pCold™ III DNA
Contents
1. ees v201010Da Woo o ci a PEERS anen TaKaRa R DR2. 1 2844 covalently closed circularforml RFI 70 3 cen lapis Et real ire E or p 1 1 New Jersey 2 Ao E A aa Code 3360 3361 3362 3363 3364 3365 p id 2 QIAGEN His Code 3360 3361 3362 3 el Sacl Kppl X ol BamHI EcoRI Hindili Sall ne OE Pstl Xbal 1 4 RY ay FHA _A FFI EI th CoA pCold III DNA
3. CACAAAGTG SD MetAsn His Lys Val Agel Sacl Xhol BamHI EcoRI Hindill Sall Pstl Xbal CATATG GAGCTC GGTACC CTCGAG GGATCC GAATTC AAGCTT GTCGAC CTGCAG TCTAGA TAGGTAATCTCTGCT His Met Glu Leu GlyThr Leu Glu GlySer Glu Phe LysLeu ValAsp Leu GIn Ser Arg End pCold R Primer TAAAAGCACAGAATCTAAGATCCCTGCCATTTGGCGGGGATTTTTTTATTTGTTTTCAGGAAATAAATAATCGAT 3 transcription terminator v201010Da pCold III DNA Code No 3363 Shipping at 20 C Size 25 u g 0 50D Storeat 20 C 2 Lot No Concentration Volume pCold III DNA Vector map of pCold I DNA cspA 3 UTR multiple cloning site TEE cspA 5 UTR lac operator cspA promoter pCold cs A cspA 5 5 UTR translation enhancing element TE
4. Cold Shock expression vector pCold III DNA Code No 3363 Shipping at 20 C Size 25 u g 0 50D Store at 20 C 2 years from date of receipt under proper storage conditions Applications This is a vector for protein expression utilizing the promoter of cold shock gene cspA Lot No g Vector map See the reverse side Concentration z H g H 1 PRODUCTS are for research or laboratory use only PURCHASER understands and V agrees that PRODUCTS shall not be administered to humans or animals and shall olume Hu not be used for pharmaceutical in vitro diagnostic or any commercial purposes other than internal research 2 PURCHASER shall not modify pCold Vector DNA sequences located between and including the CspA 3 UTR and CspA Promoter The adjacent multicloning site MCS is exempt from this restriction Regarding protocol please refer to the product man 3 PURCHASER shall not utilize any partial sequences from PRODUCTS for the purpose i gt of new plasmid construction using the Cold Shock Expression System ual supplied with this vector 4 PURCHASER shall not transfer or sell copies of PRODUCTS components of PRODUCTS derivatives of PRODUCTS and or products obtained through the use of PRODUCTS collectively DERIVATIVES to any third parties Notwithstanding oredoing PURCHASER may transfer DERIVATIVES solely to a third party which has already been granted a license to use PRODUCTS for research p
5. E His Factor Xa multi cloning site lac operator pCold TEE His Factor Xa pCold IIV 4 pCold ill TEE pCold pCold Ill DNA 4 377 bp ColE1 O 10mM Tris HCl pH8 0 1mM EDTA _ 1 NewJersey QIAGEN ONE 4377b 7 p 2 Oxi
6. ld vectors whose arrangements vary in the covered by the claims of U S Patent No 6 479 260 6 897 042 and their foreign existence of TEE His Tag sequence and Factor Xa cleavage site counterpart patent claims pCold III contains TEE only M9 pCold vectors P This product is covered by the claims of U S Patent No 6 479 260 and its foreign Form 10mM Tris HCl pH8 0 counterpart patent claims 1mM EDTA Chain length 4 377 bp Note gt 2 This product is for research use only It is not intended for use in PE therapeutic or diagnostic procedures for humans or animals Also do Purity hi d food gt ii holdi 1 Contains over 70 double stranded covalently closed circular DNA RF I not use this product as tood cosmetic or household item etc i aan KA 8 4 Takara products may not be resold or transferred modified for resale 2 Confirmed to maintain cloning sites by dideoxy sequencing method or transfer or used to manufacture commercial products without 3 Shown to be cleaved at a single site by restriction enzymes Nael Sac written approval from TAKARA BIO INC Kpn Xho BamH EcoR Hind III Sall Pst land Xba If you require licenses for other use please contact us by phone at 81 77 543 7247 or from our website at www takara bio com Cloning site of pCold III DNA Produced by TAKARA BIOTECHNOLOGY DALIAN CO LTD pCold F Primer TEE gt 5 AAAATCTGTAAAGCACGCCATATCGCCGAAAGGCACACTTAATTATTAAGAGGTAATACACCATGAAT
7. urpose through purchase of PRODUCTS from TAKARA BIO its subsidiaries or its local distributors aa provided that PURCHASER shall enter into a prior separate agreement with TAKARA Description BIO for the transfer of DERIVATIVES to said third party Cold shock expression vectors pCold DNA are designed to perform efficient protein expression utilizing a promoter derived from cspA Protein Purification Technology of His Tag used in some of pCold vectors is licensed from Hoffmann La Roche Inc Nutley NJ and or Hoffmann La Roche Ltd Basel gene which is one of the cold shock genes At the downstream of the Switzerland and is provided only for the use in resaerch Information about licenses cspA promoter acoperator is inserted so that the expression is strictly for commercial use is available from QIAGEN GmbH Qiagen Strasse 1 D 40724 Hilden controlled In addition 5 untranslated region 5 UTR translation Germany enhancing element TEE His Tag sequence Facter Xa cleavage site NOTICE TO PURCHASER LIMITED LICENSE and multicloning site MCS are located at the downstream of the cspA promoter As this product utilizes the promoter derived from coli most E coli strains can be utilized as an expression host L13a pCold vectors This product is covered by the claims of U S Patent No 5 981 280 6 686 174 and their foreign counterpart patent claims assigned to the UMDNJ This product is There are four kinds of pCo
Download Pdf Manuals
Related Search