User manual Version 1.19
Contents
1. User manual Genome ARTIST Version 1 19 Genome ARTIST Table of Contents 1 PPO OM ROTE 3 1 1 What is Genome ARTIST E NE PEDE erne EE rer 3 1 2 Reports BUS SS bolt ibo rio aet E 4 and IRM soi aa ife t videret 4 L REGUL MICU HS enis ur Saddle s esed o dde 4 Dre Install dune ete eee sb efte cer o ER 6 IS UBI iecit os imt itae oM e e 6 M 2 data T 6 317 Aeguiring BOM OMICS dioi es tut at Ea TS 6 3 2 Ready lIor use zenome Bosse iste a a age nada e 8 S d 10 4 Launching ae eta PCT 12 2 REACUIS Ihe TES US 14 SEK JETS Qe D ec ahs seas 15 202 tie SUSE SEES SEE HESS ESS 16 2 3 Res lts tab LE Ae ia eal as 16 5 4 Result p2. 4 The reverse complement sequence of pyd associated insertion The program will strip away any unnecessary information like spaces new lines GenBank or FASTA additional information and keep only the relevant characters A C G T and N After entering all of the necessary information press the Search button and the prografm will launch the query While the query is processed a message will inform that the query is running After the program computes the results they will be shown in a new tab on the main interface 13 Genome ARTIST Warning to compute the alignment results for a common iPCR derived sequence query 100 500 nucleotides it takes between one second and a few tens of seconds depending on the reference genome size and on the CPU performances the system must also correspond to the other hardware requirements 5 Reading the results The results window has 3 sections as presented in Fig 5 Query Information Best result Results table Genome ARTIST File New Search Settings Load A Save Save As Genome ARTIST query 001 Query information Score Sequence Search date 13 04 2012 Time elapsed 6s Mapping Query 225 226 374 375 1 SS n 438 11 2 113 Final results 1 P lacw 2 3 P lacw UL aer 314 375 Partial alignments Sa Open partial alignments 11 a 1 P
3. and in Fig 4 the reverse complement sequence simply obtained by checking the dedicated button is shown Sometimes the reverse complement sequence is more intuitive for analysis relative to the reference strand of the genome 12 Genome ARTIST Query TTTAAGTGTATACTTCGGTAAGCTTCGGCTATCGACGGGACCACCTTATGTT TTTCATCATGCTCAGTCGGTTCAGATTATCGCGCTTGTGCGGTTGTGCGGAG CGGACGAGCTGAAGTGGCCGAGTCGTGAACTTGAAATCTATACAGGCGTTTT CATAAACAAACAAATACGAATGCGAAAGAGCCGGTAAAAGTTTAAAT GTTTGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGAT GTGCTGCAAGGCGATTAAGTTGGGTAACCGCCAGGGTTTCCCCAGTCACGTA CGTTGTAAAACGACGGCCAGTGCCAAGCTCTGGCTGCTCTAAACTACGCATTT Query content Reverse complement query Search Cancel Fig 3 The original sequence obtained with the primer Spl Query CTACTGTGCGGTAGGGTCCAGTTCATGTTAATGNATAAGAGGCGTGAGGAAAAAATTC GTACTTGGAGTACGAAATGCGTAGTTTAGAGCAGCCAGAGCTTGGCACTGGCCGTCG ACAACGTACGTGACTGGGGAAACCCTGGCGGTTACCCAACTTAATCGCCTTGCA IGCACATCCCCCTITCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCAAACA AAACTTITTACCGGCTCTITCGCATTCGTATTTGTTTGTTTATGTTTTAAAACGCCTGTA AGATTTCAAGTTCACGACTCGGCCACTTCAGCTCGTCCGCTCCGCACAACCGCACAA GCGCGATAATCTGAACCGACTGAGCATGATGAAATAACATAAGGTGGTCCCGTCGAT GCCGAAGCTTACCGAAGTATACACTTAAAT Query content Reverse complement query Search Cancel Fig
4. lacw 2 dmel 21 3 P lacw Best result 193 374 375 Score 884 491 712 1 P lacw 21 dmel 3 P lacw Open result 4757438 1 4757618 2 CGCATTCGTATTTGTTTGTTTATGTTTTAAAACG CCTGTATAGATTTCAAGTTCACGACTCGGCCA CTTCAGCTCGTCCGCTCCGCACAACCGCACA GCGCGATAATCTGAACCGACTGAGCATGAT GAAATAACATAAGGTGGTCCCGTCGATAGCC 4757438 1 4757618 1 2 1 dmel 21 P lacw Fig 5 Details of the results window 14 Genome ARTIST 5 1 Query Info At the top left summary information about the query can be found This shows the context in which the query was ran The summary fields are Search date the date the search was first launched Time elapsed the time required for the search to be completed Query the sequence that was processed during the search Final results the number of results that have been found for this search NOTE the maximum number of reported results can be changed from Settings Partial alignments found the partial alignments which were used to assemble the final results may be seen by pressing the button Open partial alignments Fig 6 Partial alignments x Score Locati Position Length Sequence E I Mapping 5 292 437 491 777 288 1 438 491 777 _ 187
5. position in the mapped files Under each result in Sequence Mapping column there is a legend specifying the files which were mapped and the numbers associated with them are used to visually identify the sequences The matching strands relative to the reference sequences are also indicated by arrows placed inside the graphical representations of the results If the arrow is pointing to the right the sequence matches the forward or reference genomic transposon strand If the arrow is pointing to the left then the sequence matches the reverse reverse complement genomic transposon strand This panel shows the minimum amount of information for each query To find more detailed information about one particular result double click on it and a new window with annotation details will open 5 4 Result panel Best result or Result candidate This panel offers several details about a particular result It is composed of 3 rows standing for Sequence mapping Sequence alignment Detailed coordinates and Annotations The sequence mapping section shows the same figure as Sequence Mapping in the results table and depicts how specific sub sequences have matched the given query The sequence alignment offers details at nucleotide level regarding matches mismatches and indels 16 Genome ARTIST In Result panel section the alignments are described along with the nucleotide coordinates pertaining to the
6. 416 339 dmel 3R 4757430 4757654 230 1 ee gt 4757430 4757654 375 438 126 Ptlacwi 1 64 e pes di 64 EDT 394 120 dmel 2L 14234063 14234145 438 14234063 14234145 375 414 68 10691 10651 ao QT 10691 Pag Bal 56 5272141 5272173 5272141 79 121 56 22676169 22676128 43 1 1438 22676169 248 282 v Lok Fig 6 A list of partial alignments of the query with either genomic blue or transposon magenta sequences 15 Genome ARTIST 5 2 Best result This panel shows the best proposed results If by examining the results the user finds that another result may be biologically the best this result can be marked accordingly as Best result and it will be shown in the panel 5 3 Results table The results table shows the best matches of the given query to the files stored in the database A result contains Score and Sequence Mapping The score is proportional to the number of nucleotides that have perfectly matched the query The Sequence Mapping represents how the genome and transposon sequences matched the query Genome files and transposon files are differentiated by color genome sequences are depicted in blue and transposon sequences are shown in magenta The numbers above the mapping represent the position in the query while the number below represents the
7. 7 and installing Oracle JAVA JDK 7 instead as described above Starting with Ubuntu 13 04 care should be taken about a default setting which opens the executables as text The problem is solved as it follows open the folder Genome ARTIST select File Preferences Behaviour then for Executable Text Files select either Run executable text files when they are opened or Ask each time Genome ARTIST 2 2 Installation The program comes as a zip archive that must be extracted in a folder easy to be accessed Aside the extraction there is no other necessary action to be done 2 3 Running To start the program the script Genome ARTIST sh which should be marked as an executable when imported from an external storage device must be run As an alternative Genome ARTIST may be used as an executable from an ext2 ext3 ext4 formatted external storage device If the user wants to avoid installation of both an OS and a Genome ARTIST package in the computer a combination of a BioLinux 7 USB live stick and a ext2 ext3 ext4 formatted external storage device containing the Genome ARTIST package is the fastest and simplest solution 3 Loading data 3 1 Acquiring genomes On the project s website www genomeartist ro the user can find bundles containing D melanogaster genome or the genomes of some well know model organisms These genomes can be extracted and loaded using the Add folder feature of Genome ARTIST However if the gen
8. anel Best result or Result 16 5 3 Gene TAP MR 18 Saving and cR 19 E E ERE 19 T NS SE ANC Hise pcena EDU onerous 19 CERRO TEES 20 5 Licenses A 21 9 Authorsofthe 21 Genome ARTIST 1 Introduction 1 1 What is Genome ARTIST Genome ARTIST ARtificial Transposon Insertion Site Tracker is a new bioinformatics tool www genomeartist ro originally developed in order to allow a rapid detection of insertional mutations generated in the genome of Drosophila melanogaster by means of artificial P element derivatives Aside from the large gene disruption projects FlyBase www flybase org many fly laboratories run small scale transposon mutagenesis screenings Basically mobilization with a transposase source of artificial molecular constructs derived from a natural P mobile element or from other transposons induces insertional mutations in the germline Many different mutant strains are derived f
9. e Sequence location raw press the browse button on the right of the field and select the file containing the raw data a continuous sequence of nucleotides only A a C c G g T t characters are permitted inside the file since any other characters like the space character or new line will cause the file to be processed in a wrong manner Genes location fasta press the browse button on the right of the field and select the file containing the genes information corresponding to the raw file written in the fasta format The first two fields are required and the third field is optional Press the Ok button see Fig 1 and the program will process your input to create the new genome data source Warning the time interval necessary for creating the new data source depends on the computer performance Genome ARTIST Transposon files Parameters Add folder Add file Delete fie 42 Create file Sequence Genes location location jJresources raw dmel X raw Jresources gene dmel_X gene Jresources raw dmel U raw Jresources gene dmel_U gene Jresources raw dmel_4 raw Jresources gene dmel_4 gene Jresources raw dmel_3L raw _ resources gene dmel_3L gene Jresources raw dmel 2R raw Jresources gene dmel 2R ge Jresources raw dmel 2L raw Jresources gene dmel 2L gene Fig 1 Pressing Ok will load all the genome files chromosomes in RAM memory c Creating a
10. e of interest 7 Genome ARTIST If the genome of interest contains only one chromosome as in bacteria the user should download the file ending with gbk If the genome has more than one chromosome then for each of them the user should download the file ending with extension gbk Place all downloaded files into a single folder From Genome ARTIST install folder copy the three script files found in scripts NCBI into the folder containing the downloaded chromosome files Ensure that the three script files are marked as executable chmod x Run the parse ncbi sh file After the script is executed a folder named output will be generated This folder contains all the required files for loading the genome and the annotations into Genome ARTIST Load the genome of interest into Genome ARTIST using the Settings gt Add Folder option then press to finish uploading NOTE the scripts described above work only for some of the genomes available in the FTP repository of NCBI 3 2 Ready for use genome files a Loading a whole genome At www genomeartist ro you may find Genome ARTIST user friendly ready for use genome files of some experimental models Just extract the archive of interest in a dedicated folder then open the Settings Panel in Genome ARTIST and under Genome files you will find the button folder You will be prompted for a name and a folder This na
11. install lib32z1 2 5 lib32bz2 1 0 or sudo apt get install libstdc 6 i386 b Software Operation system Linux OS Genome ARTIST has been tested on Ubuntu 10 04 14 04 Linux Mint 14 1 openSUSE 12 3 CentOS 6 4 and Fedora 19 distributions and similar performances were obtained Other dependencies JAVA JRE v1 6 or v1 7 sometimes called v7 which can be installed from Ubuntu Software Center OpenJDK Java 7 Runtime As an alternative the user may choose Oracle JAVA JDK 7 which can be installed through a PPA repository available at http www webupd8 org 2012 01 install oracle java jdk 7 in ubuntu via htm using sudo add apt repository ppa webupd team java sudo apt get update sudo apt get install oracle java7 installer For smooth running performances of Genome ARTIST we recommend BioLinux 7 workstation based on Ubuntu 12 04 OS http nebc nerc ac uk tools bio linux bio linux 7 info which contains pre installed packages of ia32 libs and OpenJDK Java 6 Runtime BioLinux 7 is tuned for bioinformatics applications and may be also run live from a DVD or a USB stick if full installation or dual boot is to be avoided We noticed that some automatic updates of BioLinux 7 impair the graphics of the loading bar which display the alignment progression during query searching This problem may be circumvented by avoiding updates by running live BioLinux 7 from a DVD or USB live stick or by removing OpenJDK from BioLinux
12. ity to construct alignments referred to as final results FRs by merging PAs of genomic and transposon origin The FRs are shown in an adjustable hierarchical list of alignments and each member may be analyzed in detail by clicking on it In FRs built by merging genome derived PAs with transposon derived PAs the site of insertion is represented by the genomic nucleotide closest to the first or the last reference nucleotide of a transposon 7 2 Parameters The parameters that are found in Parameters tab Fig 9 a and Fig 9 b are Type of interval expansion tells the algorithm how to expand the initial intervals Short means that any mismatches during the expansion process will be badly penalized and Long means the algorithm is less severe with the mismatches Zero offset Advanced represents the shift of the score considered neutral for the expansion algorithm Negative values mean greatly punishing bad alignments Match score Expansion this is a bonus for an exact match in the first position Mismatch score Expansion penalty for a mismatch on the first position 20 Genome ARTIST Length modifier Expansion the multiplier for the initial score of the expansion phase Picking depth affects the number of small pieces that are picked as candidates for assembling the final result Nucleus size represents the minimum size of an interval in the final result Number of res
13. lculated and the best mix sequence with the genomic and transposon coordinates is offered to the user Different colors are used for genomic versus transposon fragments and an intuitive list of results and details is also depicted One may easily observe the site of insertion relative to the specific genomic release loaded in Genome ARTIST the gene affected by the transposon insertion and also the genes located in the close vicinity of the insertion Special biological conditions occurring during mutagenesis experiments such as transposon reinsertions into the original mobile element copy are not usually detected with other searching algorithms therefore 3 Genome ARTIST Genome ARTIST is designed to reveal and to interpret such events To some extent Genome ARTIST is an alternative for the classical alignment algorithms and may be exploited for checking the specificity of short sequences as primers or probes Last but not least aficionados of different model organisms may use the abilities of Genome ARTIST by loading other genomes and or specific transposons The performances of Genome ARTIST were also successfully tested on various genomes as those of Pseudomonas aeruginosa Saccharomyces cerevisiae Arabidopsis thaliana Caenorhabditis elegans Drosophila pseudoobscura Ciona intestinalis Danio rerio Because of the sheer size of mammal genomes of Mus musculus and Homo sapiens only a bit more than half of such a genome may be loaded i
14. me will be used as a suffix for naming the loaded chromosomes example dmel 2L dmel 3L etc Select the folder that appeared after extracting the genome archive After choosing the folder and the name just press Ok and the loading of the genome into the application should start Warning this will take some time depending on the size of the genome and the computer s performances After loading a genome you may co load a different genome if you are interested in comparative sequence analysis following the same steps as above For running bacteria or invertebrate genomes 1 GB of RAM is enough but for individual genomes of vertebrates such as D rerio at least 3 GB of RAM are required Genome ARTIST b Loading a chromosome genome file Instead of using Add folder option in order to load a whole genome one may load only one or a few chromosomes here regarded as genome files step by step Loading even an entire genome file by file is advantageous since the right association between a sequence and its annotation is manually performed therefore is not necessary to adjust the names of the downloaded raw and fasta files The names may be kept unchanged as in the host database To load a genome file access the Settings menu and select the Genome files tab Once there press the Add file button and the necessary information will be prompted Name enter the name for the new genome data sourc
15. n a single Genome ARTIST package thus the user should choose the chromosomes of interest for loading Additionally pairwise comparative alignments may be performed among sequences pertaining to various species allowing the identification of structural orthologous genes 1 2 Reporting Bugs So the inherent bugs We would appreciate any report concerning such annoying things in order to fix them as soon as possible Please send any comments at alexandruecovoiu yahoo com 2 Installing and Running 2 1 Requirements a Hardware RAM memory 512 MB should be available in order to use only the D melanogaster genome For any additional genome files loaded the RAM requirements will increase with about the size of the loaded file 50 of its size DISK memory 700 MB if you plan to use only the D melanogaster genome For any additional genome files loaded the space requirements will increase with approximately 3 SIZE OF LOADED GENOME FILE Processor The lowest performance processor the program has been tested with is an Intel Atom 1 GHz Genome ARTIST was designed for a 32 bit architecture but users of a 64 bit OS version may employ the software by installing the package ia32 libs For Ubuntu 12 04 one can install this package by running the command sudo apt get install ia32 libs Starting with Ubuntu 13 10 ia32 4 Genome ARTIST libs is not supported any longer and the issue is solved by running the command sudo apt get
16. new genome data source directly inside the program To create a new genome data source access the Settings menu and select the Genome files tab Once there press the Create file button and the necessary information are prompted Name enter the name for the new genome data source Sequence enter the nucleotide sequence only A a C c G g T t N n characters will be kept after processing it allows for copy paste from another location that contains spaces new lines or any other unnecessary characters Press the Ok button and the program will process the input to create the new genome data source d Deleting a genome data source To delete a genome data source access the Settings menu and select the Genome files tab Once there select the source to be deleted and press the Delete file button Individual chromosomes selected from a loaded genome can also be deleted 3 3 Transposon files a Loading an existing transposon file To load a new transposon file access the Settings menu and select the Transposon files tab 10 Genome ARTIST Once there press the Add file button and complete the necessary information Name enter the name for the new transposon data source Sequence location raw press the browse button on the right of the field and select the file containing the raw data a continuous sequence of nucleotides only A a C c G g T
17. nse_ and the source code is freely available at http www bioinformatics org 9 Authors of the User manual This manual was co authored by Ecovoiu Al Al and Ghionotu I 21
18. omes found on the website are not relevant the user can forge specific Genome ARTIST friendly genomes Genome ARTIST supports the loading of genomes of D melanogaster and D pseudoobscura from FlyBase and also the conversion of many genomes from Ensembl www ensembl org and from NCBI www ncbi nlm nih gov a Loading data from FlyBase 1 ftp ftp flybase net genomes From FlyBase FTP genome repository 1 download the raw files and the fasta files for the genome of choice Place all the downloaded files into a single folder and extract all the archives Rename the raw files example 2L raw Rename the annotation fasta file using the following syntax chromosome name gt _gene fasta example 2L_gene fasta The term gene fasta is mandatory Load the genome into Genome ARTIST using the Settings gt Add Folder path and press Ok to finish the uploading Completion of the task will take between a few minutes for invertebrates 6 Genome ARTIST and a several tens of minutes for vertebrates depending also on the hardware performances b Loading data from Ensembl 2 http www ensembl org info data ftp index html From Ensembl FTP repository 2 download the following files for a given genome From DNA sequence gt FASTA download all the chromosome s sequences from the beginning of the list till the folder dna toplevel fa gz which should not be uploaded For example for D melanogaster all
19. ormed to surpass the alignment imperfections An initial score of alignment is defined for each of the selected intervals and a window of 4 nucleotides equivalent to a byte is used to extend the alignments in the very vicinity of the borders An implementation of Smith Waterman algorithm where a match 2 and a mismatch 1 combined with an original formula that penalizes mismatches is used for computing the score of the extension Any extension stops when the sum of the initial alignment score of an interval and the score of extension drops below zero for each of its borders Intrinsic to the algorithm a few mismatches are still incorporated in the resulting extended intervals EIs which are generated this way When Els are overlapped or adjacent to each other they are coalesced into merged extended intervals After this stage a list of alignments also referred to as candidate intervals CZs is created The list contains basic intervals MCIs EIs and together covering for each nucleotide position in the query Using again a Smith Waterman implementation for a rigorous realignment of the C s a match 2 and a mismatch 1 the best scoring alignments are obtained and presented to the user as a list of partial alignments PAs in the graphical interface of Genome ARTIST Some of the P s pertain to the genome chromosome and others to the transposon sequence The most distinctive property of Genome ARTIST consists in its capac
20. otice that P lacW insertion is located close to gene of D melanogaster at nucleotide 4757618 genome release 5 46 nucleotide 1 of P lacW artificial transposon www flybase org coincides with nucleotide 375 of the query 5 5 Gene map To obtain more information about the gene hit by the insertion access Gene map window by double clicking the Annotation field The Gene map panel shows the aligned query sequence relative to the local genomic landscape The arrow shows the relative orientation of the query sequence At the ends of the arrow the names of the closest upstream and downstream genes are depicted Under the graphical view there is a table that briefly describes the genes their cytological map their absolute genomic coordinates and location of their sense strands relative to the reference strand of the genome 18 Genome ARTIST Gene map tRNA R 85Cb 2 A osk Cytological Position in location 4760853 4764117 map 85B7 85B7 0003015 8583 8587 14652790 4757599 FBgn0262614 tRNA R 85Cb dmel 4688655 4688727 FBgn0053551 Fig 8 In the Gene map panel it may be noticed that the P lacW insertion is located upstream to pyd gene as the sense strand of pyd is on the reverse strand of D melanogaster genome 6 Saving and loading The result that has been found for a given
21. query at specific parameters can be saved by using the Save and Save As button Any result is saved in a Genome ARTIST format and will have the extension GA The files may be stored for a further analysis The Load button works with files having GA extension and it would load the saved result into the interface 7 Advanced Settings The settings for the search algorithm are found in Settings gt Parameters 7 1 The search algorithm Genome ARTIST uses overlapped intervals of 10 nucleotides the k mers or decamers further referred to as basic intervals both for indexing the reference sequences and for spanning the query sequence When loaded into the built in database of Genome ARTIST each genome or transposon sequence is hashed and an index of addresses is generated for all of the theoretical 1 048 576 4710 distinct decamers When a comparative search is started the query sequence is scanned for all its overlapping k mers then the appropriate index matches hits are retrieved Many initial alignments occur then the overlapped and or adjacent basic intervals are fused and merged continuous intervals 19 Genome ARTIST are generated At this stage each of the MCIs from the query perfectly aligns with a MCI from the reference sequence The MCIs along with some selected basic intervals are gathered together in a pool which is considered for the next step of the algorithm Then an extension step is perf
22. ress the Ok button and the program will process your input to create the new data source c Deleting a transposon data source To delete a transposon data source you must access the Settings menu and select the Transposon files tab Once there select the source you want to delete and press the Delete file button 11 Genome ARTIST 4 Launching a query To launch a query press the New Search button on the main interface and complete the necessary information Query name enter the name for the new query Query content enter the query to be run Accepted input Acontinuous nucleotide sequence The query in the GenBank or in FASTA format Starting with version 1 18 of Genome ARTIST high throughput alignments are performed when the search window is fed with a list of sequences in FASTA or in GenBank format Similarly if blocks of nucleotides are separated by at least an empty line in a list of sequences each block is considered a distinct query which is individually aligned against the reference sequence and each alignment is reported as a distinct result Thus care should be taken in order to avoid accidental empty lines We present here a real case of a P lacW insertion close to gene from D melanogaster obtained in our laboratory In Fig 3 is depicted the sequence obtained consecutive to iPCR with the primer Sp http www fruitfly org about methods inverse pcr html
23. rom affected parents using classical genetic crosses and in the end their putative useful mutations are analyzed by inverse PCR iPCR and sequencing The sequencing product is a mixture of information where part of it pertains to the fruit fly canonical genome and the rest of it belongs to a specific artificial element The most critical aspect of sequence analysis is to detect the exact border between the genomic and transposon DNA equivalent with identification of the insertion site at the nucleotide level Sequencing products are not always perfect and a few artifact bases mismatches may impair a fluent insertion mapping Most commonly the sequences of interest are aligned on line with BLAST http blast ncbi nlm nih gov or BLAT http www genome ucsc edu against D melanogaster official genome without considering either natural or artificial P transposons Alternatively dedicated software like iMapper http www sanger ac uk cgi bin teams team113 imapper cgi are employed but some limitations regarding customization and sensitivity are encountered Often additional manual sequence annotation is needed in order to finish an accurate insertion mapping and here is when Genome ARTIST enters the scene and offers a bit of help The query sequence is simultaneously compared off line against both the D melanogaster genome and the specific transposon sequence partial sequence alignments are matched to each other relative scores of alignments are ca
24. specific genome transposon reference sequence If more genes are in the area only one is shown as a green bar From this panel the result can be exported as Image or as PDF or can be printed Another option is to set any particular result as Best result The result will be shown in the Best result panel in the main query window Using the result panel actually allows the user to locate the exact position of the transposon insertion site Fig 7 In the case of pyd mutant the insertion is located in chromosome 3R at genomic coordinate 4757618 according to release 5 46 from FlyBase which is placed right near to the nucleotide 1 the most external one of P lacW artificial transposon 17 Genome ARTIST Result candidate x Export Print y Best Result Score 884 5 225 226 374 375 438 EES CEL 491 1 712 4757470 2 4757618 1 64 1 P lacw 2 3 P lacw 374 375 CGCGAT AAT CT GAACCGACT GAGCAT GAT GAAAT AACAT AAGGT GGT CCCGT CGAT AGCCGAAGCTT ACCGAA a 4757618 1 Pflacw CI T Coordinates Annotations Location Position in query P lacw 5 225 491 712 1 o 0 tRNA R 85Cb gt 24 226 374 4757470 4757618 P lacW 375 438 1 64 Fig 7 In the result table panel may n
25. t characters are permitted inside the file any other characters like the space character or new line will cause the file to be processed in the wrong manner Genes location fasta press the browse button on the right of the field and select the file containing the genes information for the raw file written in the fasta format The first two fields are required and the third field is optional Press the Ok button Fig 2 and the program will process the input to create the new transposon Genome files Transposon files Parameters Add folder Delete file 42 Create file Sequence data source Name Genes location location P lacw resources raw P lacW raw Jresources gene P lacw gene Ok Cancel Fig 2 Loading a transposon file b Creating a new transposon data source directly inside the program To create a new transposon data source access the Settings menu and select the Transposon files tab Once there press the Create file button and you will be prompted for the necessary information Name enter the name for the new transposon data source Sequence enter the nucleotide sequence here you can enter any character but only A a C c G g T t N n characters will be kept after processing so you can copy paste from another location that contains spaces new lines or any other unnecessary characters P
26. the folders starting with Drosophila melanogaseter BDGP 5 73 dna chromsome 2L fa gz and ending with Drosophila melanogaseter BDGP 5 73 dna chromsome dmel mitochondrion genome fa gz should be downloaded For the masked version of the genome the folders from Drosophila melanogaseter BDGP 5 73 dna rm chromsome 2L fa gz and including Drosophila melanogaseter BDGP 5 73 dna rm chromsome dmel mitochondrion genome fa gz should be downloaded Enough time should be allowed for the output folder to be completed The release number BDGP 5 73 is used just for the sake of the example as it is constantly changing following re annotation From Annotated sequence gt EMBL download all the archives Place all downloaded files into a single folder Extract all archives From Genome ARTIST install folder copy the two script files found in scripts Ensembl into the folder containing the downloaded files Ensure that the two script files are marked as executable chmod x Run the parse ensemble sh After the script is executed a folder named output will be generated This folder contains all the required files for loading the genome into Genome ARTIST Load the genome into Genome ARTIST using the Settings gt Add Folder option then press Ok to finish uploading c Loading data from NCBI ftp ftp ncbi nlm nih gov genomes From NCBI FTP repository 3 one should download the following files for a genom
27. ults the number of final results that will be assembled Give bonus to insertion candidates a bonus is given if the sequence has a transposon flanking a genomic sequence A transposon end as an inverted repeat in the case of P mobile element derivatives must be present at the site of insertion in order to give the bonus Genome files Transposon files Parameters Genome files Transposon files Parameters Type of interval expansion Type of interval expansion 1 of expansion 7 E qe Type of expansion C M Short Medium Long Custom Short Medium Long Custom Advanced expansion parameters Advanced expansion parameters Zero offset 5 Zero offset 4 Score match 4 Score match 2 Score mismatch 2 Score mismatch 0 Length modifier 4 Length modifier 4 Result candidates Result candidates Picking depth 2 Picking depth 2 Nucleus size 15 Nucleus size 15 Results number 20 Results number 20 Give bonus to insertion candidates Give bonus to insertion candidates ok Cancel ok Cancel A B Fig 9 a The parameters are set for Short type of expansion b The parameters were set for Medium type of expansion thus the advanced expansion parameters shifted to different values 8 License Terms Genome ARTIST is an open source application and is published under GNU General Public Lice
Download Pdf Manuals
Related Search