USER GUIDE - loadritensw.com.au
Contents
1. WDISPIGAY Yo sere EEE a atan AE a kt stress a saa kai ate bete RA 2 1 WOE VRP AD n nn a tee ke m aa e e E a m TE a da pann ed eta kato ee elan nen dane avi 3 15 INDIGATOR UGH O ik t t nwa nn dane aa da a te a da ak oo an kak twe m kara eki 4 1 6 TRIGGER a a gn da dtan a tt nef tr aa e l n nna EENE a eta 4 1 7 SWITCHING ON a Sarat ticisiaco de su tras aaa trase ata ea tate it t re da a a a a eski aran kra la de 5 2 WEIGHING OVERVIEW ccccccccccccccccccccccecccececccecucucucucecavuuucaueveveveuevenennes 6 2 1 BEFORE WEIGHING A LOAD 0 0 0 cc cc cc cc cccccecececececcccceccececetecscecscncaesceauueneesneesuensennaes 6 2 2 WEIGHING A LOAD 20 0 cece cece cece ccc ccececsccccccccececccncecneueceueceaetecueetseuuaeseeauueneesnecsteesennaes 6 2 3 ENTERING BIN SIZES 20 ccccccccccccccccccecccecececececsceucceececececsceusesuuseeeausensestansusvsuneaenens 7 3 Te here A ot AA AA cee cece cen cece cet cece cece cect cost cece ANA A MW A WA A PAPA MWN 8 8 Bel OONO TOTAL e bote a aa Grate eke e sise ae 8 4 ZEROING THE URS20 wi tit t t two ww 0 8 wa tw 0 dw wy sw 0 dv w eat di aw a e ik w e w w w l e e 10 4 1 LARGE ZERO ERROR ccc eccecccececececececcccececececscetacsccuceseauseneesuecsesuauseauseneasnensets 10 5 ADDING AND RECALLING c ccccccccccecececececececececececacuvauevevevevevavevevevevanes 11 5 1 ADDING A WEIGHT 2 0 c cece ccc ccececcecccecececececsceueccecucececetecseececsceuauaeausenessnecsesnansnans 11 52. 10 1 TRIGGER FAULT The LR920 continually checks the function of the trigger device Ifa fault occurs the indicator displays the following message If this occurs contact your Loadrite dealer 10 2 NOT DUMPED This error message can occur when Automatic Adding is enabled For a weight to be automatically Accepted added to the totals the forks must go back to the dump position as part of the sequence If they do not go back far enough the following message is displayed The operator can manually Accept Add the measured weight if valid Refer to page 11 for more details on Adding weights 10 3 RELEASE CODE REQUIRED This message appears typically on new systems that require a Loadrite Distributor to enter a Release Code after checking the system is correctly set up and calibrated This process ensures the LR920 system will operate at its best performance The display will flash the message Contact Loadrite for release code Ph 1 800 665 860 Please contact your local Loadrite distributor in Australia and provide them the serial number on the back of the LR920 indicator console LOADRITE LR920 User Guide LOADRITE 11 920 SPECIFICATIONS Minimal Weighing Delay Weighing delay is minimal because the weighing function is carried out during a normal lift LR920 Power Requirements Supply Voltage 12 to 32 Volts DC Supply Current LR920 160mA typical 350mA max LP950 printer 50mA standby 4A pea
3. data logger modem or other device if fitted To enter additional data This explanation uses the example labels above R When the LR920 is Ready press D l i A O WEIGH NETTO O O The LR920 displays the first label e g l Customer No and prompts you to enter a Cust No number 12345678 Enter a number up to eight digits and ENT press WEIGH NETTO O O The LR920 displays the second label 7 e g Docket No and prompts you to enter Docket a number 87654321 ENT 3 Enter a number and press WEIGH NETTO O O LOADRITE LR920 User Guide LOADRITE w PAN Enter the third number e g Bin No in the B i n N 0 43215678 same way WEIGH NETTO O O The LR920 then returns to the Ready to Weigh state Ready Total O WEIGH NETTO O O a You may have one two or three label number pairs available depending on how the LR920 is set up at installation time LOADRITE 13 LOADRITE LR920 User Guide LOADRITE um 7 USER MENU OPTIONS The User menu UserMenu allows you to set the clock It also provides access for Loadrite installers to calibrate and set up the LR920 Setup requires a security code to allow access to these functions 7 1 MENU KEY The same keys are used for all menu options as follows To access the menu press B To obtain the next menu option press the arrow keys ENT To accept an option press To exit the
4. menu press 6 If you do not press a key the LR920 returns to the Ready state after a short delay 7 2 SETTING THE TIME AND DATE The LR920 has an internal clock which can be used for inserting the time and date into recorded and printed data You can also display the time and date on the upper display by pressing is the TIME I DATE icon To set the time and date UserMenu Clock When the LR920 is Ready press Fa Press l and the display should show ENT To set the clock press weickHQ NETC O O LOADRITE LR920 User Guide LOADRI TE s PA O ad The LR920 shows the current time and prompts you to enter the minutes Enter the correct minutes using the number ENT keys and press You can clear mistakes using the key 11 31 Am Minutes 3 WEIGHO NETIC O QO Enter the correct hours using the number keys Use f L to toggle AM PM setting ENT When the hours are correct press 11 31 Am Hour Am LA WEIGH NETIC O QO Enter the correct month using the number keys ENT and press Enter the correct date using the number keys ENT and press 24 Apr Month 04 WEIGH NETIC O QO 24 Apr Date 24 WEIGH NETIC O QO Enter the correct year using the number keys ENT and press WEIGH NETTO O O Finally the LR920 displays the complete time and date for a few seconds before returning to the Ready state At any
5. output supply Ground output Printer SD n pa no o 10 11 12 Negative Positive 12V output do not use N C No function Printer RS232 output Printer busy EDP RS232 input EDP RS232 output Ground Reserved N C LOADRITE ODA w L A
6. 2 AUTOMATIC ADDING OF WEIGHTS c cccccccccececececececccccececececntecscsvanseaeacneass 11 5 3 RECALLING LAST NETT WEIGHT c cccccccccececececececcecccececececucecscneauseaeaeuenss 11 6 ADDITIONAL DATA ccccccececececececccecccuecccccecacccavvevevevacavevevevevevevevevevevanes 12 7 USER MENU OPTIOMN See er rr at os bos los kilos ion loss Bb 14 31 MENU KEY ala to a ot a ev are lt tra ao ta ez pe wemebiraGwesione si 14 7 2 SETTING THE TIME AND DATE ccc cc ecececccccccccecccececccuccscceaececsueuscsteuseeeaeneass 14 8 PRINT FUNCTIONS ccccccecccecececececccecececacacauecacauecevevevauevevevavevevevevevevevenes 16 8 1 RECEIPT PRINTING c ccc cc cccceccccscecscececncceccceaecececececscetscseeuseueaeneneesnecseensenvas 17 9 SPAN CALIBRATION CORRECTION cccccccececcecececcecececcecucccscnceees 18 10 ERROR MESSAGES u u ccccccccccccccccccccccccccececececucececucucucucucucuauauauauauauauauaueuaues 20 10 1 TRIGGER FAULT c cccccccccscececececcccccccececececscncecsceuauseaecececsuensesucuseuvanueastsnsestsnensnars 20 10 2 NOT DUMPED 0 sa ete atant ka coups cate les incvatmatelantcsiondcavagesbateabiedensanatnacesamece 20 10 3 RELEASE CODE REQUIRED 2 000 veeteeteeteetseseeesesteseeoeeosseoseueeeseoeeeseossosseneeeneuonene 20 11 SPELCIEIGAT NON e E A n acne cite kk ca ek ct kk ce kk N pk e eki ek e anne se 21 12 OUTPUT INPUT CONNECTIONS c ccccccccccccecccecececccce
7. LOADRITE kg PAN LOADRITE LR920 USER GUIDE Software No 60278 Version No 1 41 Document No 80675 03 Issue Date July 2010 E infoQloadritescales com W www loadritescales com A solution of VWACTRONIC TECHNOLOGIES www actronictechnologies com This manual is copyrighted with all rights reserved Under copyright laws this manual may not be copied in whole or in part or reproduced in any other media without the express written permission of Actronic Ltd Permitted copies must carry the same proprietary and copyright notices as were affixed to the original Under the law copying includes translation into another language Please note that while every effort has been made to ensure that the data given in this document is accurate the information figures illustrations tables specifications and schematics contained herein are subject to change without notice Actronic Ltd assumes no liability in connection with the use of any LOADRITE branded product Copyright 2010 Actronic Ltd LOADRITE and ACTRONIC TECHNOLOGIES are trademarks of Actronic Ltd LOADRITE LR920 User Guide LOADRITE Sp A Contents 1 THE LOADRITE LR920 WEIGHING SYSTEM ccccecececececececececececececeveveees 1 1 1 LOADRITE LR920 CONSOLE occ ccc ccc cece ccecececececececececececsentecsceuceueauneneestecsusnananans 1 1 2 WEIGHT MEASUREMENT c cccccecccececececececcceccececececececsestacscauseneauseneestessusnseseans 2 Meo
8. cceececacescncuecs 22 LOADRITE LOADRITE LR920 User Guide 1 1 Indicator lights THE LOADRITE LR920 WEIGHING SYSTEM The Loadrite LR920 weighing system measures the weight of loads lifted by front loading garbage trucks The heart of the system is the LR920 indicator which provides a keypad for entering instructions and an LCD screen to display weights and messages The indicator has internal memory which stores settings and data even when switched off The LR920 is installed in the cab of the truck and is connected to sensors on the lifting arms LOADRITE LR920 CONSOLE LCD display Keypad Main Operating Keys LOADRITE LOADRITE 920 1 LOADRITE LR920 User Guide LOADRITE um 1 2 WEIGHT MEASUREMENT The LR920 indicator console measures the sensors as the container is raised and lowered The indicator converts the sensor signals into a weight reading and displays the value An electronic trigger device mounted on the lift arms ensures that the weight measurements are taken at the same position each time The weight of the forks and arms are zeroed out when the system is calibrated so that only the weight of the payload is displayed When the Nett contents weight of a bin is displayed it can be added to the truck total 1 3 DISPLAY WEIGH C NETTO O O LOADRITE LR920 The LR920 display gives instructions and information along with the measured or total truck weight T
9. code Code ENT Enter the access code and press WEIGH NETTO O O LOADRITE LR920 User Guide LOADRITE m The LR920 prompts you to enter the Loadrite value for the weight Enter the Loadrite weight 6000 in this ENT example and press WEIGH NETTO O O The LR920 prompts you to enter the weighbridge value Enter WB Enter the weighbridge weight 6200 in this Va Lue ENT example and press WEIGH NETT O O If the adjustment is within limits the LR920 alters its calibration briefly Rea d y displays a value of scale factor and then returns to the Ready state n If the required adjustment is too large the LR920 displays an error message and does not change its calibration weOTO O O Checking the adjustment You can check the calibration adjustment by obtaining and comparing new Loadrite and weighbridge totals If necessary the calibration adjustment can be performed again using the new data Notes to remember It is important that you only use this function once with a given set of data If the same weights are entered again the LR920 will over correct and its accuracy will be seriously impaired It is very important to measure the empty Tare weight of the truck when it has dumped its load Stored Tares can be inaccurate and cause the system to be incorrectly calibrated LOADRITE 19 LOADRITE LR920 User Guide LOADRITE um 10 ERROR MESSAGES
10. d to enter the number 8 and to display the clock F pe e N Nine Long Used to enter the number 9 and to display the long Total total 1 5 INDICATOR LIGHTS The LR920 provides four indicator lights positioned below the display The left light flashes when a weight is measured The 2nd light comes on when the Nett weight of a container is measured and displayed The other two lights are not typically used WEIGH NETT Q Q 1 6 TRIGGER To ensure consistent and accurate measurement the LR920 system incorporates a position sensor trigger which initiates the weight measurement as the lifting arms are raised and lowered LOADRITE LR920 User Guide LOADRITE 1 7 SWITCHING ON The LR920 is normally connected so that it powers on with the ignition of the truck It can be put into a Stand by mode by pressing the key when Ready is displayed When in Stand by pressing any key returns to Ready On power up the upper display shows a sequence of check messages and then the Ready message WEIGH NETTO oO O LOADRITE LR920 LOADRITE 5 LOADRITE LR920 User Guide LOADRITE 2 WEIGHING OVERVIEW When ready to weigh the LR920 displays Ready on the display If the arms are not in the correct position to start the weighing cycle the display will show the message Arms Up There may be other information on the display depending on the mode of operation The total weight is sho
11. d weight will be automatically added a short time after it is displayed There is no need to press any buttons NOTE The Automatic Add function will only operate when the arms have gone back to the dump position during the cycle This helps to ensure that only valid bin emptying cycles are added Refer to page 20 for details on the No Dump error message RECALLING LAST NETT WEIGHT The recall function recalls and displays the last Nett weight if it has timed out Recalling is equivalent to lifting the same weight again however it will only work if the previous Nett weight timed out To recall the previous Nett weight Weights shown are examples only Press ZN is the RECALL icon Nett The LR920 displays the previous weight and the NETT light comes on ec D WEGH NETTQO O O LOADRITE 11 12 LOADRITE LR920 User Guide LOADRITE aon D A v ADDITIONAL DATA If this feature is enabled the LR920 allows you to enter up to three user defined numbers which provide additional information to the weight data The specific data for the LR920 is set up at installation time Examples for the labels attached to the data are Cust No Docket Bin No When you press the D key the LR920 displays the three labels in sequence and you can enter the relevant numbers for the current load The numbers can be up to 8 digits long This information can be printed or logged to an onboard computer
12. ghbridge weight be entered after the Total is cleared If prompted enter the weighbridge total value and press ENT 3 1 LONG TOTAL In addition to the normal Total a Long Total is recorded The Long Total is normally used to record the total hauled for a day or week To display the long total Weights shown are examples only Long Tot ress 9 res N 192340 L The Long Total is displayed while the key is held down and for a few seconds after it is released weicHO NETICV O O LOADRITE LR920 User Guide LOADRITE aQ ys ke PAN To clear the long total Weights shown are examples only While the Long Total is displayed press The LR920 prompts you to confirm that you do want to clear WEIGH NETTO O O ENT Press to confirm Long Tot Cleared The indicator clears the Long Total and then displays WEIGH NETTO O O LOADRITE 9 10 LOADRITE LR920 User Guide 4 1 ZEROING THE LR920 LOADRITE gs PA O ad When you raise empty forks through the weighing zone the indicator should display zero if the LR920 is configured to display weights as the load is lifted However due to changes in the lifting arms mainly caused by temperature a small zero error may occur This is mostly automatically compensated for by the LR920 when the empty weight of the container is measured To zero the LR920 Weights shown are examples only With empty fo
13. he display is backlit for ease of operation in low light conditions To turn on or off the display lighting Press the key LOADRITE LR920 User Guide 1 4 KEYPAD The table below shows the special functions that the keys have in addition to their numeric values used for entering data LOADRI TE g PA oO TA KEY NAME DESCRIPTION ED Exit Exits the operation without changing the data and to put the system into Stand By mode a Add Adds the current load to the running total Zero Used to enter the number 0 and to Zero the weighing system Data Access the data menu This menu is used to access and amend data e Bin Size Used to select the bin size Clear Total Clears the short total TOTAL Clear Entry Clears the entry when entering data or changing settings ENT Enter Enter key for accepting data or changes Arrows Arrows used to navigate through the menu Decimal Point Used to enter the decimal point LA One Used to enter the number 1 B Two Used to enter the number 2 Three Used to enter the number 3 3 Four Recall Used to enter the number 4 and to recall a weight B Five Used to enter the number 5 B Six Menu Used to enter the number 6 and to access the menu LOADRITE 3 LOADRITE LR920 User Guide LOADRITE w w Y KEY NAME DESCRIPTION Seven Light Used to enter the number 7 and to turn on or off the backlight Eight Clock Use
14. k Automatic transient suppression exceeds relevant SAE specifications for DC automotive power supply transients Signal Inputs and Outputs Sensor inputs 4 20mA 0 100 Trigger input Pulse width modulated 0 to 5V Serial communications RS232 to printer and data logger Display Keyboard DisplayBacklit LCD Keyboard 20 backlit keys including numeric and special function keys Clock Built in clock provides time and date Hours minutes AM PM day month year Physical LR920 indicator protected to IP54 Dimensions W 170mm L 270mm and H 90mm Weight 2kg with mounting bracket Rotary trigger Protected to IP67 Available Options LP950 printer 24 column Remote ADD button For operator convenience Interlock system To disable weighing under defined machine conditions Optional features A range of additional operating features can be enabled at installation time LOADRITE 21 22 LOADRITE LR920 User Guide 12 OUTPUT INPUT CONNECTIONS Transducer Se Se Do not connect Analog input 2 from sensor amplifier Do not connect 10 volt excitation Analog input 1 from sensor amplifier Shield Ground Power Control A TE Oot eS a N gt O 13 14 15 Negative supply ground Positive supply Remote button 2 no present function Remote button 1 add N C Interlock N C Trigger Positive supply N C Rotary trigger N C N C Ground output Positive
15. nted by pressing the 1 key on the LR920 keypad Depending on options selected at installation a docket similar to below will be printed Sands Hauling Bin Nett 450kg Bin Size 1 Truck Number 456 Date 1 Jun 2010 Time 12 30 pm LOADRITE 17 LOADRITE LR920 User Guide LOADRITE 920 mw AA 9 SPAN CALIBRATION CORRECTION This function allows small changes to be made to the LR920 calibration ifthe arms of the truck are modified or if no accurate test weight is available when the LR920 is calibrated at installation time The adjustment is carried out by entering the total of weights recorded at a weighbridge scale house over a period of time and the corresponding LR920 total To perform the adjustment you need to obtain a security access code from your Loadrite installer WARNING The LR920 alters its calibration every time this function is used It is important that you only use this function once with a given set of data If the same weights are entered again the LR920 will over correct and its accuracy will be seriously impaired The method is explained below using an example A truck is loaded and then proceeds to a weighbridge scale house The totals for the loads in this example are as follows LR920 6000kg Weighbridge 6200kg To correct the calibration of the LR920 rece c UserMenu Setup ENT Press WEIGHO NETIC O QO The LR920 prompts you to enter the Access security access
16. rks raise the arms until the left light flashes and the Lifted message appears Lower the arms until the second light comes on Lifted O O Press FT The LR920 performs the zero adjustment and displays a confirmation message Zeroed WEIGH NETT O O The LR920 then returns to the Ready to Weigh state Ready a O O LARGE ZERO ERROR If while zeroing there is a large zero error displayed weight greater than 5 of full scale the LR920 asks you to confirm that the forks are ENT empty Press yes to confirm forks are empty or press any other key if not Depending on your response the indicator displays Zeroed or Not Zeroed LOADRITE LR920 User Guide LOADRITE 5 1 5 2 5 3 920 ADDING AND RECALLING ADDING A WEIGHT The ADD function adds the Nett weight to the short and long total To add a new Nett weight 1 Lift and lower the arms so that the NETT light is on The bottom line of the display shows the Nett weight 2 Press aQ The LR920 updates the totals Timeout After the container has been lowered to the ground if the Nett weight is not added within a short period of time it will time out Before the weight times out the LR920 will prompt to Add AUTOMATIC ADDING OF WEIGHTS The LR920 has an option configured at installation to automatically accept Nett weights and ADD them to the totals If Automatic Add is enabled then the measure
17. the NETT light remains on for a few seconds you can Press a to add the displayed weight to the running totals Press o to zero the measuring system These functions are described separately later in this manual If you don t press a key the LR920 beeps and prompts you to take action If after a further delay you do not press a key the LR920 discards the just measured weight and goes back to the Ready state 2 3 ENTERING BIN SIZES Only necessary for Strain Link systems The LR920 uses the size of the bin container as part of the weight calculation There are up to 9 different bin sizes available numbered 1 to 9 which are set up at the time of the system configuration To enter the bin size press the O key and then the number key of the bin required Enter the bin size BEFORE lifting the bin The bin sizes for your system can be entered below Bin Size Actual size LOADRITE 7 LOADRITE LR920 User Guide LOADRITE aH 3 TOTAL The LR920 displays each weight measured and the running total as you add Nett weights The Total is normally used to record the payload of the truck The LR920 displays Total on the bottom line of the display To clear the Total Cleared Total Press normally done at the land fill The indicator clears the Total and then displays Cleared Total WEIGH NETTO O O The LR920 may also be configured to request the wei
18. time while entering the time and date you can press 6 to return the LR920 to the Ready state without altering the current time and date LOADRITE 15 LOADRITE LR920 User Guide LOADRITE aT 8 PRINT FUNCTIONS When an LP950 printer is connected weight data can be printed as the LR920 makes measurements Most print options can be set up at installation The data can be automatically printed when particular functions are performed as listed below On Power Up LR920 Always printed ADD performed Weight Optional Sequence number Optional Time Optional User defined data 1 Optional User defined data 2 Optional User defined data 3 Optional Clear short total Total weight Optional User defined data 1 Optional User defined data 2 Optional User defined data 3 Optional ID number of truck Optional Time and date Printed if Total printed User title company name Printed if Total printed Clear long total Long total weight Always printed ID number of truck Always printed Time and date Always printed Zero performed Weight zeroed Always printed LOADRITE LR920 User Guide LOADRITE O34 03 senn 8 1 RECEIPT PRINTING The LR920 has an optional function that allows a customer receipt to be printed on command This function is useful if a docket needs to left with the customer when a bin is emptied When enabled after a bin has been emptied and the weight Added to the truck Total a receipt can be pri
19. wn on the bottom line of the display 2 1 BEFORE WEIGHING A LOAD Before weighing for optimum accuracy make sure that The display shows Ready The container bin is fully back on the forks The forks are level The truck is on level ground The correct bin size is entered only for Strain Link systems 2 2 WEIGHING A LOAD To weigh a load Weights shown are examples only Raise the container through the weighing n zone The LR920 displays Weighing Wei g hin g If necessary level the container to prevent To ta 1 material spillage As you raise the load past the weighing lee F zone the LR920 beeps and the left hand weic g NET D light flashes to show that the weight has ZIN been measured The LR920 will either show the Lifted m message or show the actual combined Li f te d container and material weight This is configured at installation Continue to lift the container and empty it in the normal way NIZ WEIGH NETTO O O ZIN LOADRITE LR920 User Guide peep hE Lower the container to the ground As it N ett passes through the weighing zone the LR920 will again show the Weighing message When the weighing is complete the left ec p hand light will flash The Nett weight is then A displayed the second light will turn on ware O O ZIN gt While the Nett weight is displayed the NETT light will be on In the picture above the weight is 220kg While
Download Pdf Manuals
Related Search