特 許 公 報 特許第5758889号
Contents
1. ii 9578 UDDUUDDDUUDDDUADDUUDDDUDDDU D000 000000000000000000000 0000000000000 10 00 0 300 0000 000000 5000 0 0 0 1007 00000000000 D uud s50 00000 60 0 0000 80 0 0 0 0009o0000000000000000000 10 i2. DN 0000000000000000000000 0000000000000000000000000 30 DNIO000000000000000000000 00
3. DJorgensen Trends Biotechnol 8 1 0000000 2 340 344 1990 Flavell Proc Natl Acad Sci USA 91 3490 3496 1994 Finnegan et al Bio Technol ogy 12 883 888 1994 Neuhuber et al M ol Gen Genet 244 230 241 1994 Flavell et al 1994 Proc Natl Acad Sci USA 91 3490 3496 Jorgensen et al 1996 Plant Ml Biol 31 957 973 J ohansen and Carri ngton 2001 Plant Physi ol 126 930 938 Broin et al 2002 Plant Cell 14 1417 1432 Stoutjesdijk et al 2002 Plant Physio 17 33 129 1723 1731 Yu et al 2003 Phytochenistry 63 753 763 0 0 0 0 5 034 323 5 283 18 40 O 5 942 6570 00000 D00000000000000000 Rthsten et al in Plant MI Cell Bol 6 221 246 1989 Liu et al 2002 Plant Physio
4. ii e 0960 a nagunmuagagaaundn esent 0500000000000000050000100000 0000000000000000000000130 D005000000000000000130000 oY D 607 D 1 50960 00000 4596 D 9096 WO OMOOOOOU 00000023000000000000013 10 60 00 00000
5. Hoggins amp Sharp 1989 CABI CES 151 153 00000 D0000000000000000000000 300000000000000 00000 D0000000000000000000000 a 0000002000000000000000000
6. DUDU 00000 00000 50080 045 0000000000000000000 00000 277 28 50 OOO Puchta et al 1994 Experientia Swoboda et al 1994 EMXJ 13 484 489 df 4 ringa et al 1993 Proc Natl Acad Sci USA 90 o9 0000300000000095 000000 Kenpin et al 1997 Nature 389 802 8 000000000000000000000000 7350 7346 Terada et al 2002 Efficient gene targ 0000000000000000 0 40 00000 0 03 0 eting by honol ogous reconbi nation in rice Nature 10 000000000000000 0000003200 otechnol ogy 20 10 1030 10340 OOO Us00000000000000320000 917 0 0000 60 00000 045 0 D0
7. 000000000000000 0000 0 000000000000000000000 000 D0000000000000000U00UUU00 00000000000000000 0000000 D0000000 0000000000 000000 000000000000000000000 000 OOOO RI0000000000000000000000 D0000000000000000U00UUU00 0000000000000000000 00000 000000000000000000000 20
8. 13 JP 5758889 B2 2015 8 5 00000010 0000000000 HOO 0402 gt 200000 000000 3 E oe Se See et ELE SS ooo ELE E 10 El L3 L3 L3 re Eoi e Ecce Ee E 0 um gU I Ei ET 3 HG N I gt El L3 C3 C3 OO OOO C3 OOO OOo OOOO OOOO OOOO ET EL ELE EL EI ELE 0 000 00000 H E HHH C C SUD O O E EI co E E 9 8
9. D0000000000000 00000000000 000000000000000000000000 0000000000000000000000000 3 Us00000000000000320000310o 00 8 00000 5078 00000 45 D o i 9596 d 49 axi 50
10. 9576 41 D00000000000000000000000 u ttl 09900 0000000000000000000000001 2 D02000000000000000000000 9576 5 D00000000000000000000000 x00000 i 9596 9576 D00000000000000000000000 D0000000000000000000000 00 090 DUDU 0
11. OP lt 0 01 0000000 0 000000000000000 00000000 a 000000002D0000000000000000c lt D000000000000 00000000000 KIOO0D00000000000000 n 15 000 D0000000000000 000000 0000 D000054 N00 100 000000000000 01 0 gt 5 5 6 5 gt u uuu O O1 ckx3 O0 0 0 0 D0000000000000ckx3 ckx5g000000 00000 2 e a QOOOO0000000 u uuu 100m0000000000000 OOO cea 9 uuu 3 000000 u G G BI KAT T OM TD 0 0 0 S Salk Tg UD Torrey esa TOMO t OO 00 212 000000000 D U D ckx2 SICSALK 068
12. P 0000000000000000000000 OO 50 0000000000000000000000000 12 JP 5758889 B2 2015 8 5 23 24 0000000000000 MNWNI000000000 00 0000000000000000000000 ISO0 000000000000000000001s
13. i 9596 coooa ii 95 1T 10 0000000 20 0008001000000000000000000 DUO0000000000000000 DUOO0000000000000000000U0000 00000000000000000000 0000 30 40 0000000 Wwk D WS amp Mk M C 200
14. D00000000PRIO00000000 0 D0000 ckx4 any and D00000000000000000000 0000 2200 8 16 Benfey 19 0000000000000000000 D Ze Ai oskop 2 p ust 10 24 C 0 iow A O O 65 0 0O O Percival AR66 0 0 00000000 DOO00000000000 iss Jena CX RW O Verwoerd et al Verwoerd et al 1989 OO00 0 cea ckx5 00 00000 Schneitz er al RNase 0O 0 0 Des 1995 WI type ovul e devel opnent in Arabi dopsi s el Fernentas St Leon Rot Gernany 0 37 C thaliana a light mcroscope study of cl eared who 250M EDA le nountti ssue Plant J 7 3 743 000000 0 0000000 O30 hRNXO9 5 p OU REPO 00 Oooo eecagi n
15. 21 250 090 uuu D00000000000000000000001300 D000000 000 000 RNJO000000RW D0500000000000000130000 1000 O00000000000000000000 00 D00000 0000000000000130 140 0000000 0000000000000000 00 60 00000 50 00000 45960 DRNAUOOOOOOOOOOOOOOOOOO0D D0000000000000000000000 00 D0000000000000RNIO000000 50 0000000000000000000000000 Z L3 L3 L3 N OO a N EL EL EI C3 C3 C3 CJ DJ a EIE Et ES
16. 5 i i 0000000000000000000000 00 400000000 000010000000000 0000000000000000000000 00 000000000000000 SI90000000 U0000 U0000 OO 00 ii ii 10 D0D00040000000000 959g i 00 4000000000 9578 0 0 UO O00 D0000000000000000000000 00 D0000000000000000000000 00 000000000000000 00000000 000000000000000 5 1 2 JP 5758889 B2 2015 8 5 i 00000000000000 400000000 0000000000000000 00
17. 0000000000000040 g 100 0000 d 000010000000000 9 A00000 004000000000000400000459 000000000000 10000 3000 00000 00000 s50 5000 10000 0000000000 0 0 80 0 0000 60 000000000000000 000000000 0000000000000 101 0 4400 OO0 50 00000 60 00000 80 0000 9000 10 e 00000000000000 9400000 i 00000000000000 400000000 000000000000 140000 3000 00000 5000 111 0000000000 000000000000 7000 0 300000000 00000000000000000000000011 0000000000000530000000000 0000000000000 14000000 4 00 000000000000000000000000 OO0 50 00000 60 0000 80 0000 0000000000070000 8400000 DOWm00000000000000000000 50 0 0 D 0O 60 0 0 D 0 80 D 0000 0 90 000
18. 1000 60 0 0000 50 00000 0000048 10 80 OO0 s50 00000 60 000008 0000000000000000000000 00 00000 00000000000000 OOO00 M4 0000 000000000000000 00000 b 000000000000000000000000 000000000000000009 I00000 000000000000000000000200 000000 9598 6 Us0000000000000020000 100 0 0 00000000000000000000 0000000000000000000000000 20 0000000000000 oooAOOOOOOOOOOOOALOOOO 00000 60 00000 50060 045 0 0 0 1000 UDDUUUDDUUDDDUeIDUU 0000000000000000000 00000 8 6078 50960 0 000000000000000 00000 000000000000000000000000
19. BAST D0000000000000000000 D00000 0000000000000000000 D00000000000000000000010000 uewmnaiagng enmajmug amp geuenggmuaugg 4 0000000000000000000000000 Hai koff amp Heni koff 1989 Proc Natl 00000 Fenikoff and Heni k 000 00 gt 000000 109150 Acad Sci LAB off 1992 Proc Natl Acad Sci USA 89 10915 10 000000 O00 913 24 OOOO BAN D00000000000 0000 Kerlin amp A tschu 5873 57870 90 Proc Natl Acad Sci LBA 1993 u au BASH D0000000000000000000000000 50 000000 000000000000000000 16 3l 00000000000000 0000000000 D0000000000
20. Mood 00000000000 0000000000000 0000 0000000000000000000000000 10 0000000000000 O4 0 RNA 00000000000000 00000 000000000000000000000N0D0 20 0000000 0000000000000000000D0M000
21. 4 JP 5758889 B2 2015 8 5 8 7 OO ii 00000000000000000000 0000 a 000010000000000 900000 i 000 40 00 D00000000000000 400000000 000010000000000 Oo 00000000000000 0000000 00 000000000000000 D00500000000000000013000 100 U0000 D0000000000000000U00UUU00
22. ELE PI EL EI EE ELE B E ET EI EI EL BO EL ES EI EI EJ EJ EL EI Ei EI EL EI EL EI EL EL EL EL EL EJ EJ EJ EL EL EI EI EJ E E ELE EI EI EJ EJ EL EL ET EI OOO E EL EE E ET TESI EA ET ELE EA EES ELE EI EE EL EI EL ELE Ek EES EL EI ET EI EI ELE ESI ELE EL SE E EL ELE EI ELE ELL EL ELE ESSE EST EL E ESL ET ERIT ERU EI EST EL EL ELE ETE E EI EST EET ERE EET EST EL ELE EXT EL EL EL E EL EL EL EL EL EL EE E L3 7 es E EJ EJ 3 50 14 JP 5758889 B2 2015 8 5
23. 10001 WOOO 0 130 4 3 aj D00000000100000000000000 3 0000000000000000000000000 44 000 D000000000000000004 0000 mu 80 0 0 60960 50960 9 8078 O O 60 0 0 0 0g 0 50 u uuu 00 000 Oo o 10 1 ii 12003100000000002000000000 9596 130 a 4 9996 9096 80 o0 o
24. 0940 1000 30 a 00000000000002m0000000000 8 U LU 1 60760 00000 50 t 9 000000000 1940 0 0 Barbara MGi ntock 9576 DO C O0O00 000000000
25. 000000000090 00000000000 D000000000000000 000000000 D0 0000000000000000000000 D000000000 0000000 00000000 DO000000000000000000000T N D00000000 0000000000000000 D00000000000000000 0000000 DO0000000000000PRIO0000000 DO00000000000000000000000 DO00000000000000000000000 D000000000000 000000000000 DO00000000000000000000000 THUDNIOO0D000000000000000000 TILL NG Targeting Induced Local Lesio McCall l umet al 2000 00000 0 ns nGenones Targeting nduced Local Lesions n Genones TI LLING for Plant Functional Genonncs Pl ant Physio ogv 123 439 442 MG lumet al 2000 Targe ted screening for induced natati ons Nature Biotec hnol ogv 18 455 457 Col bert et al 2001 Hgh Throughput Screening for Induced Poi nt Mita ti ons Pl ant Physi ol ogy 126 480 4849 0 0 10 207000 55 20M
26. OMOO000000000000MIO0000000 20 JP 5758889 82 5 2
27. urmw puagagnagkqaia20 ggm Rmgiug 20 0000000000000000000000000 9 OOOO cea OOOO RI PR DU Me Step RT PCR OD Q agen H Iden Grmomd PR O 9498 30 0 57 C 309 00 72 C uuu 0203000000000000 D S GE D 000000 IG UE RII 00000000 LEO 4309 0 0 Zeiss Cberkochen Gernany 0 0 0 e EES 50 et a LEE d O Krupkova et al Krupkova E Inmerzeel P Pa 0 ul y M and Schnalling T 2007 Plant J 50 73 30 en TUS M Mao Rl NT EE apz CAAGGTAAAACTCACACOCCATAACO CATAAACCCTOGAGCGAAACCTAGAG GAGCOTCGGTCCCCACACTICTATAC 575000000000000000000000050 BABE 27 RIES 28 RIES 29 ag Ee ee 000000000 10m0 30460000000 UE US CSC eh luc A NAA 90 0 5 Snyth OR Bowan J L Ron Lo ows 01000000150 and Meyerowtz E M 1990 Plant Cell 2 755 767 E xq WEE
28. 000000000000000000 000000 10 500 6 000 60 00000 00000 000000 20 8070 0 000000000000000000 000000 00000000000000000000 0000 DDD000000000000000U00UUU00 000000000000000i002000000 ii O00 00000000 000000000000000 4 000 50 D0000000000000000U00UUU00 0000000000000000000 0001000000 30 0000000000000000000000000 000000000000004 00000000000000000000000 0 004000000000000400000459
29. 00000000000000000000000 0 0 OO DOD000000000000000U00UUU00 000000000000000000001 0D0200000000000002000 3a 000000000000 000000000000 20 0000000000000000000000000 40 000001i0000000000000000000
30. 30 30 00000 00000 50060 045 0 D0 00000000000000000000000 UUO0O0U0U000000000000000000 O00000009 00000000000000 0000000000000000000 00000 40 i 0 9598 00004000000000 d 400000000 000010000000000 000000000000000000000000 0000000000000000000000 00 0 000000000000000 SI90000000 00 000000000000000000000 Us000000000000004000 000 1000000 10000 401 4 0 s04 00000 6076 00000 00000 4596 5 DU 807 00000 3 EIE E ET G
31. JP 5758889 B2 5 5 000000000 d 0 0 0 0 000000000000000000000000 000000000000000000XKI00000 6 0 0 0 0 0 0 0 0 40 0 0 0 0 a 000000000000000000000000 95 0080080101 0 0 0 0 000000000000000000000000 000000000000000000 j00000 9 000000000000000000000000 0000000000000000009X000000 D 50 D 1x1 6 304 00001020 0000000000100000000000000 4596 59 5076 1 60 0 50 ow
32. OOO 100000 000008 60760 00000 50 OO HI 0 9 lt 5 50 00000000 Kunar and Bennetzen 1999 Plant R 39 etrotransposons in Annual Revi ew of Genetics 33 4 Z90000000000000 D Ad Targ D BV Sem O 00
33. 02000000000002000000000000 0 0M0D0000000000000000000 90000 ODNDO0000000000000000 dendogramO OOOOOOOOOOOOOOOOOO 0000000000000000000000000 30 BATH qure OO 0O 0 Thonp 000 son J D amp al 1994 Nucl Acids Res 22 467 0 0 0 3 4680 0 8 1 Wo MUN4000000000 100 0 0 100
34. 0000 4 Novak Q Hauserova E Anakorova 0 P Dolezal K and Strnad M 2008 Phytochenns try 69 2214 2224 OOO Scion Inage OO D D 000 0 Sci on L5 ES El 1 D poration Frederick Maryland 50 24 JP 5758889 B2 2015 8 5 R2 2 553 RT PCR 2211882 2 4 x 7343 1 7342 ckx2 8 1 GAATGGTGGAATTGGTGGTC AGTCCCGAAGCTGATTTTTG EIES 42 ENES 43 ckx3 1 CTCGGCTAAAGACGGAGTTG AATAGGTGGTTGTAAACGTAGACGCA RINGS 44 45 ckx4 S1 CTCTGCCGCTTCTCACGACTTCGGTA CATAAACCCTGGAGCGAAACCTAGAG 46 47 ckx4 Z CTCTGCCGCTTCTCACGACTTCGGTA CATAAACCCTGGAGCGAAACCTAGAG BES 48 49 ckx5 1 GCACGAATCTCTCTCGAACC CGCTGACGAAGAAGACGAC BCBS 50 Sl ckx5 G2 GCACGAATCTCTCTCGAACC AAATTCTTGGACCGGAGCTT RIBS 52 53 ckx6 S2 TGTGGATTCCCCTGCTCCATA ACCCTGTCCAAGAATGCTTCA 54 55 ckx7 Gl TTAGCCGTCCGATCAATCTC CGGAAAATCTACGGATGGTG RINGS 56 57 ckx7 TI TTAGCCGTCCGATCAATCTC CGGAAAATCT
35. O49 RA 00 0000 000000000000000 000000000D 0000000000000 00000000 000000000000000 3 0000000000000000000000000 D000000000000000000 00000 0000000000 00000 000000 00 40 000000000000 000000000000 1 DDD000000000000000U00UUU00 00000000000000000000000 0000000000000000000RMWI000 000000000000000000 000000 5
36. 0990 00 1000 4000 500 44 0010000000000000 OO000 60 00000 80 00 41 9090 000008 6078 00000 5078 00000 45 D 1 o DOO00000000000000000000 D00000000000000000000U0000 UU ii 50 a 00003000000000095 90000D0 00 0 0 00s5 00000000000000 1300 0 0 1000
37. 0000000000000000000 00000 DDD000000000000000U00UUU00 e 9 10 20 3 JP 5758889 B2 2015 85 D000000000000000000000000 DO0000C000000000000 0400000 D0000000000000000000005000 0500000000000000s5000310o 0D0 D0000000000000000000000000 D00050000000000000501000000 00 5096 0 4 0 60 00000 80 D000000000000000000 000000 0000000000000000000000000 f 00006000000000095 000000 D000000000000000000000000 00000000000000000GX000000 D0000000000000000000006000 D05000000000000000600001000000 6 0601 4596 00000 50 00000 6090 000008 OMOOOOOUMO0O000000000000 D0000000000000000000 00000 0000000000000000000000000 0000000000000000000000000 D000000000000 000000000000 D0000000 0
38. 000 Hseloff et al 1988 Na ture 334 585 5910 0 0 0 Noi et al 1990 The Plant Cell 2 27 28 0 OO 1840 283 5 020 231 5 323 024 5 D0000000000RMO000000000 RN RM OOO 0000000000000000000000 00 00000000000000
39. I I 000 OOOO Wsconsi n Genetics 0001 Soft ware Package Rel ease 7 0 Genetics Conputer Gr oup 575 Science Dr Madison WO GAPO EESTFI TO 00000 FASTA I BEL B B OOO PILEUP C LO 403 41 215 Atschul et al 1990 J Ml Biol 0000000000000000000000000 10 rt world wde wb Feng amp Dool itt P iL 00 JB ncbi nim nih govu000000000000 le 1987 J Ml Evol 35 351 3600 000000
40. O0000 5096 00000 00080o b0000009o p00000000000 0000000000000000000000 00 D0000000000000000U00UUU00 000000000000000000000000 000000000000000009 I00000 000000000000000000000200 Us0000000000000020000 1000 0 0 2 0 045 50080 00000 O00000009 00000000000000 0000000000000000000 00000 D0000000000000000U00UUU00 000000000000000000000000 000000000000000000X I00000 000000000000000000000300 D05000000000000030000100000 0 045 00000 60 00000 O0000000990 00000000000000 0000000000000000000 00000 d 000000000000000000000000 000000000000000000000 00 D0500000000000004 40002310000 DDD000000000000000U00UUU00 401 0 045 50080 00000 00000
41. 000000000000000000X I00000 000000000000000000000300 30 000000000000000000000 D00022000000000000UU00 D05000000000000030000100000 00000 50080 045 0 O00000009 00000000000000 0000000000000000000 00000 00 0000000000000000000000007 40 00 000000000000000000000 Us000000000000004000 000 0000 10007 000000000010000 0000000000009 41 8 OOOO 50080 00000 00000 45980 0 00 80 00000 60 D D 50 D g 0000000
42. OO O0000 5096 4596 ii 80 OO0 0000000000000000000000 00 D0000000000000000U00UUU00 D0000000000000000U00UUU00 0000 b 0000000000000000000000007 20 0000000000000000009 I00000 000000000000000000000200 Us0000000000000020000 100 0 0 040000000000000000000000 DOD000000000000000U00UUU00 000000000000000000 000000 0000000000000000 00000 00000 4 i OO O00000009 00000000000000 400000000 0000100000000000 0000000000000000000 00000 0000000000000000000000 00 000000000000000 SI90000000 D0000000000000000U00UUU00 U0000 30 D ii 000000000000000000000000 000000000000000000X I00000 0000000000000 00000000000 D000D00000000000000000000 0000000000000000000003000 Us00000000000000320000 1000 0 0
43. 0000 00 00000 00000000 DU 0o00 0000 DUUD 00 00000 0000 DUDU 000000 DU 000000 0000 0000 00000 00 SCHMLLI NG T et al Otoki ni n as a Regul atory Factor for Yield and Bi onass O stri but ion in Gop Pl ants Phytohornones in Pl ant Bi otechnol ogy and Agriculture OO O00 pp 97 108 BARTRI NA I et al Otoki ni n regul ates the acti vi ty of reproductive neri stens fl over organ si ze ovule fornati on and thus seed yield in Arabidopsis thali ana Plant Cell 5900000 EE L3 EI EEE ELE 2 0 0000 DU 0000 000 Vgl 23 N 10 pp 69 80 ES ELE El EF se
44. OOO0 O0000000000000000000 000000000000000 000000000 DDD000000000000000U00UUU00 DOD000000000000000U00UUU00 0000000000000000000 30 0000000000000000000000000 D000000000000000000 0000000000000000 00000000 D0000 S9000000000000000000 i 400000000 000010000000000 000000000000000000000 000 0000000000000000000000 00 0000000000000000000000 00 we 0000000000000000000000 U0000 U0O0000 ii 0000000000000 00000000000 40 06 0000 0000000000000030 HOO Gee 000000000000000000i000000 A0000000000000000000 0000 000000000000000 000000000 000000000 000000000000000 W 300000000 00000000000000 OOOOOOOOOOOOOOOOO 0235001 2006 0 oa ax 0 0 ag og a00 50 0000000000000 0000000000 0000000
45. 000 0 00000000 0000 300 0 00 10 0000000000000 45e 00000 50 00000000000 1 0 0 0 0 5000 000000 0 0000000000900000 90 D Du 60 00000 80 0000 0 O 0 0 00 804 00000 60 0 0000 50 0000 50 3 HG ES L3 L3 go L3 L3 L3 L3 L3 3 L3 EJ Ed Ed Ed EJ Ed NoD Ed Cd E Ed Cd E Cd DL BL DL C 11 JP 5758889 B2 2015 8 5 22 21 00000000 0 D bet DD D
46. 50 0 0 45960 00000000800000 0 90 0 00000 80 00 0 0 0 60 0 f 000000000000000000000000 0000000 000000000000000000X000000 3000000000 000000000000000 Us00000000000000e6000 000 DUO00O00000 900002o000000000000 ao 0000000000 000000 4 00000 50 0O 90 0 0000 8 00000 60 0 0 0 000008 6076 00000 50080 0000o 045 0 O00000009 00000000000000 D0000000000000000U00UUU00 0000000000000000000 00000 d 00003000000000095 90000D0 00000000 SI900000000000000 0 00000 3000 000 1 0 000000000000 DUOOO0O00020000000000000000 000000000010000535000000000 D000 0000000000000000000 00 00000000000000000000000010 DDD000000000000000U00UUU00 0000000000000 100000 0 4400 8040000 00000 60 50980 000 30 9000 000000000000
47. O000 10 00000000000000000 00000395 cwi00 0000000000000 13 5 5 10 P lt 0 0100000 uuu 00 0 gt 000 0 D00000000000000000 000000 000a b 0000100 a0000000000 0 0 cog ckxs D ces ckx ce000000003000000 uuu 0 33 n 30 0 d OOO gynoeceum O OO 00 DOn l2 0e 000000000000 ckx ck 25 4
48. 00000000000 9078 C1 D 807g L1 D 1 0 un f DUOO0O2000000000095 000000 000000000000000000X000000 000000000000000000000000 M009 gir 500 0 0 100 A000 500 20 D D 6078 00000 50960 00000 4596 D 100000 24 21 9096 OM OOOOOU 000008 6078 D 5078 00000 45 D o 0
49. 0 0000 eoe 0 00000 D0000 000000000000000000 D0000000000000000U00UUU00 000000000000000 000000000 i 400000000 0000100000000000 0000000000000000000000700 40 i 0U00000000000000qgess00000000 0 400000000 00000000000000 0000 100 0 0 0000000000000000 300000000 0 700 000000000000 4 0 00000000070000 eoe 0000 0 sos 0 0 0 00000 000000000000000000000000 OOO00 M4 000000000000000000 008400000 0000000000070000 0 D 0 80 0 0000 0 9076 000000000000000 000000000 0 60 0 D 0 0 50 DU 50 8 JP 5758889 B2 2015 8 5 15 16
50. ugagaaaaadgu ee rn tuttl o 1000 0 0 6 500 1000 20000 s50 00000 6076 000008 00000 04 0 100000 20 OO 50 00000 000008 oW 0000000000000000000 00000 00000000000000 9 9576
51. 7 1 bw gu 000000000 00000000000MI00000000000 10 000000000 nating buble D O D0000 oo 20 0 0 0 ND 0 0 0 0Q000000 00X X000000 0000000 3 D000000000000000000000000 D000000000000000 000000000 D00000000000000000 0000000 D000000000000000000000000 2 DO00003000000000000000000 00000000000000000000000050 40 DO00000000000000000000000 Qeykovwk amp al 1998 Mi 0000000000 ct ati on detecti on usi ng a novel plant endonucl ease Nucl c Acid Res 26 4597 4602 0 O0 Col bert et al 2001 H gh Throughput Screening for Induce d Point Mutations Plant Physi ol ogy 126 480 484 un 50 0000000000000000000000000 21 JP 5758889 B2 2015 8 5 42 41 NJ 1
52. EL EI EL EJ EL ELE EI ET EI Ei EL ET ET Gy El EJ EJ EI EL EL E EL EJ EJ ET EX 4 EL EJ EI EI EL EI EI EL EI EJ EI EI EL EL OO E 22 JP 5758889 B2 2015 8 5 454 00 000 5078 00000 eos 00000 8 Ll E E gt gt E D0000090 00000000000000 OO0 00000 5 0000 nonophospate i POG D00000000000000000 00000 N A 0000000 0000 900000 0 DOO00000000000000UU0D0UD000O cg
53. Verner et al 2001 V rner et al 00000000 C 0 0000000000000000 aeq aeq aX p ae p 0 D 10 000 weg ax 2003 Verner et al 20030 000 OX 2000000000000000qos00 0960 0 0 000000000 OQ00000000000000000 00 s 0 0 wy aeo x 000000000000 00000 aos axe 49 06 0 0 0 60l12350A0UO D0OOOO0O00000000000 i 400000000 00001000000000 0000000000000000000000 00 O000000000000000GKRS090000000 20 0000000000000 00000000000 U0000 ii U0000 0000iD DOOOO0oO000000000000000 A0000000000000000000 0000
54. aa ooo ao o edere L3 CJ DJ E EJ EJ EJ EJ EI Ed SSS EEG e EJ EJ LJ C C H y OOO C C E 5 59 CJ CJ 5 Si E a g D 5 C E DJ B3 2 DJ dH qq HH Q 19 JP 5758889 B2 2015 8 5 f 00006000000000095 000000 tu D000000000000000000000000 9576 D000000000000000 D00000000000000000GX000000
55. ono EE EL EJ IL CT EAS Ed E E Ed elu e m zs j EE I 2 E 5 EI EZ 1 Fal 5 ELE CT EE Er ET EL EL ELE EL EL ELE ELE EL ET Bes ELSE s OO 3 8 Es oOo wo v I ER El E Oooo CH E ELE E EL EL EL E E EI ET EN EL ELE ELERE ooo EJ Es ET EPELA EL ELE E OO OO OO OO OO ooo 5 L3 L3 L3 eo es oo EI OO EZ E
56. the Plant Cul ture Catal og ue and suppl enent 1997 000000000000 Ooy ed 1993 Plant M 0 lecular Bi ol ogy Bios Scientific Publishers Oxford 2000000000000000000000000 RA D000000000000000000 000000 40 9590 a D000000000000000000000000 000000 0000123000000000000000000 9590 0 D00000000000000000000000 50 000000
57. 0 f 20 OO 000000000X000000000000000 00000 3000 00 120 000000000000 ii DUDDUD 000000000010000535000000000 a 000030900000000095 90000D0 000000000000000000000000 2 00 4 1200000 0000000000000 000000000000000000000000 OO0 50 00000 60 00000 80 0000 00000 3000 40000 000000000000 009 200000000000000000000 0000000 5000 000000000014000 4 9 4400 0 140000 0000000000000 000000 30 8 00000 50 00 0 D0020Wm00000000000000000000 i b 00008000000000095 000000 00000000000000 400000000 0U000000qgeoc2000000000000000 300000000 0 7000 000000000000 3000000000 0000000000081000 5000 000000008000 0000000000000000000008000 sos 0 0 4596 7000000 000000 50 00000 4 0 0000000000800000 0 0 90 000000 80 0 0 00 0 uu 0 90 0 0000 80 00000 60 0 0 0 O0000000000000000000000000 4 0000000000 000000000000000 0000 00000000009 A000000 OO ii 00000000000M0003000000000 D00001000000000093 0000000 000000000
58. 000 ii 1 95 1 100000 OO00 1 D000000000002000000000000 000000000000000000RM0000 DDD000000000000000U00UUU00 0000000 00000000000000000 030000200000000000 0020000000000000000000000 iiaiiaiD Du dB LL L DLL DLL D D DD D 4 OOO 3 0002034 OOO0O0 O00000000000 0000000 400000000 000010000000000 0000000000000000000000 00 U0000 ii OO OOO 1 95 D0000000000000000000000 00 00000000 000000000000000 a00000000000 0 0 0 0 0 0 0 00000 0000000 00000000000000000 00 0000000000000000000000 4
59. 000 Methods in Enzynol ogy Vol 153 Reconbi nant DNA Part D Wi and Gossnan eds 1987 Acadennc D Hl Hl D QODH000000000000000000000 D0o0000000000000000000000 Berger Ausubel IO and Sanroog DOOOOOO00000000000 D000000000000000000000jJones e d 1995 Hat Gene Transfer and Expressi on Proto col s Methods i n Ml ecul ar Bi ol ogy Vol une 49 Huna na Press Tovata N Payne et al 1992 Plant Cell and Tissue Gul ture i n Li qui d Systens John Wl ey amp Sons Inc New York NY Payne Ganborg and P hillips eds 1995 Plant Cell Tissue and Organ C ulture Fundanental Methods Springer Lab Manual S pri nger Verl ag Berl i n Hai del berg New York Ganbo 20 Alas and Parks eds The Handbook of M crobi ol ogi cal Medi a 1993 CRC Press Boca Raton FL Alas D U O000 Sigra Adrich Inc St Louis M Si gna LSROCO the Li fe Sci ence Research Cell Qlture Ca tal ogue 1998 00 000 SignaAdrich Inc St L ouis M Signa PQCS
60. 0000 000 990 D00000000000000000000000 D0000000000000000000000 1010 30 000000000000000000000000 uuu a 000008 60760 00000 50 9 9576 QOOH000000000000000000SNQ 00000 0000000000000000000 4 D000LRIO000000000000000 g9a900 10000 50000
61. 000000 000000 e 00001000000000095 00000 i 00000 3000 140000 000000000000 000000000010000535000000000 300000000 0 700 000000000000 00 4578 14000000 0000000000000 00000000070000 OO0 50 00000 60 00000 80 0000 000000000000000000000000 700000L0 6A000000 009o 00000000000000000000 00000000000 90 0 0000 D 0 80 D 0 0 0 60 D 0 50 f 000020000000000 9400000 OO 000000000X000000000000000 ii 000000000000 20000 3000000 a 00003000000000095 90000D0 DU 4 0 120 0000000000000 OO0 50 00000 60 00000 80 0000 30000000 40000 000000000000 5o 009o 00000000000000000000 5000 0000000000140000 7 JP 5758889 B2 2015 85
62. 000000 50003000000000000 0000000000000000000 00000 i 0 9598 00004000000000 d 400000000 000010000000000 ao 0000000000000000000000007 W000 50 000000000000000000000 00 Wood 1000000 Us00000000000000400010om00 41 8 0 O00000 60 00000 50060 045 0 0 0000 eoe 0 00000 O00000009 00000000000000 0000000000000000000 00000 000000000000000 000000000 30 00 000 ii e 000000000000000000000000 a 00003000000000095 90000D0 000000000000000000 j00000 DDD000000000000000U00UUU00 000000000000000000000300 D000
63. 00000000000 00 40 00 0 0 Us0000000000000020000310om00 D00500000000000000013000 109 0000500000000000003i00000 00000 00000 50060 045 0 0000000000000000000 00000 4 80 OO0 0 0000000000000000000000 00 DDD000000000000000U00UUU00 DU f 0000 000000000000000000000000 b 0 000000000000000000000000 000000 Us00000000000000e6000 1000 0 0 000000000000000000000200 1917 Us0000000000000020000 0000600000000000060I0000 50 EJ E ur
64. 000000000000 00000 D 50 6 JP 5758889 B2 2015 8 5 140 00000000000000000000000 e 00 se 14000000 00000000000 000000000000000000000000 0000009 50768 00000 00000 50 000000000000000000 j00000 om000000000000000000000000 000000000000000000000300 D05000000000000050000100000 b 00008000000000095 000000 000000000008000030000000000 8 6076 50080 045 0 000000008000 oO00000009 00000000000000 0000000000000000000080000
65. 0000000000000000 D0000000000000000000000000 i DO000000000 10000000 000 5 00 0000000000000000000000000 D000 00000000000000000 8 0 0000000000000000000000000 500 og00000000000000000000000 DO0O000 0000 0000000000000100 5096 00000 0046 g eos muB 90990 0 8090 D00000000000000000000 0000 0000000000000000000000000 ii 95990 41 D0000000000000000000000 00 pnaunagggnaanaaggeesgunagunmad 400050 10 JP 5758889 B2 2015 8 5
66. 00000000000000000000000 40 0000 DN DU smth and V ternan 1981 000000000000 00000000000 4820 2 Adv Appl Mth eed enan and Winsch 1970 J Mi Biol 48 3 Pearson and Li pm 0000000000000000 00000000000000000000 0000 an 1988 Proc Natl Acad Sci USA 85 2444 50 15 JP 5758889 B2 2015 8 5 30 29
67. 0000RM0000 00000000000000000RM0O00000 00000000000000 000000 0000 D00000RMO000000000 RNW IU0O D00000000000000000000000 000 00000 000000000 000000 21 25000 000000000 000000025 0 DUDU 100 2000 DD 200 15000 0 250 10000 100 S EZ EJ EL LJ 2 EJ EJ Ee EJ EJ EI Se EX LE E EL EL GEI EJ EJ e E E E D EH E H CJ 18 JP 5758889 B2 2015 8 5 36 35 O 20020173478 20020162126 200201 0 95760 Gogoni and Maci no 2000 Post transcr 82223 DO0 00000000000000000000 i p
68. 1 A nn Rev Plant Physiol Ml Bio 52 89 1 19 0 Verner T Mtyka 0 V Laucou V Snets R Van Chckelen H Schmal li ng T Plant Cell 2003 15 11 2532 50 V rner T Mtyka V Strnad M Schnul ling T Proc Natl Acad Sci US 50 A2001 98 18 10487 92 0 3 JP 5758889 B2 2015 8 5 00000000 OO00000000000 000000 00 0 0 xg Gea aeq ao ax DOO 0 00000000 weg 0000000 0000000000000 OOM
69. 3 8449 8454 nann and A Pepan 1990 Chem Rev 90 543 P D Cook 1991 Anti Cancer Drug Desi gn 6 585 J Goodchi d Bi oconj ugate Chem 1 1990 165 DOO QS L Beaucage and R P Iyer 1993 Tetrahedro n 49 6123 F Eckstein Ed 1991 Gi go nucl eoti des and Anal ogues A Practical Approach RL Press D 0000000RNIO00000000000000 000000000000000000000RW0 DUOO0000000000000000000U000 DUOO0000000000000000000U0000 DUOO00000000000000000000000 000000000000000RMIO0000000 10 20 JP 5758889 B2 2015 8 5
70. 4 85 ckx3 51 SAK 050938 ckx4 51 SNK 055204 c 0000000 kx5 51 SALK 064309 ckx6 51 SK 070071 D 090 uuu Salk Institute Genonic OOO00000 10000 RT PCRI C Anal ysis Laboratory A onso et al 2003 Sci ence 24 301 653 65N000000000000000000 u uuu 40 2 0 Baunann D000000ckx3 E Leval d J 586 er H Schulz B Wsnan E 1998 100000000500000 Successful PCR based reverse genetic screens usi ng 0000000000 an En 1 nut ageni sed Arabi dopsi s thal i ana popul ati on generated vi a si ngl e seed descent Theoreti cal 2701 90 OO and Appl i ed Genetics 97 72 7340 0 0 0 cos u nes5itz ez 00000 Li ne D 332B10 ckx7 GL Li ne D 363002 GB 000000 tRPO00000000000 5 I KA OO O00 Rosso MG
71. ACGGATGGTG 58 EIES 59 actin TACAACGAGCTTCGTGTTGC GATTGATCCTCCGATCCAGA 60 61 0000 0000 ET HI ED Bui R WRMP ZG vd 2235 bp 51 WT 41 21 1 107 259 1746 79 1 23 203 34 28 AICKX2 um Y 003665 155 37 460 254 1129 0 52959 180 20 173 7 At2919500 2990 bp S1 korn UROG iP iPR iPRMP iP9G oe ec a ee WT 33411 0 23 0 09 0 16 0 13 300 102 020 024 0 0 bp 003005 246 28 029 0 10 035 0 10 100 5 4250 020 0 03 Z St A gy mmm Aa At4g29740 B anon 2871 bp 62 st D ge AtCKX5 180 Attg75450 160 2804 bp S g AtCKX6 Pl od At3963440 Katz G1 n 10 m 80 AtCKX7 AS21482 amp 60 3213 bp E 40 uuu De ER NN 00 crx WT 1 WT 1 WT 2 5 ES SC Actin2 _Actin2 WT ckx3 1 ckx5 1 25 JP 5758889 B2 2015 8 5 m o 633 mm2 en WT ckx3 ckx5 3 ckx5 150 150 3 5 y S 5 E 100 50 S WT 65 WT chkx3ckx5 0 0 1 ll Z7 V 2 IV WT ckx3 ckx5 ckx3 WT ckx3 ckx5 ckx5 A 5 A a af a af ai af gf d d v i d Ab gh a a a a ai 26 JP 5758889 B2 2015 8 5 U0000 0005758889000001 app 27 JP 5758889 B2 2015 8 5 0000000000 74000 100130328 74000 100130672 bs 000 00000000 000 00000 00 000 000000 0 ooo 0 oo 590000 00 00
72. D ev 0 OO DO0O0OO0O000000000000 acell 00D0D 30 21 0 21 00000000000i000000000 D00000000 00000000 00 0000 10 OO 000000000000 000000000000 4qo0000007qoe0000 0000 0000000000000000 0000 0000 000009qo400000 000000000 0000 Op mH o0000 00 85596 80968 00000 O00 99 5 0 99 0 98 000000 ao 0000000000000000000000000
73. E ELE D GE CJ CJ E 5 2 E ESSE EH sh EJ 1 EL EL E ES TE GEN E FE ES E 3 i i i B EAE E E EL ET EL ELE ST E L3 L3 L3 ES EST Er EE ES Ec 5 JP 5758889 B2 2015 8 5 9 10 ii 000000000000000 00000 a 00003000000000095 900000 0 0 00 00 000000000000000 00000000000000000000001300 00000000000000000000 D D 100 1300 0050000000000000 00000 a 0000000000000
74. Li Y Strizhov N 0000000 t 00000000 94000 Reiss B Dekker K and V isshaar B 2003 tea Plant Ml Biol 53 247 259 000000000 P N A 0000000 0000 iPR N A 50 cez TXSAL 55 Ao7 00000000000 000 23 JP 5758889 B2 2015 8 5 46 45 0000 0000000TONMIO000000000 21 D0000000030000000000000000
75. l 129 1732 1743 00 OO0000 5 759 8299 0 5 942 657 D0000000000 00000000000000 gw OW D0000000000RNIO00000000000 DOO0O0NIO000000000000000000 D0000000000000000000 00000 D0000RNIDO00000000000000 00 D0000000000000 0000000 0000 D00000 0000000000000000000 D00000000000000000 Hse ton and Ae xander June 5 2001 USP 6 242 258 Methods for the sel ecti ve regul ati on of DNA and RM transc ri pti on and transl ati on by photoacti vati on USP 6 500 615 LEP 6 498 035 LEP 6 395 544 USP 5 563 050 E Schuch et al 1991 Synp Soc Exp Biol 45 117 127 de Lange et al 1995 Gurr Top Mcrobi ol Inmunol 197 57 75 Hamilton et al 1995 Gurr Top Mcrobi ol Inmunol 197 77 89 Finnegan et al 1996 Proc Natl Acad Sci USA 9
76. oo 27 00 al H Hd ooog ID00000 UU 5758889 12 2015 6 129 amp 27 24000 8 5 2015 59 amp 27 4000 51 nt d OU 2006 01 OOOO 5 00 0 2006 01 OOOO 5 0 0 OOOO 2006 01 D un 1 00 0 0000 15 09 2006 01 0000 0 0000 0000014 00300 21 2012 519008 P2012 519008 7330000 512004671 86 22 0 0 0 9 7 2010 90 70 220 0000 cen 0 D 0 0 2012 532594 P2012 5325944 OOOO 00000 00000 UU 430 00 20 12 2012 20 120 240 0 UU 86 B E PCT EP2010 059880 7370000 512004682 820 0 D Du 1 2011 004003 000000 0000 D 820 0 D D 23 19 13 2011 1 13 DU 00000 0 250 6 24 2013 6 24 0000 00000 O00000 UU 3 0000000 09165164 6 00 0000 000000 0 327000 219 70 10 2009 7 10 7330000 3 3 000000 EP 0000 OOOO 00000 00000 UU 00 0000 000000 D 74000 110001139 U00000 50000000000000000000000000000000000000000000000000000 2 1
77. ti onal gene si enci ng across ki ngdons Genes Dev Gru T 2000 Asilence that s 638 643 10 peaks vol unes Nature 404 804 808 Hanmond et al 9596 ugagagaagauruculctlllulldlul 2001 Post transcri pti onal Gene Silencing by 0DO 00000000000000 040000 Doubl e stranded RNA Nature Rev Gen 2 110 119 Napoli et al 1990 I ntroducti on of a chal cone synthase gene i nto Petuni a results in reversible 000000 9590 2 cosuppression of honal ogous genes in trayas Pla 10 00000000000000000000000 nt call 2 2722809 000000000 000000 00 RNODO00000000000 000 000000 9576 3 D00000000000000000000000 D000000 000 000000000000000 000000
Download Pdf Manuals
Related Search