD 900 1401 m z 00 0 00 0 2 4 3 Bou U OU UU U 1obutyryl CoA malonyl CoA O O 0 D O LU UL 4 methyl 3 oxo pentanoyl CoA m z O U U LILI E LILI M C27H44N7018P3S H 878 1598 M Cz H44N7NaO sP3S Na 2H 900 1418 O 00 UL O O0 OO O n propionyl CoA isobutyryl CoA OO I ID O DHL ODDO D butyryl CoA D UU isovaleryl CoA UU U UL U D UO UO EL UI CELO D DE OU LI UI C D DU EE D IILI U 2 4 2 DUEL Methylmalonyl CoA O OO OD DOGO CIE 000060000000 CoA uuWuiuuu iti liliiuluitti L IU O tll acetyl CoA 53 00 80 0 U LIU D Lin propionyl CoA 4000000000000 06080 O 00 U paoernmu uuu 1030100000 U 2 42 GUDD 00 DU DU LC MS QUO 000000005000 DO 822 1304 OO 844 1139 0 v20 00 0 00 U U 2 4 3 OULUI UO UO O n propionyl CoA J m z GO D D UU D D EI M C24H40N7017P35 H 822 1336 M Co4H49N7NaO P3 S Na 2H 844 1155 U O UD U Ulimethylmalonyl CoA 04000000000 0 00 80 O 00 000 O 010 000 00 00 864 14360 UU 886 12390 m z 0000000 2 4
18. UU U U UUL acetyl CoA U U 00000000000 U DUUNphT7 Q90T UU YO n propionyl CoA uuu 0 00000 UO UU O UU OO DOO LI UUUU bL 2 6 2 NphT7 OO NphT7 Q90T n propionyl CoA JOU O DO E LI NphT7 1 mM n propionyl CoA 1 mM malonyl CoA 0 012 NphT7 Q90T 1 mM n propionyl CoA 1 mM malonyl CoA 0 041 66 A n propionyl CoA 5 malonyl CoA C butyryl CoA 11 malonyl CoA 150 150 5 lt 100 lt 100 E E 2 2 e 50 2 50 D g E E 01 0 8 9 10 tt 42 33 14 8 9 10 11 Y 13 14 Retention time min Retention time min B isobutyryl CoA 7 malonyl CoA D isovaleryl CoA 12 malonyl CoA 150 z 100 E E E 2 2 50 g 2 0 8 9 10 11 42 13 14 8 9 10 1f 12 13 14 Retention time min Retention time min CoA acetoacetyl CoA malonyl CoA acetyl CoA n propionyl CoA 3 oxo pentanoyl CoA isobutyryl CoA 4 methyl 3 oxo pentanoyl CoA 11 butyryl CoA 12 isovaleryl CoA NphT7 Q90F f 5787 NphT7 RISSA 1 2 3 s BA SSNphT7 RIE IR 4 5 6 Fr 8 O 2 6 3 NphT7 Q9F 0 0 HPLC OO uU UUU LU DO BDO DUDO ODO DO LU UI DO DO dd Td Td Ud OT UDO CO Lr Odo 0d DD OD DD 0000 III CALUL IULIU OOO DODOO S500000 24 20 000000000000 coApoo000000259nm0 0 0 DADO DO DO UU 67 A n propionyl CoA 5 malonyl CoA C butyryl CoA 11 malonyl CoA 150 5 et 100 lt E E e 50 D g E E O al A E 8 9 10 11 42 13 14 8 9 10 11 12 13 14 Retention time
19. UU UUUUUU 0 00000000 00000000 0000000000000 0000000 0 0 UE coli BE21 DE3 DIU U UU UU 0780 0 00 O UPTO 000000000 000000 00000000 000000000 LI UNI NTA UUO OOO 0000000000 Deda KH HIDE BE DT 000000 J24 15 iR 5 3 NphT7 C115A N GACGTCAACGCGGTCGCGTCCGGCACCGTGTTC NphT7 C115A C GAACACGGTGCCGGACGCGACCGCGTTGACGTC NphT7 H256A N AGCCACTTCGTGCCGGCGCAGGCCAACGGTGTC NphT7 H256A C GACACCGTTGGCCTGCGCCGGCACGAAGTGGCT NphT7 N286A N GTCGAGACCTACGGCGCGACGGGAGCGGCCTCC NphT7 N286A C GGAGGCCGCTCCCGTCGCGCCGTAGGTCTCGAC LL U DELL LI E 1 mM acetyl CoA 1 mM malonyl CoA JU E E E OU E 50 uL J 1 2 11 170 wel NphT7 H256 U 1 4 mg mDO JU 50 ug NphT7 C115A LU LU 1 0 mg mL 00000 D 40 0300 SU O NphT7 H256A4 JO E 100 NphT7 C115AJ Y 00 0 00 UU UO O U U E HPLCU 000 0 UU NphT7 H256A 1 UU U Uacetyl CoA TE 0000000000000 0000 VOD e E EET 41 UO O ELO TIBI 00000 NphT7 C115A OU Nphr7 H25eA TU GU UU UL UO 00 0000 UI U DU O LINphT7 N286A TOO D O O UID DE BE DEO UG UU TT OLEO UBI LI UU Oddo 2 1 2 NphT7 C115A NphT7 H256A NphT7 N286A Da 1 2 3 4 5 6 1 de 3 A 5g Il 2 3 4 5 97 0 66 0 45 0 30 0 2 1 2 9 0000 SDS PAGE 000000000000000 010Low molecular weight markerJ200 00000003000 D D D4UNi NTAD D D D D 0500 D 0 0 0600 O O D USDS PAGE DO 10940 00000 0000 000000 42 LL ELO LE ET D NphT7 C115A DU NphT7 H256A 0 000000000000 2130000 NphT7 C115A U INphT71 U U UU D LL acetoacetyl CoA UU
20. UUUUUUUUUUU UU LU 10 um APEC 000 0000000000 0 L 0000000000 0000 O LC MSU U 00 00 00 0 HPLCO OU LCII D UO 00000000 Udibutylammonium acetate O D U TIO UU UUUU 0000 00 O 000 UO 00 UAPLCO O EC MST D EOD 00 122 20 0 00 0000 UO 00 CoA 0000025 nm UVUU O UU 00 0 OMS negative model O0 UU DU O OL UO 0 UO UU OO UO UU DO TU UU DI TOI DTT UUUUUUUUULU U O UHPLCY UU LC MSU 0000060 01 24 LI LI LI LI L 100 mM Tris HCl pH 8 0 1 mM Acetyl CoA 1 mM Malonyl CoA 1 mM Dithiothreitol 27 1 2 2 HPLC OO LC MS DOT AIL Shiseido Capcellpak C18 MGII 4 6x250 mm 5 um HPLC EEE Shiseido Capcellpak C18 MGII 2 0x250 mm 5 um LC MS EEE ar SIE 25 C HPLC 40 C LC MS SS A 5 mM dibutylammonium acetate 5 mM ammonium acetate pH 6 5 iste B MeOH HS liner gradient IE 1 0 mL min HPLC 0 2 mL min LC MS 4707534 E 23 ADE A SE 96 SIS B SIS 96 0 90 10 15 20 80 16 90 10 36 90 10 28 UO 000000 1 2 10 0 0000 0 I Ll Dacetyi CoA 400 0 0 O 10 10 0 malonyl CoA 3 9 1 JU U UU 000000000930 0951000020 0 00 010200 U 00 000 00 DUDU CoAflacetoacety CoA O ET O O DU O 00 00 UU UUU 00 LC MSU UUU U UUU U 1766 1096 788 0876 1 850 1284 87210929 mz 0 00 0 00 000 00 D U LI 0 0 1 f CoA M C21H36N7016P3S H m z 766 1096 C31H35N7016P3S calcd 776 1074 M C21H36N7016P35 Na 2H m z 788 0876 C31H34N70 6P3SNa calcd 788 0893 2 acetoacetyl CoA M C2sH49N7O1sP3S H m z 850 1284 C25H39N701gP3S calcd 850 1285 M
21. catalytic triad UU E BE ELE E ELE Umalonyl E O L 0000000 KAS I TO LIED DILDO DO DI UTO GOT UI UC UI U L in vitro O DU O UU UU D NphT7 in vivo TO UUO UO 00000000 U Streptomyces albus 10 U UUU UL IUL U UL U UL UU UL n9e T7 00000 UU O UUUUUU U OO UO OOO DU npe77UUUUUUU UO UUUUUU 00 O 0000 Ustreptomyces sp CL1900 40000000000 0 00 Linaphterpin ODO Dd 0d 0000000000000 000000000 UL naphterpin H HL a EGE au MGT TaD ea Mal H Eh CEO Pe TSI ISTE a Ee acetoacetyl CoA O O L U np T7 0 0000000 00000 0 0 in vitre ET ET LU LU Li Lp lu tu 000000000000 Npehr7 II UU D DIO DO DO CEDE D DEL OL DOE EE UI LLL O00 OO OO O DE Ll Lacetoacetyl CoA synthase OO 4000000000 Acetoacetyl CoA synthase JL LL D UUU 100000000000 00 0 000 0000000000 acetyl CoA 40 J 00 UUUUUUUUUU 00000 000 LU UUUUUUUUUUUU tLiitiLuLiiiulitulltLiLbul Li 00 00 Acetoacetyl CoA synthase aac UU UU 000000 UU 00000 O O D UO OU 3 hydroxy 3 methylglutaryl CoA synthase Ames U UUU U OU 0000 000 Ll eaespt AmgsUU O OO O HL UO LO D UI UE UL 0000 0000000000000 00 U UO 0000000000 0000000 U U UKAS MOU HMGS E JI J 00 000 0000 UU 8000 0000000 00 0000000000000000 HMGS 00 KAS m nna d gd a aad acetoacetyl CoA synthase HMGS U KAS IIT UU EH ED EE ELE EE ULUI L HOUWUUUUUUUUUUUUUUUUUUUo UI NphT7 in vitro U UUU UU U 000 NphT7 KAS III O UD UU NphT7 KAS MO nut UU UUUUUUUUUUU UU 000 00 00 LL U UStreptomyces sp CL190 O 0
22. cyclase 2 polyprenyl 6 methoxyphenol hydroxylase rne efflux permease family protein factor biosynthesis repeat protein HAD superfamily subfamily IB hydrolase MarR family transcriptional regulator fe oxidoreductase similar to aryl alcoho dehydrogenase F390 synthetase Jottamate amater dehydrogenase CJ snosnjopiAejj s 5 uuo d J S Polyketide synthase modules and related proteins Acyl CoA dehydrogenases Acyl CoA synthetases AMP forming AMP acid ligases Response regulators consisting of a Che ke recei Acyl CoA synthetases AMP forming AMP acid ligases ABC type multidrug transport system 3 hydroxyacyl CoA dehydrogenase a modular polyketide synthase 9 ii o 3 CH b o o E O 222A CoA 1 JJI NphT7 000 1 00000 Npenr7ti ULUI DCoALUUUUUUU UI 000 Y ORFUU 000000 0 00 O Q0000 000000000 ORFIJII 0000000000000 000000000 0000000 Uu utt 85 TO GMR family transcriptional regulator acyl CoA dehydrogenase domain protein 2 epi 5 epi valiolone synthase pyruvate dehydrogenase complex E2 component Gihydrolipoenide acetyltransferase putative pyruvate dehydrogenase E1 beta subunit TPP dependent acetoin dehydrogenase Acyl dehydratase putative crotonobetaine camiline CoA ligase acyl CoA dehydrogenase ene iron containing alcohol dehydrogenase 3 hydroxybutyryl CoA dehydrogenase propionyt CoA carboxylase biotin lipoy attachment domain containing protein transmembrane efflux protein
23. i Hf ayx acyl Cys intermediate malonyl His His or His Asn intermediate 2 5 1 Cerulenin thiolactomycin KASII IDUUDUDUUDUDUDUUDUDUDUDUUDDUDDUDUDUDDUDDDUDUOUDUDUDUDUDUU Cys His His 0 0 000 KASIGOO KASIDDD D 0000 00 KAS ID His Asn KAS ID 10 His His DO 0000000 59 UO O O UU 0 2 5 1 100 uL 0 6 ugi NphT7 0 00 6 ug mL 00 O UL 30 030040000 00 O l cerulenin O D U O O UU acetyl CoA thiolactomyein OU LI LI EL U E U malony CoA 1 O 70 uM UU 30 uMI IU UD UJ30 C 10 0 LU UL LU UU U negative controll positive control 1010000 0 00 E 00 Ll 0 DMSO J 80 00 I LI N hT 000 NphT7L 0 D UUO 00000000000 CE DOCE UU 0 0 0 0 NpRTTEI L UD 0 AmU OOO ULUI LE LE UU M MESU pH 6 0 20 OU DU UD 15 000 gl 4 C 100 UU UO U UO O UL D 20 apr APLC OOO O 00 UO 00 0000 LIL 000000000000 0000 00 O NphT70 0 U UU UU O O malonyl CoA UL uLiuceAL DL ULL LDLUL LU LLL 0 2 5 1 000000 100mM Tris HCI pH 8 0 70 uM acetyl CoA cerulenin 003z amp ld S UC XI 30 uM malonyl CoA thiolactomycin DIZE d 8 4 KC 1 mM Dithiothreitol 1 mM Cerulenin or Thiolactomycin in DMSO UU HPLC UUU E E E E Ucerulenin thiolaetomyein UOU E HE E E E E IT UUUUUUUIUUUUUU U 22 240 000000000 NphT7 Cys His Asn 000000000000 00 000 000 DU 0 OOOO L UIDI Cys His Asn JO OUO UDO UU DEL ULEL KAS II DU 00000 00 0000 Cerulenin U U UUU O U U U acetyl CoA U U U E thiolaetemyein U OO E
24. pl Cys378 75 gt NH HiS348 HiS348 FE Abt joe ERAI 8238 g a anion E Fk Zoogloea ramigera FAX acetoacetyl CoA thiolase O O N dans M V Asnzza UU d ina N N H HH H H io SS E Phesos See ACP Phezos m ACP S f O Cys112 E a Ova me Ho SlY306 SlY306 B pe BR BER 0 a anion ER Escherichia coli BH KASIII 02 0000 0000000000 Do anion IL LU DOdo0o0 0000000000 Cysl O HMGSQOUUU Sul 0000 acyl al O uiuit J Da anion 000 LU UI 000000 000000000000 IU O0 His 0000 AsnU DO J IILI maon 0000000000000 000 00c020 0 0 DUU a anion HOOD ODO O O H4 BHL B LOB LO H4 O TH E U Zoogloea ramigera acetoacetyl CoA thiolase 0Q DODO 000000000000 Escherichia colit KAS III 9000 KAS III D EL HH acyl CoA J E E E E malonyl ACP 1 Casen O O LI LIL B ketoacyl ACP O0 LL ULL O U DC OUICEUE OS EE UO EE D CECI LT O O UUU UL Escherichia coli YU KAS III HO ULU 2 C2 acetyl CoA QU U UO UL UMycobacterium tuberculosis U KAS HI GUO O C12 lauroyl CoA DI 0 000 ANO Streptomyces glaucescens KAS MO O C4 D butyryl CoA 0 0 D Staphylococcus aureus D O KAS HI butyryl CoA 00000 O C60 hexanoyl CoA O O C40 isobutyryl CoA DD O00 000 UU UBacillus subtilis L U U U DU UL 2000 KAS 1180 00 8 000 LI L acetyl CoA U UU OO 0000 00 00d CS LU Ce O isobutyryl CoA isovaleryl CoA 0 D 00 00 0000000000000000000000 UD UO UU D B keteacyl ACP DO UU UDO DO CELO DO DELE OE I Ul
25. vivo 0000000 OOUOOUOUU0O0 0 00 00 50 852 1353 100 Acetoacetyl CoA calcd M H 850 1285 90 3 4 C Acetoacetyl CoA calcd M H 852 1352 Relative abundance 850 1302 846 848 850 852 854 856 858 m z 2 3 1 LC MSO 000 O O 1 2 Clacetyl CoA J malonyl CoA 0 OO 0000 0000 acetoacetyl CoA 0 MS I ODO 0000000000 3 4 C acetoacetyi CoA CO 000 acetoacetyl CoA p 0 H E 1 00 DD UU negative mode O0 TI 51 HOU UUUUUUU HOUUUUUUUUUUUUUUUUUUUUUU 000 LDODUNpPRT7 UI uultu ttL iui OOO OOO OUT UUUUU OULU UU UU OOO OG UTO ULUI O UO OT DU OT UO UO OUT Llacetyl CoA O ELE UULU n propionyl CoA butyryl CoA isobutyryl CoA 1sovaleryl CoA uUuBgululuilliiuiulllililil li malonyl CoA O 0 O LL l methylmalonyl CoA UO U 2 4 1 O O Seu e iik Pie ap n propionyl CoA butyryl CoA E acyl CoA BARES j ALI Y s cos S CoA isobutyryl CoA isovaleryl CoA SIGA acyl CoA B9253 amp O 0 Ho Ss coa methylmalonyl CoA ARES OU 2 431 A N e ud AA 0000000000000 52 UO 000050 uL 2 4 1 150 ug O NphT7 0003 mg mL JI I BIL 30 C 100 0000000000 UO 00 0 U APEC 000 000000 00 00 JODD OD DO OD OD IT DUO OT UYU UU O DU LC MSII 000 0 U QU U UO DU OO OO TT O TOT TUO O YUU malonyl CoAY 0 00000 LI U F UO CUOIO TO O DOOL acetyl CoA O 000 0 2 4 1 UUUUUU 100mM Tris HCI pH 8 0 1 mM B n Se 1 mM RARAS 1 mM Dithiothreitol UO UU UO U Un propionyl CoA FO UU O
26. 0 0 0 000 00000 00000000000 000 OOO 000 pete7g 0 00000 0000 770000N00000 C 00080000000 DD DD fee ecp D D aces D 000000000000 0 0000000000 Streptomyces coelicolor A320 0 100000000000 000000000000000000 q 14 0000 000000000000 Streptomyces sp CL190 nphT7 acp L L L S coelicolor AM fabD acps 000 DNA go OOOO PCRUU UI DOC DD DD D 00 000000000 O 000000000 pT7Blue vector Y 0 000 000000000000000000 000000000000000000 0000000000 0 1110000 0000000000000 0000000 DD DNADD DD 00000000000 000000 pHiss Tank 2l sk D loepe 000 pET15b acp D 000000 000000000000000000000000 pHis nph77 pHis fabD pHis apcs UU pET acpl U U LILI UL L US coelicolor KAS III ScKAS IIT 0 O 000000pQE fa5H pQE30 Sall HindM 0 000 000000 000000 umggunuunugunugnugggngagnugugnunuugnumdguut EL EL ETE LI L E coli BL21 DE3 pHis8 npAT7 jacps acp fabD U JM109 PQE fabH DD 000 UUIPTGU 0 D DG 00000 0000000000000 Ni NTA 0000000 0000000000000000 00 0 00000 ONphT7 000000 00000000000 000000000 000 native 0000000 0000 000000000000 111 00000000 J24 4 ll BR EE faz 528031 53 NPHT7 N BamHI GGGGGATCCACCGACGTCCGATTCCGC NPHT7 C EcoRI GGGGAATTCTACCACTCGATCAGGGCGC ACP_N NdeHl GGGGCATATGGCCGCCACTCAGGAAGAGAT ACP C BamHI GGGGATCCTCAGGCCTGGTGGTCGAGGATG ACPS N BamHI GGGGATCCAGCATCATCGGGGTCGGGATCG ACPS C Hindlll GGGGAAGCTTCTATCCCTCCGCGATCACCA FABD N BamHI GGGGATCCCTCGTACTCGTCGCTCCCGGCC FABD C Hindlll GGGGAAGCTTCAGGCCTGGGTGTGCTCGGC 21
27. 0 0 000 t 3 2D 0 D 00 0 UU O ONprT70 10 LJ L acetyl CoA 1 U U malonyl CoA U L DO O 010 U CoA Jacetoacetyl CoA 0000000 0000000 31 NphT7 120s NphT 7 60 s NphT7 30s NphT7 20s NphT7 10s Heat denatured NphT7 120 s 100 50 Intensity MAU Retention time min 0131 D I OL U DU D HPLCII 000 Q000000 UO OO UT OT TO TO OT OT U O 011CoA 2 Jacetoacetyl CoA 13 malonyl CoA 4 Jacetyl CoALTL 0 0000000000000 000000000000 32 E E gt O d E R C NA 7 O A A Z 20 40 60 80 100 120 Time S O E O O O e La Pd PT sla is 4 A 3 0 2 VW 1 O 1 3 2 Acetoacetyl CoAL 00000000 0 U0U0 1 3 10 0 00 Ba d Bd 0000000 00000000000 E Nen TE 000000000 malonyl CoAU U 000 UU CoAG UO GO UOC LU DOE D DODU LDD L UI OU 0000 UI UL CoA I J OO O UCOAL2 W acetoacety CoA 3 9 malonyl CoA 4 A Jacetyl CoA 33 OOO 0000000 00000 Acetoacetyl CoA DL U DU U O UO CUD UU OO U DUO UU UG UU UU UU LI ll B ketoacyl CoA acetoacetyl CoAJLIT UD UO UU LI 00000000030 mJ000000000 0 1 40 oo 0 0 0 100 mM Tris HCl pH 8 0 1 mM Dithiothreitol 5 mM MgCh bH O Jacetyl CoA UI malonyl CoA 5 ugi NphT7 U U 1 5 ug mDUU O BO 30 C 0 O UO U 0303 nmi UD O LE O DE EL O DE HEIL D DEO UUUUU DI l acetoacetyl CoA Mg 0000000090 gt 0 8 3000 0 00 Acetyl CoA KoU U U U Umalony CoA U O 100 uM U H malony CoA
28. 0 0O 200 BM 1D U DOE DD EE 00000003 0000000000000 36 HOU UL UYU UE coli KAS INeckAS DOU UU DUE 0000 0000000000 D acetoacetyl CoA 000000000 0000000000000 0 093 pmol min mg LI LILINphT7 0000004 100 0000000000000 hexanoyl CoA EL E DJ EE EIL L Staphylococcus aureus KAS III saKAS IIT UO UGUO OO 000000 U B ketoacyl CoA YO UGO D UU EE UE OUO LI L 0 014 umol min mg LLINphT 7 UU U DODO UO 600000 0000 U 1 5 1 1 5 1 KAS III O NphT7 p ketoacyl CoA 1 Rt Se Z VmaxEt lkkLigtt umol min mg ERA 00 3 amp EE FE ecKASIII 0 093 ELE TE 0 1 mM acetyl CoA 5 mM malonyl CoA saKASIII 0 014 EE TE 0 1 mM hexanoyl CoA 1 mM malonyl CoA NphT7 8 9 0 3 Vmax ANS HR UD HU DEB UL OLET UU UNphT7 00000 KAS HI GU BIBT OD DL OD EE E in vitro UU UU D O UL DEL BOE UU UU UU UU OOO 00 37 OO L NphT7 OU D BUD OULDLULULULLL O O O Catalytic triad OU EL U U J E coli Y KAS II prn 0 000 00 00 000NphT70 00 0 0 0 UO Cys His Asn O catalytic trad U OO 000000000000 0 0 00 0 0 0000 Um vitro WO 9000000000000 00000 O UE UU 0 0 coli DOO KAS II TE ED 00000006 catalytic mag J I BO W B EE DE UO DOE IU UL DI 2 1 1 Owes D 0000000 y D 000000000000 00 OClaisen QO0O0O00ay O00000 0000000000 OHis Asn Y O O malonyl 0080000 0ue anion 00 0 W Ud a dud 00 ys UUDUDUUDUUDU U DE D D DO BA Bd O BO hhi 0000 ay UUDUUUUUUUUUDUUI B ketoacyl ACP 0 UU UU YOU DO His Asa 0 000000000
29. 00 00000 1 kb 5004 PSEMV40 W pSE101 No Insert o O gt E a be C O 6 S O O 2 O a 0 EE r E 0 4 e 6 r 8 9 Time day l 3 1 2 D IO D GOG OO OL D D DEOS l UUUUUUUUUUUUUUUUU DO DDD DDD UI LU SIII L 40000000000 000 74 OOO Naphterpin O OUUUU nphT7 00000 Naphterpin O0 O O UUUU 0000000000000 000 O0 np O O L UL U UUU CL190 00060 acetoacetyl CoA UU D HO HO BO CL OTED L UU OUUOUT UTO UU D UI naphterpin 000000060 CLI90 UU OU nphT70 U DU Uin vitre LO UG UO OOO UL UO OCDE DLE BT UU UUOOUO in vivo B GO HEBEL DO DO DOLO OE EE DO CELO DS DUDU DUU naphterpin TO O LL B U D ULIS 000000000 U 3 240 l SEI S CoA acetyl CoA acetoacetyl CoA HMG CoA synthase NphT6 HMG CoA reductase NphT5 O 40H E Ho gt COH mevalonate Mevalonate kinase MphT1 Dy OP phosphomevalonate ora MEP pathway naphterpin 3 2 1 NphT7 CL190 00000000 Naphterpin NO L 000000 L ne T7 DIPPO OO DMAPPI O 0 1 O acetoacetyl CoA 00000000000000 000000000PP 0 DMAPP 00000000000000 naphterpin OO DO 000000000000 DIPP pj DMAPPO MEP 0000000000 O OO OO 00 nohT7 00000000000 mevalonate kinase 000000 nphT1 0 DO 000000000 naphterpin D 0000000000000 75 UO EL ELO DEBET BE U EI Streptomyces sp CL190 0 O UL UUU DUO UO ULUI OOOO D BE BT CI UU 00000 UU PUMVI81 0 Small O O U DO DU Dep T6 nphT7 00 0 UU 2 5 kb DNAIUDOUUDDUDDUDUU
30. 0000 00000000000000 KAS DD KAS 400000000 U ULI U B ketoacyl ACP type INO O DO type II PKS HOENEN EE P iL Bp a e mm Titi aa Ro a ai DD UD 0000000 0000000000000 KASIIUU UI UUUUUU p440 0000 1 40 H O N OMe Q o 9 RedP n Pegi ere AA ep q 8 acetyl CoA malonyl ACP H o A d KAS III v e H ia x seg HO S ACP Y scr VE Agg IN malonyl ACP N N isobutyryl CoA O O OQ KAS III CE a Te OMe S OW w S Sooner ALA S ACP Z A isovaleryl CoA malonyl ACP H methyldodecylprodiginine 4 Undecylprodiginine 9000000000 KAS III RedP Streptomyces coelicolor L O O undecylprodiginine O EIE E E E E EE EE E EL EE EE EE DU LH OOURedP QUUUUU acetyl CoA QO B TH DU UUUKAS T p D D D acyl CoA isobutyryl CoA isovaleryl CoA OOO O IL LU B ketoacyl undecylprodiginine O Ad UUUUUL 000000000 IKAS Imp UO 0000000000000 type M PKS U HO Type HI PRS UO O UO DE D DID 0000000000000 000000 UI UU UL LU LI DU DUUUU UUUUUU UI UI ana LU QUO U DU LU IULIU ituttututLuttLuuliiilliiultLitL 00000 Type M PKS UUUUU 000000000000 UU l benzalacetone benzalacetone synthase BAS U II LILIBAS p cumaroyl CoA U LU I UUU UL OU UU malonyi CoA TU O ODO U benzalacetone DD D D 0 OO 0 dayl LO 0 0 0 00 00 0 00 00 000 OUUU GUL 4 methyl 6 hydroxy 2 pyrone TAL UU U UO U 2 pyrone synthase 2 PS 000 00 002 PS O01 00 U acetyl CoA 4000000002 D 0 0 malonyl CoA 2 000000000
31. 00000 O O Umalonyl ACP Y D O 0O 0000 ULL a anion O E B 000000000000 0 O LJacetyl ACP O O O DU 000 0 OHis D J OOOO Asa D O 000000000 UU 00000000 Omalonyl AcP BOO ag d Hd d 0 B 0000000000 0000000 0 f keteacyl ACP 0000 0 00 00 ONphT7 O catalytic triad LU LU 000 I 00 O cyst O 1150 His O H256 JAsn 0 N286 L 0 O J DO Dgo pg Ala TO DOO 000000000000 NphT7 C115A NphT7 H256A DO NphT7 N286A 00 O HB BB 0000000000 39 O 1 N 1 Q i N 9 See a ASN274 imt di imus gek e Asa N HHH H H H H HH O Phezos go z ge Cy S412 Ca Hue CyS412 H E Glyaos Glyaos Cys RENO acyl RBA HS CoA O O pcm S Asnzra bud b J Asnza N N N N FM POM e Je Ze 29 o yo ese C np m Phezos CO Cys442 en E Glysoe O ta YA snz74 N N H H H N gx Jee N HHH S wel oma fa Glyaos Claisen fig amp B ketoacyl ACP D pk 2 1 1 KAS IIl 1L D E KAS IM D EL BL UO BD DE UI 000000000000 6ys BEL 00 acyl D E U LU UE TET D 0 His Asn DUU malonyl O OO OO DU 0 UUUe anion 00 0 0 000 L a anion Cys 000000 acyl O Oasen Ketoacyl ACP 70 0 0 000 E coll O KAS III LU BL 40 UO 00000000000 000000000 U 24 900 0 00 000 00 0 0000 O OQuickchangee XL Site Directed Mutagenesis Kit U U PCR D EIE LULU E E EH ED E UU UU UO D 000 pHis nphT7 U O0 O UPCRU U O ODE coli DHA5a O UO U 00 L U
32. 0000000 00 0 0 000 00 000000 15880 0 0 U 1 Tryptone soya broth O0 O O O 42 2 UU 10 000 U 000030 C H 304000000000 ut iit 00000 TSB LL LIU LU L HO 30 C H 3 020000000000 YEME 0 100 40 5 Glycine 5mM MgCLb b5H5O0 Streptomyces G153 VO DO SK Ir DH UI 1 Glycine pH 7 6 Streptomyces sp CL190 9 19e L UU U30 C FL 3000000 UU DU 10 Suerese O0 20 0000000000 5 000 gl 4 C 10 02040 00 0000200000000 0 00 00 U L protoplast buffer U OOO DOUG 00 dd 000000000200 000 protoplast buffer UU JO 000 UU ULI protoplast buffer O D UD L lysozyme J O O L L 02 mg mL DUDU 000 1mg mD UU 30 C 330000000000 0 DEED LT LI ERESSE NE TEES E E NERE STEN u EA EI IE VEN IED Tc UD DUOD UU UU O O OOO EE ULUI CE DOO CE DE 200000000000 0000 00000 Y 00 00 Uprotoplast buffer O OOO O 00000 00 00 DC DNA 10 U U 33 PEG U PEG1000 protoplast buffer U UU UU 11 UOC O DDD DO IILI 100 DU protoplast buffer O L UL JO 000 ut tutu uiii tit ill DUU protoplast buffer O O UD UIR2YEOG 000000000 130 CI 140000000000 LI 0000000000000 thiostrepton 00 0 UU 30 ug mL YU 30 C 3 LU U DU U0 Protoplast buffer O U EID U OO GO EE UO D LI LI 99 Protoplast buffer a Sucrose 10 3 g K2504 0 025 g MgCl 6H20 0 202 g Trace element 0 2 mL 80 mL b 0 5 KH3PO4 1 mL c 3 68 CaCb RH20 10 mL d 5 73 TES Buffer pH7 2 10 mL al A DO OOO 0000 0000 ull 000 U 00 protoplast buffer DU D 00 0 Streptomyces sp C
33. 00200000000 000000000 000000000000 0000060 DO OO UUUUUU UL 0000000000000 00 10040 2 00 00 CI 0000000 d00 Y HPLCII 000 0 DUO UHPLCU UI O DODO 31 200 0 O 71 000000 00000 00 0000000 00000 000000000000 UI JOY ODO BO ODO DO DO UU dl UU I OO UU Od UO Bl 3006 RES AA AAN ana 03141 LO DL 000060 J24 18 ABE 5 3 NphT7 N GGGGGATCCACCGACGTCCGATTCCGC NphT7 C GGGGAATTCTACCACTCGATCAGGGCGC NphT6 N GGGGCATGCTCCATCTCCATAGGCATTCAC NphT6 C CCCAAGCTTCTAGCGCGCCTCGTAGATGCG 0312 MODOS 772 4 AQUASIL C18 4 0x150 mm 5 um tyvi 4 45 AT im FE 40 C SIE A 0 1 acetate 0 1 triethylamine in water SR H eg isocratic 100 A 30 JUE 1 0 mL min RER big RI 74 MABI 72 pUMV181 Acclll j E Ra PE Sse83871 BI SS SS 2 1 kb OMA EA E g DSEMV40 lt ligation I Sse8387 581 acute Hindlll EAE pSEMV25 O 3 1 1 pUMV1819pSEMV25 0 00 psEMV40 0 0000000 pUMV181 UL UL UL Acclll Sse83871 Acciil O U pSEMV25 Sse83871 Hindlll 00 Hindi p D D 0000000000 73 UO UUUUUUUUUUUU UL ul Wii DE 3 1 2 TOOL pSE101 DO UU O O HL OLD UO DL DO DDD GU UT D UE CELO UTO ET LI pSEMV2S JLI D O0 EL OL OO CL BL CL BE UL 900 UELLE CE ET E1109 9 mg gr 00 UI DU UL DU ULUI UpSEMV40UU OUUUUUUUUUUU 30000000379 55 mg g 0 00 UUU 000000 UUlpsEMv25 00 000000 30000000 LU UUUUU d UU d Udo UUdd 0000000000 acetoacetyl CoA nphT7 Jogou 00 00000 Um vitro OO O O in vivo O O UL acetoacetyl CoA 00000000000
34. 1999 A new pathway for polyketide synthesis in microorganisms Nature 400 6747 897 899 Shin ya K Imai S Furihata K Hayakawa Y Kato Y Vanduyne GD Clardy J Seto H 1990 Isolation and structural elucidation of an antioxidative agent naphterpin J Antibiot Tokyo 43 4 444 447 Kaneda K Kuzuyama T Takagi M Hayakawa Y Seto H 2001 An unusual isopentenyl diphosphate isomerase found in the mevalonate pathway gene cluster from Streptomyces sp strain CL190 Proc Natl Acad Sci U S A 98 3 932 937 Kuzuyama T Takagi M Takahashi S Seto H 2000 Cloning and characterization of 1 deoxy D xylulose 5 phosphate synthase from Streptomyces sp Strain CL190 which uses both the mevalonate and nonmevalonate pathways for isopentenyl diphosphate biosynthesis J Bacteriol 182 4 891 897 Takagi M Kuzuyama T Takahashi S Seto H 2000 A gene cluster for the mevalonate pathway from Streptomyces sp Strain CL190 J Bacteriol 182 15 4153 4157 104 35 36 37 38 39 40 4 42 43 44 45 46 Takahashi S Kuzuyama T Seto H 1999 Purification characterization and cloning of a eubacterial 3 hydroxy 3 methylglutaryl coenzyme A reductase a key enzyme involved in biosynthesis of terpenoids J Bacteriol 181 4 1256 1263 Shin ya K Furihata K Hayakawa Y Seto H 1990 Biosynthetic studies of naphterpin a terpenoid metabolite of streptomyces Tetrahedron Letters 31 42 6025 6026 Hiser L Basson ME Rine J 1994 ERG
35. 3 0 2 VW 1 O 2 2 3 acetyl CoA O O O JU UU acetoacetyl CoA O 0000000000 0 2 2 20 0 0 000000000000000000000 00000 NeRT7E O D 7 7E 7 D E CE malonyl CoA 00 0 000 DD CoA 1 III 000030000000 O000000000000000000 CoA GOODE 0 0Co0A02 ei acetoacetyl CoA 3 e malonyl CoA 49 Acetoacetyl CoA O O LI J UU acetyl U OU 000 LI LL EL EL E E B EB E DO D UUNphT7 acetyl CoA O U U U UL acetoacetyl CoA 0000 00000 000 00000000 000000000000 acetyl UL O acetoacetyl CoA 4000000000000 000 O 1 mM 12 C acetyl CoA 99 atom 1 mM malonyl CoA 1 1 UU DD D D DI O UD 1 2 10 0 50 uL 15 480 NphT7 000 0 3 mg mL 000003009 20000000000000000 100 pL HPLCO ODO O UO DL O UO acetoacetyl CoA O O O 0000 00 EC MS Y 000 O 00 U O O LC MS 00000 231000 00 E 0 O U 00852 1353 0 wvz D D U O 00 00000 011 2 Clacetyl CoA malonyl CoA GO 0000003450 acetoacetyl CoA m z D 0 0 000000 M Co3 CoHapN7O1gP3S H 852 1352 LU O 00 00 00 UNphT7 acetyl CoA E B DO DU D UU aeetyt OOO UU U 00000000800 0 0 0 000 0850 1302 0 mz 000000000000 D C DOO 000000 acetoacetyl CoA 0 mz 400000000 M C gt 5H40N7018P35 H 850 1285 00 0 E 0000 O malonyl CoA 00000 DO O 00 O acetyl CoA 0 O O0 UO 000 DUO 000 000 000 DU NphT7 ImMMpod000000000000 00000 acetoacetyl CoA QUO D O I 0 U UU acetoacetyl CoA UL D HB E 0 00000 0 0 00 0000 DUT mM LL DIE BEL EL DUU in vivo i D B D D V BUE 7L 0000000
36. 7 NphT7 HMGS D D HEU DU UL UU 000b4AcP 0000000000000 0000000 tubi 0000000000000 000000000 BAM GS IJ KAS M0 00 0000000000000 0000KAS MO Cys His Asn 0 DO Glu LL EE OE EE UUUUUU DU OOO OE GU OO BE ELO V UUU OE Cit UICE LIT CI D000 000000000000000000000000000000000 Uim ud uluikAS rititiputtttuiutittlutuliut 0000 DU 200000000000 I0000000000KA4S00000000 UU U ULUI 00000000 HII UKAS m0 N LI UUUUUUU LU ULUI 0000000000 0 00 0000 000 DAS II HMGS U U U U E UU Glu Cys His Asn UD U U U U U a anion 1 E O O U Glu 0000000000 Cys His Asn TU CEU UUUUUUUUUUUUUUUUO 02000000000 ACPUUU IUL 0000 KAS 147 48 0 00 40 LI Ul 00000 amos KAS I PA4g0B80d 0000000000000 acetoacetyl CoA synthase O OUO 0000000000 OULU 00 00 DU 000000000 U 2 36 88 Thiolase Homolog A pemx Ancestral thiolase CH CO gg HMGS M acetivorans 100 HMGS M jannaschii HMGS A pemix 70i HMGS S cerevisiae 97 HMGS H sapiens HMGS 100 HMGS A thaliana Glu Cys His Asn HMGS C elegans 97 JamH L majuscula ay HMGS S aureus 5 HMGS Streptomyces sp CL180 AS Streptomyces sp strain CL190 p A KAS III E coli e KAS III G max i 100 KAS III A thaliana KASIII KASII M tuberculosis Cys His Asn e KASIII S griseus 109 r KASIII S coelicolor 88 KASIII S avermitilis gag aa g KES B napus EERE EEE EEE EEE EEE n 99 KCS S arvensis 62 L KCS A thaliana KCS KCS M polymorpha Cys His Asn 100 KCS Z ma
37. APP 0000000 6000000000000000 0000 0000000000 4 I HUL 2L U acetyl CoA acetoacetyl CoA O L acetoacetyl CoA thiolase LU UUUUUU ULUI UU pull open reading frame LU NphT7 1T UU 00 L DO ODO Dodo do UU UU UUUU UU UUNphT7 DL DIDI IO IU HOUUUUUUUUUUUUUUUUUUUUUUUUUUUUU Protein Data Bank http www pdb org pdb JUL LU BLAST E ELE ET EE DIII LUKAS HI UO UUU UUUUU II DOLCE dd DUCLI90 0O U I III EO EE OE EE CE EE ET Ul HUBEEEBEBEIULDIULDLLilismeptemyces sp KO 3988 U Actinoplanes sp A40644 YS anulatus L U UL UU JII UU DO OO OOOO O OLET L furaquinocin BE 40644 Jendophenazine 0 0 00 LH 5 ria d qd d d d gu ui OOO Ld uugulililii 0000000000 00000 000 00 DUU 00000000000 00000 tl Lacetoacetyl CoA thiolase IO LIB LE LE UU O O UNphT7 00 UU 60 70 identity 00 000000000 OrEFDJOrEB O DU ppzT JO DU DD ELO UUU 100 6 1 NphT7 BLAST O O O Name PDB Code Origin Identity E value Orf F Streptomyces sp strain KO 3988 73 8 0e 131 Orf B Streptomyces sp strain A40644 59 7 Qe ppzT Streptomyces anulatus 9663 75 1 0e 122 KAS III 1NHJ Escherichia coli 35 4 8e KAS II 1MZJ Streptomyces sp R1128 31 9 3e 8 KAS III 1UB7 Thermus thermophilus HB8 37 21e KAS III 1HZP Mycobacterium tuberclosis 32 2 ge27 KAS III 1ZOW Staphylococcus aureus 32 3 0e27 13 1 kb nphT1 I nphT2 DA nphT3 gt nphT4 DAnphT5 nphT6 gt NphT7 N HMG CoA synthase HMG CoA reductase O Thiolase O O NphT6 O O
38. BEIuluuliulituliiiluilLiliiLlitLbi t iL Acetoacetyl CoA synthase UU U NU E ELE E E UUUUU Cys His Asn U U HHTHH PU HIHI PH I D acetyi CoA H E T U DILLO DO 010 UI UUUUUUULU DUCADO onto uuiuultuutiulititituli itu ultu utbtiutuLutLtLl L UU OO AO DICE BI EE OE EE CE BE CUOIO HT BE EE COE UG UE BE UO UU Acetoacetyl CoA synthase WU UL LI D DO UO UU LEO UUUU UO O UO UU U 2 0 Mycobacterium DUO UL DU UUUUU OO 00 DO 00 0 000 000 0440000000 000000 000 DOT 21000000 L U Streptomyces C CoA LO DELE UO DEO DEL o OL OCC US DE CIE 0000000000060 ub OO O uuu 000000 00000000 OOOO UU UU UL UU uli pod od add ndo 0000000000 22 4018 00 000 00 0000 0000000 Np 70000000 0000000Ps00000 0000 0 UBI LLL 0000000000000 82 0 2 1 p000000000 0000 NpRTZ D DID E EMA Score Identity Yo E value Accession No Streptomyces sp strain KO 3988 470 73 Be BAD86800 Streptomyces anulatus 443 75 1e CAX48662 Streptomyces sp strain KO 3988 431 72 6e BAE78983 Actinoplanes sp strain A40644 338 59 Te BAD07381 Streptomyces sp C 331 54 Ge ZP 05511702 Streptomyces flavidofuscus 313 55 den ZP 04335288 Mycobacterium ulcerans Agy99 311 52 De YP 907152 Mycobacterium marinum M 309 53 dg YP 001851502 Streptomyces sp Mg1 307 51 1e ZP_05002626 Streptomyces sp AM 298 51 Ge ZP 05478992 Streptomyces roseosporus NRRL 15998 252 AT be ZP 04696763 Streptomyces viridochromogenes DSM 40736 233 45 1e ZP 05529691 83 contains acyl CoA N Superan domai
39. C35HaoN701gP3S Na 2H m z 872 1092 CosH3gN7OjsP3SNa calcd 872 1105900 U UUL O O EL BJ EE E LILINphT7 acetyl CoA malonyl CoA ULULI acetoacetyl CoA uuu uiu uL LLL 29 Intensity mAU 9 10 11 12 Retention time min B geg 4 766 1096 E CoA 9 calcd M H 766 1074 5 l YA 2 50 calcd M Na 2H 788 0893 aq gt aq E 788 0876 0 700 720 740 760 780 800 m z 850 1284 Acetoacetyl CoA calcd M H 850 1285 calcd M Na 2H 872 1105 Relative abundance 872 1092 0 i 800 820 840 860 880 900 m z 1 2 1 NphT7L 0 0 UU HPLCU DU LC MSIU 000000 ALIO U DU UU 259 nm UBUL 0 01020 0 0 0 U 000 negative mode JA DO U 00 0 U O O gi uNphr7rututulutuuuuNphr 7Duutuuiuutuiutbtiuuut uultu LU U O01 CoA 9 3 2 acetoacetyl CoA 9 5 03 malonyl CoA 9 1 14 acetyl CoA 30 NphT7 acetoacetyl CoA O O U 0008000 0 0000 NphT7 acetoacetyl CoA 000000000000 acetyl CoA Jmalonyl CoA 0000 0 LI UU CoAllacetoacetyl CoAll O0 UDO D O UO OO OG 000000 HOU OOO O UO OO GO O UI DU 0000 000 000 UO U ULUI GO Od ODO DO DO DD DO DUO UO UU OT 0000010 200300601200 O U 0 D O 100 00 ODIDUUU U5 acti Hi U UUUUUUULU 0000000000 0 0 UHPLCU TOO U 00 00 00 00000000000 00 YU UUUU UU DO OU NphT70 UU DU UU DU Umalonyl CoAY 0 E DO DICT L CoA DU UU BL UO O UO UTO UU O DE EE UL 039 TT UO BEL UO DL OO UE IU UU O HDI D BPECEH 00000 1 3 10 D U 00000 00 00 0 0000 0 0 00 04000 0000 0
40. E3 pHis nphT7 pHis fabD pHis acps pET acp U U UL E coli JM109 pQE fabH UU UU CE CO LIIS DO CE CE UU UUUU UU UO O UD EB 95 UU 00037020 UL 000000 000000000000 00 LU Ucolony direct PERO DUDOD D UU O UO DO 000000 OOO DI UO OD O UU LBU UD 0003 e0120 UU uui 0000000 007180 U U 1 L 00 37 C I ODso 1 00 0 O O 00 00 0 0 000 0 UO 0000 10000000 000 1 mmi 0000 IPTGU LI O UD 18 200000000 0000000 00000 00 JO UO 0000000000000 00 Ampicillin 100 ug mL Kanamycin 50 ug mL EL ELO TIL II T O OO 100 mE 5 000 g D 1000000000 00 0 000 DL lysis buffer U O UO UO OD UO U HU UU DU DU 040 000 s00 22000000000 00 DO DU E LU Ni NTA resin UUO 2 mL QIAGEN 9 00 O 20 mL wash buffer O DU 00 LU U 120 mL elution buffer O O UU resin f E E UUU UG LI ULUI UI 00000000 UO ub DU OO UO i tutiilr bL tL tl 0002000000000 0000000 O O VIVA SPIN 20 VIVA SCIENCE 0000 U UO UO 000000000 00000 0 EINphT7 KAS INTO 00000 Ub LL buffer 000000 1 mM dithiothreitol WU O 00000 0 Ul JU II Buffer IU E D LL D DL EL U LI Wash Buffer pH8 0 50 mM Tris HCl 0 5 M NaCI 20 v v Glycerol 20 mM Imidazol Lysis Buffer pH 8 0 Wash Buffer 1 v v Tween 20 96 Elution Buffer pH 8 0 50 mM Tris HCl 0 5 M NaCl 20 v v Glycerol 250mM Imidazol KAS III g pH 7 5 50 mM HEPES pH7 5 200 mM NaCl 20 v v Glycerol NphT7 ACP FabD ACPS pH 7 5 50 mM HEPES pH7 5 50 mM NaCl 20 v v Glycero
41. EO D L malonyl CoA O OOO DIL O CoAT UU UDO DOE U UL UL CE 00000003 004000000000 00000 Umalony CoA O0 YU EU UO CEU UG UL IU LT UO 00000 APLCOQUUUUO 22200000000 0000 000000 0 000000 0000 000000 22 300 8 00 U 0 0 D UNphT7 malonyl CoA 00000 acetoacetyl CoA 000000000 DU DO 000 00000 2006 malonyl CoA 1 U U U CoA acetoacetyl CoA U O TU HB EIE E UU ETE EL E E 00 LIU LI LINphT7 KAS INT type 1MPKS 0000000000000 0 00 0 00 BPP i iB iii LU UL LU AAA EEE DIE E Aa E AED EEE EEE EET EHE ARE E JE H RIDEI S DUDU UL I 22 0000 ODU D DOGO KAS mr rnb i rmt Up 15100800 UD 0000000000000 EE UU UO EE 0Np170 0 0 0 O malonyl CoA O LILIKAS m 00 0 80000 0 00 0 0000 BEA NphT7 NphT7 ecKASIII saKASIII 2 2 1 NphT7 O KAS Ill DHL HD D D Eg ELE TE umol min mg 1 mM acetyl CoA 1 mM malonyl CoA 8 9 1 mM malonyl CoA 1 8 0 1 mM acetyl CoA 5 mM malonyl CoA 0 093 0 1 mM hexanoyl CoA 1 mM malonyl CoA 0 014 47 NphT7 120 s NphT7 90s Nph17 60 s NphT7 30s Heat denatured NphT7 120 s 100 Intensity mAU e e Retention time min 22222 O00000 HPLC DO l JUDUUUDUDUDUDUDDUDDUUuDUDUDUuDnDUBnHunUulUHunuuucCoA 2 acetoacetyl CoA 3 malonyl CoADO 0 000000 00 OO OO OO O TUO DO DOO DEO DUDU OU II CoA UL 259nmG O il lilutLiuiL LLL 48 O Co Concentration mM O 0 4 E er i 0 2 0 0 60 80 100 120 Time s O O O OQ n 2x Be er EN Po PDP d
42. ESARERINGI SKBKMSVS V E mKASI 235 GDVGRRAMDA EXGVRPDGOG V NELLVENISOL RPIBAVVANDI 320 340 a PEE Ae te ee kuu CT Rue Eo t ya asa dX er A Poa Ca NphT7 292 MZ TMBJAAVR AF EV ASEMA ASFALIEW ecKASII 280 VINCALMEAVR DigR QINV EABCICHCEFT WGSALVRF saKASM 274 Wa S IPOELK NIEIKLESDDDTI VINV efmelelelL T WGAMT KWG K mKASI 295 HEMLAMAELLIT TAA DINA IGY amp gt 5jAGLS YAAQVVRMPK G 2 6 1 KAS MOOO NphT7 EH 000000 UOOQUUUaL Cys His Asn 00000060 ACP J Arg DU UU U DewO D U B D U JAd00 000000 00000 0000000000 UI UI OU UU LUI liil Lt D UI 00 0000000000 PDB ID 00 LJecKASIII E coli O KAS III acetyl CoA 1HN9 saKASIII S aureus KAS III butyryl CoA 1ZOW mtKAS HITIM tuberclosis KAS III lauroyl CoA 1 HZP 63 UO LL EL ELBILELET DIE ET ET LI gEBEHEBEHHEH U 26 01 O UJ UU QuickChange XL Site Directed Mutagenesis Kit Stratagene O O PCRU ULUI UU UU UU UO 00000000 0 00 O 000 NphT70 0 OL 0 000 UU DE pHis npA TAL 0 U U UPCRO U UU U D E coli DHSa U UU UU UU 00 UUUUUU 0 0000000000 0000000 JULI UL 00000 UE coli BL21 30000 0 0 00 E TBU U UU O OPTOU 000400 0000000000 000000000 0 UU O UU 0000 00 NphT7 Q901 UU NphT7 Q90F Ni NTA 000000 0 0 0 00 DO OD BIBI EE O EE DEBT OE ULCE OI LEE L 261 UUUDUUDUDUDUDDUUU J24 455 GARA 53 NphT7 Q90T N CCGGACCGGCCGACGCCGCCCACGGCG NphT7 Q90T C GGCCTGGCCGGCTGCGGCGGGTGCCGC NphT7 Q90F N CCGGACCGGCCGTTCCCGCCCACGGCG NphT7 Q90F C GGCCTGGCCGGCAAGG
43. GCGGGTGCCGC 000006 1 mM EIL O L Umalony CoA 01000 000 0000 6300 000 2 41 YU 50 uL 070 ug O NphT7 Q90T O0 O O 1 4 mg mL JO OO 80 gl NphT7 Q90F 0 O 1 6 mg mL UU U 00030 100 00000000000 0000 OU HPLCU 000 0 00 00 U CE E Umalonyl CoA 4000000000 Aaa arar a A A A E O dana SE AP E A TD LL HL EL EL EE EL EL LIL UUL n propionyl CoA butyryl CoA isobutyryl CoA U isovaleryl CoA LU LU 20 E O LILI 2 4 10 2L 64 UO DUDU II U 0000000 UNphT7 Q90T DUU NphT7 Q90F OO UO OC O UO BEC I 00 0000 0 00 2 62 NphT7 Q90T NphT7 Q90F kDa 1 2 3 4 5 6 2 3 4 amp 8 97 0 66 0 2 6 2 00000000 D SDS PAGE 2040400000000 00 O UillLow molecular weight marker 200 000000 OSUU O O D DAUNI NTA O D 0 00 0549 D O 0 0600 0 U U USDS PAGE O 10 00 000 O 000 UUUUULU 65 LL EU LE ET D NphT7 Q90F NphT7 Q90T J WOU DI O UUD DO 2 6 3 00 2 6 4 1 U Bd QUO DOOU LU UI UUUUUUUUU Gs 00000 2 4 2 000000 00 Npar7 DUDU DEO DUDU 000000000000 NphT7 Q90F LU UU UUU UI OT O DU OO UO TTT UTO O TULL U 2 6 3 A D0000 0 0 NphT7 00000000 malonyl CoA O D D UL acetoacetyl CoA UU OO UUU O D Nphr7 Q90T OU HU LU n propionyl CoA U UO UU UO UO DO DEO D DU D D UI DIOE UUULU 3 oxo pentanoyl CoA WU UU UU UDO O UO DO UO NpRT7 UU 0000 Ul 000 BICI 2 6 4 400 0000 0000 0 10 041 umol min mg 400 000 D DU UNphT7 D 000 330000000 1 2 6 2 NphT7 Q907 00000060 malonyl CoA U UL acetoacetyl CoA
44. H O NphT5 O OH aT a n E eae S CoA S CoA HO S CoA HO O OH acetyl CoA acetoacetyl CoA HMG CoA mevalonate Mevalonate Phosphomevalonate Diphosphomevalonate kinase kinase decarboxylase Type 2 IPP isomerase NphT1 O OH NphT3 O OH NphT2 NphT4 HO OP HO OPP OPP opp phosphomevalonate diphosphomevalonate isopentenyl dimethylallyl diphosphate diphosphate IPP DMAPP Naphterpin BE 40644 Furaquinocin Endophenazine DI 6 ULUULUUUUUUUUUUUULU LUI iiu 0 0 UU Streptomyces sp CL190 00 000 0000000000 9000 O UE 7E LU 7E U D UE E Ap E A A E E i IE A E sin ma UULUUUUU LU ODO ODO ODO DD OD ODO DDD DU UUUUUUUUUUU 14 NphT7 UU UULU 0000000000 00000 000000000000 00000 00 Escherichia colit D KAS IDEE CEULTIO UO UO O DO DO DO LT Ll O O0 O0 O O Cys His Asn UU catalytic trad O O O DO B D D BB DU malonyl ACP Y ACPO UU DD 0000000000 Are D 0 0 NphT7 00 000 Vall Ud UGO lll CI 000 000 UUNphT7 KAS WO TIC 1 UU Claisen LH UU DU OOO OO EE LEE UU Ceci 000000000000 UU O UO BIDUO UD C CEU DU malonyl ACP E D type II PKSH KCS LIL malonyl CoA UOU U U U U acetoacetyl CoA E UUU U UU UNphT7 U 000000000 00000 00 ulii pit i Lip BL LLL O00 U ot 30 60 NM E EMT ner NphT7 1 nro vir T d Gef lt Lui v DIS a EEE m D DOATE 3OLATA ecKASII 1 e ef Lio vr JADLEKMVD CR Wa AAP NETVEITMGFE TO DI 110 NphT7 61 FIGRARILKA PERL TV TRENS TPDRPO PR A vun YNE che TVE ecKASH 58 FJATREVIEM EKD IGL UE
45. IO from Saccharomyces cerevisiae encodes acetoacetyl CoA thiolase J Biol Chem 269 50 31383 31389 Dairi T 2005 Studies on biosynthetic genes and enzymes of isoprenoids produced by actinomycetes J Antibiot Tokyo 58 4 227 243 Saleh O Gust B Boll B Fiedler HP Heide L 2009 Aromatic prenylation in phenazine biosynthesis dihydrophenazine 1 carboxylate dimethylallyItransferase from Streptomyces anulatus J Biol Chem 284 21 14439 14447 Kawasaki T Hayashi Y Kuzuyama T Furihata K Itoh N Seto H Dairi T 2006 Biosynthesis of a natural polyketide isoprenoid hybrid compound furaquinocin A identification and heterologous expression of the gene cluster J Bacteriol 188 4 1236 1244 Kawasaki T Kuzuyama T Furihata K Itoh N Seto H Dairi T 2003 A relationship between the mevalonate pathway and isoprenoid production in actinomycetes J Antibiot Tokyo 56 11 957 966 Kawasaki T Kuzuyama T Kuwamori Y Matsuura N Itoh N Furihata K Seto H Dairi T 2004 Presence of copalyl diphosphate synthase gene in an actinomycete possessing the mevalonate pathway J Antibiot Tokyo 57 11 739 747 Zhang YM Rao MS Heath RJ Price AC Olson AJ Rock CO White SW 2001 Identification and analysis of the acyl carrier protein ACP docking site on beta ketoacyl ACP synthase III J Biol Chem 276 11 8231 8238 Jez JM Ferrer JL Bowman ME Dixon RA Noel JP 2000 Dissection of malonyl coenzyme A decarboxylation from polyketide formation in the reactio
46. Kal E UU acetyl CoA O 1200 uM H EH UD UD DOG III Lineweaver Burk 00000 0 OU Kalkal 8d 0 00 40 8 0 0 0 0 1 4 20 0 000 o NM o O B ketoacyl CoA Mg A Enzyme AL Mg complex R S CoA HO S_COA R S CoA Anm Acyl CoA Malonyl CoA B ketoacyl CoA ii 1 4 1 p ketoacyl CoA acetoacetyl CoA E E B Il p ketoacyl CoA 0 000 0 0000000000000 00000 0000000000000 QU 3093nm 0000000000 g0 DU 0 0 Up ketoacyl CoA acetoacetyl CoA UU 34 UO lH B HE EPI EEE EE DEE HEEL DE Eee TT 008 Michaelis Menten LIL Lineweaver Burk JJ O 1 4 2 GOO OU 000000000000 J lacetyl CoA D UU malonyl CoA E UU D D D Km O 68 3242 0 00 28 322 6 uM 00 00000000 Aa O 10 3 0 2 s 00 0 00 UU 1 4 7 00000000 00 Vmax umol min mg K ce Co uM KMar CoA UM Kea S7 Ka K Malo Co si uk 8 9 0 3 68 3 4 2 28 3 2 6 10 3 0 2 0 3 35 A 51 Malonyl CoA 100 uM V umol min mg I E E 065 o E gt 0 0 0 1 1 Acetyl CoA uM 0 100 200 300 400 500 600 Acetyl CoA uM B 81 Acetyl CoA 200 uM v umol min mg P E Da gt 0 0 0 1 1 Malonyl CoA uM 0 0 20 40 60 80 100 120 Malonyl CoA uM 1 4 2 Michaelis Menten Lineweaver Burk O DODO A Acety CoA 0000 KmO00000000010020 50 100 500 uM JJI 0000 malonyl CoA 1 O 100 uM O 0 00 UBlmalonyl CoADO DO bell 00090000 100 200300500100 uM 000 00 0 Dacetyl CoA 0 O0
47. L190 nph77 0 0 HI D 0 0 D In frame deletion 0 OOOOOOOUNphT70000000000 0000 pSEAnphT7 O D LE U DEO DEO np T7 0 UNUUU UD UL SnaBI ET ET UU DU 8 mer Belit HL D T CIL OL LO 1000000000005 000 000U Streptomyces sp CLI90 LO OO OO UU L D R2YE IOUDUDDUUDUDUDUUDUUDUUDUUDUUDDUUDU thiostrepton HUHUUUUUUUUUUUUUUUUUUUUUUUU 100000000 O thiostrepton UU ELO D DO E UL OL CELO UE UL OE CELO L iii a Area ada EN ESE eee BEE NOE VELE thiostrepton O TSBU UO LLD D UL D DEO CE UL OL CELO FECE OE CELO FECE UL CT UU UDUUZDDUDUDUUDUUDUU thiostrepton L LI LL LL D LE D LT U LE UE LI l DADO DD OO A BO DD ODO ULUI UI ULUI UUUUUUULU ODO 0000 nphi6 NUUUUUUUO TI CUUUUUL UU OUO PCROUOUU 22 Kb DNATIDLLLUO DEO UE UL U DEO DE DNA TT LI E Poll I III 0 9 koi L3 kt EO GO U LE U DEO D AnphT7 0000 ul 100 O DU TI LU ELO LT I UV 1600PC U T D LL UL UE LE HPLC LC 2000 system OOO LL EL EL BL FJ PU 2080 HOO KCoATI EL D E E UV 2070 000 200 00000 RI 74 D DE LE UO DEO EI LIBI EE OI LE UI E 0000 00 00 AS 2050 Hana LI LI CO 2060 LC FTMS CoA OUUU LTQ Orbitrap XL Thermo Fisher scientific UO UO 0000000000000 FPLCUGE Healthcare WOOO 0000000 Fraction Collector FRAC 100 LU 4HtLLL Gradient Programmer GP 250 Plus ERE LEAR Ul High Precision Pump P 500 ELTE E ARN UL Recorder Rec 102 Amersham Biosciences LE Monitor UV 1 101 Lu l l PA 10
48. LU UUU OO OO IU L OOD GUDO CO ET C DICE UI LT C UUUUUUULU UU H IDD Ub Ut HU U Ul Ut U UU Uu UU UU NphT7 in vitro UUUUUUU OOO NphT7 KAS IH O D D l NOE Acetoacetyl CoA EH 1 D U L DU NphT7 acetoacetyl CoA O UU D UU DOO O OOOO 000 uiuit 000 IUL UL UD NphT 7UUUUUUUUUUUUUUULU HUG Catalytic triad O U UUL 000 UUUUUUUUL acetoacetyl CoA OOO Acetoacetyl CoA O l LI UU acetyl 0O O UU 0 00 LI UD BILL OO LU Thiolactomyein cerulenin 1L E E O LI UD DOo000L E ARO DU NphT7 invivo D DL U L 00d BUD UO UT TITO nr putt DU Naphterpin O O O 0O UU NpAT7 T L LU UI C LSA H UU TATAEE UD UU 38 39 45 50 22 59 62 69 70 71 75 81 82 90 102 108 000 Acetyl CoA Acetoacetyl CoA Butyryl CoA CoA IPTG Isobutyryl CoA Isovaleryl CoA Malonyl CoA MeOH Methylmalonyl CoA n propionyl CoA SDS TFA Tris X Gal Lu UL Acyl CoA Acyl ACP D ketoacyl CoA D ketoacyl ACP DMAPP HMG CoA IPP MEP Uu Acetyl coenzyme A Acetoacetyl coenzyme A Butyryl coenzyme A Coenzyme A Isopropyl D p thiogalactopyranoside Isobutyryl coenzyme A Isovaleryl coenzyme A Malonyl coenzyme A Methanol Methylmalonyl coenzyme A n propionyl coenzyme A Sodium dodecyl sulfate Trifluoroacetate Tris Hydroxymethyl aminomethane 5 bromo 4 chloro 3 indolyl B p galactoside Acyl coenzyme A Acyl acyl carrier protein D ketoacyl coenzyme A D ketoacyl acyl carr
49. MnCL HH gt O Na2B404 OO NH4 6M0704 4H30 40 mg 200 mg 10 mg 10 mg 10 mg 10 mg AL 93 UU 1 C acetyl CoA GE healthcare D Y 0 00 0 O Coenzyme A 000000 0000 12 Clacetyl CoA acetyl CoA n propionyl CoA butyryl CoA isobutyryl CoA isovaleryl CoA malonyl CoA methylmalonyl CoA L 1 HOUUUUUUUUUUUUUUUUUUUUUUUUE cerulenin IL I thiolactomyein D UU D DHL O DL UU CELO FE UL OE ELLO CE HPLC OO 00L HPEC HL DL EL D BO DO OOO OE CELO FECE OE CELO FECE OL ELO EE CE UL CT UU UUHUUUUUUUUUUUUGFA UI UI UU e JJ UI UUUUIUUULII LB Di n butylammonium acetate ammonium acetate LU UO U DEO EL UL UO EE D I D Naphterpin O ET U E UO U LI U UUUUUUUUUUUUUUUUU LUDUOLULBLLULULDLULLLULLL Lu ODO DO DDD uiutiuuLulillul Ligation High O O0 EDU ED D LI LI HUUUUUUUUUUUUUUUUU DNALTIUTIUL DNA Blunting kit E OO U E DL UUU U Colony directed PCR PCR master mix Promega 0000000 nph77 acpi acpst fabD UU O UO UU PERO UD Expand High Fidelity PCR system Roche TUOUUUUUUUUUUUUUUUUUL PCR U QuickChange XL Site Directed Mutagenesis Kit Stratagene O L U JODODODOO 10 kb E D EE E E E E B D E LU QIAGEN Plasmid Mini Kit QIAGEN 00000000 000000 DNA YOUU QIAGEN UDO 4 80 U Minielute Gel Extraction Kit 4 kb Qiaquick 4 10 kb LILI QiaexII 10 kb OU UU OGOUO UU OO LI LI Instagene matrix Bio RAD HOUUUUUUUUUUUU N MA 0000000000 Ni NTA Superflow QIAGEN O L O UBradford UO UL U
50. N TSATHAF ic a Is mM nis m I ABA SFTY 140 170 Um INN vm gedet EAS HEC 1 TU NS os oO MEC RE RE a NphT7 121 ME NGTL R amp S GRID Ji YSE NT Ivv F GDGAGAUN TIGE ecKASI 118 DOY MA SAVK MCA av LA Inc WE Ill zeis er dep AABEE PE 208 SR ot NphT7 179 VR RV ARI A GLT Tomi RBA GGSROBILDTD GLDAGLQYFA L w TEMER P Alike ecKASII 174 PIA SYG BTE ADRVNIZENS IHLT EIN FKVA VTER RO RE 260 270 STRA er Ee We ege We ve be PR AD LEE Je ME e ee a SC NphT7 239 ge AGUM AB DISHFIEEBIEITSA WovMuoeves ED Bulle RA TE REI VET YSU TE ecKASII 227 ar AANNLIQRS iia ia II ISATAK KIMGMSMDNVV Vig ILDR HE Ode AA SMP zc ALE e ECRIRE CRUS ama Zu ET TEE Si na A SEREI W H 7 NphT7 E coli KAS III ecKASIII 0 0000000 DODODODA0 00000 Cys His Asn 0 DOD O DU D eU CACPOUO UB DU D Are I pop 00 00000 0000000000 DeckASI DE coli O KAS III PDB ID 1HN9 15 000000Np 700000000 0 in vitee 0000 000000000000 NphT7 KAS IH U UU UU acetyl CoA malonyl CoA UUO O UUU acetoacetyl CoA 0080000 00 0 000000 00000000000 00 UI 0000 000 UU DI OL EINpRT7 YOU CE CE OUT III L uuu utttututbututitulu ttLlbaeetyl CeA UU malonyl CoA 100080000000 00000000 00 0 0000000000 JODoODo00000 00 acetyi coA 0000000 100 n propionyl CoA ULUI ULUI UI DU UI 000KAS WOO 0000 00 00 000 DU EUA E AAA A USA 00000000000 0 UNphT7 HO D000 00000 000000000000 LU UULUU OU UU 0000000000 O OKAs IULDLLLuull 000000 IUUUUUUUU UI KAS HI JI HE 000000000 00000 NphT7 KAS HI
51. O 00000000 0000000 Y 33 0000 000 UUnph77 OO 0 00 00000000 0000 U O UUG UG UOGO O O 0000000000000 000000000000 FeO AAA ERE poly B hydroxybutyrate PHB acetoaetyl CoA UOU EL E EH DBEIE ES DJ EE EL ELE E O 0d d000 000 00000 PKS pp000000000000 000 methylmalonyl CoA ethylmalonyl CoA acetoacetyl CoA E NIM BLELETET O 0000000 00000000000 0000 D 000 00000 000 da NphT7 O o o AG lt 0 Pi i RE Nazi ca O O S s Acetoacetyl CoA thiolase AG 7 kcal mol O O ts sc O ai A 3 3 1 acetoacetyl CoA 000000000000 2000 acety CoAGO 1 J 1 1 I HL IO O 00 L acetoacetyl CoA 10 0000 000000 00000000 4 0 00000000000 00 urmalenyl CoA EU DU td aru OO 00800000 000000000 0000000 81 UO UU O UUUNphT7 UU O DUDU mvito 00 in vivo O O 000 UO UI UO LI U HIDE acetyl CoA JUL E E U UUU malonyl CoA O U HI Claisen U OL acetoacetyl CoA UU UUUUUUUUUUUUUUUUUUUUUUUUU DADO Bd 00000000000 00Npr7 DT D DO 00000 ULUI O LI U Lacetoacetyl CoA synthase IUU U U IT Acetoacetyl CoA synthase acetoacetyl CoA E DJ 1 DE E E E EE B EE U E UD UU 000000 LILI Llacetoacetyl CoA synthase O0 O OOO DE UUUUUUU MERZEL REI ELE SET IENE WEARTEN EL HEINS RRE E Doo go 00 D 0000 000000 00 O poly B hydroxybutyrate 00 D I 000000000 0000000000 TZ On bupanel 0 0 D DD 00 000000 oO ep D Dacetoacetyl CoA DOO OOO 0000000000000000 U UU O UUthiolase 00 000000 thiolase DETTO DU ELO UE L DADO B
52. O DICE D WU O D D 3 GREVE RE SERE CEE O E DS RE BEE 2 Tim E HR A Bi B 3 2 1 HPLCOOOG PEGASIL ODS C18 4 6x250 mm 5 um 2 772 R 30 C 0 1 acetate in MeOH 0 1 acetate in water isocratic 80 A 20 B 30 1 0 mL min 77 1 kb 2 5 kb PUMV181 Xn spon A nohte Hr 1 Smal Hit 2 5 kb Ol Fr E lg usn 0 Hincll SI ligation V d S pUCAnphT7 SnaBI te d Bo 8 mer U 273 900 ligation Hindlll Xbal SI 2s kb Oi Fr z s lg l pSE101 9 Hindlll Xbal SIT ligation 1 3kb 0 9 kb PSEAnphT 3 2 2 nphI7 00000000000 0 0 00000 SmalfSnaBi OU Baii DO 000000 000000000000 UV UUUUU O BpBagbpigugagbpiiuiulibiuiuluutuull pUMV181 0 Smal Li 0000025 kb DNAGO 0000000000000 pUC119 Hinell D D EE UD U D U DU LU O0 UpUCAnphT700 O 00 UO O pU CAnpbhT7 SnaBl O 000000000000 00 DNA 0008 mer Bo T D DU 000000000000 000000000 Bel I III TO UE L 00000000 00000000 100000000 I UU LU 000 D Hindlll Xbal 0 000000000 2 5ko0 DNAD II pSEtot 000000000 0000094770 0 0 000 0000 O pSEAnphT7 HD 0 000 78 UO HPLC 00000032300 0000000000000 naphterpin E 000000000000 00 00 naphterpin O O 00 3 2 40 0 U DEL TE D LU naphterpin O 0 91 0 05 mg g naphterpin U U UO UU lant U 0 34 0 03 mg gf DUO UU U UnphT7U U U U 0 69 0 03 mg gl 000 UU U U LInphT7L 000000 naphterpin 00000000000 0000000000 CLI190 U O O O Uacetoacetyl CoAL O O O DID EE UU 00 O DU naphter
53. Omura S Hopwood DA 1994 Cloning sequencing and deduced functions of a cluster of Streptomyces genes probably encoding biosynthesis of the polyketide 103 25 26 27 28 29 30 31 32 33 34 antibiotic frenolicin Gene 142 1 31 39 Hori Y Abe Y Ezaki M Goto T Okuhara M Kohsaka M 1993 R1128 substances novel non steroidal estrogen receptor antagonists produced by a Streptomyces I Taxonomy fermentation isolation and biological properties J Antibiot Tokyo 46 7 1055 1062 Marti T Hu Z Pohl NL Shah AN Khosla C 2000 Cloning nucleotide sequence and heterologous expression of the biosynthetic gene cluster for R1128 a non steroidal estrogen receptor antagonist Insights into an unusual priming mechanism J Biol Chem 275 43 33443 33448 Pan H Tsai S Meadows ES Miercke LJ Keatinge Clay AT O Connell J Khosla C Stroud RM 2002 Crystal structure of the priming beta ketosynthase from the R1128 polyketide biosynthetic pathway Structure 10 11 1559 1568 Abe I Takahashi Y Mona H Noguchi H 2001 Benzalacetone synthase A novel polyketide synthase that plays a crucial role in the biosynthesis of phenylbutanones in Rheum palmatum Eur J Biochem 268 11 3354 3359 Jez JM Austin MB Ferrer J Bowman ME Schroder J Noel JP 2000 Structural control of polyketide formation in plant specific polyketide synthases Chem Biol 7 12 919 930 Funa N Ohnishi Y Fujii I Shibuya M Ebizuka Y Horinouchi S
54. U NphT7 UL ACPI Streptomyces coelicolor A3 2 U U KAS HI FabH malonyl CoA ACP transacylase FabD U holo ACP synthase ACPS O0 0 I 8000 UU 00 U 00 UID O DACP FabD ACPS LU in vitro malonyl ACP 1 U U UU E DO E U E LU LC MS 000000000 O O Omalonyl ACPO 1 Clacetyl CoAD 0 O 00 0000000 positive control S coelicolor A3 2 L KAS HII U NphT7 0 0 OO LLLI 3 C acetoacetyl ACP D O D 000 DACPO 0 0 D 00000000 121 200 HO Seryg ACP NH apo ACP Aa TJ N N COS NN E H l Hs e eebe O O OH OH HO oH ACPS coenzyme A oo o OH HN O P O Ser ACP NH holo ACP a O H H OH o O d we AA boto O O OH OH E O 0 FabD malonyl coenzyme A o os OH O oO H H OH o sasi O P O Ser ACP Caen malonyl ACP e d ai N T Y N NphT7 dep e on OH OH O or 1 C acetyl coenzyme A Los KAS III i 4 OH SAY ossa 3 4C acetoacetyl ACP 1 1 1 Malonyl ACP O E O KAS MO O 0000000000000 c0000000000000000 00000000000000 O DQACPS S coelicolor holo acyl carrier protein synthase FabD S coeliclor malonyl CoA acyl carrier protein transacylase KAS III S coelicolor p ketoacyl acyl carrier protein synthase O DOD Din vitro 0 0 00 malonyl ACP 1 C acetyl CoA 0 O O HOU KAS 1 0000 Not 00 000 00 0 0 U SbSPAGE J B 00000 3 C acetoacety ACP 0 0 0000000000000 20 DO 00000000000 Streptomyces sp CL1900 D 00 00
55. acylalycerol 3 phosphate ni arta ap o hypothetical protein hypothetical protein hypothetical protein hypothetical protein E PIRE ligase a Jurcosytrantease hypothetical protein hypothetical protein hypothetical protein contains 3 S5 exonuclease domain anthranilate phosphoribosyltransferase cytochrome C oxidase subunit III CtaE ubiquinol hrome C reductase QcrC Rieske iron sulfur protein QcrA quina ochrome C reduci Maa IN unuueui uinuejoeqoo ApN GC transmembrane serinefthreonine pratein kinase L proOry uens ds seuejdougjoy CT 886 OY utes ds seoKuojdaegg E kx snjejnue seoKuiojdaejg AAA 996 0Y uies ds sesAuwojdals phaspheamesvalanate Kinase diphosphomevalonate decarborylase mevalonale kinase Type 2 IPP mamerase HMG CoA reductase HMG COA synthase 0 2 1 UUUUUUUUU LU 000000 Nph T7 E OT ET L O0000 Neht7 000040 0900 0000 0000000000 00000000 00 00 0 00 pad dado U UI 000000000 00 00 DU Mycobacterium 0 O 00000 U 0000000000000 00000000490 00000000 000000000000 60 Ud 84 N U prolyl oligopeptidase family protein Zn dependent protease with chaperone function nicotinate nucleotide adenylyltransferase iojap related protein fructose 2 6 bisphosphatase glycosidase Periplasmic binding proteins and sugar binding dom carbohydrate ABC transporter substrate binding carbohydrate ABC transporter membrane protein carbohydrate ABC transporter membrane pro
56. cyl carrier protein synthase III A key condensing enzyme in bacterial fatty acid biosynthesis J Biol Chem 274 51 36465 36471 Choi KH Kremer L Besra GS Rock CO 2000 Identification and substrate specificity of beta ketoacyl acyl carrier protein synthase III mtFabH from Mycobacterium tuberculosis J Biol Chem 275 36 28201 28207 Heath RJ Rock CO 1996 Inhibition of beta ketoacyl acyl carrier protein synthase III FabH by acyl acyl carrier protein in Escherichia coli J Biol Chem 271 18 10996 11000 Han L Lobo S Reynolds KA 1998 Characterization of beta ketoacyl acyl carrier protein synthase III from Streptomyces glaucescens and its role in initiation of fatty acid biosynthesis J 102 14 I5 16 I7 18 19 20 Zl 22 23 24 Bacteriol 180 17 4481 4486 Qiu X Choudhry AE Janson CA Grooms M Daines RA Lonsdale JT Khandekar SS 2005 Crystal structure and substrate specificity of the beta ketoacyl acyl carrier protein synthase III FabH from Staphylococcus aureus Protein Sci 14 8 2087 2094 Choi KH Heath RJ Rock CO 2000 beta ketoacyl acyl carrier protein synthase III FabH is a determining factor in branched chain fatty acid biosynthesis J Bacteriol 182 2 365 370 Li Y Florova G Reynolds KA 2005 Alteration of the fatty acid profile of Streptomyces coelicolor by replacement of the initiation enzyme 3 ketoacyl acyl carrier protein synthase III FabH J Bacteriol 187 11 3795 3799
57. ein domain typically associated with flavoprotein oxygenases DIMG NTAB family Kelosterold momerase homolog type polyketide synthase 1 kb 9 0t INSG seueBouiroug2opuiA seoKuiojdaJjs 3 carboxymuconate cyclase integral membrane protein Predicted phosphatase phosphohexomulase g secreted protein TRANSCRIPTIONAL REGULATOR m Transcriptional activator of acetoini glycerol metabolism putative aldehyde dehydrogenase large secreted protein L alanine DL glutamate epimerase and related enzymes of enolase suparfamily binding protein dependent transport systems inner membrane componen sugar ABC transporter ABC type sugar transport system GntR family regulator putative sugar phosphate Bomerase spimerase ABC type sugar transport system monosaccharide transporting ATPase nbose ABC transporter permease D ribose transporter ATP binding protein CICCO SIC ICI DOI CI UI RNA polymeraze ECF sutlamily sigma factor short chain dehydrogenasemeductase SOR type modular potyketide synthase beta ketoacy synthase in palykebde synthase crotanyl CoA reductase 3 hydroxybutyryl CaA dehydrogenase TDP myenaroayl glycosyltransierase acyl transterase domam cantainmng protein in polyKelde symihase 86651 THYN sn odsoaso sadAwojdajs 2 2C CoAT LH DH ED NphT7 T 000 3 00000 NphT7U ULUI DCoALUUUUUUU UI 000 Y ORFUU 00 00 00 0 00 O DU WOOD 00000 0 80 0 ORFIII 0000000000000 000000000 0000000 Uu utt 8
58. erclosis 000 KAS ID H Thr D amie clif DO S aureus O Phe 000000 UO UNphT7 U0 Gin O O t DOO O UO 00 UNphT7 Q90 TULUI FEDT UL UupD um d du wuliumgbiuiiudtiulttuiliiilli 62 10 20 30 DU NphT7 1 e MTD PE I V Sp QR WEEE A ecKASI 1 S uso VR THA EH RIF NET saKASM 1 mak IDRA E HH WED Majo D mtKASII 1 MTEIATTSGA MaR vv TRIO T R F REIHE 5 TO 80 50 120 EM WEEN ze RE BARS NphT7 54 THD UBITARIGR TP EQLTVHA SHIPORPOBRBFT TIT AA V NE ecKASII 51 VEITMGFIZIZIAT EK DONICLEIV TSATHAFIZSA KIgC PA VAI saKASII 51 TEID LEA Yas V A QP EDO Mg Al GDMP FIMT V GKVASMISOLE mtKASI 61 AASMEBTIZAC R MLSNENXELSA ADBOGYV IIT Nur WA odo KI LG LSH 140 180 Jun nome CEDE Tou NphT7 114 SVAGTLV YR AGA ir T S ecKASII 111 VEND Q Y VK SA RE at AASE saKASill 111 TEMKOQYVOSIED EN Iert VS mtKASI 121 ARIA DMI RGLEIG AIVNVIEt TP 200 210 220 ala EC Ee TT T Daun eni NphT7 173 TGTISPRIVRRV ALHTFIEGLTD AGGSR QPLDTDGLDA Y wd pr LURNMP RREVTEHL ecKASM 170 EP S T HLHAWMSSYGE LLTLPNADRV NPERIS HL TMALEIN KVEIVTEL saKASII 171 EGR S Y EMGSMOTGGK HLYLDKDTGK LKME OR 3 KFEIVRIM mtKASM 180 FQ GP T VAGS EQAD AIRODIDWIT FAORPS G PRPFVRLERP A R AF KM 250 260 280 290 300 EH WE REE AN IR OS GT TCR gr DEC Mere NphT7 233 POL IKGFEHE fovpAADllsH LDEVFGEINSHL PRATMHRT V S ecKASM 221 AHIVDETLAA NNLDRSOL ISATAKKINGM SMBINVVVT L 5 saKASM 215 GDASTRVVEK EINLTSDOD L M
59. h SB 2007 Discovery of platencin a dual FabF and FabH inhibitor with in vivo antibiotic properties Proc Natl Acad Sci U SA 104 18 7612 7616 Dam T Aisaka K Katsumata R Hasegawa M 1995 A self defense gene homologous to tetracycline effluxing gene essential for antibiotic production in Streptomyces aureofaciens Biosci Biotechnol Biochem 59 10 1835 1841 Kuzuyama T Dairi T Yamashita H Shoji Y Seto H 2004 Heterologous mevalonate production in Streptomyces lividans TK23 Biosci Biotechnol Biochem 68 4 931 934 Seto H Watanabe H Furihata K 1996 Simultaneous operation of the mevalonate and non mevalonate pathways in the biosynthesis of isopentenly diphosphate in Streptomyces aeriouvifer Tetrahedron Letters 37 44 7979 7982 Erb TJ Berg IA Brecht V Muller M Fuchs G Alber BE 2007 Synthesis of C5 dicarboxylic acids from C2 units involving crotonyl CoA carboxylase reductase the ethylmalonyl CoA pathway Proc Natl Acad Sci U SA 104 25 10631 10636 Ro DK Paradise EM Ouellet M Fisher KJ Newman KL Ndungu JM Ho KA Eachus RA Ham TS Kirby J Chang MC Withers ST Shiba Y Sarpong R Keasling JD 2006 Production of 106 37 58 59 60 61 62 63 64 65 66 67 68 69 the antimalarial drug precursor artemisinic acid in engineered yeast Nature 440 7086 940 943 Misawa N Nakagawa M Kobayashi K Yamano S Izawa Y Nakamura K Harashima K 1990 Elucidation of the Erwinia uredovora carote
60. ier protein Dimethylallyl diphosphate 3 hydroxy 3 methylglutaryl coenzyme A Isopentenyl diphosphate 2 C Methyl p erythritol 4 phosphate 000 HPLC LC MS OD PAGE PCR TIC UV High performance liquid chromatography Liquid Chromatography Mass Spectrometer Optical density Polyacrylamide gel electrophoresis Polymerase chain reaction Total 10n chromatogram Ultra Violet UL DU UL UUU 0000000 III I Casen DU 8000 BE Ee ED B u EEE EVE EE EIEN EL ENTE s a E sigun R B EE ERE ET ENE 0000000 acyl 000000 UU D D coenzyme A CoA LU acyl carrier protein ACP FUUVUUUUUUUUUUUUUUUUUUUUUUUUUUUO acyl CoA OO acyl ACP 400000 UU acyl UU a anion O O ET UU OOL o anion JJI UUUUUUUUUUUUUUUUUUUUUUUUU UU DO00000 000000000000000 0000000000000 acetoacetyl CoA thiolase 3 hydroxy 3 methylglutaryl HMG CoA synthase DU 000000 00000000000 000000000700 00090 B ketoacyl ACP synthase KAS III E 1 E E ELE E EJ E EE EE EJ DU EE EE E 200000 B ketoacyl CoA synthase KCS O0 0000 00000 chalcone synthase CHS O L UU 100 0 000000 000 type HI PKS L 0 DU 000000000 00000000000 0 LU type PKS UD type H PKS keto synthase 000000000 00000000000 aa d 000000000 o anion TEL D OL O di COL O DUO CIE GO UUU UI UI OO 00000 LIU UN EE E LILI DO E acetoacetyl CoA thiolase HMG CoA synthase UU 0000000000000 KASUKCS 0 PRSE Hp DO JERR ES BR 3 O Thiolase o O e E e SS PP ech gtt ier acetyl CoA ace
61. l 000400000000 BIET LI DU UUUUUUUU III UU UDO UU USDS PAGE 0 O 010 0 UO 000 00000 NphT7 FabDU KAS HD OOOO 18 00 000 O Utt ACPUACPS OU U 07100 vi UO oo O CE UL OLD UU LL UU OUUULUL 000000 L E LIHiLoad 26 60 Superdex 200 prep grade GE Healthcare VO U UDO LO LU 1 mg mED D UO UUL UU D E I mE UD UO UL 0 10 0 2 um Millipore O UU ODO U DIU DIO ELE 600 mL buffer 50 mM NaCl 100 mM HEPES 20 Glycerol pH7 5 EL 000 UL 1 0 mL min 000000000000 000000000 0000000000 IU LIE E Chymotrypsinogen A 232 kDa Alubmin 67 kDa Catalase 25 kDa 1 mg mL GE Healthcare 1 L LL ELE ELE E E UL Bovine Serum Alubmin SIGMA IB EL E 0 JUD E LH Bio Rad Protein Assay Bio Rad OU Bradford OU JOU DO O 97 Malonyl ACP Malenyl VUUUUUUUUUUUUUUUUUUUUUUUUUUUUO DIL PEGASIL 300 C4 2 0x150 mm 5 um z a RE SY AT iim E 25 C SE A acetonitrile 0 1 TFA 4B water 0 1 TFA mH SEE gradient LEE 1 0 mL min 470954 Dr i 43 ASK A S 96 mh BRE 96 0 5 95 5 9 95 10 30 TO 40 70 30 45 100 0 46 5 95 51 5 95 UDO UU ACPUU UL ACP NIiENTALE EE EID DELI 0000000000000 09 0 000 O DO DIA micon Ultrafree MC 5 000 NMWL 000000 0000 0000002000000 malonyi ACP 000 8 O U LI 98 DI LU EODD UD OLD ULDBOELE UL U PCR jj Dna da DO OUO B CELO GUT OLG TOT OE III III UU UD OD NphT7 I D DBLO DE EE BELLI QUO 00000006 00000000000000000 0000
62. min Retention time min B isobutyryl CoA 7 malonyl CoA D isovaleryl CoA 12 malonyl CoA 150 150 lt 100 2 100 E E z e 50 2 50 g 2 0 0 a 8 9 10 11 142 13 14 Retention time min Retention time min CoA acetoacetyl CoA malonyl CoA acetyl CoA n propionyl CoA 3 oxo pentanoyl CoA isobutyryl CoA 4 methyl 3 oxo pentanoyl CoA 11 butyryl CoA 12 isovaleryl CoA NphT7 Q90T EIS NphT7 RIES BA SENDhTT AR D Jo O1 P Co N 2 6 4 NphT7 Q90T 90000 HPLC OO lJ uU UUU LU DO BDO DUDO DT DU TO Td DO LU UI Td TO diii pL Odo 0D 0D OD DD 0000 CADUDODODODUODONOOO UUUUU S500000 24 20 000000000000 coApoo000000259nm0 0 0 DADO DO DO UU 68 Hu ul NphT7 00000000000 acetyl CoA malonyl CoA WU UU UU UL OL U OUGUUO O UU 00000 UCys UU Bis T Ala HO UL OOO 00060 O O O DNphT7 O Cys His Asn LL LO DL DD DO OD UO UO OO LL DU UU UO UD D ELO UU DL 7O D CE HE Dao DOLO DE EE TO COE L LU UUU 00000000000 0000 D BB DEO TO 00000000006 LU LU DU LQ90FrUUUUUUUUUUUUU IILI LI LD UL UNphT7 UU O UO UOC E coli KAS W00 0000000 000 00 000 UB BO BDO UG UGO ULUI UUUU UI IULIU UI 0000000000 O UUKAS ID thiolactomycin O O00 000000000 NphT7 DO LL UO ODO LU UU UUUUUUUUUUUUU KASmII prpditttute t 00 KAS III UU ULUI UD UD UO HO CE lili LU BE UL UL COELO CE LU 0000000 000000000 00 0000000000000 Q00000 000000 O NphT700 UO UU UIKAS Dr D EB ULL 00000000000 000000000 000000000 000 00 69 UI NphT7 in vivo
63. n lipoprotein Lppli e hypothetical protein geranylgeranyl pyrophosphate synthetase Ida I hypothetical protein regulatory protein transmembrane serineffhreonine protein kinase L gcyltransferasae esapentenyl diphosphate delta ssomermse tranaposase amp polyprenyl synthetase ldsB_1 g terpene cyclase transposase 3 decay D arabino heptulosonate 7 phosphate synthase AroG hypothetical protein hypothetical protein Ween protein lycerok 3 phosphate les EE hypothetical protein hypothetical protein e hypothetical protein OC hypothetical protein Fars fatty ack CoA ligase glycosyltransferase hypothetical protein hypothetical protein hypothetical protein contains 3 5 exonuclease domain anthranilate phosphoribosyltransferase Lil ENE b cytochrome C oxidase subunit III Cat ubiuinel A chrome G reductase Lor Rieske iron sulfur protein Cher ubiquinal cytachrome C E 66Aby suelaa n unuejoeqooAW C K I contains acyl sin Les acyltransferase Jsupertamiy domai lipoprotein LppM hypothetical protein geranylgeranyl pyrophosphate synthetase ldsA2 hypothetical protein regulatory protein polyprenyl synthetase ldsB 2 HitG Co4 synthase imopentenyl diphcsphalg delta mormerase polypreny synthetase IdsB 1 Borer cyclase 3 deoxy D arabino heptulosonate T phosphate synthase Aros hypothetical protein hypothetical protein hypothetical protein 1
64. n mechanism of a plant polyketide synthase Biochemistry 39 5 890 902 Beinert H 1953 Studies on the fatty acid oxidizing system of animal tissues II beta Ketoacyl derivatives of coenzyme A J Biol Chem 205 2 575 584 Stern JR 1956 Optical properties of aceto acetyl S coenzyme A and its metal chelates J Biol 105 4T 48 49 50 5 DZ 53 54 55 56 Chem 221 1 33 44 Qiu X Janson CA Smith WW Head M Lonsdale J Konstantinidis AK 2001 Refined structures of beta ketoacyl acyl carrier protein synthase III J Mol Biol 307 1 341 356 Price AC Choi KH Heath RJ Li Z White SW Rock CO 2001 Inhibition of beta ketoacyl acyl carrier protein synthases by thiolactomycin and cerulenin Structure and mechanism J Biol Chem 276 9 6551 6559 Musayev F Sachdeva S Scarsdale JN Reynolds KA Wright HT 2005 Crystal structure of a substrate complex of Mycobacterium tuberculosis beta ketoacyl acyl carrier protein synthase III FabH with lauroyl coenzyme A J Mol Biol 346 5 1313 1321 Scarsdale JN Kazanina G He X Reynolds KA Wright HT 2001 Crystal structure of the Mycobacterium tuberculosis beta ketoacyl acyl carrier protein synthase III J Biol Chem 276 23 20516 20522 Wang J Kodali S Lee SH Galgoci A Painter R Dorso K Racine F Motyl M Hernandez L Tinney E Colletti SL Herath K Cummings R Salazar O Gonzalez I Basilio A Vicente F Genilloud O Pelaez F Jayasuriya H Young K Cully DF Sing
65. n propionyl CoA methylmalonyl CoA 2 methyl 3 oxo pentanoyl CoA O o o o o p a A O EN PELOSA S CoA butyryl CoA malonyl CoA 3 oxo hexanoyl CoA 2 4 4 NphT7 00000 DU UI UU UD UUUUDUUU 000000000000 0 00 O B ketoacyl CoA 00 00 O HD D UL D FU D p ketoacyl CoA I 00 B D 00 E D DLE EE ELO EE 000000000000 7 upgguugdzutuzisliluiuupuiututiubitutilbili umol min moll 2 4 2 ITU UL HB I 58 Thiolactomycin cerulenin UUU UO UU Cerulenin Thiolactomycin II jJ H ED H EH HB BH HE EH U LU KAS B ketoacyl ACP synthase O U U E Cerulenin DAS E E EH E EB DJ EE ET E Cys acyl L O UD 000000 OKAS 19000 0 OU 0 OCIKAS TU KASI 00 O U ULDOUEUULBULDLD OT UO UO acyl AcP O D D Cerulenn O E O E C 0000000 00K4s HIH TY O A Hd acyl DU LU 00000000000 00000 UDKAS MO KAS 10 UO KAS 4000 0000 0 0 000800 DUDU OOO UO UO EIE U Uthiolactomycin malonyl ACP malonyl JJ J E E O DO BB DOO UU KASI KAS I His His KAS II His Asn E B B E E E DOD KASOOO000000000 2 500 NphT7 KAS HIT U H UU Uacetyl CoA 1E E U U DO UL E Ucerulenin 000000 thiolactomycin UU UO OU OD DUO D UD OG UO 00000000 00 NphT7 UU UU 000 O HO FQN Nana AO dO e ju m O O ia 4b Qu Cerulenin Thiolactomycin KAS I Il inhibitor KAS II IIl inhibitor N N Hi S Ad Hi i i IS a ISan Hea CY pr N N TP H H H lg Os H Hydrophobic pocket O DE Serro Pos CyS463
66. noid biosynthetic pathway by functional analysis of gene products expressed in Escherichia coli J Bacteriol 172 12 6704 6712 Chang MC Eachus RA Trieu W Ro DK Keasling JD 2007 Engineering Escherichia coli for production of functionalized terpenoids using plant P450s Nat Chem Biol 3 5 274 277 Keasling JD 2008 Synthetic biology for synthetic chemistry ACS Chem Biol 3 1 64 76 Chang MC Keasling JD 2006 Production of isoprenoid pharmaceuticals by engineered microbes Nat Chem Biol 2 12 674 681 Aldor I Keasling JD 2001 Metabolic engineering of poly 3 hydroxybutyrate co 3 hydroxyvalerate composition in recombinant Salmonella enterica serovar typhimurium Biotechnol Bioeng 76 2 108 114 Aldor IS Keasling JD 2003 Process design for microbial plastic factories metabolic engineering of polyhydroxyalkanoates Curr Opin Biotechnol 14 5 475 483 Aldor IS Kim SW Prather KL Keasling JD 2002 Metabolic engineering of a novel propionate independent pathway for the production of poly 3 hydroxybutyrate co 3 hydroxyvalerate in recombinant Salmonella enterica serovar typhimurium Appl Environ Microbiol 68 8 3848 3854 Lee SK Chou H Ham TS Lee TS Keasling JD 2008 Metabolic engineering of microorganisms for biofuels production from bugs to synthetic biology to fuels Curr Opin Biotechnol 19 6 556 563 Mukhopadhyay A Redding AM Rutherford BJ Keasling JD 2008 Importance of systems biology in engineering microbes for biofuel producti
67. on Curr Opin Biotechnol 19 3 228 234 De Rosa M Gambacorta A 1988 The lipids of archaebacteria Prog Lipid Res 27 3 153 175 Murakami M Shibuya K Nakayama T Nishino T Yoshimura T Hemmi H 2007 Geranylgeranyl reductase involved in the biosynthesis of archaeal membrane lipids in the hyperthermophilic archaeon Archaeoglobus fulgidus FEBS J 274 3 805 814 J Sambrook DWR 2001 Molecular Cloning A Laboratory Manual THIRD EDITION T KIESER MB MJ BUTTNER KF CHATER DA HOPWOOD 2000 Practical Streptomyces Genetics 107 UO DABA BDO DO BE IGT UI GU UD OT uti iui UUUULU DO DO BDO 0 OT UO TUO LU Ud Ud DEO DU UO OOO DLE DODO UO O UL UI OOO O CE DIEI DU UU QUO UU BEBE OE H E COE BEBE CE BI LIE HIH udpgduduguuiiuiiiliiiiiiuiliuliuillit iulbiL 6tLL lLit Streptomyces coelicolor A3 2 U KAS TIL U U O U ELE IUL E E pQE fabH BA a B E EEE ELE DEDE uuuuliuitliiuLitulilul LL Ll Co LEDERE RE Wii i a AA E BEE Vo E SA SI AER 00000000 0000000 000000 0000000000000 00000 ulli ADEKA 000000000 000000060 DABA ODO BO DO DD 000000000 108
68. pUciio Hindy 000000000000 YU Linph77U NU BOO D UU SnaBlUUUUUUU O UBgII UI UL UUUUU 00000000 00 0000000 Bet UU UD O UO LU OO O 1000060 U Linph77 QUUU OO OGUO OO UU O UU O UO CDL UO ODO UU Hindit Xbal TU 000000000 O 0 DNA DO UU 00pSE101 0O O 0000 000 0080 0000000000 pSEAnph T7 00 OUOU 3 2 2 pSEAnphT7 00 Streptomyces sp CL190 E E pSEAnphT7 LI O OU CL190 00000 0000 0000000 000000021 O O U UL pp A T7 In frame deletion OUUU U Instagene matrix stratagen 004000000 00000000000 000 ph T6l NOUL I nphT71 CUL 00000 200000 3 1 10 00 Ol nphT6 nphT71 L 0 0 L 2 2kb DNA 00000000000 000 DNAD LL B00 000000 00 0 9 kb UD 1 3 kb DNA UL UL UU D aph70 0 000000 UU ot O ELO UU D E naphterpin 00000 NphT7 YU 10 mL KGU O U 37 E I28 CT ET CE UU EID UO LIE UI OE UI Ul 100 mL KG O 500 mE E UO DU 190 O 00 030 U 028 C O O UO 00 LI control mevalonate kinase UU LL DL npAT7I L LI T kuzuyamal Junpublished result LILI UL BOBO DO DD OB III UJU L LU O uu i UU 00000000010 at TO QUO UOD 0 02 UO UO OO OO O UO CIE O CE Cc co BE ELE 00000000000 002000 0000200000000 000000000 00000000000 000 0 00 020000000000 0000 0 0 00 0 1 100 pL 0000 0000 00005 uL O HPLCT DOO 0 00 CLHPECT 000000 32400 0 00 0 00 0 O O naphterpin O0 0265 nm O O O DUO 00000 UD 000000000000 76 UD UL 000 mg mL in MeOH Unaphterpin UU UO U UO U DO U LT LI U OO O 0000000000000 naphterpinn WU UU O O
69. pin L LU HDD UO UGO OT O UG UL ELO DOE UO UD LU NphT7 LU UU Dnph77 000000 naphterpin 4 O UU O UU UU ODDO O 0 acetoacetyl CoA thiolase OU UTIL UU U UL UL Acetoacety CoA thiolase UUUUUUUUUUUUUUUUU III A coelicolor A3 2 S avermitilis S griseus UL B E DH BJ U U UUUU EL ET EL ET U DU 000 odo OCLI900 0000000 00000000 e ERA AnphT7 AnphT1 amp SE TENA naphterpin E fn Intensity AU e C Retention time min O 3 2 3 HPLCTI I LI DUDU UD 000 naphterpinQ 0 DUDU 26500000000 000000000000 0000 U 00 00 UGO UGO L 79 1 0 on naphterpin wet cell weight mg g wild type Anph T 7 AnphT1 3 2 4 0000 noeh T Tt nphT7 000 naphterpin D 00000 Naphterpin L HL HL HH HH b HH HH H LB O 000000000000 UOC 7B 7E 7E 7E EE EE ID LU O wild typel O O HLAnph TZ nphT7 0 O UAnphTI nphT1 mevalonate kinase O L L JUL 80 DUU HI NphT7 in vivo O O LI acetoacetyl CoA O O U 0000 0 00000 Y 00 O Acetoacetyl CoA O UO U D U D U BU 0000 00000 acetoacetyl CoA thiolase Jin vitro UD EL E E UU UUU thiolysis UUU U 000000000000 00 gud O OKAS MO type N PKS 1 800 0 I U O E ELLE IB ketoacyl ACP U B ketoacyl CoA O EL O ULI E El malonyl ACP UU malonyl CoA acetyl CoA ATP DL UU UU UO D EE ULUI UE 00000 DO Dthiolase gg aga odo ado 00000000 46000 00 O UNphT7 acetoacetyl CoA O O UU thiolase DU O UO D
70. tein 2 alpha hydroxyacid dehydrogenase ABC type multidrug transport system g Co chaperonin GroES transcriptional regulator ArsR family Activator of Hsp90 ATPase homolog 1 like protein DNA helicase Rad3 N U glutamate racemase U FAD FMN dependent dehydrogenase notmmanserese cyclopropane fatty acid synthase carbohydrate ABC tra er substrate bindi otein SCH ng pr ly carbohydrate ABC transporter membrane protein 1 S CUT ES m carbohydrate ABC transporter membrane protein 2 CUT1 EE di acyl CoA synthetase AMP forming AMP acid ligase H leucyl tRNA synthetase a SOS regulatory protein LexA membrane protease subunit stomatin prohibitin transcriptional regulator NrdR ribonucleoside diphosphate reductase adenosylcobalamin dependent NA protease subunit stomatin prohibitin 1 kb ATP dependent protease Cip ATPase subunit C Lea tee ft lylpolyglutamate synthase dihydrofolate synthase nucleoside diphosphate kinase rod shape determining protein MreB rod shape determining protein MreC rod shape determining protein MreD penicillin binding protein 2 shape determining protein RodA GERA Radical SAM superfamily Fe S oxidoreductase gt uncharacterized conserved protein ribonuclease Rne Rng family RNAse G LSU ribosomal protein L21P i ribosomal protein L27P GTP binding protein Obg CgtA Jontamato 5 kinase a predicted metal dependent hydrolase
71. toacetyl CoA o o O HMGS INI HS CoA AA A k PTT gt Ho S CoA acetoacetyl CoA acetyl CoA 3 hydroxy 3 methylglutaryl CoA Ar ie BU o o KASI O o j AA iu AHA HS ACP dcos HO S ACP y d S ACP n acyl ACP n 1 6 malonyl ACP B ketoacyl ACP n 1 6 O O O O oO KAS Ill LL _ HS CoA ar T HO ber STAGE acyl CoA malonyl ACP B ketoacyl ACP KCS O LL n 9 Q t HS CoA AI cor M HO S CoA AA s coa malonyl CoA E y 8 acyl CoA n 8 11 y B ketoacyl CoA n 8 11 HO O HO OH Type Ill PKS CF o 0 CHS 3x S CoA ea O OH 4x HS CoA p cumaroyl CoA malonyl CoA chalcone l DO000 0000000000 0000000000000 pan 000 000000000 000000 OThiolase Jacetoacetyl CoA thiolase HMGS 3 hydroxy 3 methylglutaryl CoA synthase KAS I Il IM B ketoacyl ACP synthase KCS B ketoacyl CoA synthase CHS chalcone synthase HUUUUUUUUUUUUUU Cys MGS DUU Gul LED LI acyl WU et UO O GU UGO DU 0 40 UUe anion 0000000000 00 LU ULUI 0000 His UI Aen DUU DUU malonyl O EI BEI OL ET U LI D DD DD 000 dnce D D D 0000 a anion DU DL B DI 200 0000000 LL EL EE EL E LILI Udi keto E E O E malonyl CoA malonyl ACP UYU LU LU extender substrate LI UL U U UU U acyl CoA OU O L primer substrate U 0 UG 20000000000 aciona 000060 UU UO UO O DO DO DO ODO UO TO UO TU UO IGO UUUUULU UU OU UU 000 0 U 0 OKAS INT type HI PRSE UD OOO UU UO UO GO 00 L 0000 O O O Ag Ges O q C S89 CoA CoA x O w H H maaan H N A N 2 Cys378 7S
72. ys KCS D salina al 100L BAS R palmatum ER PYS G hybrid 9 PhlD P fluorescens Tos Asn eo nx ne IA 100 RppA S griseus e E Polyketides 02 d i sen 2 3 AACS NphT7 Cys His Asn O 000 0000000000000 KAS WD KCSOCHS OOO Cys His Asn 0 000 0000000000000 DHMGS D Glu DO UUUU MU good 000000000000 AACS p00000 00000000 00 DUDU 000 89 00060 UO UOUUUUOUUUUUUUUUU LBUUUU OUUU Bacto tryptone Bacto yeast extract NaCl Bacto A gar TBO L Bacto tryptone Bacto yeast extract Glycerol KH3P04 K HPO JOUUUUUU KG Glucose Soy bean meal Dry yeast O O U CaCO 1 0 0 5 94 0 5 1 5 1 2 2 4 Yo 0 504 0 231 1 254 2 5 1 5 0 2 0 4 HOUUOUUUUUUU PHY 620 UUUUUUUUUUULU 9 SK II soluble starch 2 Yeast extract 0 5 Polypeptone 0 2 Meat extract 0 3 KH3PO4 0 02 MgSO4 H20 0 06 pH 7 6 0U YEME U U L Bacto Yeast Extract Bacto Polypeptone Oxoid Malt Extract Glucose Sucrose R2YE U DO Sucrose K5SO0 MgCb H O Glucose Bacto Casamino Acid Trace Element Solution Bacto Yeast Extract ull 0 3 0 5 0 3 1 0 34 51 5 g 0 125 g 5 06 g 5 0 g 0 05 g I mL 2 5 g ll g 400 mL LL EL LUUU UU EIE EE EE EL UUU 0 5 73 TES Buffer pH7 2 50 mL 3 68 CaCb PH gt 0O O 40 mL 0 5 KHPO UU 5mL OO IUL O ooo L U 20 t Proline 7 5 mL O O 92 Trace element Solution ZnCl FeCl 6H2O CuCl RH20

チオラーゼスーパーファミリーにおけるミッシングリンクの発見と機能解明

Contents

Download Pdf Manuals

Related Search

Related Contents

チオラーゼスーパーファミリーにおける ミッシングリンクの発見と機能解明

Contents

Download Pdf Manuals

Related Search

Related Contents

チオラーゼスーパーファミリーにおけるミッシングリンクの発見と機能解明