LTR FINDER USER MANUAL version 1.0.2 - T
Contents
1. 120 4 12 P Sequence ID pattern POSIX regular expres sion This parameter is ID of one sequence in a multi fasta file When enabled only sequences with this ID will be processed 4 13 F Signals status control 01 string The parameter controls output by sequence tag status It is a binary string of 11 bits From left to right bits denote the status of following signals TG in 5 end of 5 LTR CA in 3 end of 5 LTR TG in 5 end of Y LTR CA in 3 end of I LTR TSR PBS PPT RT IN core IN c term and RH 1 means reported models should containing the signal and 0 ignoring searching it when used the program will only report models whose status of sequence tags match it 4 14 C Auto mask highly repeated regions With this parameter LTR FINDER will try to mask highly repeated regions defined by the same exact match pair repeat 14 more times within 3000bp By using this parameter LTR FINDER can perform much more quickly on sequences which have centriole or telomere region 11 5 Acknowledgements We thank Heng Li for his linear space pairwise alignment library and Xiaoli Shi for providing rice tRNA sequences The authors are also grateful to colleagues who helped us testing the web server References Flavell R B 1986 Repetitive dna and chromosome evolution in plants Philos Trans R Soc Lond B Biol Sci 312 1154 227 242 Gao L McCarthy E M Ganko E W and McDonald J F 2004 Evolut2. possible ORF 31193 35236 IN core 3 Domain 33779 34387 possible ORF 31193 35236 RT Details of exact match pairs 35259 35472 214 1 35474 35590 117 29632 29845 214 1 29847 29963 117 Details of the LTR alignment 5 end 35259 CATTAGATCTATTACATTATGGGTGGTATGTTGGAATAAAAATCAACTATCATCTACTAAC alte UD il Ill tl Exi LIIITE EEE CA AG C ACA TAT AAT TGTTGGAATAAAAATCAACTATCATCTACTAAC KAK 29632 Details of the LTR alignment 3 end 35590 xk ACAATTACATCAAAATCCACATTCTCTACAATAATAGAA TAATGAA CGATAACACACA LPUTEETVTEEET TEEPE Eo II I Il Ul ACAATTACATCAAAATCCACATTCTCTACA TGGTAGCGCCTA TGCTTCGGTTACTT 29963 Details of the PBS alignment tRNA type ThrAGT GCTTCCAAT CGG ATTTG HITTITE Ill LELLI GCTTCCAATTTACCGGAATTTG 30031 Details of PPT AACAAACAAATGGAT 135215 While most of the output is straight forward there are some fields need further explanation 1 Score Score is an integer varying from 0 to 11 It measures if signals TSR TG CA box PBS PPT IN core IN c term RT RH occur Be cause TG CA box consists of four parts TG at 5 end of 5 LTR CA at 3 end of P LTR TG at 5 end of 3 LTR and CA at 3 end of I LTR there are 11 signals in total The LTR match score matchscore is the sequence similarity between 5 LTR and 3 LTR It is a decimal between 0 and 1 2 Status Status is an 11 bits binary string each bit indic
3. Finneg SCOT global Smatch i N match F Omisnaich N mismatch 5 Per gap E P5 gap Pz gap where Nmaten is the number of match bases Nmismaten the number of un matched bases and Finnegan Foper Port inner_gap_len 1 P5 gap Fona 5 gap_len ae Pena 3 gap_len 7 where inner_gap_len is the length of gap minus 2 end bases Usually Popen is greater than Smatch 4 2 D Maz distance between LTRs positive integer d Min distance between LTRs positive integer L Max LTR Length positive integer 1 Min LTR Length positive integer Distance between LTRs is Dist Posy LTR begin POS5 LTR_ena 1 The four parameters makes detected models meet common features of LTR retrotransposons 4 3 g Extension maz gap positive integer j Extension cutoff decimal between 0 and 1 J Reliable extension decimal between 0 and 1 The three parameters control the extension of LTRs An example of 2 neigh bouring LTR pairs is shown in Figure 3 If s i me and s j ne are sim ilar enough we extend LTRs from s i i and s m me to slis Mel and s jp el CASSIE mb Me nb Ne Figure 3 Pi sli te 5 Jo Je and Po s ms me s ny nel P and P are pre sorted so that jp gt ib nN gt Ms and jp gt mp Since Pi and P are two exact match pairs we know lenpairi le i 1 Je Jo 1 lenpair2 Me My 1 Nne nm 1 Obv
4. neighboring exact match pairs 6 Details of the LTR alignment This section shows the alignment details around 5 and 3 boundaries of LTR regions Single asterisk in line points out putative boundary after the second run boundary decision see Strategy Section Other 4 6 continuous asterisks show the positions of putative TSR 7 Details of PBS amp PPT Numbers indicates the 5 ends of signals 3 2 Summary output Summary output is extracted from Full output by omitting some detailed information Here is an example output gt Sequence CHR2 Len 813138 1 CHR2 Len 813138 Location 29632 35590 Len 5959 Strand Score 9 LTR match score 1 Status 11111111100 5 LTR 29632 29963 Len 332 3 LTR 35259 35590 Len 332 5 TG TG TG 3 CA CA CA TSR 29627 29631 35591 35595 ATAAT Sharpness 0 479 0 52 Strand PBS 17 22 30031 30052 ThrAGT PPT 11 15 35215 35229 Domain 31889 32416 possible ORF 31193 35236 IN core Domain 33779 34387 possible ORF 31193 35236 RT 3 3 Figure output If user select output with figure LTR FINDER will produce a PNG file to show the relative position of each LTR retrotransposons The figure was plotted by both normal axis and logarithmic axis Elements drawn on silver background was plotted by their real size that means 1 pixel stand for 1 base Elements drawn on white background was plotted under logarithmic axis
5. LT R_FINDER USER MANUAL version 1 0 2 Zhao XU and Hao WANG April 9 2009 1 Algorithm 1 1 Structure of LTR retrotransposons oA Sk Se P 5 LTR pol 3 LTR Figure 1 basic structure of a full length LTR retrotransposon The typical structure of a full length LTR retrotransposon is shown in Figure 1 1 LTR Region 5 LTR and 3 LTR are two similar regions identical while the element inserts into the host genome and once in serted they begin to evolve independently Mutations and indels thus are often found A typical LTR retrotransposon has a structure called TG CA box with TG at the 5 extremity of 5 LTR and CA at the 3 extremity of I LTR 2 TSR Region TSR target site repeat is a 4 6bp short direct repeat string flanking the 5 and 3 extremities of an element It is the sign of insertion of transposable elements 3 PBS Near 3 end of the 5 LTR there is a 18bp sequence complemented to the 3 tail of some tRNA The site is very important because tRNA binding process is the first step of initiating reverse transcription 1 4 PPT Polypurine tract is a short rich purine segment about 11715 bp in length Like PBS this region is important for reverse transcription 5 Protein domains In a typical virus genome there are three polygenes gag pol and env Among them pol is most conserved Inside pol there are three important domains IN integrase RT reverse transcriptase a
6. ates the status of a certain signal From left to right signals are TG in 5 end of 5 LTR CA in 3 end of 5 LTR TG in 5 end of I LTR CA in 3 end of 3 LTR TSR PBS PPT RT IN core IN c term and RH If a signal occurs corresponding position is 1 and 0 otherwise 3 Sharpness It is a decimal between 0 and 1 to evaluate the fineness of the bound ary of LTR region Higher sharpness means more accurate boundary decision The first value is sharpness of 5 end and the second is that of 3 end In a window of length 2W Sharpness of the center position i Minside M outside W W Sharpness where Minsiae and Moutside are the number of matched bases in left half and right half window respectively Put the center position at the LTR boundary to get the sharpness 4 PBS amp PPT For PBS the first number in square brackets is number of matched bases and the second is total alignment length For PPT the first is the number of purines and length of putative PPT Following is signal po sitions String in parentheses is the tRNA type and anti codon See this web page for detail http lowelab ucsc edu GtRNAdb legend html The minus sign before tRNA type stands for reverse strand not showed in this example 5 Details of exact match pairs This section shows the exact math pairs used to construct the LTR alignment Number in square brackets is the pair length and number in parentheses is the distance between
7. han this value to do further pro cesses from all exact match pairs detected If a very small value is given LTR_FINDER will spend much time on randomly matched short sequences We use P value to estimate proper value of p that is the probability of ex act match of length longer than L occurs if 2 sequences are drown randomly In Waterman 1989 under independent letter model using asymptotic ex treme value distribution P value were worked out analytically Now if one assign the P value length can be deduced From experiments 20 is appro priate in most situation and we suggest not using of value less than 15 4 5 r Min match length for PBS detection positive integer When aligning tRNA 3 tail 18nt string to the inter LTR sequence if LTR FINDER finds an alignment that match length exceeds this threshold it will report this region as a putative primer binding site 9 4 6 s Predict PBS by using which tRNA database filename To predict primer binding site we need tRNA sequences especially the 3 end 18nt of each sequences LTR FINDER can load tRNA of differ ent species A good tRNA set can be found at Genomic tRNA Database http lowelab ucsc edu GtRNAdb Our database was download from Genomic tRNA Database on 2007 07 17 Here is an example of required format gt Athal chr4 trna25 AlaAGC 13454563 13454635 GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGCACGGGGATCGATA CCCCGCATCTCCA LTR_FINDER uses the str
8. ing after the last minus sign in sequence identifier field as the tRNA type name In this example AlaAGC 4 7 a Use ps_scan to predict IN core IN c term and RH dirname This parameter is a directory name LTR_FINDER can predict protein do mains by calling ps_scan which can be obtained from ExPASy PROSITE http www expasy org prosite User should place data file prosite dat and ps scan in this directory If this parameter is enabled LTR FINDER will call them and report these protein domains if they are detected 4 8 S Output score threshold integer This is the threshold for LTR retrotransposon score Models that have higher scores are output 4 9 B Sharpness higher threshold decimal between 0 and 1 b Sharpness lower threshold decimal between 0 and 1 LTR_FINDER calculates sharpness for both 5 and 3 extremities of putative elements Both of them must be greater than the lower threshold and one greater than the higher threshold 10 4 10 w Output format 0 1 or 2 This parameter controls the output format Value Format 0 Full output 1 Summary output 2 Table output not available on web 4 11 O Length of alignment details positive inte ger LTR_FINDER can output alignment details of LTR boundaries left to 120bp and right to 80bp relative to boundaries Users are allowed to assign the output length by setting this parameter The whole 200 bp alignment is output when it gt
9. ionary history of oryza sativa ltr retrotransposons a preliminary survey of the rice genome sequences BMC Genomics 5 1 18 Gao X Havecker E R Baranov P V Atkins J F and Voytas D F 2003 Translational recoding signals between gag and pol in diverse ltr retrotransposons RNA 9 12 1422 1430 Jordan I K and McDonald J F 1998 Evidence for the role of recombination in the regulatory evolution of saccharomyces cerevisiae ty elements J Mol Evol 47 1 14 20 Kalyanaraman A and Aluru S 2006 Efficient algorithms and software for detection of full length ltr retro transposons J Bioinform Comput Biol 4 2 197 216 Kim J M Vanguri S Boeke J D Gabriel A and Voytas D F 1998 Transposable elements and genome organization a comprehensive survey of retrotransposons revealed by the complete saccharomyces cerevisiae genome sequence Genome Res 8 5 464 478 Ma J Devos K M and Bennetzen J L 2004 Analyses of ltr retrotransposon structures reveal recent and rapid genomic dna loss in rice Genome Res 14 5 860 869 McCarthy E M and McDonald J F 2003 Ltr struc a novel search and identification program for ltr retrotransposons Bioinformatics 19 3 362 367 McCarthy E M and McDonald J F 2004 Long terminal repeat retrotransposons of mus musculus Genome Biol 5 3 R14 McCarthy E M Liu J Lizhi G and McDonald J F 2002 Long terminal repeat retrotran
10. iously the gap lengthes between them are gap Ma te 1 Gaps n jJe 1 8 Introduce Diff number of base differences resulting from extension as Lengthinner mis gap gt 0 and gap gt 0 Diff maxt gapi gap2 min gap gap2 otherwise where Lengthinner_mis is the number of different mismatches and indels bases from global alignment of s i 1 m 1 and s je 1 n 1 The similarity of merged loci is then lenpair max gap gap lenpair2 When LTR_FINDER decides whether two neighboring pairs should be merged it first calculates Dif f make sure that it does not exceed the value of extension max gap then calculates Sim If Sim lt extension cutof f pair extension will stop here P s i i s j je will be reported as a candidate for LTR element If Sim gt reliable extension new pair P gt and inter pair regions will be linked to the previous one P to construct a longer new pair P siy Me 5 Jo e and LTR FINDER continues to find next neighboring pairs if extension cutof f lt Sim lt reliable extension it means we are not sure whether continue to extend or stop So LTR_FINDER first report a LTR element candidate P s ip ic s jp je while at the same time the extension process will continue Sim 4 4 p Length of exact match pairs positive integer Running time of LTR_FINDER is very sensitive to this parameter The program only selects pairs that are longer t
11. nd RH RNase H which are enzymes for reverse transcription and insertion RT and IN are regarded essential for autonomous LTR ele ments to fulfill their function 6 These signals may become blur or even undetectable for evolutionary events 1 2 Strategy The Program first constructs all exact match pairs by a suffix array based algorithm and extends them to long highly similar pairs Then Smith Waterman algorithm is used to adjust the ends of LTR pair candidates to get alignment boundaries These boundaries are subject to re adjustment using supporting information of TG CA box and TSRs and reliable LTRs are se lected Next LTR_FINDER tries to identify PBS PPT and RT inside LTR pairs by build in aligning and counting modules RT identification includes a dynamic programming to process frame shift For other protein domains LTR_FINDER calls ps_scan from PROSITE http www expasy org prosite to locate cores of important enzymes if they occur Then possible ORFs are constructed based on that At last the program reports possible LTR retrotransposon models in different confidence levels according to how many signals and domains they hit 2 Input data 2 1 Format LTR_FINDER accepts only FASTA format sequences and only the first un gapped string identifier in the description line is recorded to identify the input sequence other options in the description line will be ignored Here is an example of input gt CHR1 19971009 Chrom
12. osome I Sequence CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACCCACACACACA CATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTGGCCAACCTGTCTCTCAACTT ACCCTCCATTACCCTGCCTCCACTCGTTACCCTGTCCCATTCAACCATACCACTCCGAAC TGATGGAGAGGGAGGGTAGTTGACATGGAGTTAGAATTGGGTCAGTGTTAGTGTTAGTGT TAGTATTAGGGTGTGGTGTGTGGGTGTGGTGTGGGTGTGGGTGTGGGTGTGGGTGTGGGT GTGGGTGTGGTGTGGTGTGTGGGTGTGGTGTGGGTGTGGTGTGTGTGGG gt CHR2 19970727 Chromosome II Sequence AAATAGCCCTCATGTACGTCTCCTCCAAGCCCTGTTGTCTCTTACCCGGATGTTCAACCA AAAGCTACTTACTACCTTTATTTTATGTTTACTTTTTATAGGTTGTCTTTTTATCCCACT TCTTCGCACTTGTCTCTCGCTACTGCCGTGCAACAAACACTAAATCAAAACAATGAAATA 2 2 Size limit Users could submit sequences large to 50 000 000 bytes The timeout limit for uploading sequence is 60 minutes For users who want to scan very large size sequences executive binary code will be available on request 3 Output format LTR_FINDER offers three types of output Full output Summary output and Figure output 3 1 Full output amp Summary output An example of Full output format is presented as follows gt Sequence CHR2 Len 813138 1 CHR2 Len 813138 Location 29632 35590 Len 5959 Strand Score 9 LTR match score 1 Status 11111111100 5 LTR 29632 29963 Len 332 3 LTR 35259 35590 Len 332 5 TG TG TG 3 CA CA CA TSR 29627 29631 35591 35595 ATAAT Sharpness 0 479 0 52 Strand PBS 17 22 30031 30052 ThrAGT PPT 11 15 35215 35229 Domain 31889 32416
13. so that the long distance could be resized to place on a small canvas Blue circles denote for PBS brown circles stand for PPT and purple circles on the end of LTRs are TSRs 4 Parameters LTR_FINDER has many parameters which can be divided into two groups parameters used in finding LTR retrotransposons construction parame ters and parameters used in filtering out unreliable results filter param eters The first group includes o t e m u D d L l p g J j S a and r the second group includes S B b w O P and F Fig CHR10 Gray background Scale 1 1 1 base 1 pixel ase score oo na R 692 j White background el 483660 Scale n log n 4 Ar N bases c x log N pixels 3 LTR score 11 1 338 1083 i 472151 RT RT l A e3660 IN core IN core 338 1 LTR score 6 1 2 LTR score 8 0 ae 97244 Boz h RT C 77904 71 71 Fi IN core 166 472151 Figure 2 Legend of output figure 4 1 o Gap open penalty positive integer t Gap extend penalty positive integer Gap end penalty positive integer m Match score positive integer u Mismatch score negative integer The five parameters control alignment algorithm Denote gap open penalty as Popen gap extend penalty as Pert gap end penalty as Pena match score as Smaten and mismatch score as Smismatch then global and local alignments score are SCOT Elocal Smatch y N match F Simismateh N mismatch ma 5
14. sposons of oryza sativa Genome Biol 3 10 RESEARCH0053 McDonald J F 1993 Evolution and consequences of transposable elements Curr Opin Genet Dev 3 6 855 864 McDonald J F Matyunina L V Wilson S Jordan I K Bowen N J and Miller W J 1997 Ltr retrotransposons and the evolution of eukaryotic enhancers Genetica 100 1 3 3 13 SanMiguel P Tikhonov A Jin Y K Motchoulskaia N Zakharov D Melake Berhan A Springer P S Edwards K J Lee M Avramova Z and Bennetzen J L 1996 Nested retrotransposons in the intergenic regions of the maize genome Science 274 5288 765 768 Xiong Y and Eickbush T H 1990 Origin and evolution of retroelements based upon their reverse transcrip tase sequences EMBO J 9 10 3353 3362 Yoder J A Walsh C P and Bestor T H 1997 Cytosine methylation and the ecology of intragenomic parasites Trends Genet 13 8 335 340 Zhang X and Wessler S R 2004 Genome wide comparative analysis of the transposable elements in the related species arabidopsis thaliana and brassica oleracea Proc Natl Acad Sci U S A 101 15 5589 5594 12
Download Pdf Manuals
Related Search