神経障害性疼痛における ミクログリア特異的転写因子 MafB
Contents
1. McMahon and Malcangio 2009 Milligan and Watkins 2009 10 Figure 2 EAI2. Ginhoux et al 2010 Ransohoff and Cardona 2010 Saijo and Glass 2011 Figure 5 ramified Haematopoietic cells CNS cells Haematopoietic stem cell Common Common lymphoid myeloid progenitor progenitor ae Pontos i a i uring development only from extra embryonic Sa yolk sac myeloid cells Neuroectodermal neuroepithelial progenitor Y Megakaryocytic eryt
3. Kreutzberg 1996 Hashizume et al 2000 Hanisch 2002 Koizumi et al 2007 Kataoka et al 2009 Paresce et al 1996 Monsonego and Weiner 2003 Liberatore et al 1999 Le et al 2001 Wu et al 2002 Zhang et al 2005 Maguire Zeiss and Federoff 2010 Jack et al 2005 Napoli and Neumann 2010
4. PETRI SO Fee FAAS OO Le ANE UE MafB D R ARREMETE O A DARE RUT mRNA TAHIR 3 21 1 7 MafB MafB MafB MafB MafB
5. 2008
6. EAR AE PE FE ME _ 57
7. 196S Melzack Wall 1979 Melzack and Wall 1965 Basbaum and Fields 1979 Woolf 1983 Liu et al 1997 Nichols et al 1999 GABA van den Pol et al 1996 Moore et al 2002 Coull et al 2003 AB Woolf et al 1992
8. Steinhauser and Gallo 1996 Pocock and Kettenmann 2007 neurotransmitter wraps mein ound 7 glhiotrransmitter Koizumi et al 2003 Gordon et al 2005 Hields and Stevens Graham 2002 eo Hansson and Ronnback 2003 Inoue et al 2007 irontapni tech es 5 20 sg roa K Microglia f ynapties Postsynaptic eyinal terminal AY Pres t Figure 2 Allen and Barres 2009
9. MafB MafB Bakri et al 2005 Tillmanns et al 2007 Sarrazin et al 2009 MafB MafB EdU MafB CD68 MafB 3 2 MafB MafB
10. MafB MafB siRNA BV2 LPS LPS ILAB IL 6 TNF a siRNA TL 1B IL 6 MafB LPS Toll like receptor 4 TLR4 LPS TNF a MafB LPS LPS TLR4 AP 1 Activator protein 1 NF KB Nuclear factor kappa B IRF3 MyD88 Myeloid differentiation protein 88 IRAK IL 1 receptor associated kinase TRAF Tumor necrosis factor receptor associated factor MAPK Mitogen activated protein ki
11. m L3 DRG clic LS CMD 14586 ARSS Cf gt _ LS L5 DRG LSEM A gt LS LT4 AP Figure 7 3 0 RAK ChE UL 0 5 mg ml 0 1 ml 13 1 von Frey filament Up and down Dixon 1980 Chaplan et al 1994 Up and down S 3 BORRA CAC VU ART IVS BRR Y AIO CRE SSSss Ta a
12. Figure 24B C CCL21 MafB Figure 24D A cx cm Bs ops C gt D PBS 3 WCCL21 k E CCL21 E 40 d 5 wna 15 vu 9 30 a y N Sm Ss 20 35 10 ES 0 5 w 6 0 hr 24hr 6hr 24hr 24hr 2 6hr C PBS E 24hr C PBS 5 E CCL21 CCL21 SE 5 TE 5 rn QS AN lt Q lt Q Q Q ES ES 0 0 0 1 2 3 4 0 1 2 3 4 Relative MafB Relative MafB immunofluorescence intensity immunofluorescence intensity Figure 24 CCL21 FREE FICE ARRAIZ OT 7 CO MafB A CCL21 60 ng mouse lB HEINE 5 72 6 24 L4 WHER AIC BIT S MafB n 6 Scale bar 50 um B C CCL21 AMENE 6 24 L4 AHH AIC MafB OX42 pri role cod MafB C n 4 5 202 00 001 p lt 0 05 vs PBS D CCL21 HAIB AP HEA 42 6 6 24 L4 MafB PBS MafB 36 2 16 CCL21
13. 20 cm 60 2 37C 10 CO 1 1 6 1 A MafB siRNA MafB 2 siRNA si63 si65 siC siRNA i invitrogen stealth siRNA Lipofectamine RNAiMAX invitrogen 100 uM siRNA RNAiMAX PBS 10 EAA 20 20 pmol siRNA RR Z 2 wl Alpe PBSC 33M
14. MafB Inoue and Tsuda 2009 MafB MafB AWALAWA ZEZ TICKS MafB MafB MafB mRNA 2 BEcheverry et al 2008 Suter et al 2009 Tsuda et al 2011
15. Coull et al 2005 Trang et al 2009 P2X4 IEN y Lyn CCL21 Tsuda et al 2008b Tsuda et al 2008a Tsuda et al 2009a Biber et al 2011 P2X4 Figure 4 7 x HO Nie Pe P2X4 ATP P2X7 ATK P2Yn Chessell et al 2005 Kobayashi et al Fibronectin 2008 Tozaki Saitoh et al 2008 Tsuda Primary et al 2010 Kobayashi et al 2011 inal Za ga gt tegrins Toll Tanga et al 2005 Kim
16. MafB shRNA MafB shRNA BV2 MafB MafB Figure 16A shC MafB shRNA sh6 sh21 BV2 72 mRNA RT PCR MafB mRNA Figure 16B MafB mRNA siRNA mRNA Figure 16C B 313 shC 4 E sh6 1 Ml sh21 lt x Zz Oc E 0 5 Uv HHH HHH 2 0 mafB 1 5 1 5 1 1 0 5 0 5 T y HHH Je JOB p2rx4 p2rx7 p2ry6 p2ry12 tlr2 tlr4 1 5 1 5 1 5 1 5 1 5 1 5 1 1 1 1 1 0 5 0 5 0 5 0 5 xx 0 5 a J i oJ y
17. MafB siRNA shRNA ATP Toll S IRF MafB MafB MafB MafB MafB siRN
18. PARE ORE w B a Artner et al 2006 Aziz et al 2006 Artner et al 2007 Artner et al 2010 MafB _ 40 BV2 MafB MafB siRNA shRNA BV2 P2X4 Tsuda et al 2003 Coull et al 2005 Trang et al 2009 P2X7 Chessell et al 2005 Kobayashi et al 2011 P2Y12 Kobayashi et al 2008 Tozaki Saitoh et al 2008 TLR2 Kim et al 2007 TLR4 Tanga et al 2005 IL 1f Samad et al 2001 Honore et al 2006 Binshtok et al 2008 Kawasaki et al 2008b IL 6 Arruda et al 1998 Arruda et al 2000 Lee et al 2010 TNF a Svensson et al 2005 mRNA
19. 12 60 ie C CCL21 CCL21 PBS 100 ug ml PBS 10 ng ml D Lipopoly saccharide LPS LPS PBS 100 pg ml IARR PBSI dh NIE NR A O CARE BV2 100 ng ml 1 7 1 30 mg ml 0 2 ml PBSC 20 ml KA 4 paraformaldehyde 40 50 ml 1
20. MafB PU 1 Sfpil SFFV proviral integration 1 Fos FBJ osteosarcoma oncogene Myb Myeloblastosis oncogene Gcm2 Glial cells missing homolog 2 TFE3 Transcription factor E3 DNA Kataoka et al 1994 Sieweke et al 1996 Bakri et al 2005 Tillmanns et al 2007 Zanocco Marani et al 2009 Kamitani Kawamoto et al 2011 MafB IRF Kim and Seed 2010 MafB DNA IRF3 IRF7 CBP CREB binding protein DNA IRF IRF8 IRFS 2011
21. MafB 24 3 A Tk ME ee 1 1 kk mae 1 2 A a BRE TF TL 7 A A o 1 3 10 1 4 E T AA aA EE caro onononennan nara onononenann cara rnonenenennanrn eos 10 E O O O A 11 EA 12 E AN 14 t8 at 15 1 9 RT PCR Boo eccecccccescsccscescsecscescsesscescesssccscessesseesvsessceevsevseeseeseaeeaes 1S 1 10 II 18 1 11 st cesscscscsscsesssscsesecscscsscsssssscsssssscsssecsesscssscssssssssscsesssssssesssesscasseessesssaesees 18 E a E AE 19 2 1 LT4 FIT SB MafB 19 2 2 MafB 5 AMO EE As 20 2 3 ARATE ROA HERAT Y TU 7 CORRA MafB Dl 2 4 MafB _ 23 2 5 MafB
22. Tanahashi et al 2010 LEDOT ARRE MafB MafB mRNA mRNA mRNA MafB GSK3 SUMO MafB Tillmanns et al 2007 Eychene et al 2008 Kanai et al 2010 MafB
23. MafB MafB MafB MafB Figure 6 Maf 7 Eychene et al 2008 1 1 1 1 8 12 in C57BL 6 P2X4 p2rx4ko CCL21 plt
24. Figure 19F CO 7 siC si63 si65 Figure 19G A siRNA it Injury allodynia test day 3 day 2 day 1 day0 day 3 day 7 Immunostaining e Real time RT PCR B SI63 C 100 xxx O Contra D 7 2 5 O Contra T BEB psi z HEH psi g 80 ne 2 v O xk E 60 2215 e ae o gt gt 50 52 40 Eq 1 S E e 20 S 05 gt 0 SIC SI63 si65 siC SI63 SI65 30 E Contralateral side side Ipsilateral side 2 0 20 2 2 1 5 9 1 5 siC lt 10 si63 10 si65 5 is 0 5 0 5 amp 0 amp 0 O 1 a 3 5 7 Days after nerve injury Days after nerve injury F Injury siRNA i t A 2 1 A A A A l day 0 day 7 allodynia test day 14 GY O Contra Ipsilateral side E ipsi T pa e SIC 1 5 e si63 D e si65 S 1 0 2 0 5 j E day 7 10 14 Days after nerve injury Figure 19 MafB siRNA DAREA E AR HIRE GRD AHR AN MafB A 3 1 2 3 MafB siRNA 20 pmol
25. DAPI MafB MafB mRNA MafB mRNA MafB mRNA data not shown MafB mRNA mRNA MafB JNK
26. BV2 3 7 formaldehyde MAMA Elm TC 30 PBS blocking buffer 15 blocking buffer Hi MafB 2500 OX 42 1000 4C PBS Alexa488 IgG Alexa546 IgG blocking buffer 1000 1 PBS VectaShield with DAPI VectaShield
27. 8 20 20 8 REX 1 2 Anti MafB rabbit polyclonal antibody Calbiochem Anti Ibal ionized calcium binding adaptor molecule 1 rabbit polyclonal antibody Wako Anti CD11b OX 42 rat monoclonal antibody Clone 5C6 Serotec Anti GFAP glial fibrillary acidic protein rat monoclonal antibody Clone 2 2B10 Zymed Lab Anti APC CC1 mouse monoclonal antibody Clone CC1 Calbiochem Anti NeuN neuronal nuclei mouse monoclonal antibody Clone A60 Chemicon Anti CD68 ED 1 rat monoclonal antibody Clone ED 1 Serotec Alexa Fluor 488 546 conjugated with goat anti mouse rat rabbit IgG antibody Molecular Probes 3 0 5 PAA AAE SF nacalai tesque A O E E GF
28. siRNA MafB MafB IR HRA _45 MafB CCL21 CCL21 MafB CCL21 MafB CCL21 plt MafB CCL21 A AES 7070 TICE UT MafB
29. Higure 1 Woolf and Mannion 1999 Baron 2006 Nicholson 2006 QOL an Touch stimuli Figure 1 C ARE E TEN AS Kuner 2010
30. CCL21 MafB CCL21 MafB CCL21 p7 MafB D CCL21 ARENE CCL21 MafB CCL21 MafB CCL21 MafB
31. 24 2 6 MafB siRNA 25 2 7 MafB shRNA 27 2 8 MafB LPS iii 28 2 9 MafB kk 229 2 10 MafB siRNA 30 2 11 MafB siRNA 25 12 ES FREER AR O ARENA TERME 30 2 12 MafB siRNA HELL DMR RO AHR AT 7 TY ALA E 33 2 13 P2X4 ZARBERIAS Y AICS IT ORR GRO FRE MafB ia 34 2 14 CCL21 MafB kk 35 2 15 CCL21 REIZ ARRAS 7 uY TCD MafB ka 36 2 16 CCL21 MafB Be 3 E 39 3 1 MafB ki 39 3 2 MafB kik 40 3 3 MafB kk sA gt
32. Figure 19A EF siRNA MafB MafB siRNA 3 H BO L4 siRNA siC MafB 2 MafB siRNA si63 si65 Figure 19B MafB siRNA MafB MafB Figure 19C D siRNA siC si63 BE si6S Figure 19E MafB 7 siRNA 1 2 3
33. MafB PBS CCL21 6 MafB f Figure 23A B A o J m sw sr pes HH MCCL21 1 0 5 0 Ohr Thr 6hr 20hr PBS CCLI HH X a Tn MafB intensity per cell Figure 23 CCL21 MafB A B CCL21 0 1 6 20 MafB A MafB B Scale bar 50 um n 5 p lt 0 001 p lt 0 01 vs PBS p lt 0 001 p lt 0 01 vs 0 hr a 35 2 15 CCL21 MafB CCL21 MafB ae CCL21 DRIEN MafB HALEN Le YO ADAH CCL21 60 ng mouse 6 20 MafB pea PBS CCL21 REGAR RIO CH HEIR A CO MafB Figure 24A E MafB
34. CCL21 MafB MafB Figure 26 MafB Damaged primary afferent neuron Neuropathic pain O ors Dorsal horn neuron CA pa S Hyperexcitability IL 1f IL 6 TNFa CatS microglia Figure 26 882707 71283 S MafB _ 46
35. MafB MafB Aziz et al 2006 Bychene et al 2008 siRNA MafB siRNA 3 3 MafB siRNA MafB MafB MafB siRNA 2 3 ATP Toll like receptor 2 2
36. MafB 7 siRNA ee loa MafB MafB MafB BV2 MafB MafB
37. 1 MafB MafB BSCB Zhang et al 2007 Cao and DeLeo 2008 Costigan et al 2009 Echeverry et al 2011 MafB Kelly et al 2000 Bakri et al 2005 Friedman 2007 MafB 1 Ibal 39 MafB MafB
38. P2X4 MafB P2X4 3 Tsuda et al 2003 MafB P2X4 MafB P2X4 CC CCL21 Biber et al 2011 CCL21 12 A DRG P2X4 CCL21 CCL21 plt
39. pCAG HIVep pCMV VSV G RSV Rev amp amp BIZ PEI polyethylenimine HEK293T 37C 5 CO 12 forskolim 10 uM 48 ERRELE TOR Se Ee Fh 10 wiv PEG polyethylene glycol 4C 2 600xg 30 PBSC TERRA BV2 GFP sense GCCCGAGTTGATCTATCAA sac antisense TTGATAGATCAACTCGGGC sense ACGGCTTCGATCTTCTCGA ne antisense TTGAGAAGGTCGAAGTCGT PeR sense AGTAACTATCAGCAGGTGA antisense TCATCTGCTGGTAGTTGCT Table 2 MafB shRNA b BV2 37C 5 CO BV2 6 24 96
40. aR Fr 8 2012 2 2 ATE Intrathecal delivery of PDGF produces tactile allodynia through its receptors in spinal microglia Junya Masuda Makoto Tsuda Hidetoshi Tozaki Saitoh Kazuhide Inoue Molecular Pain 2009 5 23 These authors contributed equally to this work PDGF 537 07 4 KT IC BU OFS 7 TY To ER EH wW hE MS 52 2009 6 21 A 24 Spinal microglia mediate PDGF induced tactile allodynia in rats Junya Masuda Makoto Tsuda Hidetoshi Saitoh Kazuhide Inoue Fukuoka Purine 2009 2009 7 23 25 Analysis of microglial activation in tissue slice using two photon imaging Junya Masuda Tozaki Saitoh Hidetoshi Makoto Tsuda Ka
41. 10 BAGEL Ea PRA LER RNA 75 ethanol 500 wl JZ _15 5 RNA WR Jal Sb RNase free water 12 ul RNase free DNase I 0 4 unit RNase inhibitor 3 unit DNase D 37C 30 RNase free water 70 ul phenol chloroform isoamylalchol 25 24 1 100 wl 13 2 isopropanol IZ k Six ethanol RNA WIZ RNase free water 10 ul Nanodrop spectrophotometer Nanodrop RNA Y 2 RNA RNase free water 50 ng l PrimeScript Reverse Transcriptase Takara BUDA AICI 5x PrimeScript Buffer PrimeScript RT Enzyme Mix I Oligo dT Primer 50 uM Random 6 mers 100 uM total RNA 250 ng T Gradient Biometra 37C 15 85C 5 k KERZ 4C PCR
42. Aziz et al 2009 MafB Beggs and Salter 2007 Echeverry et al 2008 Suter et al 2009 Tsuda et al 2011 O RARER OAS 7071070 MafB 8 MafB BV2 MafB MafB siRNA BV2 MafB shRNA BV2 BV2 MafB cyclin D2 4
43. MafB E Mania rior 2 4 RAFTER AR OAH AIC SIT MafB MafB EdU 12 24 48 L4 FRIO MafB EdU MafB Ibal 24 Figure 12D EdU 48 Figure 13A B MafB EdU EdU MafB Higure 13B D MafB EdU E MafB Wi EdU O MafB EdU mm _ Cont Ipsi Cont Ipsi L Cont Ipsi _ 12hr 24hr 48hr 100 Cell number Cn NO VI MafB negative 20 EdU positive cells 48hr Ipsi Contralateral Ipsilateral Figure 13 KRRB DAM MafB
44. Neurodegeneration Inflammation Infection Microglial activation Ramified morphology Hypertrophic morphology Dynamic motile processes Proliferation Continuous surveillance Chemotaxis and Migration Rapid chemotactic response to injury Phagocytosis Antigen presentation Cytokine production and release Figure 3 Watkins and Maier 2003 Tsuda et al 2005 Narita et al 2006 Beggs and Salter 2007 Echeverry et al 2008 Zhang et al 2008 FICHE 7 TY 707
45. 3 4 MafB MafB ARTA AREA te ECS 7 TU ACES BE HS MafB JE WAKE ATP Nakatsuka and Gu 2001 Cook and McCleskey 2002 Inoue et al 2005 AB REE BIC KO ARS 7 TU TRE P2X4 Tsuda et al 2003 Tsuda et al 2009b ATP P2X4 MafB P2X4 MafB P2X4 MafB
46. Chloroform Hayashi Pure Chemical Click iT EdU Alexa Fluor 555 Imaging Kit Invitrogen DNase I Roshe Dulbecco s modified eagle medium DMEM GIBCO Easy dilution Takara ECL Western Blotting Detection Reagents Amersham Biosciences 5 ethynyl 2 deoxyuridine EdU Invitrogen Ethanol nacalai tesque Fetal bovine serum FBS GIBCO Formaldehyde solution Wako Glycerol Wako Glycogen nacalai tesque Horse serum HS GIBCO 2 Mercaptoethanol SIGMA Methanol nacalai tesque Normal goat serum Vector Labolatories Inc O C T compound SAKURA Paraformaldehyde Wako Penicillin streptomycin liquid GIBCO Phenol Chroloform IsoamylAlchol 25 24 1 Invitrogen Phosphate buffered saline PBS GIBCO Phusion DNA Polymerase Finnzymes Poly L lysine SIGMA Premix Ex Taq Takara PrimeScript Reverse Transcriptase Takara 2 Propanol nacalai tesque Random 6 mer primer Takara RNA later solution Ambion RNase free water GIBCO RNase inhibitor Promega RNeasy mini plus kit Qiagen Sucrose Wako TRIsure Nippon genetics Triton X 100 Wako Trypan blue stain 0 4 GIBCO 0 25 Trypsin EDTA GIBCO UltraPure dNTP Mix Clontech VectaShield Vector Labolatories Inc 4 A a 4 paraformaldehyde PBS 40 g L paraformaldehyde HA Z IMZ MERAL To WER SUE CHO LU RO pH
47. 140 gt 162 7 Maf 236 370 Maf Nishizawa et al 1989 Hang and Stein 2011 Maf MafF MafG MafK DNA a gt Ln un na NRL Transactivation domain Phosphorylation bZIP ES Extended homology region Sumoylation Maf Basic domain Acetylation _ Leucine zipper MafA MafB c Maf Maf Nrl I Glycine rich sequence C bZIP NA EX Histidine rich sequence SUMO Figure 6 Z Kataoka 2007 Bychene et al 2008 MafB 1123 ME HEREC BST 4 Bergsagel and Kuehl 2005 van Stralen et al 2009 MafB
48. 4 C 48 0 3 Triton X 100 PBS Alexa488 Alexa546 IgG IgG blocking buffer 1000 FERL 3 0 3 Triton X 100 PBSM XU PBS AMUA Aminopropyltriethoxisilane APS PBS VectaShield with DAPI VectaShield 4 _ 14 LSMS10 Zeiss EdU Click iT EdU Alexa Fluor 555 Imaging Kit Invitrogen 1 8 APS 12
49. MafB MafB CCL21 CCL21 pt wt plt 1 3 T4 MafB wt plt MafB Figure 25A pit MafB MafB Figure 25B C wt plt 3 MafB Figure 25D A Contralateral Ipsilateral Contralateral Ipsilateral B 150 JE Contra C Contra MA psi MA psi p 0 17 J 2 5 100 5 2 g 53 h 1 5 EN C x ae 0 Eq 1 A Ec r mom 05 i day1 day3 day1 day3 dayl day3 dayl day3 wt plt wt plt 37 J E15 E 15
50. siRNA MafB 3 siRNA 48 EdU data not shown MafB Azizet al 2006 siRNA MafB
51. 4 4 5 4 paraformaldehyde WH FIC CAE eT OT TOR VF 30 sucrose ARICA ARI 4C 24 Rein Lic BAL FDA 30 sucrose Amb amp HER Lich ARE RO LATS LU CW ARES 2 8 CRW Bo de ARO FF HE 4 O C T Compound 80C Es 2 80C Leica 20 30 30 um PBS O C T Compound 0 3 Triton X 100 PBS blocking buffer 2 blocking buffer MafB 5000 4 Ibal 2000 CD1lb 1000 fF Ht GFAP 1000 APC 200 NeuN 200 CD68 500
52. 4 1 9 RT PCR 1 total RNA A 30 mg ml 0 2 ml PBS 20 ml HEE UL CAL Le BEV YC AREAL 4 RNA later 12 AMEk glycogen 0 25 mg ml TRIsure 10 RNA 24 BV2 glycogen 0 25 mg ml TRIsure RNA B RNA TRIsure ZX 300 pl chloroform 60 wl 2 4C 15000 rpm 13 RNA 2 isopropanol 20C 30
53. 30 1 3 mL m ee Figure 8 Ses Ses Figure 8 2 50 von Frey filament 6 No 2 44 0 04 g No 4 31 2 0 g No 3 22 0 162 x X
54. A 12 24 48 L4 WHER AIC KIT A MafB EdU Scale bar 200 um B L4 MafB BdU MafB EdU n 3 4 p lt 0 001 p lt 0 01 vs Cont C 48 L4 AE AIC SST MafB EdU Scale bar 50 um D 48 L4 FRE AIC KUT D EdU MafB 29A 2 5 MafB CD68 MafB 7 CD68 CD68 MafB Figure 14 Contralateral Ipsi
55. siRNA Table 1 sense CAGUGGAGGCGUCUUUACUCGAUCA ES antisense UGAUCGAGUAAAGACGCCUCCACUG l sense GCGUCCAGCAGAAACAUCACCUGGA 5103 antisense UCCAGGUGAUGUUUCUGCUGGACGC pe sense GAGAAACUCGCCAACUCCGGCUUCA antisense UGAAGCCGGAGUUGGCGAGUUUCUC Table 1 MafB siRNA B CCL21 CCL21 PBS 100 ug ml PBSON M amp H 30 pg ml 60 ng CCL21 2 PBS 3 uW C EdU BdU PBS paraformaldehyde 2 0 2 ml 50 mg kg 2 A MafB siRNA siRNA Lipofectamine RNAiMAX invitrogen 10 nM 12
56. Z stack MafB Figure 11F A MafB 0X42 MafB 0X42 E uo E psi Q 5 150 100 t B MafB GFAP MafB NeuN MafB CC1 50 0 F MafB OX42 DAPI MafBT cell number OX42 negative C o E one D 7 6 5 SS Sa _ C Contra 0X42 m E ipsi OX42 positive 93 5 0X42 T MafB positive cells day3 Ipsi Figure 11 ARAITZ MafB A B 3 L4 HR AIC KU MafB OX42 7 GFAP NeuN CC1 COMB BRA Scale bar 50 um O 3 H HO L4 Ae AIC KIT SD MafB OX42 n 3 p lt 0 001 vs OX42 p lt 0 01 vs OX42 Contra D 3 L4 MafB OX42 E 3 AE OAH Ibal n 3 p lt 0 001 vs Contra EF 3 L4 Aa MafB OX42 DAPI Z stack Scale bar 50 um _ 20 2 3
57. MafB 512 MafB in vitro B LU in vivo 3 1 MafB MafB OV CRA LE AMARE ERO AEN MafB mRNA 3 21 MafB MafB FEA MafB MafB MafB MafB mRNA
58. ATP P2X4 P2X4 Tsuda et al 2003 in vitro P2X4 Tsuda et al 2003 P2X4 P2X4 brain derived neurotrophic factor BDNE GABA K CT KCC2
59. IRF8 siRNA IRFS IRF8 LAUDO RH ramified
60. 2012 MafB IRF8 IRFS IRF8 ARTA RTE GRO AREA MafB BV2 MafB IRFS data not shown IRF8 IRFS MafB 33 MafB MafB IRF8 IRFS
61. 4 X 50 No 4 31 Q0g 2 0 g 50 AVE Paw withdrawal threshold g 10 29 7 10 000 Xf k x 1 4 ARENDS ST SESE 1 32G 2 9 cm 3 cm PE 10 2 32G PE 10 1 cm 32G 5 0 2 70 10 PBS 2 BEN DOT
62. MafB L4 MafB 1 3 7 L4 AHBICBVY CT MafB OX 42 MafB Figure 12A MafB OX 42 1 3 7 Figure 12B MafB 1 7 Figure 12C Ibal 3 Figure 12D MafB Figure 12E Ipsilateral side B C Contra v XXX _ Contra ou ER c 3 E ipsi 2 E ipsi 5 e XXX nD in 5
63. Mori et al 2001 Nakano and Gunn 2001 Rappert et al 2002 plt CCL21 CCL21 CCL21 MafB CCL21 CCL21 MafB p7 MafB MafB CCL21 ArH 70701 TICE UC MafB
64. B C D MafB siRNA 3 L4 MafB 6 MafB OX42 CC MafB D Scale bar 50 um n 3 p lt 0 001 p lt 0 01 p lt 0 05 vs Contra p lt 0 001 p lt 0 05 vs siC Ipsi E MafB siRNA n 6 p lt 0 001 vs Contralateral side p lt 0 001 p lt 0 01 p lt 0 05 vs Ipsilateral side of siC 7 1 2 3 MafB siRNA 47 7 AA HE 20 pmol G 7 MafB siRNA n 4 p lt 0 001 vs Contra eo e 2 11 MafB siRNA MafB siRNA mRNA RT PCR 3 HA OL4A
65. MafB triggers functional changes of spinal microglia that contributes to allodynia following peripheral nerve injury Transcriptional factor MafB regulates microglial proliferation and gene expression Junya Masuda Tozaki Saitoh Hidetoshi Sosuke Yoneda Makoto Tsuda Kazuhide Inoue Neuroscience 2011 e ES 2011 11 12 16 MafB BR ie 64 KKR 2011 11 20 aR ie 2011 12 21 22 re MafB
66. Figure 22A C A wild type day3 N EEA Contralateral lpsilateral p2rx4ko day3 ane Contralateral Ipsilateral B Ciconra JE Contra HH ipsi MA psi XXX 15 x p 0 06 5 100 SY 2 w 3 Uv Za t Ow 1 5 cE X O 50 1 Eg mo 05 0 0 wt p2rx4ko wt p2rx4ko Figure 22 p2rx4ko Y Y AlCASIT BARA FRET i DAHER ES 70707 CD MafB A wt p2rx4ko 3 La APR FACT MafB Scale bar 200 um B C wt p2rx4ko 541 3 HHO MafB OX42 B MafB C n 3 0 lt 0 001 p lt 0 05 vs Contra o 2 14 CCL21 MafB MafB DRG CCL21 Biber et al 2011 CCL21 10 ng ml MafB
67. P2X4 CCL21 MafB MafB MafB MafB MafB 44 Shh Oy J MafB D RH
68. 10 0 5 ml DNase I 10 mg ml 30 MAH LIE DNA Trypsin 5m PBSC 45 ml 1000Xg 6 10 ml 100 um FALCON 10 ml 50 ml 10 ug ml Poly L lysine TIS cm Corning 1 5 2X 10 cells 10 ml flask 37C 10 CO gt 2 2 3 O IS
69. 3 PCR PCR Premix Ex Taq Takaray SYBR THUNDERBIRDqPCR Mix Toyobo cDNA Z FA x Forward Reverse TaqMan Premix Ex Tag ROX Reference Dye I ABI 7500 Real Time PCR System Applied Biosystems PCR 18s ribosomal RNA Primer Probe Applied Biosystems 7300 System SDS Software 1 3 1 Applied Biosystems probe primer Table 3 gene 5 to 3 sequence GCCTTCTTCTCCCAGCTTCA TCGGGATTCATCTGCTGGTAGT TCCGACTGAACAGAAGACCCATCTCGA Forward primer mafB Reverse primer Taqman Probe p2rx4 Forward primer ACAACGTGTCTCCTGGCTACAAT purinergic Reverse primer GTCAAACTTGCCAGCCTTTCC receptor P2X4 Taqman Probe CAATGAGCAACGCACACTCACCAAGG p2rx7 Forward primer TGCAGCTGGAACGATGTCTT purinergic Reverse primer CCAAAGCAAAGCTCTAATGTAGGAA receptor P2X7 Taqman Probe TATGAGACAAACAAAGTCACCCGGATCCA p2ry6 Forward primer AACCGCACTGTGTGCTACGA purinergic Reverse primer GCGACAATAACAAGCCAGTAAGG receptor P2Y6 Taqman Probe TGGCCCTCACGGTCATCGGC le p2ry12 Forward prime
70. QOL
71. day 1 z day3 N W wt ipsi N E wt ipsi plt ipsi S E pit ipsi amp 10 10 E E J E g 3 5 a y lt gt gt lt O O e 0 2 0 0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 Relative MafB immunofluorescence intensity Relative MafB immunofluorescence intensity Figure 25 plt 77 ARIJ SATA 1512 OF HERA 7 TU CD MafB A wt plt 1 3 L4 Phe E MafB Scale bar 50 um B O wt plt 1 3 MafB OX42 B MafB C n 3 p lt 0 001 p lt 0 01 p lt 0 05 vs Contra p lt 0 05 vs wt day3 Ipsi D wt plt MRANTI MafB MafB _ 38 3 zh ATH Cli FRR ERI ET LV OD AICS SERS AT MafB tL ES L4 FHT BRO LAFZI A MafB MafB siRNA
72. 2 6 48 B MafB shRNA a MafB 2 shRNA control H EF1 promoter shRNA sh6 sh21 EF1 promoter OF shRNA shC Table 2 Figure 9 MafB shRNA EGFP EF Bem He PER AG Cat Ve pENTR4 H1 RIKEN CSI Gateway cloning system Invitrogen Figure 9 H1 shRNA EF EGFP
73. 7 4 4C b 30 sucrose PBS 30 w v sucrose 4C c Blocking buffer 0 3 Triton X 100 PBS WZ Z HK EDS 3 0 v v normal goat serum B a 3 7 Formaldehyde 37 Formaldehyde solution PBS 10 pH 7 4 b Blocking buffer 0 3 Triton X 100 PBS 42 Z BK EDS 3 0 v v normal goat serum O DMEM 10 FBS 50 unit ml penicillin 50 ug ml streptomycin BV2 DMEM 5 FBS 50 unit ml penicillin 50 ug ml streptomycin 2 mM Glutamate 1 2 Kim and Chung 1992 Higure 7 29 98 LS
74. mterferon regulatory factor 5 Taqman Probe Forward primer Reverse primer Tagman Probe Forward primer Reverse primer Taqman Probe CGCACACCATTCAGCCTTATCCCAG TGGTGACTGGGTATACTGCCTATG TGCCCCCGTAGTAAAAGTTGA CCTCAGCCGTACAAGATCTACGA GTAGCATTCTCTGGAGCTCTTCCT CCAACGGCCCTGCTCCCACA Table 3 RT PCR Primer Probe 1 10 96 BV2 SF nacalai tesque SF 10 3 450 nm 1 11 Student s t test one way ANOVA two way ANOVA two way repeated measures ANOVA Bonferroni posttests 18 2 1 14 SRC BI SD MafB LA L4 FED RNA Real tme PCR
75. MafB mRNA MafB mRNA 3 21 Figure 10A MafB MafB 3 MafB Figure 10B MafB MafB MafB Figure 10C D A 25 C Contra 5 2 E ipsi ERE yyy T 9 ex FEY KH 2 1 5 Vv lt Z oc E e 0 5 0 d0 d0 5 d1 d2 d3 d5 d7 d10 d14 d21 d28 C Contra C 200 O Contra D u 3 M Ipsi day 3 W ipsi x D o 25 Ro 21504 xx oY NN SR U gt 5 Q o a DEE x ep 15 NY 2 ES 1 S 50 EE a Contralateral Ipsilateral aa 0 0 Figure 10 ATREA ate DAP HEC
76. Ohashi PS 2008 LPS TLR4 signal transduction pathway Cytokine 42 145 151 Machiya J Shibata Y Yamauchi K Hirama N Wada T Inoue S Abe S Takabatake N Sata M Kubota I 2007 Enhanced expression of MafB inhibits macrophage apoptosis induced by cigarette smoke exposure Am J Respir Cell Mol Biol 36 418 426 Maguire Zeiss KA Federoff HJ 2010 Future directions for immune modulation in neurodegenerative disorders focus on Parkinson s disease J Neural Transm 117 1019 1025 McMahon SB Malcangio M 2009 Current challenges in glia pain biology Neuron 64 46 54 Melzack R Wall PD 1965 Pain mechanisms a new theory Science 150 971 979 Milligan ED Watkins LR 2009 Pathological and protective roles of glia in chronic pain Nat Rev Neurosci 10 23 36 Monsonego A Weiner HL 2003 Immunotherapeutic approaches to Alzheimer s disease Science 302 834 838 Moore KA Kohno T Karchewski LA Scholz J Baba H Woolf CJ 2002 Partial peripheral nerve injury promotes a selective loss of GABAergic inhibition in the superficial dorsal horn of the spinal cord J Neurosci 22 6724 673 1 Mori S Nakano H Aritomi K Wang CR Gunn MD Kakiuchi T 2001 Mice lacking expression of the chemokines CCL21 ser and CCL19 plt mice demonstrate delayed but enhanced T cell immune responses J Exp Med 193 207 218 Nakajima K Kohsaka S 2001 Microglia activation and their significance in the central nervous system J Biochem 130 169 175 Nakano H Gunn MD 20
77. PCNA Tba1 IRF8 IRFS MafB mRNA Figure 15C A MafB OX42 DAPI S 15 aie 5 Sl siC si63 5 B si63 lt E si65 E 05 ARK mafB i i i 05 i 05 l 0 5 0 5 0 5 1 0 5 JOBA A Cal OEN i p2rx4 p2rx7 p2ry6 p2ry12 tlr2 tlr4 1 5 1 5 1 5 1 5 0 5 ssa 05 si US a 0 5 HHH 1 ect 0 0 a 0 0 il1b il6 tnf ctss 1 5 1 5 1 5 1 5 1 5 1 1 1 1 1 XX 0 5 0 5 0 5 HHH 0 5 0 5 ee XX 0 E 0 0 0 0 Ccnd2 pcna aif1 iba1 irf8 irf5 Figure 15 BV2 siRNA MafB A MafB siRNA 48 BV2 MafB OX42 DAPI Scale bar 50 um B C MafB siRNA 48 BV2 MafB B CO mRNA RT PCR n 5 p lt 0 001 p lt 0 01 p lt 0 05 vs siC 296 2 7 MafB shRNA
78. e et al 2007 Glutamate ee e Er CX3CR1 CCR2 Inflammatory BDNF gt Verge et al 2004 Abbadie 2005 pea cytokines Y o cr gt GABA Glycine Clark et al 2007 Zhang et al 2007 ror niii A j Dorsal horn neuron TrkB 9 enh lote Zhuang et al 2007 Abbadie et al y A aai 2009 Clark et al 2009 Depolarization Hyperexcitability Depolarization Figure4 PRI PALES modified from Inoue et al 2007 Neuropathic pain TL 1B IL 6 TNEF o moue 2006 Kawasaki et al 2008a interferon regulatory factor 8 IRF8 2011 IRFS ARRIR RE FaU T TRR
79. 0 1 ml PBS C 3 11 PBS 1 0 23 3 L4 1 5 PREFERS Z u YY TORREK LORIE 0 1 70 PBSC 2 0 25 Trypsin EDTA 5 ml 50 mm 5Sml Trypsin EDTA 37C
80. 106 Basbaum AI Fields HL 1979 The origin of descending pathways in the dorsolateral funiculus of the spinal cord of the cat and rat further studies on the anatomy of pain modulation J Comp Neurol 187 513 531 Beggs S Salter MW 2007 Stereological and somatotopic analysis of the spinal microglial response to peripheral nerve injury Brain Behav Immun 21 624 633 Bergsagel PL Kuehl WM 2005 Molecular pathogenesis and a consequent classification of multiple myeloma J Clin Oncol 23 6333 6338 Biber K Tsuda M Tozaki Saitoh H Tsukamoto K Toyomitsu E Masuda T Boddeke H Inoue K 2011 Neuronal CCL21 up regulates microglia P2X4 expression and initiates neuropathic pain development 49 EMBO J 30 1864 1873 Binshtok AM Wang H Zimmermann K Amaya F Vardeh D Shi L Brenner GJ Ji RR Bean BP Woolf CJ Samad TA 2008 Nociceptors are interleukin 1beta sensors J Neurosci 28 14062 14073 Cao L DeLeo JA 2008 CNS infiltrating CD4 T lymphocytes contribute to murine spinal nerve transection induced neuropathic pain Eur J Immunol 38 448 458 Chaplan SR Bach FW Pogrel JW Chung JM Yaksh TL 1994 Quantitative assessment of tactile allodynia in the rat paw J Neurosci Methods 53 55 63 Chessell IP Hatcher JP Bountra C Michel AD Hughes JP Green P Egerton J Murfin M Richardson J Peck WL Grahames CB Casula MA Yiangou Y Birch R Anand P Buell GN 2005 Disruption of the P2X7 purinoceptor gene abolishes chronic inflamma
81. Alzheimer s disease amyloid beta protein via a scavenger receptor Neuron 17 553 565 Pocock JM Kettenmann H 2007 Neurotransmitter receptors on microglia Trends Neurosci 30 527 535 Raivich G 2005 Like cops on the beat the active role of resting microglia Trends Neurosci 28 571 573 Ransohoff RM Cardona AE 2010 The myeloid cells of the central nervous system parenchyma Nature 468 253 262 Rappert A Biber K Nolte C Lipp M Schubel A Lu B Gerard NP Gerard C Boddeke HW Kettenmann H 2002 Secondary lymphoid tissue chemokine CCL21 activates CXCR3 to trigger a Cl current and chemotaxis in murine microglia J Immunol 168 3221 3226 Saijo K Glass CK 2011 Microglial cell origin and phenotypes in health and disease Nat Rev Immunol 11 775 787 Samad TA Moore KA Sapirstein A Billet S Allchorne A Poole S Bonventre JV Woolf CJ 2001 Interleukin 1beta mediated induction of Cox 2 in the CNS contributes to inflammatory pain hypersensitivity Nature 410 471 475 Sarrazin S Mossadegh Keller N Fukao T Aziz A Mourcin F Vanhille L Kelly Modis L Kastner P Chan S Duprez E Otto C Sieweke MH 2009 MafB restricts M CSF dependent myeloid commitment divisions of hematopoietic stem cells Cell 138 300 313 Sieweke MH Tekotte H Frampton J Graf T 1996 MafB is an interaction partner and repressor of Ets 1 that inhibits erythroid differentiation Cell 85 49 60 Steinhauser C Gallo V 1996 News on glutamate receptors in glial c
82. IS IT 5 MafB A Opsi Contra L4 FRANZI 4 MafB mRNA RT PCR n 4 5 p lt 0 001 p lt 0 01 vs Contra B C D 3 L4 MafB B MafB C MafB Scale bar 200 um n 3 9 lt 0 01 p lt 0 05 vs Contra 19 2 2 AFA OSI A MafB ARE MIRES O CEBA A MafB 3 HBO L4 FPHBIC BV YC MafB MafB OX 42 Figure 11A D Ibal 110E DAPI
83. U x o gt S 50 Eg I 7 cn E 2 0 0 day1 day3 day7 day1 day3 day7 D 250 Contra 200 W ipsi 150 100 0 day1 day3 day Iba1 cell number E amp 30 30 E gt 3025 Contra 125 ore psi gt E ps 220 320 45 215 y y 10 y 10 3 3 gt lt gt O 5 Q 5 e E 0 2 0 E 1 2 Yo amp 5 0 1 2 3 4 5 6 7 Relative MafB immunofluorescence intensity Relative MafB immunofluorescence intensity 30 E Contra 2 E psi 20 E aS D 10 N x S ga 0 YY 2 EAS O F Relative MafB immunofluorescence intensity Figure 12 MafB A 1 3 7 L4 MafB Scale bar 200 um B C L4 MafB OX42 B MafB C n 3 4 p lt 0 001 p lt 0 01 p lt 0 05 vs Contra D L4 TIbal n 3 p lt 0 001 vs Contra E 1 3 7 L4 MafB
84. it CA GINA ae AAA MD IIA PAA E A 100 w wd 50 SIC si63 SI65 Figure 21 MafB siRNA A B MafB siRNA 3 L4 Ibal A Ibal B Scale bar 200 um 50 um n 3 p lt 0 001 p lt 0 01 vs Contra 33 2 13 P2X4 MafB MafB ATP P2X4 Tsuda et al 2003 Coull et al 2005 wt P2X4 p2rx4ko 3 T4 MafB wt p2rx4ko Y MafB MafB
85. 0 0 il1b tnf ctss aif1 irf8 irf5 Figure 16 BV2 shRNA MafB A MafB shRNA BV2 MafB GFP Scale bar 50 um C MafB shRNA 72 BV2 MafB B Eo C mRNA RT PCR n 5 p lt 0 001 p lt 0 01 p lt 0 05 vs shC 297 2 8 MafB LPS MafB MafB siRNA 48 MafB BV2 MANIC AGERE UT LPS 100 ng ml LPS 3 IL 1B IL 6 TNF a mRNA RT PCR LPS siC si63 si6S IL 1B IL 6 Figure 17 il1b il6 tnf O si 2000
86. 01 Gene duplications at the chemokine locus on mouse chromosome 4 multiple strain specific haplotypes and the deletion of secondary lymphoid organ chemokine and EBI 1 ligand chemokine genes in the plt mutation J Immunol 166 361 369 Nakatsuka T Gu JG 2001 ATP P2X receptor mediated enhancement of glutamate release and evoked EPSCs in dorsal horn neurons of the rat spinal cord J Neurosci 21 6522 6531 Napoli I Neumann H 2010 Protective effects of microglia in multiple sclerosis Exp Neurol 225 24 28 Narita M Yoshida T Nakajima M Miyatake M Takagi T Yajima Y Suzuki T 2006 Direct evidence for spinal cord microglia in the development of a neuropathic pain like state in mice J Neurochem 97 1337 1348 Nichols ML Allen BJ Rogers SD Ghilardi JR Honore P Luger NM Finke MP Li J Lappi DA Simone DA Mantyh PW 1999 Transmission of chronic nociception by spinal neurons expressing the substance P receptor Science 286 1558 1561 Nicholson B 2006 Differential diagnosis nociceptive and neuropathic pain Am J Manag Care 12 S256 262 e Nimmerjahn A Kirchhoff F Helmchen F 2005 Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo Science 308 1314 1318 Nishizawa M Kataoka K Goto N Fujiwara KT Kawai S 1989 v maf a viral oncogene that encodes a leucine zipper motif Proc Natl Acad Sci U S A 86 7711 7715 Paresce DM Ghosh RN Maxfield FR 1996 Microglial cells internalize aggregates of the
87. 011 MafA and MafB activity in pancreatic beta cells Trends Endocrinol Metab 22 364 373 Hanisch UK 2002 Microglia as a source and target of cytokines Glia 40 140 155 Hanisch UK Kettenmann H 2007 Microglia active sensor and versatile effector cells in the normal and pathologic brain Nat Neurosci 10 1387 1394 Hansson E Ronnback L 2003 Glial neuronal signaling in the central nervous system FASEB J 17 341 348 Hashizume H DeLeo JA Colburn RW Weinstein JN 2000 Spinal glial activation and cytokine expression after lumbar root injury in the rat Spine 25 1206 1217 Honore P Wade CL Zhong C Harris RR Wu C Ghayur T Iwakura Y Decker MW Faltynek C Sullivan J Jarvis MF 2006 Interleukin lalphabeta gene deficient mice show reduced nociceptive sensitivity in models of inflammatory and neuropathic pain but not post operative pain Behav Brain Res 167 355 364 Inoue K 2006 The function of microglia through purinergic receptors neuropathic pain and cytokine release Pharmacol Ther 109 210 226 Inoue K 2008 Purinergic systems in microglia Cell Mol Life Sci 65 3074 3080 Inoue K Tsuda M 2009 Microglia and neuropathic pain Glia 57 1469 1479 Inoue K Tsuda M Koizumi S 2005 ATP receptors in pain sensation Involvement of spinal microglia and P2X 4 receptors Purinergic Signal 1 95 100 Inoue K Koizumi S Tsuda M 2007 The role of nucleotides in the neuron glia communication responsible for the brain functions J Neuroch
88. 25 Arruda JL Colburn RW Rickman AJ Rutkowski MD DeLeo JA 1998 Increase of interleukin 6 mRNA in the spinal cord following peripheral nerve injury in the rat potential role of IL 6 in neuropathic pain Brain Res Mol Brain Res 62 228 235 Artner I Le Lay J Hang Y Elghazi L Schisler JC Henderson E Sosa Pineda B Stein R 2006 MafB an activator of the glucagon gene expressed in developing islet alpha and beta cells Diabetes 55 297 304 Artner I Blanchi B Raum JC Guo M Kaneko T Cordes S Sieweke M Stein R 2007 MafB is required for islet beta cell maturation Proc Natl Acad Sci U S A 104 3853 3858 Artner I Hang Y Mazur M Yamamoto T Guo M Lindner J Magnuson MA Stein R 2010 MafA and MafB regulate genes critical to beta cells in a unique temporal manner Diabetes 59 2530 2539 Aziz A Soucie E Sarrazin S Sieweke MH 2009 MafB c Maf deficiency enables self renewal of differentiated functional macrophages Science 326 867 871 Aziz A Vanhille L Mohideen P Kelly LM Otto C Bakri Y Mossadegh N Sarrazin S Sieweke MH 2006 Development of macrophages with altered actin organization in the absence of MafB Mol Cell Biol 26 6808 68 18 Bakri Y Sarrazin S Mayer UP Tillmanns S Nerlov C Boned A Sieweke MH 2005 Balance of MafB and PU 1 specifies alternative macrophage or dendritic cell fate Blood 105 2707 2716 Baron R 2006 Mechanisms of disease neuropathic pain a clinical perspective Nat Clin Pract Neurol 2 95
89. 400 H 80 si 63 XX i 7 E si 65 1500 300 60 XX lt gt 1000 200 40 cr V 500 i 100 20 J oc die 0 0 LPS 100 ng ml LPS 100 ng ml LPS 100 ng ml Figure 17 MafB BV2 LPS MafB siRNA 48 BV2 LPS 100 ng ml 3 4 kA Y IL 1B IL 6 TNF a mRNA RT PCR n 5 p lt 0 001 vs LPS siC p lt 0 05 vs LPS siC 28 2 9 MafB MafB BV2 MafB MafB siRNA 48 BV2 24 48 72 sie63 si65 siC Figure 18A B MafB shRNA BV2 Fig
90. 8 Dixon WJ 1980 Efficient analysis of experimental observations Annu Rev Pharmacol Toxicol 20 441 462 Echeverry S Shi XQ Zhang J 2008 Characterization of cell proliferation in rat spinal cord following peripheral nerve injury and the relationship with neuropathic pain Pain 135 37 47 Echeverry S Shi XQ Rivest S Zhang J 2011 Peripheral nerve injury alters blood spinal cord barrier functional and molecular integrity through a selective inflammatory pathway J Neurosci 31 10819 10828 Eychene A Rocques N Pouponnot C 2008 A new MAFia in cancer Nat Rev Cancer 8 683 693 Fields RD Stevens Graham B 2002 New insights into neuron glia communication Science 298 556 562 Friedman AD 2007 Transcriptional control of granulocyte and monocyte development Oncogene 26 68 16 6828 _ 50 Fujihara M Muro M Tanamoto K Suzuki T Azuma H Ikeda H 2003 Molecular mechanisms of macrophage activation and deactivation by lipopolysaccharide roles of the receptor complex Pharmacol Ther 100 171 194 Ginhoux F Greter M Leboeuf M Nandi S See P Gokhan S Mehler MF Conway SJ Ng LG Stanley ER Samokhvalov IM Merad M 2010 Fate mapping analysis reveals that adult microglia derive from primitive macrophages Science 330 841 845 Gordon GR Baimoukhametova DV Hewitt SA Rajapaksha WR Fisher TE Bains JS 2005 Norepinephrine triggers release of glial ATP to increase postsynaptic efficacy Nat Neurosci 8 1078 1086 Hang Y Stein R 2
91. A in vivo MafB siRNA MafB MafB siRNA mRNA vitro ATP Toll like receptor2 siRNA MafB
92. AHEIC 4517 S MafB mRNA MafB siRNA Figure 20A BV2 MERTE ATP SAS Toll RXRA REED RIA A S Tba1 IRF8 IRFS mRNA ATP Toll like receptor 2 TLR2 Figure 20B A mafB lii SIC si63 si65 _ Contra BMD psi a N gt i N ia Relative mRNA expression O ih 1 5 3 4 2 xx 13 1 a gt 2 0 5 i 0 5 i 0 5 l 0 0 p2rx4 p2rx7 p2ry12 TS tlr4 cd68 3 XA 1 5 1 0 5 0 0 ctss aif1 iba1 irf8 Irf5 HH HH O N Ww A UU Mb il6 Figure 20 MafB siRNA ORMENE LLL RIE BR ORA ENE FBLA A B MafB siRNA 3 LA MafB A B
93. T IAE PAN FENY TT IAE PMA Yaksh Yaksh et al 1980 2 WEP 98 26G PBS L4 1 cm 20G 5 0 PARLU 3 0 0 5 mg ml
94. Yano T Tsujikawa T Kitano J Tozaki Saitoh H Koyanagi S Ohdo S Ji RR Salter MW Inoue K 2011 JAK STAT3 pathway regulates spinal astrocyte proliferation and neuropathic pain maintenance in rats Brain 134 1127 1139 van den Pol AN Obrietan K Chen G 1996 Excitatory actions of GABA after neuronal trauma J Neurosci 16 4283 4292 van Stralen E van de Wetering M Agnelli L Neri A Clevers HC Bast BJ 2009 Identification of primary MAPB target genes in multiple myeloma Exp Hematol 37 78 86 Verge GM Milligan ED Maier SF Watkins LR Naeve GS Foster AC 2004 Fractalkine CX3CL1 and fractalkine receptor CX3CR1 distribution in spinal cord and dorsal root ganglia under basal and neuropathic pain conditions Eur J Neurosci 20 1150 1160 Watkins LR Maier SF 2003 Glia a novel drug discovery target for clinical pain Nat Rev Drug Discov 2 973 985 Woolf CJ 1983 Evidence for a central component of post injury pain hypersensitivity Nature 306 686 688 Woolf CJ Mannion RJ 1999 Neuropathic pain aetiology symptoms mechanisms and management Lancet 353 1959 1964 Woolf CJ Shortland P Coggeshall RE 1992 Peripheral nerve injury triggers central sprouting of myelinated afferents Nature 355 75 78 Wu DC Jackson Lewis V Vila M Tieu K Teismann P Vadseth C Choi DK Ischiropoulos H Przedborski S _ 55 2002 Blockade of microglial activation 1S neuroprotective in the 1 methyl 4 phenyl 1 2 3 6 tetrahydropyridine mouse mode
95. ed neurotrophic factor in microglia is dependent on calcium and p38 mitogen activated protein kinase activation J Neurosci 29 3518 3528 Tsuda M Inoue K Salter MW 2005 Neuropathic pain and spinal microglia a big problem from molecules in small glia Trends Neurosci 28 101 107 Tsuda M Tozaki Saitoh H Inoue K 2010 Pain and purinergic signaling Brain Res Rev 63 222 232 Tsuda M Masuda T Kitano J Shimoyama H Tozaki Saitoh H Inoue K 2009a IFN gamma receptor signaling mediates spinal microglia activation driving neuropathic pain Proc Natl Acad Sci US A 106 8032 8037 Tsuda M Kuboyama K Inoue T Nagata K Tozaki Saitoh H Inoue K 2009b Behavioral phenotypes of mice lacking purinergic P2X4 receptors in acute and chronic pain assays Mol Pain 5 28 Tsuda M Shigemoto Mogami Y Koizumi S Mizokoshi A Kohsaka S Salter MW Inoue K 2003 P2X4 receptors induced in spinal microglia gate tactile allodynia after nerve injury Nature 424 778 783 Tsuda M Tozaki Saitoh H Masuda T Toyomitsu E Tezuka T Yamamoto T Inoue K 2008a Lyn tyrosine kinase is required for P2X 4 receptor upregulation and neuropathic pain after peripheral nerve injury Glia 56 50 58 Tsuda M Toyomitsu E Komatsu T Masuda T Kunifusa E Nasu Tada K Koizumi S Yamamoto K Ando J Inoue K 2008b Fibronectin integrin system is involved in P2X 4 receptor upregulation in the spinal cord and neuropathic pain after nerve injury Glia 56 579 585 Tsuda M Kohro Y
96. ells Trends Neurosci 19 339 345 Streit WJ Walter SA Pennell NA 1999 Reactive microgliosis Prog Neurobiol 57 563 581 Suter MR Berta T Gao YJ Decosterd I Ji RR 2009 Large A fiber activity is required for microglial proliferation and p38 MAPK activation in the spinal cord different effects of resiniferatoxin and bupivacaine on spinal microglial changes after spared nerve injury Mol Pain 5 53 Svensson Cl Schafers M Jones TL Powell H Sorkin LS 2005 Spinal blockade of TNF blocks spinal nerve ligation induced increases in spinal P p38 Neurosci Lett 379 209 213 Tanahashi H Kito K Ito T Yoshioka K 2010 MafB protein stability is regulated by the JNK and ubiquitin proteasome pathways Arch Biochem Biophys 494 94 100 Tanga FY Nutile McMenemy N DeLeo JA 2005 The CNS role of Toll like receptor 4 in innate neuroimmunity and painful neuropathy Proc Natl Acad Sci U S A 102 5856 5861 Tillmanns S Otto C Jaffray E Du Roure C Bakri Y Vanhille L Sarrazin S Hay RT Sieweke MH 2007 SUMO modification regulates MafB driven macrophage differentiation by enabling Myb dependent transcriptional repression Mol Cell Biol 27 5554 5564 Tozaki Saitoh H Tsuda M Miyata H Ueda K Kohsaka S Inoue K 2008 P2Y12 receptors in spinal _54 microglia are required for neuropathic pain after peripheral nerve injury J Neurosci 28 4949 4956 Trang T Beggs S Wan X Salter MW 2009 P2X4 receptor mediated synthesis and release of brain deriv
97. em 102 1447 1458 Jack C Ruffini F Bar Or A Antel JP 2005 Microglia and multiple sclerosis J Neurosci Res 81 363 373 Kamitani Kawamoto A Hamada M Moriguchi T Miyai M Saji F Hatamura I Nishikawa K Takayanagi H Hitoshi S Ikenaka K Hosoya T Hotta Y Takahashi S Kataoka K 2011 MafB interacts with Gcm2 and regulates parathyroid hormone expression and parathyroid development J Bone Miner Res 26 2463 2472 Kanai K Reza HM Kamitani A Hamazaki Y Han SI Yasuda K Kataoka K 2010 SUMOylation negatively regulates transcriptional and oncogenic activities of MafA Genes Cells 15 971 982 Kataoka A Tozaki Saitoh H Koga Y Tsuda M Inoue K 2009 Activation of P2X7 receptors induces CCL3 production in microglial cells through transcription factor NFAT J Neurochem 108 115 125 Kataoka K 2007 Multiple mechanisms and functions of maf transcription factors in the regulation of _ 51 tissue specific genes J Biochem 141 775 781 Kataoka K Fujiwara KT Noda M Nishizawa M 1994 MafB a new Maf family transcription activator that can associate with Maf and Fos but not with Jun Mol Cell Biol 14 7581 7591 Kawasaki Y Zhang L Cheng JK Ji RR 2008a Cytokine mechanisms of central sensitization distinct and overlapping role of interleukin 1beta interleukin 6 and tumor necrosis factor alpha in regulating synaptic and neuronal activity in the superficial spinal cord J Neurosci 28 5189 5194 Kawasaki Y Xu ZZ Wang X Park JY Zhuan
98. g ZY Tan PH Gao YJ Roy K Corfas G Lo EH Ji RR 2008b Distinct roles of matrix metalloproteases in the early and late phase development of neuropathic pain Nat Med 14 331 336 Kelly LM Englmeier U Lafon I Sieweke MH Graf T 2000 MafB is an inducer of monocytic differentiation EMBO J 19 1987 1997 Kettenmann H Hanisch UK Noda M Verkhratsky A 2011 Physiology of microglia Physiol Rev 91 461 553 Kim D Kim MA Cho IH Kim MS Lee S Jo EK Choi SY Park K Kim JS Akira S Na HS Oh SB Lee SJ 2007 A critical role of toll like receptor 2 in nerve injury induced spinal cord glial cell activation and pain hypersensitivity J Biol Chem 282 14975 14983 Kim H Seed B 2010 The transcription factor MafB antagonizes antiviral responses by blocking recruitment of coactivators to the transcription factor IRF3 Nat Immunol 11 743 750 Kim SH Chung JM 1992 An experimental model for peripheral neuropathy produced by segmental spinal nerve ligation in the rat Pain 50 355 363 Kobayashi K Takahashi E Miyagawa Y Yamanaka H Noguchi K 2011 Induction of the P2X7 receptor in spinal microglia in a neuropathic pain model Neurosci Lett 504 57 61 Kobayashi K Yamanaka H Fukuoka T Dai Y Obata K Noguchi K 2008 P2Y12 receptor upregulation in activated microglia is a gateway of p38 signaling and neuropathic pain J Neurosci 28 2892 2902 Koizumi S Fujishita K Tsuda M Shigemoto Mogami Y Inoue K 2003 Dynamic inhibition of excitatory
99. hropoietic Granulocyte monocyte O progenitor progenitor Mononuclear Monocyte dendritic cell Microglia Macroglia Neurons Erythrocytes progenitor Granulocytes Neutrophils Basophils Macrophages Monocytes Dendritic Eosinophils eros yt cells Megakaryocytes and platelets Lymphocytes Oligodendrocytes Astrocytes Polydendrocytes Mast cells i A T In adulthood Perivascular macrophages Choroid plexus macrophages Meningeal macrophages Figure 5 Ransohoff and Cardona 2010 GSK3 Pp38 p38 1 a a meg T ww MafB v maf 6 O om musculoaponeurotic fibrosarcoma oncogene V 2 family protein B a a MAFB Kelly et al 2000 Bakri et al 2005 Friedman as E NO e MafB bZIP 1 373 403 Maf Maf AS42 v maf EL
100. l of Parkinson disease J Neurosci 22 1763 1771 Yaksh TL Jessell TM Gamse R Mudge AW Leeman SE 1980 Intrathecal morphine inhibits substance P release from mammalian spinal cord in vivo Nature 286 155 157 Zanocco Marani T Vignudelli T Parenti S Gemelli C Condorelli F Martello A Selmi T Grande A Ferrari S 2009 TFE3 transcription factor regulates the expression of MAFB during macrophage differentiation Exp Cell Res 315 1798 1808 Zhang F Vadakkan KI Kim SS Wu LJ Shang Y Zhuo M 2008 Selective activation of microglia in spinal cord but not higher cortical regions following nerve injury in adult mouse Mol Pain 4 15 Zhang J Shi XQ Echeverry S Mogil JS De Koninck Y Rivest S 2007 Expression of CCR2 in both resident and bone marrow derived microglia plays a critical role in neuropathic pain J Neurosci 27 12396 12406 Zhang W Wang T Pei Z Miller DS Wu X Block ML Wilson B Zhou Y Hong JS Zhang J 2005 Aggregated alpha synuclein activates microglia a process leading to disease progression in Parkinson s disease FASEB J 19 533 542 Zhuang ZY Kawasaki Y Tan PH Wen YR Huang J Ji RR 2007 Role of the CX3CR1 p38 MAPK pathway in spinal microglia for the development of neuropathic pain following nerve injury induced cleavage of fractalkine Brain Behav Immun 21 642 651 _ 56 aN ae ANIC 2 BITS SIC eT KIPARE Ze DM AE O E LTE TUN KEK SER Ot Fu Say HL ME
101. lateral Figure 14 AHA FRET EOR MafB 7 MafB CD68 Scale bar 200 um _ 24 2 6 MafB siRNA MafB BV2 MafB siRNA MafB MafB siRNA 48 MafB siRNA siC MafB siRNA si63 si65 BV2 MafB Figure 15A RT PCR MafB mRNA Figure 15B ATP Toll S cyclimD2
102. mRNA RT PCR n 8 9 0 lt 0 001 p lt 0 01 p lt 0 05 vs Contra p lt 0 001 p lt 0 01 p lt 0 05 vs siC Ipsi p lt 0 05 vs siC Contra 9 2 12 MafB siRNA MafB BdU BV2 MafB MafB siRNA siRNA 3 L4 Ibal siC si63 si65 Figure 21A L4 FRA IAS Ibal MafB siRNA Figure 21B A Contralateral side Ipsilateral side B 200 Contra Y E ipsi s Y 5 e dae ig aps oy ire F er E
103. nase Fujihara et al 2003 Lu et al 2008 MafB MafB MafB MafB cyclin D2 Bergsagel and Kuehl 2005 Machiya et al 2007 Eychene et al 2008 van Stralen et al 2009 BV2 MafB cyclin D2 MafB Maf c Maf M CSF
104. r TGAAGACCACCAGGCCATTT purinergic Reverse primer AGGCCCAGATGACAACAGAAA receptor P2Y12 Taqman Probe AAACGTCCAGCCCCAGCAATCTCTTG Forward primer TCACCGTCATCAGCATCGA tlr2 Oe receptor 2 Reverse primer CTGCACTGTCCGGTTGTTCA Taqman Probe ATCGTCCTGGCCGCCAACTCC Forward primer AAACTTGCCTTCAAAACCTGGC tir4 Reverse primer ACCTGAACTCATCAATGGTCACATC toll like receptor 4 Taqman Probe CACGTCCATCGGTTGATCTTGGGAGAA Forward primer GAAAGACGGCACACCCACC llb mterleukm 1 beta 116 mterleukm 6 tnf tumor necrosis factor alpha ctss cathepsin S ibal ionized calcium binding adapter molecule 1 Reverse primer Taqman Probe Forward primer Reverse primer Taqman Probe Forward primer Reverse primer Taqman Probe Forward primer Reverse primer Taqman Probe Forward primer Reverse primer Taqman Probe Forward primer AGACAAACCGCTTTTCCATCTTC TGCAGCTGGAGAGTGTGGATCCCAA GGGACTGATGCTGGTGACAA TGCCATTGCACAACTCTTTTCT TCACAGAGGATACCACTCCCAACAGACCTG GTTCTCTTCAAGGGACAAGGCTG TCCTGGTATGAGATAGCAAATCGG TACGTGCTCCTCACCCACACCGTCA TACATTCAGCTCCCGTTTGGT TCGTCATAGACACCGCTTTTGT TCGACGCCAGCCATTCCTCCTTCT GATTTGCAGGGAGGAAAAGCT AACCCCAAGTTTCTCCAGCAT CAGGAAGAGAGGCTGGAGGGGATCAA CAGCAGGATGATGAAGTGAACA ccnd2 l cyclin D2 Reverse primer GCTTTGAGACAATCCACATCAG Taqman Probe pena Forward primer AGAGGAGGCGGTAACCATAGAGA proliferating cell Reverse primer GACAGTGGAGTGGCTTTTGTGA nuclear antigen 1rf8 mterferon regulatory factor 8 1rf5
105. ramified Lawson et al 1990 Kettenmann et 1 2011 Streit et al 1999 Nakajima and Kohsaka 2001 Hanisch and Kettenmann 2007 Inoue 2008 Figure 3 Davalos et al 2005 Nimmerjahn et al 2005 ramified Irestng surveillanD Raivich 2005 Hanisch and Kettenmann 2007
106. synaptic transmission by astrocyte derived ATP in hippocampal cultures Proc Natl Acad Sci US A 100 11023 11028 Koizumi S Shigemoto Mogami Y Nasu Tada K Shinozaki Y Ohsawa K Tsuda M Joshi BV Jacobson KA Kohsaka S Inoue K 2007 UDP acting at P2Y6 receptors is a mediator of microglial phagocytosis Nature 446 1091 1095 Kreutzberg GW 1996 Microglia a sensor for pathological events in the CNS Trends Neurosci 19 312 318 Kuner R 2010 Central mechanisms of pathological pain Nat Med 16 1258 1266 Lawson LJ Perry VH Dri P Gordon S 1990 Heterogeneity in the distribution and morphology of microglia in the normal adult mouse brain Neuroscience 39 151 170 Le W Rowe D Xie W Ortiz I He Y Appel SH 2001 Microglial activation and dopaminergic cell injury an in vitro model relevant to Parkinson s disease J Neurosci 21 8447 8455 Lee KM Jeon SM Cho HJ 2010 Interleukin 6 induces microglial CX3CR1 expression in the spinal cord after peripheral nerve injury through the activation of p38 MAPK Eur J Pain 14 682 e681 612 Liberatore GT Jackson Lewis V Vukosavic S Mandir AS Vila M McAuliffe WG Dawson VL Dawson TM Przedborski S 1999 Inducible nitric oxide synthase stimulates dopaminergic neurodegeneration in the MPTP model of Parkinson disease Nat Med 5 1403 1409 Liu H Mantyh PW Basbaum AI 1997 NMDA receptor regulation of substance P release from primary afferent nociceptors Nature 386 721 724 Lu YC Yeh WC
107. tory and neuropathic pain Pain 114 386 396 Clark AK Yip PK Malcangio M 2009 The liberation of fractalkine in the dorsal horn requires microglial cathepsin S J Neurosci 29 6945 6954 Clark AK Yip PK Grist J Gentry C Staniland AA Marchand F Dehvari M Wotherspoon G Winter J Ullah J Bevan S Malcangio M 2007 Inhibition of spinal microglial cathepsin S for the reversal of neuropathic pain Proc Natl Acad Sci US A 104 10655 10660 Cook SP McCleskey EW 2002 Cell damage excites nociceptors through release of cytosolic ATP Pain 95 41 47 Costigan M Moss A Latremoliere A Johnston C Verma Gandhu M Herbert TA Barrett L Brenner GJ Vardeh D Woolf CJ Fitzgerald M 2009 T cell infiltration and signaling in the adult dorsal spinal cord is a major contributor to neuropathic pain like hypersensitivity J Neurosci 29 14415 14422 Coull JA Boudreau D Bachand K Prescott SA Nault F Sik A De Koninck P De Koninck Y 2003 Trans synaptic shift in anion gradient in spinal lamina I neurons as a mechanism of neuropathic pain Nature 424 938 942 Coull JA Beggs S Boudreau D Boivin D Tsuda M Inoue K Gravel C Salter MW De Koninck Y 2005 BDNF from microglia causes the shift in neuronal anion gradient underlying neuropathic pain Nature 438 1017 1021 Davalos D Grutzendler J Yang G Kim JV Zuo Y Jung S Littman DR Dustin ML Gan WB 2005 ATP mediates rapid microglial response to local brain injury in vivo Nat Neurosci 8 752 75
108. ure 18C D A 30000 SiC B 25000 sic ee m I si 63 es Msi 65 SI65 20000 g 20000 5 2 15000 X y 5 Cc 10000 Y 10000 5000 0 fe 0 z 0 24 48 72 Ohr 72hr Time hr C D O shC 50000 600004 shC mene e sh6 40000 E e sh21 _ ap w amp 40000 E 30000 J gt Cc CC 20000 S 20000 9 10000 0 c o T T rovrvv T SCC 0 0 24 48 72 Ohr hr Time hr Figure 18 MafB BV2 A B MafB siRNA 48 BV2 500 CHTEL 24 48 72 n 3 p lt 0 01 vs siC C D MafB shRNA BV2 1000 24 48 72 n 4 p lt 0 05 vs shC 29 2 10 MafB siRNA MafB siRNA siRNA 3 1 2 3
109. zuhide Inoue Purines 2010 PALAU FIRAL IDE CONGRESSOS DE TARRAGONA 2010 5 30 6 2 Real time imaging analysis of microglial condition in acute brain slice Junya Masuda Tozaki Saitoh Hidetoshi Makoto Tsuda Kazuhide Inoue Neuro2010 2010 9 2 4 Yak A HA AM MH 84 2011 3 22 24 H 48 Abbadie C 2005 Chemokines chemokine receptors and pain Trends Immunol 26 529 534 Abbadie C Bhangoo S De Koninck Y Malcangio M Melik Parsadaniantz S White FA 2009 Chemokines and pain mechanisms Brain Res Rev 60 125 134 Allen NJ Barres BA 2009 Neuroscience Glia more than just brain glue Nature 457 675 677 Arruda JL Sweitzer S Rutkowski MD DeLeo JA 2000 Intrathecal anti IL 6 antibody and IgG attenuates peripheral nerve injury induced mechanical allodynia in the rat possible immune modulation in neuropathic pain Brain Res 879 216 2
Download Pdf Manuals
Related Search