Home

RYTS Linear Template Set for E.coli (His-tag)

image

Contents

1. 4 Second Histag TCICATCATC ATCATCATCA SerHisHisH isHisHisHIi CACTGGCGGC AGCTGAGTTG GCTGCTGCCA no tag D RYTS Linear Template Set for E coli His tag 3 2 Control Template 6 00 JFirst Second OFirst PCR 0 0 0 specific sense primer 5 3 specific antisense primer 5 TGATGATGAGAACCCCCCCCCGCCCCGCCCTGCCACT C 3 First 5 159 5000 0000 00 50102 10 00000 U First PCR Second PCR 00000 05 41 2 05 1 2 ul 1 000 800 gt 500 gt 5 First PCR H 00 Second D RYTS Linear Template Set E coli His tag 3 3 000 00 00 0000 L His tag 0 0 CATO pROX F L 92ttt vector 715013 00 00000 00000 0000 00000 RYTS Kit CF002 CAT 15 SDS PAGE 000 0 000 His tag0 0 0000 0000000000 00 0 product Plasmid 6 000000000 00000 0 25000 D RYTS Linear Template Set E coli His tag 4 0000 000000
2. TEL 043 202 5755 043 202 5756 E mail tech proteinexpress co jp
3. for Unnatural Mutagenesis PEG O 0000 CloverDirect PEG4 AF tRNA Methyl PEG4 CloverDirect PEG8 AF tRNA Methyl PEG8 CloverDirect PEG12 AF tRNA Methyl PEG12 0 O 0000 CloverDirect benzoyl phenylalanine CloverDirect tRNA p acetyl phenylalanine azoAla tRNA p phenylazophenyl alanine http www proteinexpress co jp reagent 1 D RYTS Linear Template Set E coli His tag A E OU O 20 markable Yield Translation System Trial Kit RYTS Trial Kit CF001 000000000000 U Remarkable Yield Translation System Kit RYTS Kit CF002 5 0 l5m l JU UJU U 20000 5 Linear Template Set His tag 15001 0000480 RYTSLinear Template Set ProX tag 5002 0O 0 OOL pROX F L 92 1amber TS011 goa A COI 192 1 000 lU 15012 0000 pROX FL92 1ttt 15013
4. http www proteinexpress co jp reagent 1 D RYTS Linear Template Set E coli His tag 000000000 L 0000 0 0 0 000 0000 0 000 0 0 0000 0 0 0000 00 0 0 0000 00000 00 0 tRNA 09490 NH2 0 Y Ligation N 1 0000 AUC paCpA i Oooo O AUC CAO DODDO tRNA JULI III Ul 0000000 400 00000000000 0000 0000 0 0000 0000 000 0000 0 000 6 0 0 0 0000 00000 0 00000 00000 0000 00000 000 000 00000 000 00 0 00 00000 0 0 0 0000 00 0000 00 0 0 000 0000 0 00 00 000 0 000 00 0 0 0 0 0 00 00 0 L O 00 000 LU gt Eco U D 1 D D 0000000 tRNA D 0 TAG D RYTS Linear Template Set E coli 5 tag 7 0000000 00 0000 URL http www proteinexpress co jp 260 0856 1 8 15
5. D 52511 RYTS Linear Template Set E coli His tag 3 1 000 0000 RNase OU specific sense primer specific antisense primer 00 00007 00000000000 Expand High Fidelity PCR System 00 1000 Wizard R SV Gel and PCR Clean Up System 10 O 0 000000000000 m 0000 100 0000 00 0 000 0 0 00 0 0000 DNA III L 00 0 0 0 000 0 0 0000 0 00 00 0000 0 00 000 00 00000 D RYTS Linear Template Set E coli His tag Step1 Gene specific sense primer Gene specific antisense primer 000 0 1 0000000 C terminal 15 tag Gene specific sense primer 5 15 20nt sense primer Gene specific antisense primer 5 TGATGATGAGAACCCCCCCC 150 20nt primer Gene specific sense primer 5 ATG 15 20nt sense primer Gene specific antisense primer 5 TGATGATGAGAACCCCCCCC 150 20nt primer Gene specific sense primer 5 CTTTAAGAAGGAGATATCAT ATG 15 20nt sense primer Gene specific an
6. PCR HO ODOL uL buffer 10 without MgCl 5 1 10mM dNTP 1 25 250 uM 25mM MgCl 4 2 mM Forward Primer no 1 2 Reverse Primer no 2 2 Color Primer Set no 3 no 4 or no 5 1 First PCR product 100 uL 2 200 ng Expand High Fidelity Enzyme mix 0 95 30 RNase 31 9 50 2 Primer C terminal His tag Forward Primer no 1 Reverse Primer 2 O White Primer Set no 3 Forward Primer no 1 Reverse Primer 2 O Green Primer Set 4 Forward Primer no 1 Reverse Primer 2 Brown Primer Set no 5 x 000 Primer 1000 0 00000 0 0 0 900 0 00 000 D RYTS Linear Template Set E coli His tag Step5 Second 0 00000000000 0000000 00 000000 0 0 00 00 000 Forward Primer 1 00 Reverse Primer no 2 0 000 0 0 0 00000 0 004
7. 0 First Second 1 000000000000 2 3 DNase RNase 0 0 0 0000 000 4 L 00 00000 5 0000000000000 p 0000000000 0000000 D RYTS Linear Template Set E coli His tag 5 0000 Fluorescence Labeling 110 X AF tRNA 5 CR110 X Abs Em 498 521 CloverDirect HiLyte Fluor 488 AF tRNA Fluor 488 Abs Em 497 525nm CloverDirect TAMRA X AF tRNA 5 6 TAMRA X Abs Em 546 575nm CloverDirect ATTO 633 AF tRNA ATTO633 Abs Em 629 657 CloverDirect ATTO 655 X AF tRNA ATTO655 X Abs Em 633 684nm for Fluorescence Labeling Biotin AF tRNA Biotin CloverDirect Biotin X AF tRNA Biotin X CloverDirect Biotin XX AF tRNA Biotin XX for Post translational Modification CloverDirect Tyr PO_H tRNA O phospho CloverDirect Lys Me tRNA methyl Lys CloverDirect tRNA dimethyl Lys CloverDirect Lys Ac tRNA acetyl Lys
8. 0 000 DNA 100000000000 0 0000000 0000 000000000 RYTS CF001 Step6 00000 O 00000 0 00 000 00 00001 00 00 0 00 00 00 0 0 000000 000 000 0 00000 0 00 000000 0 40 7 Promoter 5 His tag tag oROX FL92 1amber pROX vector pROX FL92 1ampber Cat No TS011 FL92 1cggg Cat No 5012 pROX FL92 1ttt Cat No TS013 D RYTS Linear Template Set E coli His tag T7 Promoter Xba TCACTATAGG GAGACCACAA CGGTTTCCCT RBS Ndel GGAGATATCAT ATG GENE TAAGGG Met gt E N terminal His tag Linker stag 5 yS AGCAGCGGCA sHisHisHis SerSerGlyT TAA TAAG GGGGTTCTCA TCATCAGTAA x C terminal His tag Li nker ATG GENE 66666 Met GI yGl y TTAA TAA CERE FRX AAGGGCGAAT TGGCGGCCGT TACAAGGGCG Spel GGATCCGGCT
9. 0000 000000 RBS 100 JI 00000 0000000000 0000 00 0 0 0000 0000 0 00 0 000 006 His tag0 00 00 0 000 000000000 0000 20 First PCR Gene specific sense primer gt Forward Primer Gene specific antisense primer no 1 Color Primer Set N Second PCR 30 no 5 San Reverse Primer no 2 RBS His tag T7 Promoter 1 20000 tag Gene N terminal His tag Gene C terminal His tag Gene 0 2 00000000000 0000060 D IZEARA RYTS Linear Template Set for E coli His tag milli UID 4000 000 White Primer Set 48 uL C terminal His tag DNA OD Green Primer Set N terminal His tag 1 100 Brown Primer 481 11 10 No tag0 DNA 000 Control Template 20 uL pROX FL92 1ttt CAT CAT vector TS013 m OLL 20701 1 0 0 00 3 0 0 5 0 6 0 E 10000 w DUL L U Expand High Fidelity System Roche Applied Science 11 732 641 001 0 U Wizard R SV Gel PCR Clean Up System Promega 9282 DNA
10. tisense primer 5 TGATGATGAGAACCCCCCCC 150 20nt primer D RYTS Linear Template Set E coli His tag Step2 First PCR First PCR Expand High Fidelity PCR System 0000000000 0000 0000000 uL buffer 10 without MgCl 5 1 10 1 25 250 uM 25MM MgCl 4 2 mM Gene specific sense primer 10 uM 1 200 nM Gene specific antisense primer 10 1 200 nM uM DNA 100 2 200 ng Expand High Fidelity Enzyme mix 0 95 30 RNase 34 9 Total 50 Step3 0000000 00000 00000 0000 000 000 0 0 0 00 00 000 00 L O 00 000 0 00 00 0 D RYTS Linear Template Set E coli His tag Step4 Second PCR First Primer 100000 Second OOOO 000000 0000000000 Expand High Fidelity PCR System 0 0 00000 0
11. x D 15001 9 OUUU ProteinExpress RYTS Linear Template Set for E coli His tag 48 reactons Version 1 0 Expand High Fidelity PCR System mUD LIU l 0 0 000 00 L mI LIU LIU 0 0 00 0000 L III L URL http www proteinexpress co jp 260 0856 1 8 15 TEL 043 202 5755 FAX 043 202 5756 E mail tech proteinexpress co jp D RYTS Linear Template Set E coli His tag L Ilu a n nya 2 2 3 3 DODO0O 4 3 1 sesser 4 3 2 10 3 3 0000000 000000 11 4 DD00000000Q0 12 13 2222 15 7 essees 16 D IRENKA RYTS Linear Template Set for E coli His tag 1 0000 5 Linear Template 00000 00 0 00000 000 000000 02 0000 000 0

Download Pdf Manuals

image

Related Search

Related Contents

Samsung ML-2851ND  Toshiba Portégé Z930  Boss Audio Systems RV-70 User's Manual  AKG K330  Swift_Parrot_MCASS user manual  HP ENVY 17 Notebook PC HP ENVY TouchSmart m7 Notebook PC  Manual de Usuario Manual de Usuario  Reference Guide - v2.5 VX  Operating Instructions ECSxA Axis module Application (V8.x)    

Copyright © All rights reserved.
Failed to retrieve file