101号 pdf版
Contents
1. 0 DNAN 130 100 000000 uut Jp Get pureDNA Kit Agarose 200 samples 15 000 GKO01 11 A Q1 A1 00000000000 00 Self assembly SAC D U D uggagagamgauguuuttdte c Sef Assembled Monolayers SAMS LH 00000 Q2 A2 0 0000000000000000000000 30 Q3 A3 Q4 4 Q5 A5 00000000000 00000000000 UBdguuuuuttu 0 0 0 0000000000000000 00 50 050 0000000000000 van der Waals 0000 00 0000000000600 5 000000000 55 0 52. 00000000000000 5 0000000000000000000 0 00 0 5 AE ETE BEER EE ELE A16 400 0 0 11 000000000 EDT DEBES BEER HOGETA RAEE gE BER EIE 1 000 E Pirannati 0000300 30100 100 1580000 000000000 0 EE
3. 00000000000000 00 0 HRP streptaviding OOOO 10000 00 000 0 00 0 00 0 0 0 0 0 00 ATER 000 10 yu HRP streptavdin 8 ul TE buffer 40 ml 000 500 ul HRP streptavidin 400 TE buffer 19 6 ml 00000 HRPestreptavidin 0000000000000 EPOD ES GET ER BH e E E EICET E EE ENE EEE E EN EAS SEE BE BE EL
4. EE 0 00000000000 0000000000000 E 90000000000 EEE EEN EERE BE EER 40804 EE 2210000000 EE 0 100000000 0000000100 E EP ETE 0
5. o np Nucleostai DNA Damage Quantification Kit AP site Counting 5 samples 21 000 Get pureDNA Kit Agarose 70 00000000000 0 05 50 kbp r 00000 0 TBE buffer 000000000000 e 1 0 0 750 00000 guggagugagggaugbNAnnmngugpuuggmaug LE ET EE EE EJ EE ELE EE DE DE EE EE EE EE EE DE EE EE EE EE EE EE EE EE EE EE EE LET LE ET EE EE EJ EJ EE EE EE EE EE EE EE D DE EE EE EE EE EE DE DE DE EE EE ETE ET LT E guggagggaggggaugggagauggagggudt mau 00000000000029000000 LE ET ET EJ EE EE EE D D DE LL Get pureDNA 00000000000000 0 Gel lysis buffer 65 ml x 1 Precipitation solution 65 ml x Co precipitation solution 20 mg ml glycogen 0 5 ml x 1 1000 7900 0 0 0 0 1 5010 40 0 0 0 0000000000
6. 0 0000 000 0000000000 URL http www dojindo co jp 0120 021557 0120 489548 E mail info 9 dojindo co jp 00000000 101 14D 10 30000 00000000000 DOJINDO LABORATORIES 2025 50 861 2202 News No 101 00000 0000 00000 0000 00000 0000000000
7. 2 Summary The fluorescence representational genomic profiling FRGP method is capable of making a genome wide survey of many loci This method employs PCR mediated size selection and FITC labeling of restriction fragments containing landmark sites Using this method with methylation sensitive restriction enzyme as a landmark enzyme we scanned quail genomic DNAs from several tissues to detect the transcriptionally active regions This approach is based on the assumption that CpG methylation particularly of CpG islands might be associated with gene transcriptional regulation Sixty out of 520 FRGP spots were identified as tissue specific changes of the DNA methylation state One of the spots which show a testis specific appearance was cloned and sequenced to identify the gene The spot clone contained the segment of the quail orthologue of FOXF1 gene one of members of the forkhead gene family of transcription factors The FOXF1 gene encodes the winged helix class of DNA binding protein and is expressed in lung and placenta The RT PCR analysis of quail mRNAs from various tissues revealed that the quail orthologue is also lung specific expressed Thus FRGP using methylation sensitive restriction enzyme can offer a mean for detecting systematically the gene in which the state of DNA methylation
8. EN Table 2 RNA DNA Protein display Phage display display HNA protein fusion using puromycin STABLE assay Technique using Mass spectrometry Based on primer extention Pinpoint assay four kind of ddNTP Primer extention with three kind of ddNTPs dNTP PROBE assay in solution on chip Survivor assay Primer extention with labeled ddNTP Primer extention with 5N C labeled NTP GOOD assay Using oligo probe Using PNA probe Using biotinylated primer for short tandem repeat Using chaperon probe Invader assay Using translation to the peptide 40 00000000040000004000000000100000 0 0 0 0 0 00 in vitron OO 000000 Tabe20000000000000000 90 LE ET EE EE EJ EJ EJ EE EE EE EE EE EE D D EE EE EE EE EE EE EE DE EE EE ETE ET LT E LE EE EE EE EJ EF EE DE DE EE 7E 7E 7E 7D UO 7E 0000000 Table 0 0 0 0 00 0 00 000 0 0 00 00 LE ET EE EE EE EJ EJ EE EE EE EE EE EE DE DE EE EE EE EE EE EE EE DE EE EE EE ET LT E differential displa
9. 3 6 0 790 00000000000 EEE EEL EL ES EE vector 02040 00 0 0 0 0 0 0 0 OR e0000 100000 20 Uma 000000 1 5 0 6 0 100 150 ut UU 0 100 200 mgl 00 300 400
10. A e E LER EE EEE EEE EE EEN ENE EH EE EPI EI 1 Y Suzuki Yoshimoto Nakagawa K Maruyama Suyama S Sugano Gene 200 149 1997 P Carninci C Kvam A Kitamura T Ohsumi Y Okazaki M Itoh M Kamiya Shibata N Sakaki M Izawa M Muramatsu Y Hayashizaki C Shneider Genomics 37 327 1996 3 V Lyamichev A L Mast J G Hall J R Prudent M W Kaiser T Takova R W Kwiatkowski T J Sander M de Arruda D A Acro B P Neri M A D Brow Nature Biotechol 17 292 1999 J Chen M A lannone M S Li J D Taylor P Rivers A J Nelsen K M Slentz Kesler A Roses M P Weiner Genome Res 10 549 2000 X Chen B Zehnbauer A Gnirke P Y Kwok Proc Natl Acad Sci USA 94 10756 1997 A S Piatek S Tyagi A C Pol A Telenti L P Miller F R Kramer D Alland Nature Biotechnol 16 359 1998 7 J B Fan X Chen M K Halushka A Berno X Huang T Ryder R J Lipshutz D J
11. N glycosidase 000 000000 0 0000 OUUUUUUOU
12. AEE IEEE ET ED CET ER EP BEREIT BE HETET DAE EE AUH Aae OEE EEN END EEEE BA E 020001 E E R SH Au gt R S 1 2 H R S 5 R 2Au gt 2 R S Au Q6 A6 Q7 A7 Q8 A8 Q9 A9 L News 101 2002 0 0 E EE GE EL BE e 4230 424 425 07060 00000 0 22870 288 F289 000000 ER 0 385 386 387 404 405 C4060 0524
13. lt lt O lt lt lt lt 3 lt 4 0 lt lt lt lt x xi x x x Ol x 41 4 Olx lt I lt x 9 c Go gt lt o tv gt 4 2 gt o lt 10m 404040400 15 16 MUERE E IPIE BIET EU MEKE A B BIER HET EET ERE BELLE ELE nl 00000 lil 10x TAE 10x TNE 10x TPE 1H 1 2 4 Triazole 1H 1 2 4 Triazole 2 Aminoperimidine HBr 2 Aminoperimidine 2 Furildioxime 2 Iminopiperidine 3 Br 7 Nitroindazole 4TF 5 F BAPTA 5 F BAPTA AM 5 Nitro 2 PDS 6 7 Nitroindazole 8 Acetoxyquinoline AA AB NTA Acetone Sp Acetonitrile Sp Acridinium l ACVJ Ag l CHBA AS Ag l CHBA AS 10 bromide Azido FDA Azidoluminol BBD BDC OH Benzene CV Benzene Lu Benzene Sp Benzene Sp Sulfo OSu BNBAC3 OSu BNBAC5 OSu BNBA OSu BPR BPR BT Standard Butyl PBD Butyl PBD Butyl PBD Caged
14. 10 0 0 0 200 0 0 00 00 0 050 0 00 5 000000000000 0 0 05 0 00 400 0000 200 50000 600 700 00000000 0000000000000000 OOOO 0 C4 BssH II G4 000 CpeG uu 0 mcn ud B E E EIE E SE ET ET EI EL 000000000 0 000 SERE EB ET ET SER ELE Cpap 000 0000 DODO
15. 8000 000 Fig4000000000 000000000000 Cpr QD D gt DAN QD c t v 0 7 iJ gt 0 ca I NM FOXF1 GG UD M pain Fig 4 Expression of FOXF1 gene measured by quantitative RT PCR in eight different tissues The upper and lower bands indicate FOXF1 gene and p actin gene as an internal control respectively 50 FRGPT I OOOO 20000000000 000 restriction landmark ES ES P EE BEER EEE restriction landmark hap 00 00000000000000000 000 000 00 0000000 polygene t D D U tu LE ET EE EE EJ EJ EJ ED EE EE EE EE EE DE DE EE EE EE EE EE DE EE DE EE EE ETE ET LT E LE ET
16. EIE lt mi Eu A HE EL 5 kA b c 00200000 gt 2 PMCA DI UU 00000000000100000000000 01000 PMCA 000000006 12 0 2 0 4 30000 PrP 0 0000 00000 0 vitro PrP 0000 nwo Lu UL 1 G P Saborio B Permanne and C Soto Nature 411 810 2001 2 D A Kocisko J Come 5 Priola B Chesebro G J Raymond P T Lansbury amd B Caughey Nature 370 471 1994 3 S B Prusiner Proc Natl Acad Sci 95 13363 1998 OUUU 14004 Overview 0000 Yoshiki 410 00000 812 8581 0000000 6 10 1 092 642 3608 092 642 3611 e mail ykatatcem mbox nc kyushu u ac jp RP BE HI P DAR CU P EP Ee I 0000000000 000000 44 4 0 344 1998 00000000000000000 0 43 12 0 397 1998 News
17. Amplicon 00000 2000000 100 0 U un 10 1900000000 00000000000 00000 0108 000000000 0 0 00 00040 0 20 0000 040 0000000 00000000000 5200 000000000000600 0 600 bNA DE ET 0 9 08
18. x Gel lysis buffer Precipitation solution DELE BL ES ERE EP EET ET 1 EET BEES HEEL REL BE ERE 20 0 000 000 2 0000000000 15 ETSI vortex 000000 3 0000000000000 Precipitation solution 0000 Uu e Precipitation solution i I 0000000000000000 e 13 000 News 101 2002 4 00000 Stop e Step 80 0 9
19. E EE EI BET RETE EET ET BEL EEE 5 5 10008 000000000 000000 300 10000 00000000000 SNP 00000 5 000000000000000 ELE EE BE EE BREED Table 1 New technique for SNP typing Technique using fluorometry as detection Without PCR Invader assay Sniper assay With PCR DOL assay Luminex assay Oligo Tag a
20. 5 ELE E E 4 4 For the investigation of protein protein ligand interaction Based on two hybrid system Yeast two hybrid system Y2H Large scale Y2H Y2H in mammalian cell Three hybrid system One hybrid system Based on protein complementation assay Using Dihydroforate reductase DHFH oplit Ubiquitin Using protein splicing Using p galactosidase Using rasGEF V src myristoylation signal Using adenylyl cyclase Other Table 4 Fluorescence labeling for proteome research GFP fusion Protein insertion into GFP Fluorescence labeling using puromycin Fluorescence correlation spectroscopy Energy transfer cassette Quantum dot FLASH Using isotope labeled crosslinker Protein array E DEL E E 0 000 BIET E TELE CEPI
21. 0 00 0 00000000 000000000 0 CGH 21 genomic differential cloning 19900 000 00 0 00 0 00 0 0 0 0 00 genomic differ ential cloning Restriction Landmark Genomic Scan ning RLGS y 20 Representational Difference Analysis 0 80400 nnangapnaganpnagReesmnanagaanagna restriction landmark LE ET EE EE EJ EJ EJ E EE EE EE EE EE DE DE DE EE EE EE EE EE EE DE D EE ET ET ET E uggagggaggggauggagagugugaguRDAr 000 10 1000 1 1000 amplicon 0 000 PCR HI 0 0 00 0000 000 ge nomic differential IH 00000000000000 LE ET EE EJ EJ EJ EE EE EE EE E DE EE 7E EE 7D 7D 7D 7E 7E 7E 7 7I EE EI JiuguRLGSi 000 8060 EU utut restriction land mark representation 0000000 0 0 0 genomic differential cloning 000 O Fluorescence Representatio
22. PrP27 30 GPI anchor 01 00000000 20000 20900000 GPI anchor 0 00000000000 000000000 000000 0 0 PrP 000000000000 OOO 00000 00000 0 0 0 0 0 0 0 0 000 Saborio protein misfolding cyclic amplification uggaggaugggaugguaugggugdamn 000000600 00000000000 uggagagaggggggggugaugauau qiu 00 proteinase 27 30 00000000000000000 LE ET EE EE EE EJ EJ D EE EE EE EE EE D DE DE EE EE EE EE DE DE DE 7D EE ET ET ET E EEEE EE EE EE EE DE DE EE EE ETE ET LT E 0000 0 gt PrP9 20000 00 D EE EE EE EE DE EE D D EE ET ET ET E Protein 0000000000 0000000000 00 PrP LE ET EE EJ E D EE E L
23. B Review Topics on Chemistry 000000009 100000000000000 20000 0 00 0000 1 ISSNO385 15 16 Review 0000 1 00000000000000 1 0000 6 Topics on Chemistry ELE EESTI E EET ET EL TEE EE E BE EE ER ERR E E nmn 5 Commercial Q amp A Self Assembled Monolayers SAMS D 000 12 UD NOOO veMMeemmmmmmmmmmeHmHeHmHM M e 4 Get pureDNA Kit Agarose mI mm 10 News 101 2002 eH M99 HMM 4 ggggggadggugggal e 4 Nucleostain DNA Damage Quantification Kit AP site Counting UHWHHUBHBUD 8 LL EL EL EL EL EL E 00 or 16 vmm 17 ggggggadgggugal g eee 18 1 NOON 4 4 Get pureDNA Kit Agarose 10 120000000000000 HRS News 101 2002 Fluorescence representational genomic profiling method and its various applications Hideji Yamashita
24. 000000 000 10000 15000 200000 0000000000000 E EI DB BBC E HEBES E BEI ELE EE News 101 2002 Q14 e 0000 00 0 0 0 000 0 6 1 0000000000 0 0 22 00060 000 0 0 06 0300 000 800 10 00000000000 HEEL 4080
25. CyDTA for amino acids analysis CyDTA for amino acids analysis DABITC DABITC DAHP DDD DDPC Detergent Starter Kit Detergent Starter Kit DHEG Dibenzyl bis 12 crown 4 Dichloro CFSE DidodecyIl bis 12 crown 4 DIDS DIDS Dimercaptosuccinic acid Dimethoxyethane Sc Dimethyl CFSE Dimethyl POPOP Dimethyl POPOP Dimethylsulfonazo lll Dimethylsulfoxide Sp Dioxane Sc DIPSO DNBC DPTA OH DPTBA DTAN DTBPA Eu DPM Eu FOD Eu PTA FTA GHA Good s Buffer Starter Kit Good s Buffer Starter Good s Buffer Starter Kit Ill GTB HABT HDTA Hexanes Sp Ins 1 3 4 5 P synthetic iso Octane Pr iso Octane Sp iso Propyl alcohol Lu 150 alcohol Sp News 101 2002 500ml x 6 100 mg 100 mg 1g 500ml x 6 100 ug 250 ml 500ml x 6 250 ml 500ml x 6 349 00523 349 07061 340 00531 345 07041 344 00551 341 00561 342 00574 342 05591 345 05581 340 04051 340 00651 348 00652 342 03151 344 00752 349 07701 346 07711 343 07 721 340 07731 346 07691 347 00781 347 00801 344 0081 1 342 00851 340 00891 346 00893 345 05101 341 05103 345 07301 348 06431 348 07031 344 00914 345 05601 343 05381 341 06541 345 00922 341 06301 341 06781 348 06291 340 05271 346 05273 345 00961 346 00991 344 06771 341 01002 349 01003 346 01013 341 01024 345 01061 347 04142 343 03821 341 01122 344 05213 349 04803 348 05691 345 01201 3
26. EEE 0 5 000 0537 0538 0539 22 EEL BEEE ENEE 0000000000000 00F2460F24 0F269 31411 B UAE 5 0000000000000 00H3370H3380H339 STM AFM J FT IRB 0 0 D D 040 D D D D 5 EL SAMs 0 000 0 5 Q10 A10 Q11 A11 Q12 A12 Q13 A13 E GERE EIER DERE D A RES I E EE OD d P E EI ED EDI ESL
27. Lockhart A Chakravarti Genome Res 10 853 2000 P Ross L Hall I Smirnov L Hall Nature Biotechnol 16 1347 1998 A Braun D P Little H Koster Clin Chem 43 1151 1997 T J Griffin W Tanng L M Smith Nature Biotechnol 15 1368 1997 J Hanes A Pluckthun Proc Natl Acad Sci USA 94 4937 1997 R W Roberts J W Szotak Proc Natl Acad Sci USA 94 12297 1997 13 N Doi H Yanagawa FEBS Lett 457 227 1999 14 C T Chien P L Bartel R Sternglanz S Fields Proc Natl Acad Sci USA 88 9578 1991 15 J N Pelletier F X Campbell Valois S W Michenick Proc Natl Acad Sci USA 95 12141 1998 16 F Karimi Busheri G Daly P Robin B Canas D J C Pappin J Sgouros G G Miller H Fakhrai E M Davis M M Le Beau M Weinfeld J Biol Chem 274 24187 1999 17 S P Gygi B Rist S A Gerber F Turecek M H Gelb R Aebersold Nature Biotechnol 17 994 1999 2 Kur 2 2 S 2 I News 101 2002 Nucleostain DNA Damage Quantification Kit AP site Counting Nucleostain DNA Damage Quantification Kit AP site Counting 0 0 0 ER EE EE EIER
28. 00000 EE EE Q15 000000000000 15 0 10000000000000000000 Q16 A16 0 10 20 000000000 1300 0 0300000000 u00 10 710 00000000 NHSE 000 ET Se E BEC 414 0 BH EEE EEE ERE EEN EE EEE 0 O L EH EEEEEEEE Q17 A17 0000000000000000000000000 190000000000 0 1700 0 20 100 mg ml 50 0 0 100 SAMST 0000 000000000000 100 WSCH 100 uig 000 030000000000000 000 11 Amino 1 undecanethiol hydrochloride 11 AUT HCI 10 mg 13 100 423 100 39 400 423 8 Amino 1 octanethiol hydrochloride 8 AOT HCI 10 mg 13 100 A424 100 mg 39 400 A424 6 Amino 1 hexa
29. 0000000000000 kb 0 5 i m e ES IX Me us 1 T 2 549 e 25 M9 _ Td 4 _ 4 7 4 gt _ a P Fig 2 FRGP profile of quail testis DNA Eag and Hinf were used as a landmark enzyme and restriction enzyme 3 respectively Fig 1 The arrow indicates the testis specific spot QTEH56 Brain Heart 27 XL 8 lt lt gt Kidney Testis Um lt 4 T 2 t amp am e Fig 3 Parts of FRGP profiles surrounding Spot 56 in four different tissues The arrows indicate Spot QTEH56 and represent disappearance and appearance of Spot 56 respectively News 101 2002 56 Fig 20 9 3 000 0000 ERSTE EE 0 10 Forkhead F10 FOXF1 H 0000000000060 560
30. 02553 007 59 342 01814 M008 100mg 347 04201 T009 MXB 1g 342 01853 M013 19 3343 04203 T009 N N Dimethylfprmamide Sp 500mlx 6 342 00971 5 09 1g 345 02563 T010 Na l CHBA AS 1g 343 03201 A027 TAR 1g 349 02583 T011 Naphthalene 100g 344 01891 N044 5g 347 02584 T011 NBDI 19 347 03841 021 10mg 343 07101 T323 NBHA 500mg 346 03833 NO22 TDBA OSu 10mg 340 07111 T324 Neo TB 10 348 01953 NO06 25 mg 343 05881 T038 Neo Thorin 19 349 01961 NO07 5mg 345 07801 T401 Neo Thorin 59 345 01963 007 Thiooxine 1g 342 02713 019 n Heptane Lu 250ml 344 0139 LU10 Thorin 19 343 02721 T020 n Heptane Sp 500mlx 6 341 01384 SP13 Thorin 5g 349 02723 T020 Ni II EDTA 25g 345 02002 E015 tma DPH 50mg 341 05201 T034 NIPF 10mg 342 06711 N372 10mg 342 07311 A375 Nitr 5 5mg 349 05741 051 100 348 07313 A375 Nitr 5 AM 1mg 348 06791 N376 TMG 25 ml 348 06632 NX33 Nitr 7 5 mg 346 05751 052 TMG 500 ml 342 06635 NX33 Nitroso ESAP 100mg 348 04091 NO09 19 93948 02793 T025 NOR 2 10mg 348 06931 N389 5g 346 02794 T025 NOR 2 50 344 06933 N389 19 341 02803 026 NOS Inhibitor Set arginine analogs 1 Set 343 07581 NIO1 TPC 5g 349 02804 T026 NOS Inhibitor Set II for iNOS 1 Set 340 07591 NIO2 TPP 10 342 03891 T002 NPDE ig 93946 06731 N267 TPPC 10 93948 02813 7027 o 0 Dihydroxyazobenzene 1g 348 00951 D009 TPPC 5g 346 0281
31. 101 2002 100000 E E EEE ET EE BED BE BEER EL ET E EHE BET LEGE EE BREED DE UE DE UP UE ETE 22 J EEE EIE BEC DRE B EET DUBIE Eo EI B PHI EE EIE dis 2 10 000000600 0000 0000 0 00 0 0 0 00
32. EE EE EJ EJ EJ ED EE EE EE EE EE DE DE EE EE EE EE EE E EE 7D EE EE ETE ET LT E Du 1 F Larsen G Gundersen H Lopez and H Prydz Genomics 13 1095 1992 2 F Antequara and A Bird Proc Natl Acad Sci USA 90 11995 1993 3 P A Jones Trends Genet 15 34 1999 4 W A Bickmore and A P Bird Methods Enzymol 216 224 1992 5 X Nan F J Campoy and A Bird Cell 88 471 1997 6 P L Jones G J Veenstra P A Wade D Vermaak S U Kass Landsberger J Strouboulis and A P Wolffe Nat Genet 19 187 1998 7 Ahringer Trends Genet 16 351 2000 8 H H Ng and A Bird Curr Opin Genet Dev 9 158 1999 9 1 Hatada Y Hayashizaki S Hirotsune Komatsubara and T Mukai Proc Natl Acad Sci USA 88 9523 1991 10 N Lisitsyn N Lisitsyn and M Wigler Science 259 946 1993 11 J Kuromitsu H Yamashita H Kataoka T Takahara M Muramatsu T Sekine N Okamoto Y Furuichi and Y Hayashizaki Mol Cell Biol 17 707 1997 12 S Komatsu Y Okazaki M Tateno J H Konno M Kusakabe A Yoshiki M Muramatsu W A Held and Y Hayashizaki Biochem Biophys Hes Commun 267 109 2000 13 T Ushijima K Morimura Y Hosoya H Okonogi M Tatematsu T Sugimura and M Nagao Proc Natl Acad Sci USA 94 2284 1997 14 K Muller H Heller and W Doe
33. aspartic acid Caged ATP dimethoxy Caged cAMP Caged cGMP Caged fluorescein Caged fluorescein DPPE Caged fluorescein Sulfo OSu Caged GABA Caged glutamic acid Caged glycine Caged GTP Caged GTP dimethoxy Caged proton Caged proton dimethoxy Calcichrome CAPSO CAPSO 9 500ml x 6 500ml x 6 10 mg 25 mg 500ml x 6 5 mg 5 mg 347 07501 341 07565 341 07521 345 06561 343 06562 344 03971 347 03961 344 01293 346 07331 342 07291 340 0481 1 344 05791 347 05801 340 03451 347 04821 343 07221 347 00063 344 00012 344 07653 340 00031 323 00043 347 06521 342 07051 344 03231 340 03233 346 0491 1 349 04901 340 06871 341 03241 340 03711 340 03691 343 03941 349 00241 347 00225 345 00221 340 06251 346 06231 343 06241 349 06221 349 00361 345 00363 349 00383 340 0041 1 348 00412 346 00413 349 06081 342 05971 340 05891 347 05921 348 0631 1 349 06341 342 06331 346 06091 349 06101 346 061 11 343 05901 348 05951 343 06121 340 06131 344 00453 345 05461 343 05462 Carboxyarsenazo 1 5 CDCQ 1 Chloranilic acid Chloroform Sp Chol AECM mannan Chol AECM pullulan Chromazurol Chromazurol S Chromazurol S 1 1 Colloid Titration Reagent A Colloid Titration Reagent B Colloid Titration Reagent C Colloid Titration Reagent D Colloid Titration Starter Kit 1 5 Cu Il AA AS Cu II CHBA AS Cyclohexane Sp
34. length of fragment C digested with enzyme 3 O and adaptors for restriction sites of enzyme 1 and 2 respectively FITC News 101 2002 FRGPT 1 00000 1000090000 20 0000000 0000000 0 1 9000000000 PCRO O D 0 0000000 representation 0 00 00000000000 restriction landmark 00 00000000000000 000000060 0 OOO 000000000 1 0 Amplicon DOO 00 0 000 Amplicon 000000000 Amplicon 0000 y
35. 00 10000 1000000000 601 00000 0000000 5 1 0 19 1 ADNA Hind II 0 000000000000000000 00 1 20 00000 0000 0000007200 0000000000000 0000000 0 solution glycogen 0000000 00000 0 00 0000 0 0000 0 0600 Cco precipitation solution News 101 2002 Get pureDNA Kit Agarose 0 0 0 DNATI Fig 1 ADNA Hind 111 HuuuuuuutLuttl Lane 1 23kbp 9 42kbp 6 56kbp 4 36kbp 2 32kbp 2 02kbp Lane 2 Lane 3 Lane 4 Lane 5 Lane 6 Lane 7 0 8 Agarose 100V 60min ADNA Hind Ill Fig 2 pUC19 Msp 1 Lane 1 501bp 404bp 331bp 242bp 190bp 147bp 111bp Lane 2 Lane 3 Lane 4 Lane 5 Lane 6 Lane 7 Lane 8 Agarose 100V 60min 19 0 solution PCRO0000000000000000000 LE ET EE EJ EJ ED EE EE ET LT L 0000000 200 0 5160 1 2 5160 2 00000000 1 5
36. 00 mg 36 000 F246 8 Ferrocenyl 1 octanethiol 8 10 mg 11 800 F247 100 mg 36 000 F247 6 Ferrocenyl 1 hexanethiol 6 10 mg 11 800 F269 100 mg 36 000 F269 11 Hydroxy 1 undecanethiol 11 10 mg 11 500 H337 100 mg 34 000 H337 8 Hydroxy 1 octanethiol 8 10 mg 11 500 H338 100 mg 34 000 H338 6 Hydroxy 1 hexanethiol 6 HHTO 10 mg 11 500 H339 100 mg 34 000 H339 News 101 2002 HERO 4 11111 14 1 exe ere S eru pep Chloroform Ethyl alchool Dichloromethane Tetrahydrofuran 10 vos 100 19 m T n Methyl alcohol 7 DMF 2 2 2 p m p xixixixi ol 0 esp x x X x x x x Ol OlO x x x x x x xi Ol O xI x OI O 0 0 0 4 Ool 41 lt lt lt lt lt lt x lt
37. 0000 Topics on Chemistry News 101 2002 UUUUUUUUUUUUUUU 000 0 110000000000000 00000 000 0 19961 00000000000000 000000000000 00 0 2000000000000 00000 0 0 0 14200000 0000 0000 7 300 0 10000 00000 0000 0000 00000 00 00000 00 00000 Western 0 00000000000000000000 000000 NIU
38. 4 T027 ODQ 10mg 345 07781 O277 TTD 14 crown 4 5 mg 340 06751 T302 Pb II CHBA AS 19 348 02151 029 Umbelliferone 5g 347 02883 0001 1g 341 03981 15 Blue B hydrochloride 5g 347 02903 V001 PBPB 5g 8347 03983 P015 _ VO II AA AS ig 347 04681 A031 PC3P 25 mg 346 05871 P030 10 93948 02933 X002 Phenyl phosphorodichloridate 500g 349 07005 NX16 Zn Il CHBA AS 1g 341 03001 A032 Phenylarsonic acid 25g 344 02212 008 1Set 344 03851 0024 Phisyl Cl 10mg 340 07091 P308 500 346 01275 004 10 347 02263 P010 00000 0 500 3343 01285 F005 PPKO 19 348 02271 P011 PPKO 10g 342 02274 P011 Pr DPM 19 23942 02291 P018 Pr FOD 19 345 02301 P019 PTA 5g 23943 02341 P013 p Terphenyl 100g 341 02641 T016 su 1g 340 02351 EDU LE ET EE EJ EJ EE EE EE EE DE EE EE EE EE EE D 7 EE ET EL PV 5g 346 02353 P014 Pyridine 100 ml 341 06661 NX29 Pyridine 500 ml 343 06665 NX29 Quene 1 1mg 345 05841 Q004 Quene 1 AM solution 1ml 342 05851 Q006 Quin 2 AM 50mg 342 04893 Q002 oomoo S Aminoethyl ITU 19 348 0727 A383 y s Nocs 19 341 02381 S002 109 345 02384 5002 E ___ EE SBD CI 10 342 04991 S012 Scintisol AL 1 3L 341 02401 68001 SCR 1g 345 02443 5004 S Ethyl ITU ig 341 07261 E259 News 101 2002 12000000000000000 000 Jugududdd uugg
39. 42 01211 349 01221 347 01261 341 01323 342 05471 349 05481 346 05491 348 01333 341 01362 343 05641 347 01401 349 05861 343 02101 340 02091 349 02321 342 0231 1 I M Iun Pt C006 C340 A019 0406 034 C009 5 06 C036 C037 News 101 2002 00000 _ L NIL 25 mg 347 07241 1233 S Isopropyl ITU 25 mg 344 07371 1011 L NNA 19 346 07211 10 S Methyl ITU 19 344 07251 358 Lumogallion 1g 345 01603 L003 S Nitroso L cysteine J 5X1 ml 340 07351 N414 Maleimido C3 benzyl EDTA 10mg 345 06061 M031 SNPA 19 346 03811 S014 MBD 500mg 343 03723 M017 SPADNS 5 0 8347 02481 S005 MBOTAD precursor 10mg 346 06971 M319 SPADNS 25g 345 02482 S005 MBPM 10mg 341 06281 M274 SPQ 50mg 344 05671 S017 Meldola s Blue 1g 343 03681 M001 Stilbazo 1g 340 02493 S006 MESS 10mg 348 06551 M023 Stilbazo 5g 348 02494 S006 Methyl alcohol 250ml 347 01641 PRO4 Stilbenefluoblue S 1g 343 02503 S007 Methyl alcohol Sp 500mlx 6 340 01631 SP15 19 342 03031 S008 Methylcyclohexane Sp 500mlx 6 341 01703 SP16 5g 3348 03033 S008 Methyl EDTA 25g 8340 01712 X Sulfarsazene 100mg 341 03861 S009 Methylene chloride sp 500mlx 6 349 01721 SP17 Sulfochlorophenol S 19 8340 02513 5010 1g 346 03171 A025 Sulfonazo Ill 19 29347 02523 S011 MMTr CI 25g 341 06622 2 5g 3348 02531 005 Mn II CHBA AS ig 340 04671 A026 19 341 02543 T006 MTB 1g 29344 01813 MO08 19 93948
40. Gel lysis buffer 300 60 91 1000000000 00000020 3000 vortex 2000000 Precipitation solution 300 0 13 000 x 9000 5000000000 000000000000 1 5 20 Co precipitation solution 2 ul 000500 vortex pj 000 000000 800 000 500 vortext 00 13 000 x 00 S0000000000000000000 Step 3 Step 4 Step 5 Step 6 Step 7 Step 8 DD 90 DNAnnnng7ovenumuuugiugimnmnmt5mt 0 013 000 00 0 0 0 0 000 0000 0 0 0 0000 buffer 10 mmol l Tris 1 mmol l EDTA D D EH D D Step 9 Step10 LE ET ET ET LT L 1 00000 200 00000 0 000000 1 50 lysis buffer Precipitation solutionrt 4 0500000006060 700 co precipitation solution 2 ul J 1 5 2 TBE 0000 3 0000000000 LL EE EE ET DT E L 4 Precipitation solution 00000000000000 5 e EE lt 20 u gg
41. nal Genomic Profiling FRAQPO0 000000000 00000000 EE EA EEN e EISE Extraction of genomic DNA A B C D 2 2 1 3 1 2 DNASes IL I L L L lt a b 4 Landmark cleavage with restriction enzyme 1 4 Fragmentation with restriction enzyme 2 4 Ligation with restriction site specific adaptors The limited size for PCR amplification PCR amplification with FITC labeled primers Amplicon A Amplicon C Amplicon D 4 1st fractionation by agarose disk gel electrophoresis 1D 4 Fragmentation of amplicons with restriction enzyme 3 4 2nd fractionation by PAGE 2D 4 Detection of FITC labeled DNA fragments d a kb 0 P n M Amplicon D Amplicon A Amplicon C l 1 l l l l l l l d l l 1 1 Fig 1 The procedure of FRGP 1 3 restriction sites for restriction enzyme 1 landmark enzyme 2 and 3 respectively A D restriction fragments digested with enzyme 1 and 2 a d the length of fragments A D x and y the
42. nethiol hydrochloride 6 AHT HCI 10 mg 13 100 A425 100 mg 39 400 A425 N Fmoc Aminoundecanethiol 11 FAUTT 10 mg 14 800 F287 50 mg 45 000 F287 N Fmoc Aminooctanethiol 8 FAOT 10 mg 14 800 F288 50 mg 45 000 F288 N Fmoc Aminohexanethiol 6 10 mg 14 800 F289 50 mg 45 000 F289 10 Carboxy 1 decanethiol 10 10 mg 11 300 C385 100 mg 31 000 C385 Carboxy 1 heptanethiol 7 10 mg 11 300 C386 100 mg 31 000 C386 5 Carboxy 1 pentanethiol 5 CPT 10 mg 11 300 C387 100 mg 31 000 C387 10 disulfide 10 10 mg 11 300 C404 100 mg 33 000 C404 7 disulfide 7 10 mg 11 300 C405 100 mg 33 000 C405 14 L News 101 2002 5 0 10 20000000 5 Carboxypentyl disulfide 5 10 mg 11 300 C406 100 mg 33 000 C406 4 4 Dithiodibutyric acid 500 mg 14 000 D524 Dithiobis succinimidyl undecanoate DSU 10 mg 13 200 D537 50 mg 39 800 D537 Dithiobis succinimidyl octanoate DSO 10 mg 13 200 D538 50 mg 39 800 D538 Dithiobis succinimidyl hexanoate DSH 10 mg 13 200 D539 50 mg 39 800 D539 11 Ferrocenyl 1 undecanethiol 11 10 mg 11 800 F246 1
43. rfler J Biol Chem 14 14271 2001 LH ULL OOOO Yamashita EB 1 2 0000000000000 000 869 1404 Tel 09676 7 3932 Fax 09676 7 3960 e mail hideyama 2as 1 ktokai u ac p L News 101 2002 EIE LI e D D D 0 00 1000097 00 102 00 2D 00000000 30 20 1 6 50 8 0 0000 13 0000 9D 000000000 71 00 76 00 60000000 0 00010 0 0000 pbo ut 0 002000 80 000 0 00020 9D 000000000000 e 0000000000 1000099 00 0 20000 0 0 10 0 00 Jr uuu II EDTA H ED LU U 500g Hequest C421 1009 24 000 420 DUBII ug 7000 0000 3p 1300000 150000 0120 4895480 000000 20000000000 00000000000 0096 286 151510 000
44. rray LCX assay Kinetic PCR PicoGreen TagMan PCR Pinpoint assay News 101 2002 0 E AEO ED ENE ER E EET Invader 210 0850000 DOL assay j molecular beacon Sniper 5 00000 LE ET EE EE EJ EJ EJ D EE EE EE EE EE EE D D DE EE EE EE EE EE 7D D OU EE ET LT E 9 Pinpoint assay PROBED LE ET EE EJ EJ EJ EE EE EE EE EE EE EE EE EE EE EE EE EE EE EE EE EE D EE ETE ET LT E 2 00000 000
45. uuuut 110 1200000 70000 30000000000000 00000 Digi
46. y 0 00 000 Two Hybrid LE ET EE EE EE EJ EJ EE EE EE EE EE EE DE DE EE EE EE EE EE EE EE DE EE EE ETE ET LT E E REV BG BRE Table 3 Various techniques for proteome analysis For protein indentification and differential display Peptide sequence using charged tag SMA or SPA reagent Isotope label ICAT assay ICAT assay with N enrich medium 2 dimensional PAGE Capillary LC Identification of phosphorylation site Protein array News 101 2002 4 000 90 600 000
Download Pdf Manuals
Related Search