Home
Get pureRNA Kit
Contents
1. Oo pg Dg O ga ao 00 000000000000 http www dojindo co jp manual gk04 html Get pureRNA Kit 50 samples 0000 mm P2 00000 Mn P2 pag 00000000000 i P2 00001 Mn P2 000 nm P2 OO 1x10 D 3x10 cells nn P2 OO 3x10 D 1x10 cells nn P3 OO 1x10 D 1x10 cells Month P3 D DU 250 30 mg mm P4 OO 19 mm PS OO 200p m P6 OO ml Min P6 DUUUUUDUUUDUDUU IITITIIIITITITIIIIIH P7 goooD000000 mm P8 00000 m Ps 0000 mn P8 DOJINDO MOLECULAR TECHNOLOGIES INC 0000 Get pureRNA Kit 00 D 0 0000 00 O 30 L3 ci ci Ci Ci 00000000000 00000 RNAAgo0 0000000000000 000000000000 0000 0 000000000 UD DUU U OO0000000001491901000000000000 00 DO 0 RNAQ RT PCRODO 0 000000 D DeDNA po000000000 00000 50 sample kit 0 0 0 0 0 Lysis buffer 13 mlx2 Precipitation solution 13 mix1 Precipitation solution Il 8 mlxi DNase 0 55 ml x 1 DNase dilution buffer 12 mix1 ESA SII ET HORE ARD EL UR LEUR ER EATUR L3 L3 ci Ci Ci Ci Ci Ci Ci Ci B Mercaptoethanol 100 ethanol 70 ethanol DEPC treated water PBSOOOU000 RNase free I 1 pog000000 po0000000 Een Bru Total RNA uat OO RNase 000 Od U Bou O0 RNase fee ID O O Dodo 0000000 Lysis buffer 70 0000 OOOO000d00 ipitation solution ORNAD E FI UI C D ipitation solution o O 0 O O O O 0 qi L3 L3 L3 r3 C3 L3 Q o CI Q 0000000 od au
2. 5H B vortex og 13000 xx 00 20000000000000000 0000 RNase free DEPC treated water O O O RNase free buffer 000000000000 1g 0000001 00000000 000 51000000000 lysis Buffer 20 mi P Mercaptoethanol ID E 100 u IQODDO Oooo 30 60 000000000 DO UL CUL LU DU UBL U U U UL UL I UE UU UU U UI UU UU LU ULL LU Z4 U UU LUttututctttu Precipitation solution 4ml 50 DO vortex O O Precipitation solution TO 7 7 LJ DDR Ll I UJ U LU U LU LU 1t0000xgp00050000000000000000 po0000000 U LUUD UU O UU UU U C IL UL UU U I UC I UU V UUUUUUUUUBUUUUUUUUU UU UU UU UU UC ugagugagagaugaugaagagauauaiuu us OO vortex 0 10000 x000 20000000000000000 0000 DIO U UU UL U U U AO URNA UE E U V U UI U U ULULU DUOC UD OOOO OOOO 00000 0000 070 UUUUUUOUUUUDUUUUUUUUCUUUEU 204 DO O 1000000000 70 0 0000 22m1000 0500 vortexO D 10000 xg 00 20000000000000000 0000 0000000020000 DNase working I O0 D O O ooo 7 7 DNase 0 4 ml DNase dilution buffer 7 6 ml DNase working 11 8 ml 800000000000 00000000 Ut gg t UU UUUUUUUUUUUUU UU UU UU UU UU U U UL U UU 37 C ISO OOO000000000g Precipitation solution 2 ml 600 vortex9 O O Precipitation solution 1 7 770 7000000000000 Precipitation solution I 2mlQ 0 60 O vortex O O Precipitation solution UO 770000000000 LU LU f LU 10000 xg 0 00 50000000000000000 00000000 UU UUUUUUUUUUUUUUUUUNUUUU UU UU UU LU U D ILU UU OL UU U IU UU C IL UU UT ugaggaga
3. U UU U U E ILU U U U UI 98 VO 0 UU UU 0040 70 0 0000 10m000 0500 vortexO D O 10000 x000 20000000000000000 0000 RNase free DEPC treated water O O O RNase free buffer L 0000000000 001110101111 Sample E p Cell Tissue Blood materials zarten le scal 1g 200p sample scale lO on O eee Lysis buffer 250 ul 500 ul 5 ml 500 ul 20 ml 300 ul 7 5 mi B Mercapto 2 5 u1 su sou sul Lama sul 1125 ul ethanol Precipitation Soin lor Il 50ul 100 ul 1 ml 100ul Amt 100 ul 2 5 ml Step2 or 3 DNase working 200 ul 200ul 2ml 200ul 8ml 200ul 4ml solution Precipitation soln cour sour 500ul soul 2ml soul 1 ml Step12 13 or14 DUDUDDUDUDDUUDUDDUUDUDUODUDUD UDUODUUDUODUU 0000000000000 O00000 1 RNADOO00000000000000O00 00000000000 vortex mxo 00000000 0 Total DAT DEE EL 0 poa00000 uuu D00000000PRNA0000000000000 Sample nal p4000000000000000 HeLa 1x 10 cells 90 150 2 0 2 2 7 gt 0000999 yssen 01926 emit em mm ana 0000000000000 000000000000 E fO00000000000000000000000 Mouse brain 30 mg 15 25 2 0 2 2 DUUUUOUUUDUUUDUDUUDDUDUDUDUDUDUUDU Mouse kidney 30 mg 40 55 2 0 2 2 uggaaggggagaguuguaudul Lysis buffer Mouse heart 30 mg 7 15 2 0 2 2 DOda gd gon on 000 0 0 0000000000000 Mouse liver 1 0 g 3800 4400 2 0 2 2 am Soe Zu Mouse brai
4. 5 100000 UDUUDDUUDUDUDDU 30 60 000000000 00 UU LUUUU BUUUUUUU UU U UU UC U UU Ug UUUUUUUUUUUULUt Precipitation solution 1004 II 0 0 500 vortex DD Precipitation solution 1 7 7 LJ L L1 LU U LU LU U LU U I LU 13000x9000050000000000000000 po0000000 UUUUUUUBUBUUUUUUUUUUUUUUt tut Utgggtg UU UU UUUUUUUUUUUUUUUUUUU ugagugaugagaugadgaagaagauauaiuu us O O vortex 0 0 13000 xg 0 00 20000000000000000 0000 IO000 OOOO ODO U 00 ERNA E UU LU UI U U UU LUUDUUU ZBUUUUUUUCUUUUU UC UU I UU IO ODO OOOO UU UUCUUUU 204 VO O 1000000000 70200000 1m0000500 vortexO O 13000 xx 00 20000000000000000 0000 000000020000 DNese D DD Duct DNase 104 I DNase dilution buffer 1904 DNase working 2004 10 88000000000 po0000000 UUUUUUUUUUUUUUUUUUUUUU UC 1000000000000 37 C SO 0000000000000 Precipitation solution 504 II O Y 500 vortex Dn Precipitation solution IV 7 LI Ul U U LU U U LU LI Precipitation solution II 504 IO 0 O 50 0 vortex Dn Precipitation solution II 7 7 PT LJ LI LU E LU LU LU LU U I LU 4 00 13000 x0 00 50000000000000000 po00000 100000 UUUOUOUUUUUUOUUU UU UUUUUU UU UU LUU UU UU U UU U UU U U UU UU U U UE UT ugagugaugagugaugagaagagagauaiuu us O O vortex DO 13000 xx 00 20000000000000000 0000 UULUUUUULDUUUUULUULDUNAUUUUULULL UU gOUUUUUUUUUUUUUUUUUUUUUUU ULUUU LU UD U UU U UU U U IE IL UU U U UI 908 VO C UU UU UU UU C 70920000 1 mtd B
5. I 204 DO C UU UU UU UU 13000 xg 0 00 20000000000000000 0000000 00000000200 0 U DNase working 1000 ooo DNase 104 1 DNase dilution buffer 1904 DNase working Y 2004 19 99000000000 00000000 DO0DO0 OOOO OOO OOOO OOOO U U VEU U UU UU I000000000000 37 9 1500000000000000 Precipitation solution 504 10 00 50 D vortex O O Precipitation solution 1 7 7 7 0700000000000 Precipitation solution II 50u IO O O 500 vortex O O Precipitation solution UO 7 LJ I IJ Ll LU U LU LU LU L1 LU 13000 xx 00 50000000000000000 poo00000 UU gU UUUUUOUUUUUUUUU UU UUUUUU UUUUUU O UUUDUU UU UU U UU U U V UU UL U U UE C ugagugagaugaugagaagagagauaiu us O O vortex I DO 100000000000 RNA IL UU glycogen 20 mg ml ZU VTITUL UU U UI O DNA 0000000000 1000000 17 13000 xgU 00 20000000000000000 0000 ULL LDUOUBGS CUL UU LU U U U URNA E UU LU UI U U UULUUUUUUUIUIUUUUUUUUUUUULULU UL UU UU U UU U U UC UL U U U E UU UI EG 908 N0 0 1000000000 18 70 0000 imliQOU00 500 vortexO O O 19 13000 xgU 00 20000000000000000 0000 20 RNase free DEPC treated water O RNase free buffer O0 0000000000 DO 5ml 000000200000000 1 UUUDU mulli 5m0000000000 Lysis Buffer 7 5 mi B Mercaptoethanol 0 0 OD 125 u 10 po0g00 000000000000 00000000 po0d0000000000 2300000 2 Precipitation solution 2 5 ml DO 500 vortex DD Precipitation solution IT 1 00000000 3 Precipitation solution II 2 5 ml 70 50
6. OUOUUUUUUUUUUUOUUUUU UU UU UU O UU UU U UU UU U U U UU UL UL U U UU ugagugagagugaugadgaagagagauaiuis O O vortex DO 10000 xg 0 00 20000000000000000 0000 UULUUUUDUUBUUUUULUULUNAUUUUULULC Utt gU UUUUO UU UUUUUUUUDUUUUUUU ULUUU UU LU U CU U U IU UU U U OEE U lt 20 wii ff UU UU 0040 70 0 0000 1209m0 000500 vortexO D O 10000 xg 0 00 20000000000000000 0000 0000000020000 DNase 10010000 DNase 1004 DNase dilution buffer 1 9 ml DNase working 2 mif 800000000000 po000000 0000 0000000000000 00000000000 0000000000000 seqi1s0 0000000000000 Precipitation solution 5004 IOD DD 500 vortext O O Precipitation solution IT 770 LJ LI I LI U LU LU U LI LU Precipitation solution Il UU Precipitation solution UO 7 LJ LI Ll LU U LU LU LU I LU 500u IDODO 500 vortex 10000 x000 50000000000000000 0000000 Ut gU UUUUUOUUUUUUOUUUUUOUUUUUU DOI OOOO OOOO UU UU UU UU UU U U UU ugagugagagugaugadgaagagagauaiuuis O O vortex O 10000 x000 20000000000000000 0000 UULUUUULUUBUUUUULUULUNALUUUUUULC UU UOUUUUUUOUUUUUUUUUUUUUUUUUU ULUU UL UU UU U UU U U I IL UU U UU 98 VO 0 UU UU UU U UL C 70 0 0000 10ml 0500 vortexO D O 10000 x000 20000000000000000 0000 19 RNase free DEPC treated water RNase free buffer O0 0000000000 0000 GUDUDLDL 04280000 0000000000000 0000000 OO 25 30 mg 00000050 00000000 000 15m000000000 Lysis buffer 500p I0 P Mercaptoethanol 00 4
7. U UU UU U 0040 709200000 mi OD Hd 500 vortex LU 13000 xg 0 00 20000000000000000 0000 10 0000000020000 DNase working I O D O O ooo DNase 104 I DNase dilution buffer 1904 DNase working 2004 I0 90000000000 00000000 OO U D UU U UI UU D UL CO COCU CMCBLUL LL UU seqi1s00000000000000 Precipitation solution 504 II 00 500 vortex O O 7 Precipitation solution IV 7 000000000000 Precipitation solution II 504 IO O O 50 0 vortex Dn Precipitation solution II 7 7 PT RD LI LUI EU U U LU LU U LU 13000 xg 0 00 50000000000000000 po00000 UUUUUUUUBUUUUUUUUUUUU tii Utgggt UU UU UUUUUUUUUUUUUUUUUUU u ugagugagagugagugaggaagagauauaiuu us O O vortex DO 13000 xg 00 20000000000000000 0000 IO000 OOOO ODO OOOO LRNA E UL LUC UI U U UU LUDUUUBUUUIUUUUUUUUUUUULULUU UU LUUD UU LU LUU UU UU U U U IE UL U UI EG 90 N0 0 UUUUOUUUUUU 70200000 1m0000500 vorext O 13000 x000 20000000000000000 0000 RNase free DEPC treated water O0 O O RNase free buffer O0 0000000000 OO 1x10 1 x 10 cells OOOOO0Sso00000000 somijyuuauugau aguaudgddddddeddudddu u upngaggaunauggung PBSS5mmm i nBdud 200xg 5000000000 0000000 0 Lysis buffer 5 ml B Mercaptoethanol QO 50 u IOOD0OD0ODDDO DoOpo0o0000000000000000 0000 000 2300000 Precipitation solution 1 ml L1 ISO O vortex 0 0 Precipitation solution IO 7 000000000000 10000 x90 00 00000000000000000 po0000000 1000011 UU U
8. gaugagaagagauauaiuu us O O vortex O 10000 xg 0 00 20000000000000000 0000 ULULULUUUOCUBLCLU 000000 URNA UO IL LUC UI U U UU LUUDUU BDUUUUUCUUUUUUUUUULLUU UL LULDLUU U LU UU CU U UU U U U I UC U UI EG 90 00 4000000004 70 0000 22m00 00500 vortexO O O 10000 xg 0 00 20000000000000000 0000 RNase free DEPC treated water 0 RNase free buffer O0 0000000000 00001 O00000 DOD00000000000 0000000000000 DO 2004 00000050 00000000 HOODOO 200410 15m 00000000000 Lysis Buffer 3004 IDB Mercaptoethanol 000 0 5pu BOB a gg gg 00 0 0000000000000 pad 00000000000 2300000 Precipitation solution 1004 I 00 500 vortex Dn 7 Precipitation solution 7 7 LU 1 U LU I Precipitation solution II 100410000500 vortex ooo Precipitation solution UO 7 LJ OI Ll U LU LU LU LI LU 13000 x 00 58000000000000000 po0000000 ULL UU OOOO UU U UU U UU U UU U UL Precipitation solution 100 u II DI 500 vortexG DD Precipitation solution 1 7 OO LJ I LU LJ U LU LU U LI LU 13000 x 00 5S0000000000000000 po0000000 Ug OOOO OOOO UOUUUUUOUUUUUU UUUUUU S UU UU U IU U UU U U V UC UU U UE UU uua 0000000000005 O O vortex DO U UU UU UU RNA EU TO HO E glycogen20 mg ml 7 2H ID I1 LU U LU LU LUI RNA UI FU UU U U U LU U LU U 0000000 13000 xg 00 20000000000000000 000pr0 0000001m00 500 vorext D D UU 00000000000 DNA UO 07070 00 1000010 OOOO DO OOOO ULUOUUL UU UU U UU U U IE UL UU U U U
9. n 1 0 g 700 1000 2 0 2 2 3 tS Ue d Mouse blood 5 ml 70 120 2 0 2 2 TT 00000 Precipitation solution ID DUU 20 Asso Az 00 H 00 H RNAD TE buffer 10 mM Tris 1 mM RE i EDTA pH8 0 0 0000000000 DEPC treated water Precipitat lution I T a H Cd Lesen g aa GG 0 o TI pppnnnAsAeQ ODODDDDDOUDDOODUD 10000 xg OD0000000000000000000 uggaggggaaugaudagudeasttll 4 DO RNA UU LU LU uaggagaggaugguudgudattdbattlt D0d0g0 0d 00 0000000 00000000000 DOdg gon og og Dg 0 gd 0 0000000000 lt 20 A DM000000 00000 5 DO RNAT I U d 0000000 00000000 000000 0000008000000 0000000000000 00000000 RNase freeQ 00000000000 lt 000 gt D Dojindo Molecular Technologies Inc 211 Perry Parkway Suite 5 Gaithersburg MD 20877 Telephone 1 301 987 2667 Fax 1 301 987 2687 URL http www dojindo com 0000 gt poo0d0000000 Tel 096 286 1515 0 Fax 096 286 1525 LE 0000 E 000 UD Tel 03 3578 9651 0 DI Fax 03 3578 9650
10. n o0 oooO Q o o0 sand m er O 5 o P og CS DL gt oo 2 one oO x o ed L3 L3 L3 C3 L3 L3 C3 TO U C3 C3 C3 C3 C3 C3 C3 L3 L3 L3 E3 C3 C3 F3 0 O 0 0 0 O 0 0 0 0 0 0 ETET ES SEMI U 0 O 0 O 0 5 C 000 000 DNaseeQVOOOOOU0000U BH LO 28 BUS DE DAL B TBI Dugpapuapupnuanupgugnaupnpnanmnadnp OU 00000050 00 1 x 10 3 x 10 cells HOoOUdd 15mg 0000 00000000 504100000 pad 0000000000000 00000000 RNase free PBS o 2000 5 D B U B U C D D U 0000000 Mercaptoethanol po0000000 00 2300000 Lysis buffer 250 u IQ B 2541000000000 0000000000000 Precipitation solution 50410 O00 500 vortex Precipitation solution IV 7 LI Ul U U LU U U LU LI 13000x9000050000000000000000 po0000000 100000 UU UU UOUUUUUUUUUUUUUUU UU UU UUUUUUUUUUUUUUUUUUUUUUUU ugagugagagagugagaagagauauaiu us O O vortex DO 13000 x000 20000000000000000 0000 IDO000 OOOO ODO DO OO PANA UL I UO UI U U UU LUDUU ZGBC UUIUUUUUUIUUUUULULU UL LUUD UU LULUUUCUUDUULULULUUEL OU lt 204 00 1000000000 70200000 1m0000500 vorext O 13000 xx 00 20000000000000000 0000 0000000020000 DNase working 0 0000 ooo DNase 104 I DNase dilution buffer 1904 DNase working 2004 10 90000000000 ugaault Ugmtuggg UO UUHUUUUDUHUUUUUUUU UU UE 0000000000070 87 C 150 0000000000000 P
11. recipitation solution 504 II 00 500 vortex Dn Precipitation solution IO 7 LI Ul U U LU LU U LU LI Precipitation solution II 504 IO O O 50 0 vortex O O Precipitation solution UO 7 7 BR BT Ul LU LU U LU LU LU LU 13000 xg 0 00 58000000000000000 2 O000000 U LUUD UU OOOO OOOO OOOO U IU I UU V UUUUUUU UUBUUUUUUUUU UU UU UU UU UC ugaguagagaugadgaagagauauau is O O vortex DO 13000 xx 00 20000000000000000 0000 U LUUD UU U U UU UL U U U AO URNA UO U UC U UI U U UU LUUUUC O UB OOOO OOOO 00000 0000 070 UU LUUD LUUD UUUULUOUUUCULULDUULLL edu unit 1000000000 70920000 1mM0000500 vortexO O 13000 xx 00 20000000000000000 0000 RNase free DEPC treated water O O O RNase free buffer O0 0000000000 DO 3x 10 1x 10 cells OOOOO0S5000000000 SmMiQ000000000000000000000 OOOOO00000 0000000 PBS500 u IO D 000010 2001000000000 000000 0 O Lysis buffer 500 u ID P Mercaptoethanol 0 1 u 10000000000 0080000000000 00000000000 O 2 30 0000 Precipitation solution 1004 IO O0 0 500 vortex DD Precipitation solution IT 7 7 J UJ LJ LU U I LU 13000xg000050000000000000000 po0000000 UU UU U UU UU D ILU UU U LLL UU U C UU OO UU tU UUUUUUUUUUUUUUUUUUUUUU ugagugagagaugagagagauauaiuuis O O vortex 010 13000 xg 0 00 20000000000000000 0000 UULUUUULDUUBUOUUUULUULUNAUUUUULULDC Ut gU UU UUUUO UU UUUUUUUUUUUUUUU ULUOUU LU UU UU U ILU U U CE ILU U U UU 98 VO 0 U
12. vortex UU Precipitation solution II 7 OO0O00O000O0000000U0 4 10000 xg3p 01 50000000000000000 po0000000 UILU UU UL IC LU UU U IU U IU U IU U UE U 5 Precipitation solution 2 5 ml DU 500 vortex O 0 Precipitation solution IV 7 I LI LJ U U LU U U LU LI 6 10000 x000 50000000000000000 po0000000 UUUUUUUUUUUUUUUUUUUUUUUUgUUt UtgggttgU UU UUUUUUUUUUUUUUDUUUUU 7 B uguguggggagagagagaguguuududls O O vortex DO 8 10000 xa 1 IL 2 00 00007040 ooo LU UL UL UU U U U OOOO DO URNA 7 U E UU U UU U LU U DOI OOOO OOO OO OOOO U U UE UL UE U 000 UU LU UL LOL UL U EL CIL UL UE UE UL 7L UL UI UT UU 9098 DU O 6 oo oo oo oo oo 1000000000 10000 x000 20000000000000000 000000 00000000200 0 U DNase working I Y D O O poo U 7 DNase 2004 DNase dilution buffer 3 8 ml DNase working 4 ml 900000000000 po000000 Ut g UU UUUUOUUUUUOUOUUUUUOUUUUUU UU UU LU L U C UU UU LU 37 C SOOOU0O000d0000g Precipitation solution 1mlQ O O 500 vortex O O O J Precipitation solution TO NO 000000000070 Precipitation solution II 1 ml 00 500 vortex 00 Precipitation solution UO 7 LJ I LJ Ll LU U LU LU LU FL LU 10000 x000 50000000000000000 po00000 UU gOUUUUUUOUUUUUDUUUU UU UUUUU UU UU UU O UUDUUU UU UU U UU U U UU UU U UU ugagugagagaugagagagauauau is O O vortex DO 10000 x000 20000000000000000 0000 UULUUUUUUBUUUUULUUUNAUUUUUULULDL UU UU UUOUUUUUUUUUUUUUUUUU UU UU LU DU UU
Download Pdf Manuals
Related Search
Related Contents
CR-2 AF カタログ APC 5KVA PDU w/ 480 PRI 208/120 SEC K13 Rated XMER Les matériaux de l`architecture et du paysage 全ページ一括表示(PDFファイル:9209KB) Helios IP - 2N Telekomunikace [Drucken] klicken. - Firmware Center DMT FSKF Instructions / Assembly VEYRON 2400 26422 - INST.FED. DE EDUC., CIENC. E TEC Copyright © All rights reserved.
Failed to retrieve file